DOCSLIB.ORG

US5218101.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
US5218101.Pdf |||||||||||||||| US00521810A United States Patent (19) 11 Patent Number: 5,218,101 Hansen 45 Date of Patent: Jun. 8, 1993 (54) LEADER SEQUENCE INDUCING A 56) References Cited POST. TRANSLATIONAL MODIFICATION OF POLYPEPTIDES IN BACTERIA AND U.S. PATENT DOCUMENTS GENE THEREFOR 4,716,115 12/1987 Gonzalez et al. ................ 435/172.3 OTHER PUBLICATIONS (75) Inventor: J. Norman Hansen, Silver Spring, Hurst et al.; Can. J. Microbiol. 17: 1379 (1971). Md. Nishio et al.; Biochem. Biophys. Res. Comm. 116: 751 (1983). (73) Assignee: The University of Maryland, College Banerjee et al.; J. Biol. Chem. 263: 9508 (1988). Park, Md. Primary Examiner-James Martinell Attorney, Agent, or Firm-Oblon, Spivak, McClelland, 21) Appl. No.: 214,959 Maier & Neustadt 57 ABSTRACT Filed: Jul. 5, 1988 The method by which polypeptides having residues 22) other than the 20 common amino acids are made is established. A leader peptide sequence, and its gene, are (51) Int. Cl............................................... C12N 15/31 identified which induce or assist post-translational mod 52) U.S. Cl. .................................. 536/23.7; 435/69.1; ifications of Cys, Thr and Ser in prokaryotes. The 935/47; 935/49 leader sequence may be used to induce the presence of (58) Field of Search .................... 435/69.1, 69.2, 69.7, covalent bonding sites in polypeptides and can be ex 435/69.8, 71.2, 9, 172.1, 72.3, 252.3, pressed by either naturally occurring or artificial means. 252.31-252.35, 320, 320.1; 536/27; 530/300, 325, 326, 350; 935/11, 47,49, 72 3 Claims, 3 Drawing Sheets U.S. Patent June 8, 1993 Sheet 1 of 3 5,218,101 U.S. Patent June 8, 1993 Sheet 2 of 3 5,218,101 12 24 36 G. got CG 60 CCG GAC AGG AGT ATT TTA AGGAAG AGC TTC AAG AGT TAA ACA AAA GAT CAT GAGCTA CTA (-35) tta tot 9 Ott CCG (rRNA) 20 TGA CAA GGA TTA TAT CIT TGG ATT CCA TAA CTA TGA ATC AAT GGA AGGGGA CGA AGC AGT (-0) (+) 44 156 168 18O ACC TTT GCA GTA CGT TGGTTT GTT A TGG AGC TGT AG, TGT AGG CTT AGG GT ATT AAA 192 204 216 228 240 CAT GGA ATT AGG CTC AAA AAC AGA TTG GAC AAA AGC ATT ATT AAT TTA ATA AAA AAA GGA 252 264 276 (r,bs,) AAA AAA TGA TAA AAT. CTT GAT AT TGT CTG TTA CTA TTT AG TAT TGA AAG GAG GTG ACC SSSSSSS EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE AAT ATG TCA AAG TTC GAT GAT TTC GAT TTG GAT GTT GTG AAA GTC TCT AAA CAA GAC TCA Met Ser Lys Phe Asp Asp Phe Asp Leu Asp Val Vol Lys Val Ser Lys Gln Asp Ser (leader region) EEEEEEEEEEEEEEEEEEE - - TC- - -T -G-C ----G-C-C-G-A-C --T AAA ATC ACT CCG CAA TGG AAA AGT GAA TCA CTT TT ACA CCA GGA TT GTA ACT GGT GCA Lys lle Thr Pro Gln Trp Lys Ser Glu Ser Leu Cys Thr Pro Gly Cys Ya Thr Gly Al Q 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 C-- - --A --- - - - - - --A --C --T --- - - - - 480 TTG CAA ACT TGC TTC CTT CAA ACA CTA ACT TGT AAC TGC AAA ATC TCT AAA TAA GTA AAA Leu Gln Thr Cys Phe Leu Gln Thr leu Thr Cys Asn Cys Lys le Ser Lys 16 17 18, 19 20 21 22 23 24 25 26 27 28 29 30 3 32 492 504 56 528 540 CCA TTA GCA TCA CCT TGC TCT GAC TCC TG CAC TTC TGA TG TTA TAC ATA CTT ATT TTC 552 564 ATA GAG TCGGGA CAA GAA AAT GAA GTA AAA AAC GAC GGG TGT GAA AGA GTT TAT ATT CAC (terminator) 62 624 636 648 660 ACC CT TTT TAT ATT CGG CTT TAA GGA GGA ACA CAA TTG TAG AAC GA AGA AC GT ATT 672 684 696 708 720 TTC GAT CAT GCGTTT TGA ATA ACA TTC CAA TAA AAA TTC CAG TCT CTT CCT CAA ATG CAG 732 744 756 768 780 ACA AAG GAT GAA GGA CTT AAG GT ACT TAC CAG GT TTA TGGTTA AGA ATA TTT CTA AGA 792 804 816 828 ACA TCA TAT TT, TTA TTAGA AAT TAATAAATGAA TG ATC ACT CTA GA 776.2 U.S. Patent June 8, 1993 Sheet 3 of 3 5,218,101 2 24 36 48 60 ATTGACGAATATTTAATAATTTTATTAATATCTTGATTTTCTAGTTCCTGAATAATATA 72 84 96 108 120 GAGATAGGTTTATTGAGTCTTAGACATACTTGAATGACCTAGTCTTATAACTATACTGAC 132 44 56 168 80 AATAGAAACATTAACAAATCTAAAACAGTCTTAATTCTATCTTGAGAAAGTATTGGTAAT 192 204 216 228 240 AATATTATTGTCGATAACGCGAGCATAAAAACGGCTCTGATTAAATTCTGAAGTTTGTT 252 (-5' end of n is in rRNA 288 EEE AGATACAATGATTTCGTTCGAAGGAACTACAAAATAAATTATAAGGAGGCACTCAAAATG r, b, s, MET EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE ATACAAAAGATTTTAACTTGATTTGGTACTGTTTCGAAGAAAGATTCAGGTGCATCA SerThrLysAspheAsnLeu-AspleuVal SerValSerlyslysAspSerGlyAl QSer EEEEEE--C-TC-C-T-TG-C-----G-C-C--------C-----------C CCACGCATTACAAGTATTTCGCTATGTACAGCCGGTTGAAAACAGGAGCTCTGATGGGT ProArgile ThrSerleSerleuCysThrProGlycysLysThrGlyAlaleuMETGly 1 2 3 4 5 6 7 8 9 O 2 3 4 5 6 78 20-ner --C-T----------- T-A-C-----CTC-C-T--GTCT-- 480 TGTAACATGAAAACAGCAACTTGTCATGTAGTATTCACGTAAGCAAATAACCAAATCAA CysAsnMETLysThrAl ThrCysHisCysSerilehisValSerlystER 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 492 3' end of n is in rRNA-) AGGATAGTATTTTTTATTCAGACATGGATACTATCC A 76.3 5,218, 101 1. 2 develop an expression vehicle for incorporating a gene LEADER SEQUENCE INDUCING A which will specifically encode for the production of POST-TRANSLATIONAL MODIFICATION OF these peptides and which is suitable for the transforma POLYPEPTIDES IN BACTERIA AND GENE tion of commonly available bacteria. THEREFOR SUMMARY OF THE INVENTION BACKGROUND OF THE INVENTION The Applicants have identified gene leader sequen 1. Field of the Invention ces, which, when coupled with the gene encoding the This invention pertains to the expression of proteins precursor of a polypeptide, induces or participates in which require post-translational modification of their 10 the post-translational modification of the precursor to amino acid sequence before a mature form is reached. obtain the mature form. The structure of the full gene, Such proteins exhibit amino acids other than the 20 including probable ribosomal binding sites, confirms the common amino acids coded for by the conventional post-translational modification model for the manufac nucleic acids. Specifically, a leader peptide sequence is ture of these peptides. identified which can induce post-translational modifica 15 The gene for the expression of the precursor, and tion of specific amino acids when expressed in conjunc ultimately, the mature protein, of subtilin appears in tion with the precursor polypeptide. Methods of form FIG. 2. The leader sequence, which can be used to ing improved compositions using this leader sequence promote post-translational modification of other prote are also addressed. ins which contain unusual amino acids, such as nisin and 2. Background of the Prior Art 20 the like, is set forth specifically in FIG. 3. A separate Polypeptides, including those having natural antibi leader sequence, bearing significant homology with that otic activities, have been identified which comprise for subtilin, is also identified, and the overall genese amino acids other than the 20 common acids specified quence is given in FIG. 3. by the genetic code, as the expression products of bac teria, and other organisms. The structure of two of the 25 BRIEF DESCRIPTION OF THE DRAWINGS more important ones, nisin and subtilin are set forth in FIG. 1 is the conformational structure for the small FIG. 1 of this application. antibiotic proteins nisin and subtilin, as determined by The presence in these polypeptides, and others, of the Gross et al., Protein Cross-linking, pages 131-153 unusual amino acids lanthionine, 3-methyllanthionine, (1977). D-alanine, dehydroalanine, and dehydrobutyrine 30 FIG. 2 is the genetic base pair sequence for the entire clearly suggests that something other than ordinary digested fragment containing the gene which encodes protein biosynthesis directed by the genetic code is for the subtilin precursor peptide, including the leader involved in the expression of the mature forms of these fragment responsible for inducing post-translational naturally occurring polypeptides. Nonetheless, research modification. A putative ribosomal binding site is la has demonstrated that the appearance of these polypep 35 tides can be blocked by protein biosynthesis inhibitors. beled R.B.S., the leader fragment has astericks above it, Hurst et al., Canadian Journal of Microbiology, 17, and those amino acids of the precursor which undergo 1379-1384 (1971). It is also known that precursor pep modification are set forth in bold face. tides of the mature forms can be detected with antibod FIG. 3 is an illustration giving the sequence for the ies against the mature peptide. Nishio et al., Biochemis gene coding for nisin, and the precursor polypeptide try Biophysics Research Community, 116, 751-751 corresponding thereto bearing the same types of mark (1983). These observations, with other observations ings and having the same meanings as FIG. 2. concerning nisin, subtilin and related proteins suggest a DETAILED DESCRIPTION OF THE mechanism that involves primary biosynthesis of a pre NVENTION cursor via a ribosomal mechanism, followed by post 45 translational modifications. To arrive at the gene for the polypeptide precursor The activity of these proteins, and potential mutant for the proteins of interest, and therefore, for the ulti variations thereof, are of sufficient commercial interest mate expression of the mature form of the protein, it is so as to generate substantial activity in the field of de necessary to develop a gene probe, based on the puta rived microorganisms containing foreign DNA frag 50 tive amino acid precursor sequence of the protein in ments and coding for the protein's production. U.S. Pat. question. For ease of discussion, the description herein No. 4,716,115, issued to Gonzalez et al. is directed to will be first in the context of the gene and precursor for just such a derived microorganism.
Load more

Recommended publications
  • Dissertation
    Dissertation submitted to the Combined Faculty of Natural Sciences and Mathematics of the Ruperto-Carola University of Heidelberg, Germany for the degree of Doctor of Natural Sciences Presented by M.Sc. Matilde Bertolini born in Parma, Italy Oral examination: 02/03/2021 Profiling interactions of proximal nascent chains reveals a general co-translational mechanism of protein complex assembly Referees: Prof. Dr. Bernd Bukau Prof. Dr. Caludio Joazeiro Preface Contributions The experiments and analyses presented in this Thesis were conducted by myself unless otherwise indicated, under the supervision of Dr. Günter Kramer and Prof. Dr. Bernd Bukau. The Disome Selective Profiling (DiSP) technology was developed in collaboration with my colleague Kai Fenzl, with whom I also generated initial datasets of human HEK293-T and U2OS cells. Dr. Ilia Kats developed important bioinformatics tools for the analysis of DiSP data, including RiboSeqTools and the sigmoid fitting algorithm. He also offered great input on statistical analyses. Dr. Frank Tippmann performed analysis of crystal structures. Table of Contents TABLE OF CONTENTS List of Figures ......................................................................................................V List of Tables ...................................................................................................... VII List of Equations .............................................................................................. VIII Abbreviations ....................................................................................................
    [Show full text]
  • Phylogeny Recapitulates Learning: Self-Optimization of Genetic Code
    bioRxiv preprint doi: https://doi.org/10.1101/260877; this version posted February 6, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Phylogeny Recapitulates Learning: Self-Optimization of Genetic Code Oliver Attie1, Brian Sulkow1, Chong Di1, and Wei-Gang Qiu1,2,3,* 1Department of Biological Sciences, Hunter College & 2Graduate Center, City University of New York; 3Department of Physiology and Biophysics & Institute for Computational Biomedicine, Weil Cornell Medical College, New York, New York, USA Emails: Oliver Attie [email protected]; Brian Sulkow [email protected]; Chong Di [email protected]; *Correspondence: [email protected] Abstract Learning algorithms have been proposed as a non-selective mechanism capable of creating complex adaptive systems in life. Evolutionary learning however has not been demonstrated to be a plausible cause for the origin of a specific molecular system. Here we show that genetic codes as optimal as the Standard Genetic Code (SGC) emerge readily by following a molecular analog of the Hebb’s rule (“neurons fire together, wire together”). Specifically, error-minimizing genetic codes are obtained by maximizing the number of physio-chemically similar amino acids assigned to evolutionarily similar codons. Formulating genetic code as a Traveling Salesman Problem (TSP) with amino acids as “cities” and codons as “tour positions” and implemented with a Hopfield neural network, the unsupervised learning algorithm efficiently finds an abundance of genetic codes that are more error- minimizing than SGC.
    [Show full text]
  • Effect of Correlated TRAN Abundances on Translation Errors and Evolution of Codon Usage Bias
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Faculty Publications and Other Works -- Ecology and Evolutionary Biology Ecology and Evolutionary Biology 9-2010 Effect of Correlated TRAN Abundances on Translation Errors and Evolution of Codon Usage Bias Premal Shah University of Tennessee - Knoxville Michael A. Gilchrist Follow this and additional works at: https://trace.tennessee.edu/utk_ecolpubs Part of the Ecology and Evolutionary Biology Commons Recommended Citation Shah, Premal and Gilchrist, Michael A., "Effect of Correlated TRAN Abundances on Translation Errors and Evolution of Codon Usage Bias" (2010). Faculty Publications and Other Works -- Ecology and Evolutionary Biology. https://trace.tennessee.edu/utk_ecolpubs/37 This Article is brought to you for free and open access by the Ecology and Evolutionary Biology at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Faculty Publications and Other Works -- Ecology and Evolutionary Biology by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Effect of Correlated tRNA Abundances on Translation Errors and Evolution of Codon Usage Bias Premal Shah1,2*, Michael A. Gilchrist1,2 1 Department of Ecology & Evolutionary Biology, University of Tennessee, Knoxville, Tennessee, United States of America, 2 National Institute for Mathematical and Biological Synthesis, University of Tennessee, Knoxville, Tennessee, United States of America Abstract Despite the fact that tRNA abundances are thought to play a major role in determining translation error rates, their distribution across the genetic code and the resulting implications have received little attention. In general, studies of codon usage bias (CUB) assume that codons with higher tRNA abundance have lower missense error rates.
    [Show full text]
  • The RNA Code and Protein Synthesis
    Downloaded from symposium.cshlp.org on January 18, 2014 - Published by Cold Spring Harbor Laboratory Press The RNA Code and Protein Synthesis M. Nirenberg, T. Caskey, R. Marshall, et al. Cold Spring Harb Symp Quant Biol 1966 31: 11-24 Access the most recent version at doi:10.1101/SQB.1966.031.01.008 References This article cites 37 articles, 24 of which can be accessed free at: http://symposium.cshlp.org/content/31/11.refs.html Article cited in: http://symposium.cshlp.org/content/31/11#related-urls Email alerting Receive free email alerts when new articles cite this article - sign up in service the box at the top right corner of the article or click here To subscribe to Cold Spring Harbor Symposia on Quantitative Biology go to: http://symposium.cshlp.org/subscriptions Copyright © 1966 Cold Spring Harbor Laboratory Press Downloaded from symposium.cshlp.org on January 18, 2014 - Published by Cold Spring Harbor Laboratory Press The RNA Code and Protein Synthesis M. NIRENBERG, T. CASKEY, R. MARSHALL, R. BRIMACOMBE, D. KELLOGG, B. DOCTOIr D. HATFIELD, J. LEVIN, F. ROTTMAN, S. PESTKA, M. WILCOX, AND F. ANDERSON Laboratory of Biochemical Genetics, National Heart Institute, National Institutes of Health, Bethesda, Maryland and t Division of Biochemistry, Walter Reed Army Institute of Research, Walter Reed Army Medical Center, Washington, D.C. Many properties of the RNA code which were TABLE 1. CHARACTERISTICS OF AA-sRI~A BINDING TO RIBOSOMES discussed at the 1963 Cold Spring Harbor meeting were based on information obtained with randomly C14-Phe-sRNA bound to ribo- ordered synthetic polynucleotides.
    [Show full text]
  • A Numerical Representation and Classification of Codons To
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.02.971036; this version posted March 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A Numerical Representation and Classication of Codons to Investigate Codon Alternation Patterns during Genetic Mutations on Disease Pathogenesis Antara Senguptaa, Pabitra Pal Choudhuryd, Subhadip Chakrabortyb,e, Swarup Royc,∗∗, Jayanta Kumar Dasd,∗, Ditipriya Mallicke, Siddhartha S Janae aDepartment of Master of Computer Applications, MCKV Institute of Engineering, Liluah, India bDepartment of Botany, Nabadwip Vidyasagar College, Nabadwip, India cDepartment of Computer Applications,Sikkim University, Gangtok, Sikkim, India dApplied Statistical Unit, Indian Statistical Institute, Kolkata, India eSchool of Biological Sciences, Indian Association for the Cultivation of Science, Kolkata, India 1. Introduction Genes are the functional units of heredity [4]. It is mainly responsible for the structural and functional changes and for the variation in organisms which could be good or bad. DNA (Deoxyribose Nucleic Acid) sequences build the genes of organisms which in turn encode for particular protein us- ing codon. Any uctuation in this sequence (codons), for example, mishaps during DNA transcription, might lead to a change in the genetic code which alter the protein synthesis. This change is called mutation. Mutation diers from Single Nucleotide Polymorphism(SNP) in many ways [23]. For instance, occurrence of mutation in a population should be less than 1% whereas SNP occurs with greater than 1%. Mutation always occurs in diseased group whereas SNP is occurs in both diseased and control population. Mutation is responsible for some disease phenotype but SNP may or may not be as- sociated with disease phenotype.
    [Show full text]
  • Genetic Code Degeneracy Is Established by the Decoding Center
    bioRxiv preprint doi: https://doi.org/10.1101/2021.05.16.444340; this version posted May 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Genetic code degeneracy is established by the decoding center of the ribosome 2 3 Shixin Ye and Jean Lehmann* 4 5 INSERM U1195 unit, University of Paris-Saclay, 94276, Le Kremlin Bicêtre, France 6 Institute for InteGrative BioloGy of tHe Cell (I2BC), CEA, CNRS, University of Paris-Saclay, 7 91198 Gif-sur-Yvette, France 8 9 *Corresponding author 10 Emails: [email protected]; [email protected] 11 12 SUMMARY 13 The degeneracy of the genetic code confers a wide array of properties to coding sequences. Yet, 14 its origin is still unclear. A structural analysis has shown that the stability of the Watson-Crick 15 base pair at the second position of the anticodon-codon interaction is a critical parameter 16 controlling the extent of non-specific pairings accepted at the third position by the ribosome, a 17 flexibility at the root of degeneracy. Based on recent cryo-EM analyses, the present work shows 18 that residue A1493 of the decoding center provides a significant contribution to the stability of 19 this base pair, revealing that the ribosome is directly involved in the establishment of 20 degeneracy. Building on existing evolutionary models, we show the evidence that the early 21 appearance of A1493 and A1492 established the basis of degeneracy when an elementary 22 kinetic scheme of translation was prevailing.
    [Show full text]
  • New Horizon College of Engineering Departmrnt of Biotechnology
    NEW HORIZON COLLEGE OF ENGINEERING DEPARTMRNT OF BIOTECHNOLOGY UNIT 4: TRANSLATION Introduction to Genetic code: Elucidation of genetic code, Codon degeneracy, Wobble hypothesis and its importance, Prokaryotic and eukaryotic ribosomes. Components of translation. Activation of tRNA. Mechanism of translation: Initiation, Elongation and Termination of protein synthesis, Differences between prokaryotic and eukaryotic protein synthesis. Post-translational modifications and its importance. Protein splicing. Protein targeting: signal hypothesis and cotranslational processing, transportation. Inhibitors of protein synthesis. The Genetic Code Elucidating the Genetic Code • A triplet code is required: 43 = 64, but 42 = 16 - not enough for 20 amino acids • But is the code overlapping? • And is the code punctuated? The Nature of the Genetic Code • A group of three bases codes for one amino acid • The code is not overlapping • The base sequence is read from a fixed starting point, with no punctuation • The code is degenerate (in most cases, each amino acid can be designated by any of several triplets Assignment of "codons" to their respective amino acids was achieved by in vitro biochemistry • Marshall Nirenberg and Heinrich Matthaei showed that poly-U produced polyphenylalanine in a cell-free solution from E. coli • Poly-A gave polylysine • Poly-C gave polyproline • Poly-G gave polyglycine • But what of others? Features of the Genetic Code • All the codons have meaning: 61 specify amino acids, and the other 3 are "nonsense" or "stop" codons • The code is unambiguous - only one amino acid is indicated by each of the 61 codons • The code is degenerate - except for Trp and Met, each amino acid is coded by two or more codons • Codons representing the same or similar amino acids are similar in sequence • 2nd base pyrimidine: usually nonpolar amino acid ,2nd base purine: usually polar or charged aa .
    [Show full text]
  • Bt6504 – Molecular Biology Question Bank
    JEPPIAAR ENGINEERING COLLEGE B.TECH – BIOTECHNOLOGY (R- 2013) BT6504 – MOLECULAR BIOLOGY III YEAR & V SEM BATCH: 2016-2020 QUESTION BANK PREPARED BY Mr. G. GOMATHI SANKAR G. Gomathi Sankar S.N TOPIC REFER PAGE O ENCE NO UNIT I – CHEMISTRY OF NUCLEIC ACIDS 1 Introduction to nucleic acids TB1 79 2 Nucleic acids as genetic material TB1 79 3 Structure and physicochemical properties of elements in DNA and RNA TB1 80-82 4 Biological significance of differences in DNA and RNA TB1 84-92 5 Primary structure of DNA: Chemical and structural qualities of 3’,5’- TB1 94-96 Phosphodiester bond 6 Secondary Structure of DNA: Watson & Crick model TB1 97-100 7 Chargaff’s rule TB1 109 8 X–ray diffraction analysis of DNA, Forces stabilizes DNA structure TB1 110-112 9 Conformational variants of double helical DNA, Hogsteen base pairing TB1 114 10 Triple helix, Quadruple helix, Reversible denaturation and hyperchromic effect TB1 112-114 11 Tertiary structure of DNA: DNA supercoiling. TB1 148 UNIT II – DNA REPLICATION & REPAIR 1 Overview of Central dogma TB1 208 2 Organization of prokaryotic and eukaryotic chromosomes DNA replication: TB1 209 Meselson & Stahl experiment, bi–directional DNA replication 3 Okazaki fragments TB1 210 4 Proteomics of DNA replication, Fidelity of DNA replication TB1 224-231 5 Inhibitors of DNA replication TB1 232-235 6 Overview of differences in prokaryotic and eukaryotic DNA replication TB1 271-273 7 Telomere replication in eukaryotes TB1 239-246 8 D-loop and rolling circle mode of replication TB1 255-258 9 Mutagens, DNA mutations
    [Show full text]
  • The Graph, Geometry and Symmetries of the Genetic Code with Hamming Metric
    Symmetry 2015, 7, 1211-1260; doi:10.3390/sym7031211 OPEN ACCESS symmetry ISSN 2073-8994 www.mdpi.com/journal/symmetry Article The Graph, Geometry and Symmetries of the Genetic Code with Hamming Metric Reijer Lenstra Route Cantonale 103, Saint Sulpice VD 1025, Switzerland; E-Mail: [email protected]; Tel.: +41-798-535-889 Academic Editor: David Becker Received: 28 April 2015 / Accepted: 7 July 2015 / Published: 14 July 2015 Abstract: The similarity patterns of the genetic code result from similar codons encoding similar messages. We develop a new mathematical model to analyze these patterns. The physicochemical characteristics of amino acids objectively quantify their differences and similarities; the Hamming metric does the same for the 64 codons of the codon set. (Hamming distances equal the number of different codon positions: AAA and AAC are at 1-distance; codons are maximally at 3-distance.) The CodonPolytope, a 9-dimensional geometric object, is spanned by 64 vertices that represent the codons and the Euclidian distances between these vertices correspond one-to-one with intercodon Hamming distances. The CodonGraph represents the vertices and edges of the polytope; each edge equals a Hamming 1-distance. The mirror reflection symmetry group of the polytope is isomorphic to the largest permutation symmetry group of the codon set that preserves Hamming distances. These groups contain 82,944 symmetries. Many polytope symmetries coincide with the degeneracy and similarity patterns of the genetic code. These code symmetries are strongly related with the face structure of the polytope with smaller faces displaying stronger code symmetries. Splitting the polytope stepwise into smaller faces models an early evolution of the code that generates this hierarchy of code symmetries.
    [Show full text]
  • Dependency of Codon Usage on Protein Sequence Patterns: a Statistical Study
    Foroughmand-Araabi et al. Theoretical Biology and Medical Modelling 2014, 11:2 http://www.tbiomed.com/content/11/1/2 RESEARCH Open Access Dependency of codon usage on protein sequence patterns: a statistical study Mohammad-Hadi Foroughmand-Araabi1,BahramGoliaei1*, Kasra Alishahi2 and Mehdi Sadeghi3 *Correspondence: [email protected] Abstract 1 Institute of Biochemistry and Background: Codon degeneracy and codon usage by organisms is an interesting and Biophysics, University of Tehran, Tehran, Iran challenging problem. Researchers demonstrated the relation between codon usage Full list of author information is and various functions or properties of genes and proteins, such as gene regulation, available at the end of the article translation rate, translation efficiency, mRNA stability, splicing, and protein domains. Researchers usually represent segments of proteins responsible for specific functions or structures in a family of proteins as sequence patterns or motifs. We asked the question if organisms use the same codons in pattern segments as compared to the rest of the sequence. Methods: We used the likelihood ratio test, Pearson’s chi-squared test, and mutual information to compare these two codon usages. Results: We showed that codon usage, in segments of genes that code for a given pattern or motif in a group of proteins, varied from the rest of the gene. The codon usage in these segments was not random. Amino acids with larger number of codons used more specific codon ratios in these segments. We studied the number of amino acids in the pattern (pattern length). As patterns got longer, there was a slight decrease in the fraction of patterns with significant different codon usage in the pattern region as compared to codon usage in the gene region.
    [Show full text]
  • Synonymous Codons Influencing Gene Expression in Organisms
    Journal name: Research and Reports in Biochemistry Article Designation: REVIEW Year: 2016 Volume: 6 Research and Reports in Biochemistry Dovepress Running head verso: Mitra et al Running head recto: Synonymous codons influencing gene expression open access to scientific and medical research DOI: http://dx.doi.org/10.2147/RRBC.S83483 Open Access Full Text Article REVIEW Synonymous codons influencing gene expression in organisms Sutanuka Mitra1 Abstract: Nowadays, it is beyond doubt that synonymous codons are not the same with respect Suvendra Kumar Ray2 to expression of a gene. In favor of this, ribosome profiling experiments in vivo and in vitro Rajat Banerjee1 have suggested that ribosome occupancy time is not the same for different synonymous codons. Therefore, synonymous codons influence differently the speed of translation elongation, which 1Department of Biotechnology, University of Calcutta, Kolkata, West guides further cotranslational folding kinetics of a protein. It is now realized that the position Bengal, 2Department of Molecular of each codon in a coding sequence is important. The effect of synonymous codons on protein Biology and Biotechnology, Tezpur structure is an exciting field of research nowadays. This review discusses the recent develop- University, Napaam, Tezpur, Assam, India ments in this field. Keywords: codon usage bias, synonymous codons, ribosome profiling, cotranslational protein For personal use only. folding, protein structure Introduction In the standard genetic code table, of the 64 triplets or codons, 61 codons correspond to the 20 amino acids. While Met and Trp are encoded by one codon each, the other 18 amino acids are encoded by two to six different codons. This is called codon degeneracy.
    [Show full text]
  • Synonymous Codon Usage Bias in Plant Mitochondrial Genes Is Associated with Intron Number and Mirrors Species Evolution
    RESEARCH ARTICLE Synonymous Codon Usage Bias in Plant Mitochondrial Genes Is Associated with Intron Number and Mirrors Species Evolution Wenjing Xu☯, Tian Xing☯, Mingming Zhao, Xunhao Yin, Guangmin Xia, Mengcheng Wang* The Key Laboratory of Plant Cell Engineering and Germplasm Innovation, Ministry of Education, School of Life Science, Shandong University, 27 Shandanan Road, Jinan, Shandong 250100, China ☯ These authors contributed equally to this work. * [email protected] Abstract Synonymous codon usage bias (SCUB) is a common event that a non-uniform usage of codons often occurs in nearly all organisms. We previously found that SCUB is correlated with both intron number and exon position in the plant nuclear genome but not in the plastid genome; SCUB in both nuclear and plastid genome can mirror the evolutionary specializa- OPEN ACCESS tion. However, how about the rules in the mitochondrial genome has not been addressed. Citation: Xu W, Xing T, Zhao M, Yin X, Xia G, Wang Here, we present an analysis of SCUB in the mitochondrial genome, based on 24 plant spe- M (2015) Synonymous Codon Usage Bias in Plant cies ranging from algae to land plants. The frequencies of NNA and NNT (A- and T-ending Mitochondrial Genes Is Associated with Intron codons) are higher than those of NNG and NNC, with the strongest preference in bryo- Number and Mirrors Species Evolution. PLoS ONE phytes and the weakest in land plants, suggesting an association between SCUB and plant 10(6): e0131508. doi:10.1371/journal.pone.0131508 evolution. The preference for NNA and NNT is more evident in genes harboring a greater Editor: Genlou Sun, Saint Mary's University, number of introns in land plants, but the bias to NNA and NNT exhibits even among exons.
    [Show full text]