Construction of a Shuttle Vector for Protein Secretory Expression in Bacillus Subtilis and the Application of the Mannanase Func

J. Microbiol. Biotechnol. (2014), 24(4), 431–439 http://dx.doi.org/10.4014/jmb.1311.11009 Research Article jmb

Construction of a Shuttle Vector for Protein Secretory Expression in Bacillus subtilis and the Application of the Mannanase Functional Heterologous Expression Su Guo, Jia-jie Tang, Dong-zhi Wei, and Wei Wei*

State Key Laboratory of Bioreactor Engineering, Newworld Institute of Biotechnology, East China University of Science and Technology, Shanghai 200237, People’s Republic of China

Received: November 6, 2013 Revised: December 11, 2013 We report the construction of two Bacillus subtilis expression vectors, pBNS1/pBNS2. Both Accepted: December 24, 2013 vectors are based on the strong promoter P43 and the ampicillin resistance gene expression cassette. Additionally, a fragment with the Shine-Dalgarno sequence and a multiple cloning site (BamHI, SalI, SacI, XhoI, PstI, SphI) were inserted. The coding region for the amyQ (encoding an amylase) signal peptide was fused to the promoter P43 of pBNS1 to construct the First published online December 30, 2013 secreted expression vector pBNS2. The applicability of vectors was tested by first generating the expression vectors pBNS1-GFP/pBNS2-GFP and then detecting for green fluorescent *Corresponding author Phone: +86-21-64251803; protein gene expression. Next, the mannanase gene from B. pumilus Nsic-2 was fused to vector Fax: +86-21-64251803; pBNS2 and we measured the mannanase activity in the supernatant. The mannanase total E-mail: [email protected] enzyme activity was 8.65 U/ml, which was 6 times higher than that of the parent strain. Our pISSN 1017-7825, eISSN 1738-8872 work provides a feasible way to achieve an effective transformation system for gene expression in B. subtilis and is the first report to achieve B. pumilus mannanase secretory expression in B. subtilis.

Introduction compared with other promoters [18]. Furthermore, P43 promoter has been successfully used in recombinant Gram-positive bacterial strains are well known for their proteins production, such as thermostable β-galactosidase, contributions to agricultural, medical, and commercial staphylokinase, and dehydrogenase [18]. enzyme production. Among them, Bacillus subtilis has been Endo-1,4-β-mannanases (β-mannanases, E.C. 3.2.1.78) widely used in recombinant protein production such as catalyze the random hydrolysis of manno-glycosidic bonds enzymes, biochemicals, antibiotics, and insecticides. B. subtilis in mannans and heteromannans. Based upon the amino has been developed as an attractive host because of several acid sequence alignment and hydrophobic cluster analysis, reasons: nonpathogenic and considered as a safe organism, most β-mannanases belong to glycoside hydrolase (GH) no significant bias in codon usage, and capable of secreting families 5, 26, and 113. Endo-1,4-β-mannanases play important functional extracellular proteins directly into the culture roles in basic research, the bioconversion of biomass medium [10, 15]. At present, about 60% of the commercially materials, and various potential industrial applications [3, available enzymes are produced by Bacillus species [11]. A 8, 13]. β-Mannanases from bacteria (Bacillus sp., Aeromonas wide variety of promoters used in B. subtilis have been sp., Streptomyces sp., Pseudomonas sp., or Vibrio sp.), fungi reported [2, 11, 18]. Among them, the constitutive promoter (Penicillium sp., Tyromices sp., Trichosporum sp., Sclerotium P43 is active during the exponential and lag phases of sp., and Aspergillus sp.), plants (Amorphophallus konjac), growth and shows the highest expression capability animals, and in the colonic region of humans were

April 2014 ⎪ Vol. 24⎪ No. 4 432 Guo et al.

reported in previous research. During recent years, the Table 1. Both E. coli cells and B. subtilis cells were grown in Luria- production of mannanases in recombinant Escherichia coli Bertani (LB) medium at 37oC. Antibiotics were used in this study has been well studied [3, 17]. However, there have been at the following concentrations: ampicillin at 100 µg/ml for E. coli few reports of the mannanases expression in Bacillus subtilis. and kanamycin at 30 µg/ml for B. subtilis. In this study, we report the construction of two B. subtilis Chemicals and Manipulation of DNA expression vectors, pBNS1 and pBNS2, both with the strong Taq DNA polymerase, restriction endonucleases, T4 DNA constitutive promoter P43. The two newly constructed ligase, and pMDTM19-T vector were purchased from Takara vectors can be efficiently transformed into B. subtilis by (Takara Biotechnology, Shanghai, China). Isolated chromosomal electroporation and be used for intra- and extracellular DNA from B. subtilis, plasmids, and gel extraction of DNA were production of recombinant proteins in B. subtilis. In our prepared using the AXYGEN kit (BIOSCIENCE, Shanghai, China). study, the GFP gene and mannanase gene were expressed PCR products and DNA bands were separated by electrophoresis successfully. Both vectors can be used to express exogenous on a 1.0% agarose gel. Transformation of E. coli was carried out

genes in B. subtilis and are useful for the large-scale gene using CaCl2-treated 50 µl aliquots of competent cells, and Bacillus expression industry. subtilis cells were transformed by electroporation. Primers used in this study are listed in Table 2. Materials and Methods Construction of Shuttle Expression Vector pBNS1 and pBNS2 First, the original plasmid pBEn (7.4 kb) was constructed using Bacterial Strains, Plasmids, and Culture Conditions plasmids pUB110 (4.5 kb) from B. subtilis and pGEM (2.9 kb) from The following strains were used: Escherichia coli DH5α, Escherichia 3 E. coli. Then, plasmid pBE2a (6.3 kb) was constructed by removing coli BL21(DE3)/pLysS (Invitrogen), B. subtilis 1A751 (Lab collection), a 1.1 kb PvuII cleavage fragment in pBEn. Primers P43-U/P43-D and Bacillus pumilus Nsic-2 (wild strain, accession number: and A1/A2 were used to clone the P43 promoter sequence (from CCTCC AB 2013050. China Center for Type Culture Collection). B. subtilis 168) and signal peptide (from B. amyloliquefaciens), The bacterial strains and plasmids used in this study are listed in respectively. The PCR products were gel extracted and cloned

Table 1. Bacterial strains and plasmids used in this study. Strains/plasmids Relevant features Source Strains E. coli DH5α F--, ϕ80d/lacZ∆M15, ∆(lacZYA-argF)U169, deoR, recA1, Lab collection endA1, hsdR17 (rk- mk+), phoA, supE44, λ-, thi-1, gyrA96, relA1 B. subtilis 1A751 apr his npr eglS (DELTA) 102 bglT/bglS (DELTA) EV Lab collection Bacillus pumilus Nsic-2 Wild strain (CCTCC AB 2013050) Lab collection pBNS1-GFP-1A751 B. subtilis 1A751 recombinant strain harboring plasmid pBNS1-GFP; KanR This study pBNS2-GFP-1A751 B. subtilis 1A751 recombinant strain harboring plasmid pBNS2-GFP; KanR This study Plasmids pMDTM19-T Cloning vector; AmpR Takara pUB110 Bacillus cloning vector; KanR Lab collection pGEM3 E. coli expression vector; AmpR Lab collection pMT-P43 pMDTM19-T containing the P43 promoter; AmpR This study pMT-amyQ pMDTM19-T containing the amyQ signal peptide; AmpR This study pMD19-SP pMDTM19-T containing the 188 bp fusion fragment; AmpR This study pBE2a Basic cloning vector; AmpR and kanR This study pBNS1 Bacillus-E. coli shuttle vector; vector for intracellular expression; AmpR and KanR This study pBNS2 Bacillus-E. coli shuttle vector; vector for extracellular expression; AmpR and KanR This study pBNS1-GFP pBNS1-based vector, carrying gfp gene; AmpR and KanR This study pBNS2-GFP pBNS2-based vector, carrying gfp gene; AmpR and KanR This study pBNS2-man pBNS2-based vector, carrying mature mannanase gene; AmpR and KanR This study

AmpR, ampicillin resistance; KanR, kanamycin resistance.

J. Microbiol. Biotechnol. B. subtilis Secretory Expression and Application 433

Table 2. Synthetic oligonucleotides used in this study. Primer Specificity Amplicon size Nucleotide sequence (5’ → 3’) A1 amyQ signal peptide 96 bp ATGATTCAAAAACGAAAGCGGACAGTT A2 amyQ signal peptide 96 bp TACGGCTGATGTTTTTGTAATCGGCAA P43-U P43 promoter 305 bp CGCGAATTCTGATAGGTGGTATGTTTT (EcoRI) P43-D P43 promoter 305 bp CGCTCTAGATTCATGTGTACATTCCTC (XbaI) F1 Fusion fragment 188 bp GGCTCTAGATTTAAGAAGGAGATATACATATGATTCAAA (XbaI) R1 Fusion fragment 188 bp CTCGAGGAGCTCGTCGACGGATCCTACGGCTGAT R2 Fusion fragment 188 bp GATGGTGATGGCATGCCTGCAGCTCGAGGAGCT R3 Fusion fragment 188 bp GCCAAGCTTGTGATGGTGATGGTGATGGTGATG (Hind) pBNS1-gfp-U GFP reporter gene 771 bp GCCTCTAGATTTAAGAAGGAGATATACATATGAGTAAA (XbaI) pBNS1-gfp-D GFP reporter gene 771 bp GCCAAGCTTGCATGCCTGCAGGTCTGGACATTTATTTGTA (Hind) pBNS2-gfp-U GFP reporter gene 726 bp GCCGGATCCAGTAAAGGAGAAGAA (BamHI) pBNS2-gfp-D GFP reporter gene 726 bp GCCCTCGAGTTATTTGTATAGTTCATCCAT (XhoI) manA-F β-Mannanase gene 1,008 bp GTCTGGATCCCATACTGTGTCGCCTGTGAAT (BamHI) manA-D β-Mannanase gene 1,008 bp GGCCCTCGAGCTCAACGATTGGCGTTAAA (XhoI) Primers P3/P4, A1/A2, pBNS1-gfp-U/pBNS1-gfp-D, pBNS2-gfp-U/pBNS2-gfp-D, and manA-F/manA-D were used to amplify the P43 promoter, the amyQ signal peptide, the GFP reporter gene, and the β-mannanase gene, respectively. Primers F1/R1, R2, and R3 were used for sequential PCR to amplify the 188 bp fusion fragment. The underlined sequences are the restriction sites. The bold underlined sequence are the modified Shine-Dalgarno sequences.

into the vector pMD19-T to generate pMT-P43 and pMT-amyQ, 30 µg/ml kanamycin and shaken at 37oC overnight in Luria- respectively. Next, the 0.3 kb P43 promoter gene obtained from Bertani (LB) broth. The obtained transformants were examined for pMT-P43 was subcloned into the EcoRI/XbaI site of pBE2a to the expression of GFP under a fluorescence microscope. generate expression plasmid pBNS1 (B. subtilis intracellular expression plasmid). Measurement of Green Fluorescent Protein To construct the B. subtilis secreted expression vector pBNS2, Recombinant B. subtilis strains were cultured for 24 h at 37oC. the method of sequential PCR with specific primers F1/R1/R2/R3 After centrifuged at 10,000 rpm for 10 min (at 4oC), the supernatant was used. In this way, a fragment of designed SD sequence was and the precipitated cells were collected, respectively. The added to the upstream of the amyQ signal peptide, while a precipitated cells were diluted in 100 mM sodium phosphate multiple cloning site sequence including BamHI, SalI, SacI, XhoI, buffer (pH 7.0). Both supernatant and precipitated cells were PstI, and SphI and the optional C-terminal His-Tag sequence were analyzed for GFP expression on a microtiter plate reader (GENios inserted into the downstream of the amyQ signal peptide. Finally, Pro), using an excitation wavelength of 485 nm and an emission the 188 bp target fragment was obtained and inserted into wavelength of 535 nm [7]. pMDTM19-T vector (named pMD19-SP). Next, the 188 bp fragment was subcloned into the XbaI/Hind site of pBNS1. The constructed Construction of pBNS2-Man and Enzyme Assays plasmid, named pBNS2 (6,781 bp), contains the amyQ signal To further verify the constructed plasmids, the β-mannanase peptide and C-terminal His-Tag. gene (GeneBank Accession No. KC436314) was inserted into the SD sequence of pBNS2, and the β-mannanase activity was measured.

Construction of GFP Reporter Vector and Transformation Using primers manA-F/manA-D, the β-mannanase (named manB)

Using the pGFP1 (Clontech) plasmid as the template, the GFP gene was amplified from Bacillus pumilus Nsic-2. Next, the manB gene (717 bp) was amplified with the primers pBNS1-gfp-U/ gene was subcloned into the BamHI/XhoI site of pBNS2 to pBNS1-gfp-D and pBNS2-gfp-U/pBNS2-gfp-D. Next, the 0.7 kb generate pBNS2-man. Sequence verification of the manB gene in GFP gene was subcloned into the XbaI/HindIII site of pBNS1 and pBNS2-man was performed. The recombinant plasmid was then the BamHI/XhoI sites of pBNS2 to generate pBNS1-GFP (7,359 bp) transformed into the B. subtilis 1A751 strain. and pBNS2-GFP (7,483 bp), respectively (Fig. 1). Sequence verification Mannanase activity was assayed using the DNS method with and sequence analysis of the GFP gene in pBNS1-GFP and pBNS2- some modifications [17]. The reaction mixture containing 100 µl of GFP was performed (HuaDa Gene Company, Shanghai, china). appropriately diluted enzyme sample and 900 µl of 0.5% (w/v) The constructed plasmids were transformed into B. subtilis by locust bean gum in 0.05 M sodium phosphate buffer (pH 7.0) was electroporation. The positive strains were selected based on incubated at 50oC for 10 min, and terminated by the addition of

April 2014 ⎪ Vol. 24⎪ No. 4 434 Guo et al.

Fig. 1. Schematic diagram of the constructed plasmids in B. subtilis. SD, amyQ, MCS, gfp, Ori, Amp, and Kan represent the B. subtilis Shine-Dalgarno sequence, signal peptide of alpha-amylase from Bacillus amyloliquefaciens, multiple cloning site sequence, green fluorescent protein gene, replication origin, ampicillin resistance marker, and kanamycin resistance marker, respectively.

0.5 ml of DNS reagent. After boiling in a water bath for 10 min, pBNS2 vector was constructed by modification of pBNS1. the absorbance was measured at 540 nm. The reaction system, Using the method of sequential PCR, the XbaI-Hind with the same enzyme sample added after DNS reagent, was restriction fragment of pBNS1 was replaced by a 188 bp treated as the control. Activities were expressed as mean values in U DNA cassette (see Fig. 2). The constructed plasmid pBNS2 (mg protein). One unit of enzyme activity is defined as the amount contains the SD sequence, B. amyloliquefaciens amyQ signal of enzyme releasing 1 µmol of reducing sugar per minute under peptide-encoding sequence, multiple cloning site sequence the assay experimental conditions. (BamHI, SalI, SacI, XhoI, PstI, SphI), and optional C-terminal His-Tag sequence (see Fig. 2). Promoter P43 was amplified Results from B. subtilis 168 chromosomal DNA. The homology Construction of Expression Vectors pBNS1 and pBNS2 analysis showed that the length of P43 promoter is 305 bp In this study, we constructed two shuttle expression and 100% identical to the reported B. subilis genome DNA vectors that are based on the strong promoter P43. The (GenBank Accession No. AL009126.3).

J. Microbiol. Biotechnol. B. subtilis Secretory Expression and Application 435

Fig. 2. Construction of plasmid pBNS2. (A) Part of the pBNS2 sequence. The sequence between the EcoRI site and XbaI site is the P43 promoter (contains transcription factors σA and σB). The SD sequence is marked by blue underline. The sequences in the black and red boxes are the B. amyloliquefaciens amyQ signal peptide and MCS, respectively. The C-terminal His-Tag sequence is indicated by the bold underline. (B) Schematic diagram of sequential PCR. SD, amyQ, and MCS represent the B. subilis SD sequence, the signal peptide of alpha-amylase from Bacillus amyloliquefaciens, and the multiple cloning site sequence, respectively.

Construction of the GFP Reporter Recombinant Strains recombinant strains pBNS1-GFP-1A751/pBNS2-GFP-1A751 and Growth Curve Analysis reached the exponential phase after 6 h of culture. We used the GFP gene as a reporter to test the applicability of the constructed vectors pBNS1 and pBNS2 Validation of the Vector Applicability by the GFP in Bacillus subtilis. Expression vectors pBNS1-GFP and Fluorescence Detection and SDS-PAGE pBNS2-GFP were first transformed into E. coli and then The two newly constructed plasmids were Escherichia transformed into B. subtilis 1A751 by electroporation. The coli-Bacillus subtilis shuttle expression vectors and can transformants that carried the desired vectors were directly replicate in both E. coli and B. subtilis. As there is no signal screened on ampicillin-containing solid plates for E. coli peptide (http://www.cbs.dtu.dk/services/SignalP/) in the and kanamycin-containing solid plates for B. subtilis 1A751, green fluorescent protein gene, the GFP gene was expressed respectively. The resultant plasmid and mutant strain were intra- and extracellular directly. Positive transformants, verified by restriction enzyme digestion and nucleotide pBNS1-GFP-1A751 and pBNS2-GFP-1A751, were selected sequencing (Fig. 3). and then screened for further observation of GFP expression The growth curve was determined by measuring the under a fluorescence microscope. The recombinant strain turbidity of wild strain and recombinant strains pBNS1- glowed with a bright green color and was visible by the GFP-1A751/pBNS2-GFP-1A751. The results show that the naked eye. The results (Fig. 4) indicated that both vectors stationary phase and the death phase of recombinant were capable of expressing the exogenous gene in B. subtilis. strains were consistent with wild strain 1A751 (Fig. 3). The After culture for 24 h, the fluorescence values in the cell concentration reached the maximum after 24-27 h fermentation supernatant and precipitated cells were cultured and then decreased as the cells ran out of nutrients analyzed. Based on data obtained from the fluorescence and died. There was a noticeable lag phase for recombinant microplate reader (Table 3), we concluded that the GFP strains as the additional kanamycin. After culture for 2 h, gene was well expressed and secreted from the constructed wild strain 1A751 reached the exponential phase, whereas expression cassette. Almost all the GFP was expressed

April 2014 ⎪ Vol. 24⎪ No. 4 436 Guo et al.

Fig. 3. The growth curve and restriction enzyme analysis of recombinant strains. (A) The growth curve of wild strain and recombinant strains pBNS1-GFP-1A751/pBNS2-GFP-1A751. The wild strain 1A751 is indicated by filled diamonds, and filled squares are for recombinant strain pBNS1-GFP-1A751, and filled triangles for pBNS2-GFP-1A751. (B) Lanes 1 and 2 represent plasmid pBNS2 digested by EcoRI/XbaI and EcoRI/Hind, respectively; M, DNA ladder. (C) Lanes 1 and 2 represent plasmid pBNS2-GFP digested by XbaI/Hind and BamHI/XhoI, respectively; lane 3, plasmid pBNS1-GFP digested by BamHI/XhoI.

Fig. 4. Detection of recombinant strains by fluorescence microscopy and SDS-PAGE analysis. (A) The fluorescence detection of the recombinant strain pBNS1-GFP-1A751. (B) The fluorescence detection of the recombinant strain pBNS2-GFP- 1A751. (C) The result of precipitated cells (pBNS1-GFP-1A751). Lane 1, control strains (empty vector); Lanes 2-6, SDS-PAGE results of target protein grow at different times (12 h, 15 h, 18 h, 21 h, 24 h); (D) The result of fermentation supernatant (pBNS2-GFP-1A751). Lane 1, control strains (empty vector); Lanes 2-7, SDS-PAGE results of target protein grow at different times (3 h, 6 h, 9 h, 12 h, 15 h, 18 h). (E) Protein purification of GFP by Ni-NTA superflow column (pBNS2-GFP-1A751).

J. Microbiol. Biotechnol. B. subtilis Secretory Expression and Application 437

Table 3. Intra- and extra-cellular GFP production obtained from the fluorescence microplate reader. 24 h Strain Intracellular fluorescent Extracellular fluorescence pBNS1-GFP-1A751 9,734 ± 29 4,416 ± 38 pBNS2-GFP-1A751 2,961 ± 36 5,261 ± 45 1A751 182 ± 20 202 ± 21 The fermentation supernatant and precipitated cells of three strains collected at 24 h; the results are the average from three flasks. The standard errors are shown. intracellularly with vector pBNS1, whereas most of the detecting the mannanase activity of the positive transformants. GFP was secreted extracellularly with vector pBNS2 (64% The resultant plasmid and mutant strain were verified by from culture medium). The result indicates that vector restriction enzyme digestion and nucleotide sequencing pBNS2 has the capacity of secreting functional extracellular (Fig. 5A). We collected the fermentation supernatant and proteins directly into the culture medium. the precipitated cells of pBNS2-man-1A751 after culture for We collected the precipitated cells of pBNS1-GFP-1A751 24 h and samples were separated by SDS–PAGE. The result at different times and the proteins were separated by SDS– (Fig. 5C) showed a protein band with an apparent PAGE. The result (Fig. 4C) showed a protein band with an molecular mass of about 40 kDa, which was identical to the apparent molecular mass of about 30 kDa, which was identical calculated value mass of the mannanase. Furthermore, most to the calculated value mass of the GFP. Meanwhile, culture of the recombinant protein was secreted extracellularly samples of pBNS2-GFP-1A751 (fermentation supernatant) with vector pBNS2. were collected at different times. The results of SDS-PAGE After culture for 24 h, the mannanase activity was (Fig. 4D) showed that the GFP band was present in the measured by the DNS method as previously described. The fermentation supernatant, and the expression level of GFP mannanase total enzyme activity was 8.65 U/ml, and in the was decreased compared with the intracellular expression supernatant was 6.49 U/ml (about 75% of the total activity), vector pBNS1. but no enzyme activity was detected in the transformant Usage of Secretion Expression Vector pBNS2 for Mannanase harboring the empty pBNS2 plasmid (negative control). Expression The expression level of the mannanase gene in the The applicability of pBNS2 vector was tested by first constructed B. subtilis was 6 times higher than that of generating the expression vector pBNS2-man and then parent strain Bacillus pumilus Nsic-2. The results indicate

Fig. 5. Mannanase expression and SDS-PAGE analysis. (A) Restriction enzyme analysis of recombinant strains. Lanes 1 and 2 represent plasmid pBNS2-man digested by BamHI/XhoI and BamHI, respectively. (B) The restriction map of plasmid pBNS2-man. (C) The SDS-PAGE analysis of pBNS2-man-1A751. Lane 1, fermentation supernatant; Lane 2, precipitated cells.

April 2014 ⎪ Vol. 24⎪ No. 4 438 Guo et al.

that the plasmid pBNS2 was capable of secreting heterologous plays important roles in industrial applications. Many proteins directly into the culture medium in B. subtilis. microorganisms can utilize mannans as the source of carbon, and among these strains Bacillus spp. occupy an Discussion important position and have been well studied in previous research [6, 9, 16]. However, there have been few reports of Bacillus subtilis has received widespread attention because the mannanases expression in Bacillus subtilis. In this work, of several advantages, the most important being the ability we focus our attention on the construction and application of secreting proteins directly into the culture medium. of the constructed plasmids. Although the expression level These abilities have been largely successful in producing in B. subtilis was lower than E. coli, the results indicated correctly folded and soluble heterologous proteins [15], that the exogenous gene was successfully expressed in and make Bacillus subtilis with the potential application as a B. subtilis and pBNS2 has the capacity of secreting functional gene expression host [12]. However, compared with E. coli, extracellular proteins directly into the culture medium. As the expression level of Bacillus subtilis is still low. Research the cell concentration reached the maximum after 24-27 h scholars have used various methods to improve the culture and then decreased as cells ran out of nutrients and expression system of B. subtilis. The common way is using a died, we collected all the samples within 24 h. As is known, strong promoter, including inducible promoters PsacB, the amount of recombinant proteins is dependent on four

Pspac[4], Pxyl [18], and constitutive promoters, such as PlepA, major factors: efficiency of transcription, mRNA stability,

PamyE, P43 [18]. Other ways, like incorporating a fused signal efficiency of translation, and stability of the protein. That sequence to improving protein secretion or deleting various may be due to incorrect folding of the target protein, or host proteases, were also reported as efficient methods [5]. extracellular protease secreted by B. subtilis host cell, A strong promoter is the essential element to achieve high- which recognizes and degrades heterologous proteins. In level expression in B. subtilis genetic engineering. The subsequent research, we will further improve the plasmids endogenous B. subtilis promoter P43 is a cytidine/deoxycytidine by increasing the plasmid stability. Moreover, the biochemical deaminase promoter, and was originally found using a characterization of the recombinant mannanase will be promoter-probing vector. The promoter P43 contains studied. transcription factors σA (a house-keeping sigma factor that In this research, pBE2a was used as the basic plasmid to is active during the exponential growth phase) and σB constructe two expression vectors, pBNS1 and pBNS2. (transcribes stress-related genes in B. subtilis and is active First, the vector pBNS1 was used to express exogenous at the end of the exponential cell growth phase). Besides genes in high level under the control of the P43 promoter the strong promoter, an efficient Shine-Dalgarno sequence and did not contain signal peptide. Meanwhile, as it was also depended in the expression system [11]. In these contains the B. amyloliquefaciens amyQ signal peptide and two constructed plasmids, not only the P43 promoter but unique endonuclease restriction sites, the vector pBNS2 can also the SD sequence worked efficiently in Bacillus subtilis. be directly used for the secretory expression and is The green fluorescent protein has been used as a reporter convenient to further construct the desired vector in future for many applications [1]. GFP detection only requires research. In summary, we have constructed two pBE2a- irradiation with blue light, and the results can be clearly based expression vectors to achieve intracellular or secretory visualized and rapidly analyzed by fluorescence expression under the control of the P43 promoter. The two microscopy [14]. Nowadays, green fluorescent protein as a expression vectors pBNS1 and pBNS2 showed potential novel marker gene has been widely used in prokaryotic value in industrial applications. and eukaryotic cells. We use the GFP gene as a reporter to test the applicability of the two newly constructed vectors Acknowledgments in Bacillus subtilis 1A751, and the result indicated that the GFP gene was successfully expressed in B. subtilis. The This research was financially supported by the Fundamental applicability of the vectors was tested by the expression of Research Funds for the Central Universities of China (No. the mannanase gene from B. pumilus Nsic-2. β-Mannanase WF1214047), the National High Technology Research and is the key enzyme that catalyzes the random hydrolysis of Development Program of China (No. 2013AA102109), and the β-1,4-D-mannopyranosyl linkages in mannans/ National Major Science and Technology Projects of China heteromannans to release manno-oligosaccharides and (No. 2012ZX09304009).

J. Microbiol. Biotechnol. B. subtilis Secretory Expression and Application 439

References 10. Olempska-Beer ZS, Merker RI, Ditto MD, DiNovi MJ. 2006. Food-processing enzymes from recombinant microorganisms 1. Bisicchia P, Botella E, Devine KM. 2010. Suite of novel - a review. Regul. Toxicol. Pharm. 45: 144-158. vectors for ectopic insertion of GFP, CFP and IYFP 11. Phan TT, Nguyen HD, Schumann W. 2006. Novel plasmid- transcriptional fusions in single copy at the amyE and bglS based expression vectors for intra- and extracellular production loci in Bacillus subtilis. Plasmid 64: 143-149. of recombinant proteins in Bacillus subtilis. Protein Expr. 2. Chen X, Zhu F, Cao Y, Qiao S. 2009. Novel expression Purif. 46: 189-195. vector for secretion of cecropin AD in Bacillus subtilis with 12. Schallmey M, Singh A, Ward OP. 2004. Developments in the enhanced antimicrobial activity. Antimicrob. Agents Chemother. use of Bacillus species for industrial production. Can. J. 53: 3683-3689. Microbiol. 50: 1-17. 3. Dhawan S, Kaur J. 2007. Microbial mannanases: an overview 13. Srivastava PK, Kapoor M. 2013. Cost-effective endo- of production and applications. Crit. Rev. Biotechnol. 27: 197- mannanase from Bacillus sp. CFR1601 and its application in 216. generation of oligosaccharides from guar gum and as 4. Hartl B, Wehrl W, Wiegert T, Homuth G, Schumann W. detergent additive. Prep. Biochem. Biotech. DOI: 10.1080/ 2001. Development of a new integration site within the 10826068.2013.833108. Bacillus subtilis chromosome and construction of compatible 14. Tansila N, Becker K, Isarankura Na-Ayudhya C, expression cassettes, J. Bacteriol. 183: 2696-2699. Prachayasittikul V, Bülow L. 2008. Metal ion accessibility of 5. Kim JH, Hwang BY, Roh J, Lee JK, Kim K, Wong SL, et al. histidine-modified superfolder green fluorescent protein expressed in Escherichia coli. Biotechnol. Lett. 30: 1391-1396. 2008. Comparison of PaprE, PamyE and PP43 promoter strength for β-galactosidase and staphylokinase expression in Bacillus 15. Tosato V, Bruschi CV. 2004. Knowledge of the Bacillus subtilis subtilis. Biotechnol. Bioproc. Eng. 13: 313-318. genome: impacts on fundamental science and biotechnology. 6. Li YN, Meng K, Wang YR, Yao B. 2006. A beta-mannanase Appl. Microbiol. Biotechnol. 64: 1-6. from Bacillus subtilis B36: purification, properties, sequencing, 16. Vu TT, Quyen DT, Dao TT, Nguyen Sle T. 2012. Cloning, gene cloning and expression in Escherichia coli. Z. Naturforsch. high-level expression, purification, and properties of a novel 61c: 840-846. endo-β-1,4-mannanase from Bacillus subtilis G1 in Pichia 7. Lv D, Wang W, Wei D. 2012. Construction of two vectors pastoris. J. Microbiol. Biotechnol. 22: 331-338. for gene expression in Trichoderma reesei. Plasmid 67: 67-71. 17. Yamabhai M, Buranabanyat B, Jaruseranee N, Songsiriritthigul 8. Moreira LR, Filho EX. 2008. An overview of mannan C. 2011. Efficient E. coli expression systems for the production structure and mannan-degrading enzyme systems. Appl. of recombinant beta-mannanases and other bacterial Microbiol. Biotechnol. 79: 165-178. extracellular enzymes. Bioeng. Bugs 2: 45-49. 9. Nathalie E, Guylaine T, Jurgen S. 1998. Gene cloning, DNA 18. Ye R, Kim JH, Kim BG, Szarka S. 1999. High-level secretory sequencing, and expression of thermostable beta-mannanase production of intact, biologically active staphylokinase from from Bacillus stearothermophilus. Appl. Environ. Microbiol. 64: Bacillus subtilis. Biotechnol. Bioeng. 62: 87-96. 4428-4432.

April 2014 ⎪ Vol. 24⎪ No. 4