|||||||||||||||| US00521810A United States Patent (19) 11 Patent Number: 5,218,101 Hansen 45 Date of Patent: Jun. 8, 1993 (54) LEADER SEQUENCE INDUCING A 56) References Cited POST. TRANSLATIONAL MODIFICATION OF POLYPEPTIDES IN BACTERIA AND U.S. PATENT DOCUMENTS GENE THEREFOR 4,716,115 12/1987 Gonzalez et al. ................ 435/172.3 OTHER PUBLICATIONS (75) Inventor: J. Norman Hansen, Silver Spring, Hurst et al.; Can. J. Microbiol. 17: 1379 (1971). Md. Nishio et al.; Biochem. Biophys. Res. Comm. 116: 751 (1983). (73) Assignee: The University of Maryland, College Banerjee et al.; J. Biol. Chem. 263: 9508 (1988). Park, Md. Primary Examiner-James Martinell Attorney, Agent, or Firm-Oblon, Spivak, McClelland, 21) Appl. No.: 214,959 Maier & Neustadt 57 ABSTRACT Filed: Jul. 5, 1988 The method by which polypeptides having residues 22) other than the 20 common amino acids are made is established. A leader peptide sequence, and its gene, are (51) Int. Cl............................................... C12N 15/31 identified which induce or assist post-translational mod 52) U.S. Cl. .................................. 536/23.7; 435/69.1; ifications of Cys, Thr and Ser in prokaryotes. The 935/47; 935/49 leader sequence may be used to induce the presence of (58) Field of Search .................... 435/69.1, 69.2, 69.7, covalent bonding sites in polypeptides and can be ex 435/69.8, 71.2, 9, 172.1, 72.3, 252.3, pressed by either naturally occurring or artificial means. 252.31-252.35, 320, 320.1; 536/27; 530/300, 325, 326, 350; 935/11, 47,49, 72 3 Claims, 3 Drawing Sheets U.S. Patent June 8, 1993 Sheet 1 of 3 5,218,101 U.S. Patent June 8, 1993 Sheet 2 of 3 5,218,101 12 24 36 G. got CG 60 CCG GAC AGG AGT ATT TTA AGGAAG AGC TTC AAG AGT TAA ACA AAA GAT CAT GAGCTA CTA (-35) tta tot 9 Ott CCG (rRNA) 20 TGA CAA GGA TTA TAT CIT TGG ATT CCA TAA CTA TGA ATC AAT GGA AGGGGA CGA AGC AGT (-0) (+) 44 156 168 18O ACC TTT GCA GTA CGT TGGTTT GTT A TGG AGC TGT AG, TGT AGG CTT AGG GT ATT AAA 192 204 216 228 240 CAT GGA ATT AGG CTC AAA AAC AGA TTG GAC AAA AGC ATT ATT AAT TTA ATA AAA AAA GGA 252 264 276 (r,bs,) AAA AAA TGA TAA AAT. CTT GAT AT TGT CTG TTA CTA TTT AG TAT TGA AAG GAG GTG ACC SSSSSSS EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE AAT ATG TCA AAG TTC GAT GAT TTC GAT TTG GAT GTT GTG AAA GTC TCT AAA CAA GAC TCA Met Ser Lys Phe Asp Asp Phe Asp Leu Asp Val Vol Lys Val Ser Lys Gln Asp Ser (leader region) EEEEEEEEEEEEEEEEEEE - - TC- - -T -G-C ----G-C-C-G-A-C --T AAA ATC ACT CCG CAA TGG AAA AGT GAA TCA CTT TT ACA CCA GGA TT GTA ACT GGT GCA Lys lle Thr Pro Gln Trp Lys Ser Glu Ser Leu Cys Thr Pro Gly Cys Ya Thr Gly Al Q 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 C-- - --A --- - - - - - --A --C --T --- - - - - 480 TTG CAA ACT TGC TTC CTT CAA ACA CTA ACT TGT AAC TGC AAA ATC TCT AAA TAA GTA AAA Leu Gln Thr Cys Phe Leu Gln Thr leu Thr Cys Asn Cys Lys le Ser Lys 16 17 18, 19 20 21 22 23 24 25 26 27 28 29 30 3 32 492 504 56 528 540 CCA TTA GCA TCA CCT TGC TCT GAC TCC TG CAC TTC TGA TG TTA TAC ATA CTT ATT TTC 552 564 ATA GAG TCGGGA CAA GAA AAT GAA GTA AAA AAC GAC GGG TGT GAA AGA GTT TAT ATT CAC (terminator) 62 624 636 648 660 ACC CT TTT TAT ATT CGG CTT TAA GGA GGA ACA CAA TTG TAG AAC GA AGA AC GT ATT 672 684 696 708 720 TTC GAT CAT GCGTTT TGA ATA ACA TTC CAA TAA AAA TTC CAG TCT CTT CCT CAA ATG CAG 732 744 756 768 780 ACA AAG GAT GAA GGA CTT AAG GT ACT TAC CAG GT TTA TGGTTA AGA ATA TTT CTA AGA 792 804 816 828 ACA TCA TAT TT, TTA TTAGA AAT TAATAAATGAA TG ATC ACT CTA GA 776.2 U.S. Patent June 8, 1993 Sheet 3 of 3 5,218,101 2 24 36 48 60 ATTGACGAATATTTAATAATTTTATTAATATCTTGATTTTCTAGTTCCTGAATAATATA 72 84 96 108 120 GAGATAGGTTTATTGAGTCTTAGACATACTTGAATGACCTAGTCTTATAACTATACTGAC 132 44 56 168 80 AATAGAAACATTAACAAATCTAAAACAGTCTTAATTCTATCTTGAGAAAGTATTGGTAAT 192 204 216 228 240 AATATTATTGTCGATAACGCGAGCATAAAAACGGCTCTGATTAAATTCTGAAGTTTGTT 252 (-5' end of n is in rRNA 288 EEE AGATACAATGATTTCGTTCGAAGGAACTACAAAATAAATTATAAGGAGGCACTCAAAATG r, b, s, MET EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE ATACAAAAGATTTTAACTTGATTTGGTACTGTTTCGAAGAAAGATTCAGGTGCATCA SerThrLysAspheAsnLeu-AspleuVal SerValSerlyslysAspSerGlyAl QSer EEEEEE--C-TC-C-T-TG-C-----G-C-C--------C-----------C CCACGCATTACAAGTATTTCGCTATGTACAGCCGGTTGAAAACAGGAGCTCTGATGGGT ProArgile ThrSerleSerleuCysThrProGlycysLysThrGlyAlaleuMETGly 1 2 3 4 5 6 7 8 9 O 2 3 4 5 6 78 20-ner --C-T----------- T-A-C-----CTC-C-T--GTCT-- 480 TGTAACATGAAAACAGCAACTTGTCATGTAGTATTCACGTAAGCAAATAACCAAATCAA CysAsnMETLysThrAl ThrCysHisCysSerilehisValSerlystER 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 492 3' end of n is in rRNA-) AGGATAGTATTTTTTATTCAGACATGGATACTATCC A 76.3 5,218, 101 1. 2 develop an expression vehicle for incorporating a gene LEADER SEQUENCE INDUCING A which will specifically encode for the production of POST-TRANSLATIONAL MODIFICATION OF these peptides and which is suitable for the transforma POLYPEPTIDES IN BACTERIA AND GENE tion of commonly available bacteria. THEREFOR SUMMARY OF THE INVENTION BACKGROUND OF THE INVENTION The Applicants have identified gene leader sequen 1. Field of the Invention ces, which, when coupled with the gene encoding the This invention pertains to the expression of proteins precursor of a polypeptide, induces or participates in which require post-translational modification of their 10 the post-translational modification of the precursor to amino acid sequence before a mature form is reached. obtain the mature form. The structure of the full gene, Such proteins exhibit amino acids other than the 20 including probable ribosomal binding sites, confirms the common amino acids coded for by the conventional post-translational modification model for the manufac nucleic acids. Specifically, a leader peptide sequence is ture of these peptides. identified which can induce post-translational modifica 15 The gene for the expression of the precursor, and tion of specific amino acids when expressed in conjunc ultimately, the mature protein, of subtilin appears in tion with the precursor polypeptide. Methods of form FIG. 2. The leader sequence, which can be used to ing improved compositions using this leader sequence promote post-translational modification of other prote are also addressed. ins which contain unusual amino acids, such as nisin and 2. Background of the Prior Art 20 the like, is set forth specifically in FIG. 3. A separate Polypeptides, including those having natural antibi leader sequence, bearing significant homology with that otic activities, have been identified which comprise for subtilin, is also identified, and the overall genese amino acids other than the 20 common acids specified quence is given in FIG. 3. by the genetic code, as the expression products of bac teria, and other organisms. The structure of two of the 25 BRIEF DESCRIPTION OF THE DRAWINGS more important ones, nisin and subtilin are set forth in FIG. 1 is the conformational structure for the small FIG. 1 of this application. antibiotic proteins nisin and subtilin, as determined by The presence in these polypeptides, and others, of the Gross et al., Protein Cross-linking, pages 131-153 unusual amino acids lanthionine, 3-methyllanthionine, (1977). D-alanine, dehydroalanine, and dehydrobutyrine 30 FIG. 2 is the genetic base pair sequence for the entire clearly suggests that something other than ordinary digested fragment containing the gene which encodes protein biosynthesis directed by the genetic code is for the subtilin precursor peptide, including the leader involved in the expression of the mature forms of these fragment responsible for inducing post-translational naturally occurring polypeptides. Nonetheless, research modification. A putative ribosomal binding site is la has demonstrated that the appearance of these polypep 35 tides can be blocked by protein biosynthesis inhibitors. beled R.B.S., the leader fragment has astericks above it, Hurst et al., Canadian Journal of Microbiology, 17, and those amino acids of the precursor which undergo 1379-1384 (1971). It is also known that precursor pep modification are set forth in bold face. tides of the mature forms can be detected with antibod FIG. 3 is an illustration giving the sequence for the ies against the mature peptide. Nishio et al., Biochemis gene coding for nisin, and the precursor polypeptide try Biophysics Research Community, 116, 751-751 corresponding thereto bearing the same types of mark (1983). These observations, with other observations ings and having the same meanings as FIG. 2. concerning nisin, subtilin and related proteins suggest a DETAILED DESCRIPTION OF THE mechanism that involves primary biosynthesis of a pre NVENTION cursor via a ribosomal mechanism, followed by post 45 translational modifications. To arrive at the gene for the polypeptide precursor The activity of these proteins, and potential mutant for the proteins of interest, and therefore, for the ulti variations thereof, are of sufficient commercial interest mate expression of the mature form of the protein, it is so as to generate substantial activity in the field of de necessary to develop a gene probe, based on the puta rived microorganisms containing foreign DNA frag 50 tive amino acid precursor sequence of the protein in ments and coding for the protein's production. U.S. Pat. question. For ease of discussion, the description herein No. 4,716,115, issued to Gonzalez et al. is directed to will be first in the context of the gene and precursor for just such a derived microorganism.