DOCSLIB.ORG

Construction of a Shuttle Vector for Protein Secretory Expression in Bacillus Subtilis and the Application of the Mannanase Func

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Construction of a Shuttle Vector for Protein Secretory Expression in Bacillus Subtilis and the Application of the Mannanase Func J. Microbiol. Biotechnol. (2014), 24(4), 431–439 http://dx.doi.org/10.4014/jmb.1311.11009 Research Article jmb Construction of a Shuttle Vector for Protein Secretory Expression in Bacillus subtilis and the Application of the Mannanase Functional Heterologous Expression Su Guo, Jia-jie Tang, Dong-zhi Wei, and Wei Wei* State Key Laboratory of Bioreactor Engineering, Newworld Institute of Biotechnology, East China University of Science and Technology, Shanghai 200237, People’s Republic of China Received: November 6, 2013 Revised: December 11, 2013 We report the construction of two Bacillus subtilis expression vectors, pBNS1/pBNS2. Both Accepted: December 24, 2013 vectors are based on the strong promoter P43 and the ampicillin resistance gene expression cassette. Additionally, a fragment with the Shine-Dalgarno sequence and a multiple cloning site (BamHI, SalI, SacI, XhoI, PstI, SphI) were inserted. The coding region for the amyQ (encoding an amylase) signal peptide was fused to the promoter P43 of pBNS1 to construct the First published online December 30, 2013 secreted expression vector pBNS2. The applicability of vectors was tested by first generating the expression vectors pBNS1-GFP/pBNS2-GFP and then detecting for green fluorescent *Corresponding author Phone: +86-21-64251803; protein gene expression. Next, the mannanase gene from B. pumilus Nsic-2 was fused to vector Fax: +86-21-64251803; pBNS2 and we measured the mannanase activity in the supernatant. The mannanase total E-mail: [email protected] enzyme activity was 8.65 U/ml, which was 6 times higher than that of the parent strain. Our pISSN 1017-7825, eISSN 1738-8872 work provides a feasible way to achieve an effective transformation system for gene expression in B. subtilis and is the first report to achieve B. pumilus mannanase secretory expression in B. subtilis. Copyright© 2014 by Keywords: Bacillus subtilis, Bacillus pumilus, green fluorescent protein, mannanase, P43 promoter, The Korean Society for Microbiology secretory expression and Biotechnology Introduction compared with other promoters [18]. Furthermore, P43 promoter has been successfully used in recombinant Gram-positive bacterial strains are well known for their proteins production, such as thermostable β-galactosidase, contributions to agricultural, medical, and commercial staphylokinase, and dehydrogenase [18]. enzyme production. Among them, Bacillus subtilis has been Endo-1,4-β-mannanases (β-mannanases, E.C. 3.2.1.78) widely used in recombinant protein production such as catalyze the random hydrolysis of manno-glycosidic bonds enzymes, biochemicals, antibiotics, and insecticides. B. subtilis in mannans and heteromannans. Based upon the amino has been developed as an attractive host because of several acid sequence alignment and hydrophobic cluster analysis, reasons: nonpathogenic and considered as a safe organism, most β-mannanases belong to glycoside hydrolase (GH) no significant bias in codon usage, and capable of secreting families 5, 26, and 113. Endo-1,4-β-mannanases play important functional extracellular proteins directly into the culture roles in basic research, the bioconversion of biomass medium [10, 15]. At present, about 60% of the commercially materials, and various potential industrial applications [3, available enzymes are produced by Bacillus species [11]. A 8, 13]. β-Mannanases from bacteria (Bacillus sp., Aeromonas wide variety of promoters used in B. subtilis have been sp., Streptomyces sp., Pseudomonas sp., or Vibrio sp.), fungi reported [2, 11, 18]. Among them, the constitutive promoter (Penicillium sp., Tyromices sp., Trichosporum sp., Sclerotium P43 is active during the exponential and lag phases of sp., and Aspergillus sp.), plants (Amorphophallus konjac), growth and shows the highest expression capability animals, and in the colonic region of humans were April 2014 ⎪ Vol. 24⎪ No. 4 432 Guo et al. reported in previous research. During recent years, the Table 1. Both E. coli cells and B. subtilis cells were grown in Luria- production of mannanases in recombinant Escherichia coli Bertani (LB) medium at 37oC. Antibiotics were used in this study has been well studied [3, 17]. However, there have been at the following concentrations: ampicillin at 100 µg/ml for E. coli few reports of the mannanases expression in Bacillus subtilis. and kanamycin at 30 µg/ml for B. subtilis. In this study, we report the construction of two B. subtilis Chemicals and Manipulation of DNA expression vectors, pBNS1 and pBNS2, both with the strong Taq DNA polymerase, restriction endonucleases, T4 DNA constitutive promoter P43. The two newly constructed ligase, and pMDTM19-T vector were purchased from Takara vectors can be efficiently transformed into B. subtilis by (Takara Biotechnology, Shanghai, China). Isolated chromosomal electroporation and be used for intra- and extracellular DNA from B. subtilis, plasmids, and gel extraction of DNA were production of recombinant proteins in B. subtilis. In our prepared using the AXYGEN kit (BIOSCIENCE, Shanghai, China). study, the GFP gene and mannanase gene were expressed PCR products and DNA bands were separated by electrophoresis successfully. Both vectors can be used to express exogenous on a 1.0% agarose gel. Transformation of E. coli was carried out genes in B. subtilis and are useful for the large-scale gene using CaCl2-treated 50 µl aliquots of competent cells, and Bacillus expression industry. subtilis cells were transformed by electroporation. Primers used in this study are listed in Table 2. Materials and Methods Construction of Shuttle Expression Vector pBNS1 and pBNS2 First, the original plasmid pBEn (7.4 kb) was constructed using Bacterial Strains, Plasmids, and Culture Conditions plasmids pUB110 (4.5 kb) from B. subtilis and pGEM (2.9 kb) from The following strains were used: Escherichia coli DH5α, Escherichia 3 E. coli. Then, plasmid pBE2a (6.3 kb) was constructed by removing coli BL21(DE3)/pLysS (Invitrogen), B. subtilis 1A751 (Lab collection), a 1.1 kb PvuII cleavage fragment in pBEn. Primers P43-U/P43-D and Bacillus pumilus Nsic-2 (wild strain, accession number: and A1/A2 were used to clone the P43 promoter sequence (from CCTCC AB 2013050. China Center for Type Culture Collection). B. subtilis 168) and signal peptide (from B. amyloliquefaciens), The bacterial strains and plasmids used in this study are listed in respectively. The PCR products were gel extracted and cloned Table 1. Bacterial strains and plasmids used in this study. Strains/plasmids Relevant features Source Strains E. coli DH5α F--, ϕ80d/lacZ∆M15, ∆(lacZYA-argF)U169, deoR, recA1, Lab collection endA1, hsdR17 (rk- mk+), phoA, supE44, λ-, thi-1, gyrA96, relA1 B. subtilis 1A751 apr his npr eglS (DELTA) 102 bglT/bglS (DELTA) EV Lab collection Bacillus pumilus Nsic-2 Wild strain (CCTCC AB 2013050) Lab collection pBNS1-GFP-1A751 B. subtilis 1A751 recombinant strain harboring plasmid pBNS1-GFP; KanR This study pBNS2-GFP-1A751 B. subtilis 1A751 recombinant strain harboring plasmid pBNS2-GFP; KanR This study Plasmids pMDTM19-T Cloning vector; AmpR Takara pUB110 Bacillus cloning vector; KanR Lab collection pGEM3 E. coli expression vector; AmpR Lab collection pMT-P43 pMDTM19-T containing the P43 promoter; AmpR This study pMT-amyQ pMDTM19-T containing the amyQ signal peptide; AmpR This study pMD19-SP pMDTM19-T containing the 188 bp fusion fragment; AmpR This study pBE2a Basic cloning vector; AmpR and kanR This study pBNS1 Bacillus-E. coli shuttle vector; vector for intracellular expression; AmpR and KanR This study pBNS2 Bacillus-E. coli shuttle vector; vector for extracellular expression; AmpR and KanR This study pBNS1-GFP pBNS1-based vector, carrying gfp gene; AmpR and KanR This study pBNS2-GFP pBNS2-based vector, carrying gfp gene; AmpR and KanR This study pBNS2-man pBNS2-based vector, carrying mature mannanase gene; AmpR and KanR This study AmpR, ampicillin resistance; KanR, kanamycin resistance. J. Microbiol. Biotechnol. B. subtilis Secretory Expression and Application 433 Table 2. Synthetic oligonucleotides used in this study. Primer Specificity Amplicon size Nucleotide sequence (5’ → 3’) A1 amyQ signal peptide 96 bp ATGATTCAAAAACGAAAGCGGACAGTT A2 amyQ signal peptide 96 bp TACGGCTGATGTTTTTGTAATCGGCAA P43-U P43 promoter 305 bp CGCGAATTCTGATAGGTGGTATGTTTT (EcoRI) P43-D P43 promoter 305 bp CGCTCTAGATTCATGTGTACATTCCTC (XbaI) F1 Fusion fragment 188 bp GGCTCTAGATTTAAGAAGGAGATATACATATGATTCAAA (XbaI) R1 Fusion fragment 188 bp CTCGAGGAGCTCGTCGACGGATCCTACGGCTGAT R2 Fusion fragment 188 bp GATGGTGATGGCATGCCTGCAGCTCGAGGAGCT R3 Fusion fragment 188 bp GCCAAGCTTGTGATGGTGATGGTGATGGTGATG (Hind) pBNS1-gfp-U GFP reporter gene 771 bp GCCTCTAGATTTAAGAAGGAGATATACATATGAGTAAA (XbaI) pBNS1-gfp-D GFP reporter gene 771 bp GCCAAGCTTGCATGCCTGCAGGTCTGGACATTTATTTGTA (Hind) pBNS2-gfp-U GFP reporter gene 726 bp GCCGGATCCAGTAAAGGAGAAGAA (BamHI) pBNS2-gfp-D GFP reporter gene 726 bp GCCCTCGAGTTATTTGTATAGTTCATCCAT (XhoI) manA-F β-Mannanase gene 1,008 bp GTCTGGATCCCATACTGTGTCGCCTGTGAAT (BamHI) manA-D β-Mannanase gene 1,008 bp GGCCCTCGAGCTCAACGATTGGCGTTAAA (XhoI) Primers P3/P4, A1/A2, pBNS1-gfp-U/pBNS1-gfp-D, pBNS2-gfp-U/pBNS2-gfp-D, and manA-F/manA-D were used to amplify the P43 promoter, the amyQ signal peptide, the GFP reporter gene, and the β-mannanase gene, respectively. Primers F1/R1, R2, and R3 were used for sequential PCR to amplify the 188 bp fusion fragment. The underlined sequences are the restriction sites. The bold underlined sequence are the modified Shine-Dalgarno sequences. into the vector pMD19-T to generate
Load more

Recommended publications
  • Clarke.Pdf (13.44Mb)
    STADLER SYMP. Vol. 13 (1981) University of Missouri, Columbia 9 THE STRUCTURE AND FUNCTION OF YEAST CENTROMERES (Saccharomyces cerevisiae, yeast transformation, centromere cloning, functional minichromosomes, recombinant DNA, nucleo­ tide sequencing) LOUISE CLARKE, MOLLY FITZGERALD-HAYES, JEAN-MARIE BUHLER*, and JOHN CARBON Department of Biological Sciences, University of California, Santa Barbara, California 93106; *Service de Biochemie, C.E.N Saclay, 91190 Gif-sur~Yvette, France SUMMARY Segments of Saccharomyces cerevisiae DNA have been iso­ lated that contain centromeric sequences (CEN3 and-CENll) from chromosomes III and XI. When present on a plasmid vector capable of replica~ion in yea~t (pLC544 or Yrp?), centromeric DNA e~ables _that p~asm"d t~ funct"on as an ordinary monosome (or extra d"some "f dupl"cated) "nan aneuploid yeast cell. Genetic markers on a "mini~hrom~so"!e" are stably maintained through mitosis and segregate "n me"os"s I and II as centromere-linked genes. Subcloning experiments have indicated that the functional centromeric sequences, CEN3 and CENll, are each confined to a unique segment of DNA less than one kilobase pair in length. The complete nucleotide sequence of the 627-base-pair CEN3 segment is presented, along with a preliminary structural com­ parison of this region with that contained on a 900-base-pair CENll fragment. These cloned centromere DNAs represent ex­ cellent probes for studying the molecular mechanism of chro­ mosome segregation in mitosis and meiosis. INTRODUCTION The centromere is one of the most important and least un­ derstood structural elements of the eukaryotic chromosome. The presence of a centromere ensures the stable maintenance and segregation of a chromosome through the complex processes of mitosis and meiosis, presumably by providing an attachment point for spindle fibers or membrane sites involved in chromo­ some movement.
    [Show full text]
  • A New Horizon for Pbr322: in Vivo Insertion of Plasmid Fragments Into Wide Host Range Shuttle Vectors Menno Kok
    1995 Oxford University Press Nucleic Acids Research, 1995, Vol. 23, No. 24 5085-5086 A new horizon for pBR322: in vivo insertion of plasmid fragments into wide host range shuttle vectors Menno Kok Departement de Genetique et Microbiologie, Universit6 de Geneve, 1 Rue Michel Servet, 1211 Geneve, Switzerland Received August 3, 1995; Revised and Accepted November 17, 1995 Plasmid vectors based on pMB8, such as pBR322, pUC18, pGEM5 Figure 1, which encode either kanamycin or tetracycline resistance and pBluescript (1), have become virtually indispensable tools in and bear a copy of the 38 bp inverted repeat at their extremities. molecular biology. Unfortunately, pMB8 derived vectors are A typical experiment is illusuated in Figure 2. The Escherichia restricted to Enterobacteriacea. Transfer of cloned DNA fragments coli thyA gene present in the pBR322 derivative pBTAH1.2 (3) was into other bacterial species therefore necessitates alternative plasmid rendered transposable by the insertion of a 1673 bp kanamycin vectors. Insertion ofthe gene ofinterest into such (broad-host-range) cassette, obtained from plasmid pGMK833 by BanHI digestion. plasmids may be time consuming and is often difficult to accomplish Next, the thyA gene, flanked by the ampicillin and kanamycin due to the lack of suitable restriction sites, expression signals and resistance markers, was inserted into broad host range plasmid R751 genetic markers. In this paper I report a simple procedure for the by transposition. This was done by transforming E.coli MS967, introduction of genes cloned in pBR322-type vectors into organisms canying plasmids pSC259, encoding Tn3 transposase, and the which do not support the replication of these plasmids.
    [Show full text]
  • Self-Replicating Shuttle Vectors Based on Pans, a Small Endogenous Plasmid of The
    1 Self-replicating shuttle vectors based on pANS, a small endogenous plasmid of the 2 unicellular cyanobacterium Synechococcus elongatus PCC 7942 3 4Running title: pANS-derived cyanobacterial shuttle vectors 5Contents Category: Biotechnology 6Authors: 7 You Chen, Arnaud Taton, Michaela Go, Ross E. London, Lindsey M. Pieper, Susan S. Golden, 8 and James W. Golden* 9Division of Biological Sciences, University of California San Diego, La Jolla, California, USA 10* Correspondence: 11 Phone (858) 246-0643 12 Email [email protected] 13The number of words: 14 Summary 243 15 Main text 5596 16The number of tables and figures: 9 17 Tables 2 18 Figures 7 19 (Supplementary tables 2) 20 (Supplementary figures 1) 21 22Depositories: The GenBank accession number for the updated complete sequence of pANS is 23KT751091 24 25Abbreviations: EPA, eicosapentaenoic acid; MCS, multiple cloning site 26SUMMARY 27To facilitate development of synthetic biology tools for genetic engineering of cyanobacterial 28strains, we constructed pANS-derived self-replicating shuttle vectors that are based on the 29minimal replication element of the Synechococcus elongatus strain PCC 7942 plasmid pANS. 30To remove the possibility of homologous recombination events between the shuttle plasmids 31and the native pANS plasmid, the endogenous pANS was cured through plasmid 32incompatibility-mediated spontaneous loss. A heterologous toxin-antitoxin cassette was 33incorporated into the shuttle vectors for stable plasmid maintenance in the absence of antibiotic 34selection. The pANS-based shuttle vectors were shown to be able to carry a large 20-kb DNA 35fragment containing a gene cluster for biosynthesis of the omega-3 fatty acid eicosapentaenoic 36acid (EPA). Based on qPCR analysis, there are about 10 copies of pANS and 3 copies of the 37large native plasmid pANL per chromosome in S.
    [Show full text]
  • Construction of Shuttle Vectors Capable of Conjugative Transfer From
    Proc. Natl. Acad. Sci. USA Vol. 81, pp. 1561-1565, March 1984 Microbiology Construction of shuttle vectors capable of conjugative transfer from Escherichia coli to nitrogen-fixing filamentous cyanobacteria (Anabaena/plasmid RP4/plasmid pBR322/restriction sites/photosynthesis) C. PETER WOLK, AVIGAD VONSHAK*, PATRICIA KEHOE, AND JEFFREY ELHAI MSU-DOE Plant Research Laboratory, Michigan State University, East Lansing, MI 48824 Communicated by Charles J. Arntzen, November 16, 1983 ABSTRACT Wild-type cyanobacteria of the genus Ana- We report the construction of a hybrid between pBR322 baena are capable of oxygenic photosynthesis, differentiation and plasmid pDU1 (16) from the filamentous cyanobacter- of cells called heterocysts at semiregular intervals along the ium Nostoc. Because restriction endonucleases present in cyanobacterial filaments, and aerobic nitrogen fixation by the strains of cyanobacteria (17) apparently reduce retention of heterocysts. To foster analysis of the physiological processes DNA transferred into those cyanobacteria (4, 18), the hybrid characteristic of these cyanobacteria, we have constructed a plasmid was restructured to eliminate sites for restriction en- family of shuttle vectors capable of replication and selection in zymes present in several strains of Anabaena. Additional Escherichia coli and, in unaltered form, in several strains of antibiotic-resistance determinants were added, lest an orga- Anabaena. Highly efficient conjugative transfer of these vec- nism be unable to use any one such determinant. The deriva- tors from E. coli to Anabaena is dependent upon the presence tives of the hybrid plasmid proved to be shuttle vectors, ca- of broad host-range plasmid RP-4 and of helper plasmids. The pable of RP-4-mediated transfer into several strains of Ana- shuttle vectors contain portions of plasmid pBR322 required baena and of replication in those strains.
    [Show full text]
  • Construction of Over-Expression Shuttle Vectors in Streptomyces
    Ann Microbiol (2012) 62:1541–1546 DOI 10.1007/s13213-011-0408-1 ORIGINAL ARTICLE Construction of over-expression shuttle vectors in Streptomyces Ning Sun & Zhi-Bin Wang & He-Ping Wu & Xu-Ming Mao & Yong-Quan Li Received: 15 September 2011 /Accepted: 15 December 2011 /Published online: 20 January 2012 # Springer-Verlag and the University of Milan 2012 Abstract Two high-copy number vectors, pL97 and pL98, Keywords High-copy number . Constitutive . Inducible . that contain the strong constitutive ermEp* from Saccharopo- pIJ101 replicon . oriT lyspora erythraea and the ssrA promoter (ssrAp) from Strep- tomyces coelicolor, respectively, and an inducible high-copy vector, pL99, with the PnitA-NitR system from Rhodococcus Introduction rhodochrous, were constructed based on the pIJ101 replicon. These vectors have pUC18 and pIJ101 replication origins for Streptomyces are Gram-positive, soil-dwelling microorgan- high-copy plasmid number in Escherichia coli and Streptomy- isms, which can produce many kinds of antibiotics, ces, respectively, and the oriT (RK2) allows the efficient and enzymes, immuno-suppressives, etc., with commercial and convenient plasmid transfer from E. coli to Streptomyces.The academic value. Moreover, Streptomyces have also been transformants can be easily selected with apramycin. There is developed as the hosts for the expression of heterogonous also a multiple cloning site (MCS) between promoter and proteins, which might aggregate in the inclusion bodies of terminator convenient for heterologous gene cloning. The E. coli. enhanced green fluorescent protein (EGFP) gene and redD,a In order to maximize the productivity of Streptomyces,an pathway-specific regulatory gene for the production of unde- easy and routine strategy is to over-express some pivotal cylprodigiosin in S.
    [Show full text]
  • Cloning Vectors
    Cloning Vectors Vectors-the carriers offf forei gn DNA for clonin g 1. Genetic engineering ‐ Neelam Pathak 2. Gene Cloning and DNA Analysis (6th Edn) ‐ T.A. Brown CLONING VECTORS Vectors are DNA molecules that act as vehicles for carrying a fiforeign DNA ftfragment when itdinserted itintoa host cell. A cloning vector is a DNA molecule in which foreign DNA can be inserted or integrated and which is further capable of replicating within host cell to produce multiple clones of recombinant DNA. A vector can be used for cloning to get DNA copies of the fragmen t or to obtai n expression of the cloned gene (to get RNA or Protein) Characteristics/ Necessary Properties of a Vector 1. Gen eti c egengin eegeering ‐ Neel amPatha k 2. Gene Cloning and DNA Analysis (6th Edn) ‐ T.A. Brown 1. Cappyability of autonomous rep lication: vector should contain an origin of replication (ori) to enable independent replication using the host cell's machinery. 2. Small size: a cloning vehicle needs to be reasonably small in size and manageable. Large molecules tend to degrade during purification and are difficult to manipulate. 3. Presence of selectable marker genes: a cloning vector should have selectable marker gene. This gene permits the selection of host cells which bear recombinant DNA from those which do not bear rDNA. Eg.AmpR TetR,NeoR,LacZ genes. 4. Presence of unique restriction sites: It should have restriction sites, to allow cleavage of specific sequence by specific Restriction endonuclease. Unique restriction sites should be present on the vector DNA molecule either individually or as cluster (MCS- multiple cloning sites or Polylinker).
    [Show full text]
  • New Shuttle Vectors for Escherichia Coil and Bacillus Subtilis. II. Plasmid Phy300plk, a Multipurpose Cloning Vector with a Polylinker, Derived from Phy460
    Jpn. J. Genet. (1985) 60, pp. 235-243 New shuttle vectors for Escherichia coil and Bacillus subtilis. II. Plasmid pHY300PLK, a multipurpose cloning vector with a polylinker, derived from pHY460 BY Hiromi ISHIwA and Harue SHIBAHARA Yakult Institute for Microbiological Research, 1796 Yaho, Kunitachi, Tokyo 186 (Received May 1, 1985) ABSTRACT In vivo and in vitro recombination techniques were used to construct a new cloning vector, pHY300PLK (4.7 kb) from the shuttle vector pHY460 (7 kb). The newly derived shuttle vector can replicate and express the tetra- cycline resistance gene (TcR) in both Escherichia coli and Bacillus subtilis. pHY300PLK contains the TcR gene, the ampicillin resistance gene (ApR), two replication origins for EK coli and B. subtilis and a polylinker derived from ~AN7. The unique cloning sites are BalI, BamHI, BanI, BglI, BglII, BstEII, EcoRI, EcoRV, HindIII, IJpaI, SalI, SmaI, PvuI and X baI, pHY300 PLK is characterized as a copy-number mutant in E. coli. (Key words: shuttle vector; B, subtilis; tetracycline; ampicillin; copy-number mutant; incompati- bility) 1. INTRODUCTION At the first step of the gene manipulation in vitro, one must choose a good host-vector system for a desired foreign DNA. Many excellent cloning vectors in E, coli, are available. However, the expression of foreign DNA is often difficult in E. coli, and new host-vector systems need to be developed. Powerful gene manipulation systems have been developed in E, coli, so that bif unctional vectors between E, coli and other organisms are especially useful. Recently several bifunctional vectors have been developed. These include Bacillus subtilis (Ishiwa and Tsuchida 1984; Ostroff and Pene 1984 a, b), Streptococcus sanguis (Dao and Ferretti 1985), yeast (Broach et al.
    [Show full text]
  • Alkylation Damage in Mammalian Cells: an Analysis of the Mutagenic Potential of 04-Methylthymine Adducts
    ALKYLATION DAMAGE IN MAMMALIAN CELLS: AN ANALYSIS OF THE MUTAGENIC POTENTIAL OF 04-METHYLTHYMINE ADDUCTS by KARA DENISE BEST ALTSHULER B.S., Texas A&M University, 1987 SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY at the MASSACHUSETTS INSTITUTE OF TECHNOLOGY MARCH 1994 o Massachusetts Institute of Technology, 1994 () Signature of Author ,Y Division of Toxicology March 15, 1994 Certified byr John M. Essigmann Thesis Supervisor Accepted by Steven R. Tannenbaum MASSACHLUSETS 4YUSTITUT ........- ,,"1h Y Chairman, Commitee on Graduate Students APR 2 0 1994 This doctoral thesis has been examined by a Committee of the Division of Toxicology as follows: Professor William G. Thilly Chairman Professor John M. Essigmanr. , . - Thesis Supervisor -~ I Professor Helmut Zarbl Professor Edward Loechler ( ,... ~-' ,Y~~.. .. ~. _,-,, ALKYLATION DAMAGE IN MAMMALIAN CELLS: AN ANALYSIS OF THE MUTAGENIC POTENTIAL OF 0 4-METHYLTHYMINE ADDUCTS by Kara Denise Best Altshuler Submitted to the Division of Toxicology on March 15, 1994 in partial fulfillment of the requirements for the Degree of Doctor of Philosophy ABSTRACT The mutagenic effects of two alkyl-DNA adducts were investigated in mammalian cells with differing repair phenotypes. A shuttle vector system was used that consisted of a plasmid, pCNheI, which contains a pML2 bacterial origin of replication, an SV40 mammalian origin of replication, the neomycin resistance gene and SV40 polyadenylation sequences. This plasmid can integrate into and replicate within the genome of mammalian cells. Three different oligonucleotides were positioned within a single NheI site in the pCNheI shuttle vector: the control oligonucleotide, 5'-GCTAGC-3', an oligonucleotide with the same sequence containing 04MeThy in place of the single thymine, and an oligonucleotide with 06MeGua replacing the second guanine.
    [Show full text]
  • Yeast/E. Coli Shuttle Vectors with Multiple Unique Restriction Sites
    YEAST VOL 2: 163-167 (1986) YeastlE. coli Shuttle Vectors with Multiple Unique Restriction Sites JOHN E. HILL*, ALAN M. MYERS, T. J. KOERNERY AND ALEXANDER TZAGOLOFFS Department of Biological Sciences, Columbia University, New York, NY 10027, U.S.A. Received 20 February 1986 Two yeast/E. coli shuttle vectors have been constructed. The two vectors, YEp351 and YEp352, have the following properties: (1) they can replicate autonomously in Saccharomyces cerevisiae and in E. coli; (2) they contain the S-lactamase gene and confer ampicillin resistance to E. coli; (3) they contain the entire sequence of pUC18; (4) all ten restriction sites of the multiple cloning region of pUC18 including EcoRI, Sad, KpnI, Smal, BamHI, XbaI, SalI, Pstl, SphI and HindIII are unique in YEp352; these sites are also unique in YEp351 except for EcoRI and KpnI, which occur twice; (5) recombinant plasmids with DNA inserts in the multiple cloning region of YEp351 and YEp352 can be recognised by loss of (3-galactosidase function in appropriate E. coli hosts; (6)YEp351 and YEp352 contain the yeast LEU2 and URA3 genes, respectively, allowing for selection of these auxotrophic markers in yeast and E. coli; (7) both plasmids are retained with high frequency in yeast grown under non-selective conditions indicative of high plasmid copy number. The above properties make the shuttle vectors suitable for construction of yeast genomic libraries and for cloning of DNA fragments defined by a large number of different restriction sites. The two vectors have been further modified by deletion of the sequences necessary for autonomous replication in yeast.
    [Show full text]
  • Construction of a Shuttle Expression Vector for Lactic Acid Bacteria Tejinder Kaur* , Praveen P
    Kaur et al. Journal of Genetic Engineering and Biotechnology (2019) 17:10 Journal of Genetic Engineering https://doi.org/10.1186/s43141-019-0013-4 and Biotechnology RESEARCH Open Access Construction of a shuttle expression vector for lactic acid bacteria Tejinder Kaur* , Praveen P. Balgir and Baljinder Kaur Abstract Background: Lactic acid bacteria (LAB) are a diverse group of Gram-positive bacteria, which are widely distributed in various diverse natural habitats. These are used in a variety of industrial food fermentations and carry numerous traits with utmost relevance to the food industry. Genetic engineering has emerged as an effective means to improve and enhance the potential of commercially important bacterial strains. However, the biosafety of recombinant systems is an important concern during the implementation of such technologies on an industrial scale. In order to overcome this issue, cloning and expression systems have been developed preferably from fully characterized and annotated LAB plasmids encoding genes with known functions. Results: The developed shuttle vector pPBT-GFP contains two theta-type replicons with a copy number of 4.4 and 2.8 in Pediococcus acidilactici MTCC 5101 and Lactobacillus brevis MTCC 1750, respectively. Antimicrobial “pediocin” produced by P. acidilactici MTCC 5101 and green fluorescent protein (GFP) of Aequorea victoria were successfully expressed as selectable markers. Heterologous bile salt hydrolase (BSH) from Lactobacillus fermentum NCDO 394 has been efficiently expressed in the host strains showing high specific activity of 126.12 ± 10.62 in P. acidilactici MTCC 5101 and 95.43 ± 4.26 in the case of L. brevis MTCC 1750, towards glycine-conjugated bile salts preferably as compared to taurine-conjugated salts.
    [Show full text]
  • Plasmid Cloning Vectors
    PLASMID CLONING VECTORS Sources: 1. Biotechnology By B.D. Singh, 2. Gene cloning and DNA analysis By TA Brown, 3. Advance and Applied Biotechnology By Marian Patrie, 4. Molecular Biotechnology By Glick et al and 5. Principle of Gene Manipulation By sandy b Primrose et al. Dr Diptendu Sarkar [email protected] RKMV Introduction: • DNA molecule used for carrying an exogenous DNA into a host organism and facilitates stable integration and replicate autonomously in an appropriate host cell is termed as Vector. • Molecular cloning involves series of sequential steps which includes restriction digestion of DNA fragments both target DNA and vector, ligation of the target DNA with the vector and introduction into a host organism for multiplication. Then the fragments resulted after digestion with restriction enzymes are ligated to other DNA molecules that serve as vectors. In general, vectors should have following characteristics: • Capable of replicating inside the host. • Have compatible restriction site for insertion of DNA molecule (insert). • Capable of autonomous replication inside the host (ori site). • Smaller in size and able to incorporate larger insert size. • Have a selectable marker for screening of recombinant organism. 12/10/2019 DS/RKMV/MB 2 Plasmids: • Plasmids are naturally occurring extra chromosomal double-stranded circular DNA molecules which can autonomously replicate inside bacterial cells. • Plasmids range in size from about 1.0 kb to over 250 kb. • Plasmids encode only few proteins required for their own replication (replication proteins) and these proteins encoding genes are located very close to the ori. • All the other proteins required for replication, e.g. DNA polymerases, DNA ligase, helicase, etc., are provided by the host cell.
    [Show full text]
  • Ppicholi Shuttle Vector System Order # PPICH
    © MoBiTec GmbH 2019 Page 1 pPICHOLI Shuttle Vector System Order # PPICH MoBiTec GmbH, Germany Phone: +49 551 70722 0 Fax: +49 551 70722 22 E-Mail: [email protected] www.mobitec.com © MoBiTec GmbH 2019 Page 2 Contents 1. Features ................................................................................................................. 3 2. Kit Components ..................................................................................................... 3 3. Introduction ........................................................................................................... 3 4. The pPICHOLI Shuttle Vector System ................................................................. 4 4.1. Vector map pPICHOLI-1 ................................................................................. 6 4.2. Vector map pPICHOLI-HA .............................................................................. 7 4.3. Vector map pPICHOLI-C ................................................................................. 8 4.4. Multiple Cloning Sites of pPICHOLI Vectors ................................................ 9 5. Protocols .............................................................................................................. 10 5.1. Storage and Handling Instructions ............................................................. 10 5.2. Cloning Strategy ........................................................................................... 10 5.3. Strains...........................................................................................................
    [Show full text]