Clarke.Pdf (13.44Mb)

STADLER SYMP. Vol. 13 (1981) University of Missouri, Columbia 9 THE STRUCTURE AND FUNCTION OF YEAST CENTROMERES

(Saccharomyces cerevisiae, yeast transformation, centromere cloning, functional minichromosomes, recombinant DNA, nucleo tide sequencing) LOUISE CLARKE, MOLLY FITZGERALD-HAYES, JEAN-MARIE BUHLER*, and JOHN CARBON

Department of Biological Sciences, University of California, Santa Barbara, California 93106; *Service de Biochemie, C.E.N Saclay, 91190 Gif-sur~Yvette, France

SUMMARY

Segments of Saccharomyces cerevisiae DNA have been iso lated that contain centromeric sequences (CEN3 and-CENll) from chromosomes III and XI. When present on a plasmid vector capable of replica~ion in yea~t (pLC544 or Yrp?), centromeric DNA e~ables _that p~asm"d t~ funct"on as an ordinary monosome (or extra d"some "f dupl"cated) "nan aneuploid yeast cell. Genetic markers on a "mini~hrom~so"!e" are stably maintained through mitosis and segregate "n me"os"s I and II as centromere-linked genes. Subcloning experiments have indicated that the functional centromeric sequences, CEN3 and CENll, are each confined to a unique segment of DNA less than one kilobase pair in length. The complete nucleotide sequence of the 627-base-pair CEN3 segment is presented, along with a preliminary structural com parison of this region with that contained on a 900-base-pair CENll fragment. These cloned centromere DNAs represent ex cellent probes for studying the molecular mechanism of chro mosome segregation in mitosis and meiosis.

INTRODUCTION

The centromere is one of the most important and least un derstood structural elements of the eukaryotic chromosome. The presence of a centromere ensures the stable maintenance and segregation of a chromosome through the complex processes of mitosis and meiosis, presumably by providing an attachment point for spindle fibers or membrane sites involved in chromo some movement.

The yeast, Saccharomyces cerevisiae, is an ideal organ ism for the study of centromere structure and function. Ex tensive genetic mapping analysis in yeast has identified several genes that are very closely linked to centromeres. 10 CLARKE, FITZGERALD-HAYES, BUHLER & CARBON

It is the typical meiotic segregation patterns exhibited by these markers that have established genetically the presence of functional centromeres on yeast chromosomes. Centromeric region DNA can be isolated by cloning these centromere-linked genes and obtaining flanking DNA segments by overlap hybridi zation screening (chromosome "walking"; CHINAULT & CARBON 1979). In addition, yeast chromosomes do not contain highly repetitive DNA sequences in the centromere regions, making possible the isolation of relatively long contiguous DNA seg ments by overlap hybridization screening of yeast genomic libraries. Autonomously replicating plasmid vectors are available that carry both bacterial and yeast replicators along with genetic markers for selection in either Escheri chia coli or yeast (STINCHCOMB et al. 1979; KINGSMAN et al. 1979). After insertion into a "shuttle vector," a segment of DNA can be assayed for centromere function in vivo by trans formation of yeast cells. Finally, yeast is particularly tolerant of additional chromosomes (aneuploidy), and will readily maintain synthetic minichromosomes containing a functional centromere plus a suitable replicator and genetic marker for selection.

In this paper we shall describe the isolation and genetic and biochemical characterization of functional centromeric DNA (GEN) from yeast chromosomes III and XI. Both centromeres are contained on unique DNA segments that are less than one kilo base pair in length, and either segment, when present on a plasmid carrying a yeast replicator, enables that plasmid to function as a chromosome both mitotically and meiotically. Minichromosomes containing a GEN sequence are stable in mitosis and segregate as ordinary yeast chromosomes in the first and second meiotic divisions. Thus, they are excellent model systems for the study of centromere function.

ISOLATION OF CENTROMERIC DNA (CEN3) FROM CHROMOSOME III Because the size and properties of yeast centromeric DNA were unknown, our initial approach to the isolation of a cen tromere involved the molecular cloning of genes that map on opposing sides of a centromere, followed by the subsequent isolation of all the DNA between the genes. Therefore, DNA segments from around the centromere-linked leu2, cdclO, and pgk loci on yeast chromosome III were obtained on hybrid plasmids by a number of techniques, including complementation of auxotropic mutations in E. coli (RATZKIN & CARBON 1977), overlap hybridization (CHINAULT & CARBON 1979), complementa tion of mutations in yeast through transformation (HINNEN et al. 1978; CLARKE & CARBON 1980a), and immunological screening (CLARKE et al. 1979; HITZEMAN et al. 1980). In this way, a contiguous region of about 25 kilobase pairs of DNA,extending from the LEU2 gene on the left of the centromere through the GDGlO gene on the right, was obtained on a set of over-1-a-pJc>ing plasmids (Fig. 1) (CHINAULT & CARBON 1979; CLARKE & CARBON 1980a; CLARKE & CARBON 1980b). Among these is the plasmid, pYe(GDGlO)l, which contains the yeast GDGlO gene included on an 8-kilobase-pair segment of yeast DNA. Within the limits of a standard Southern blot hybridization (SOUTHERN 1975), this YEAST CENTROMERES 11

DNA segment was shown to be unique in the yeast genome (CLARKE & CARBON 1980a) .. Plasmid pYe (CDClO) 1 was isolated by comple mentation of trpl and temperature-sensitive edelO mutations in yeast from a DNA recombinant library that contained random fragments of yeast DNA sealed with poly(dA•dT) connectors into the E. eoZi-yeast shuttle vector, pLC544 (CLARKE & CARBON 1980a). This vector consists of the yeast TRPl gene and the replicator, arsl, cloned into plasmid pBR313, and it transforms both trpC E. eoZi and trpl yeast auxotrophs to Trp+ with high efficiency (KINGSMAN et al. 1979).

/eu2 centrvmere PKk 1~----8cM------1-2cM-I LEU2 ___ _ CEN;---- CDC/()_____ ------PGK 21 kbD------l----l--- ->17kbp------l +--3-.4-----f-3-.6-+-l.4+--2.-s-+--3-_3----,~1.o-lf-1.2+---,3-_4-t-:-2_.,..6 --t,...0_9:'l--:-1.6-++IH-:-,-,-_3 t-----:-s.-=-o --ff-········ l1 ? 1 +----t---t--t-·· pYe(L£U2)10 in pYe57E2 +--+---+---,,....;.-,.... pYe 40C3 6 If ~ I 6.--K-·+· pYe 4682 .. ~--· pYe (CDC IO ) I --H'tr+-+------pYe98F4T ------pYe65H3T pYelOICJT

~ py e3 5 ---.1:::_::_::_::t,+-+-- pYe(CENJ) 11 ---

Unlike other arsl--bearing plasmids, which can replicate autonomously in yeast, but are mitotically very unstable, plasmid pYe(CDClO)l transforms appropriate yeast strains efficiently and is relative stably maintained through mitotic cell divisions in all the transformants. After 15 to 20 generations of nonselective growth, approximately 90% of cells that originally harbored pYe(CDClO)l still carry the plasmid (Table I), whereas the shuttle vectors Yrp7 (STINCHCOMB et al. 1979) or Yrp7' (TSCHUMPER & CARBON 1980), other arsl-con taining plasmids such as pYe98F4T, pYe65H3T, or pYel01C3T (Fig. 1), and plasmids carrying two ars elements are almost 12 CLARKE, FITZGERALD-HAYES, BUHLER & CARBON completely segregated under the same conditions (Table l; CLARKE & CARBON 1980b).

Table 1. Relative mitotic stabilities of plasmids in yeast Percentage of Trp+ or Leu+ cells Plasmid after 15-20 generations of non-selective growth

pYe(CDClO)l 97% pYe(CEN3)41 91% pYe(CEN3)30 55-89% pYe(MET14)2 60-85% pYe(CEN11)12 73-87% pYe(CEN11)5,10 64-72% pYe(arsl-ars2)1 5-8% YRp7(arsl) 1% YRp7' (arsl) 1% pYe98F4T 1-5% pYe65H3T 1-2% pYel01C3T 1-2%

Yeast strains XSB52-23Ca(ede10 gal leu2-3 leu2-112 trpl), Jl7a(adel his2 met14 trpl ura3) or RH218a(CUP1 gal2 mal SUC trpl) were transformed with the above plasmid DNAs and in each case several individual transformants were isolated and grown nonselectively overnight on YPD (rich) medium. Each culture was subsequently streaked for single colonies on YPD agar, allowed to grow for 2 days, and replica-plated onto minimal agar medium with or without tryptophan or leucine, depending on the marker carried by the plasmid. Beween 40 and 100 individual clones of each original transformant were scored for plasmid loss after nonselective growth. Preparations of media and transformation of yeast were carried out as de scribed by HSIAO and CARBON (1979).

Because stability in mitosis is a predicted property of a replicating unit carrying a functional centromere, the unique mitotic stability of pYe(CDClO)l led us to examine the behav ior of this plasmid through meiosis and sporulation. Yeast strain XSB52-23Ca/pYe(CDC10)l(ede10 leu2 trpl/CDC10/TRP1) was crossed with X2928-30-1Aa(trpl leul adel met14), diploids were sporulated,and the resulting asci were dissected for genetic analysis. Data from 16 tetrads (cross 1, Table 2) indicate that the plasmid (marked by the wild type TRPl allele) in at least 60% of the asci segregates in the first meiotic division as a chromosome,and is thus found in the two sister spores, the products of the second meiotic division. Only parental ditype and nonparental ditype asci were obtained in this cross using as reference centromere markers leul, leu2, met14, and adel (complete data not shown). Thus the TRPl allele on the plasmid behaves as a centromere-linked marker. The TRPl gene on pYe(CDClO)l is unlinked to adel, edelO, leul, leu2 or met14 and is, therefore, not integrated on chromosomes I, III,

w w

I-' I-'

~ ~

Gl Gl t%J t%J

z z 8 8

t%J t%J

Cll Cll

8 8

>-<: >-<:

() ()

Cll Cll :i., :i.,

es es

spore spore

with with

and and

of of

ND, ND,

centro-

low low

4. 4.

of of

marker marker

Trans

TRPl) TRPl)

(chromosome) (chromosome)

trpl trpl

trpl/CDCl0 trpl/CDCl0

group group

Jl7a/ Jl7a/

mere mere

6, 6,

trpl); trpl);

the the

LEUl(VII) LEUl(VII)

ADEl(I) ADEl(I)

met14 met14

Reference Reference

TRPl(IV) TRPl(IV)

MET14(XI) MET14(XI)

tetratype; tetratype;

extremely extremely

5 5 +

proportion proportion

gal/CDCl0 gal/CDCl0

from from

T, T,

petB petB

minichromosome minichromosome

the the

his2 his2

1 1

I I

T T

Zl361-l-13C. Zl361-l-13C.

ND ND

by by

trpl trpl

high high

the the

leu2 leu2

leu2-112 leu2-112

a a

linkage linkage

(adel (adel

trpl-1); trpl-1);

6 6 1

on on

ditype; ditype;

with with

14 14

in in

NPD NPD

his6 his6

eliminated eliminated

marker marker

leul leul

leu2-3 leu2-3

type type

leu2-112 leu2-112

6 6 8 3

2 2 8 0

3 3

9 9

7 7 6 0

4 4 6 0

4 4 3

minichromosome minichromosome

his2 his2

recognized recognized

ND ND ND

PD PD

were were

results results

gall gall

wild wild

Centromere Centromere

of of

cdcl0 cdcl0

ura3/TRP1) ura3/TRP1)

leu2-3 leu2-3

nonparental nonparental

way way

canl canl

was was

adel adel

easily easily

1978) 1978)

trpl trpl

Jl7a/pYe(CEN11)12 Jl7a/pYe(CEN11)12

this this

NPD, NPD,

arg9 arg9

25%) 25%)

21%) 21%)

(21%) (21%)

(5%) (5%)

al. al.

are are

minichromosomes minichromosomes

in in

7. 7.

3(13%) 3(13%)

5 ( ( 5

5(31%) 5(31%)

0+:4-

4 4

1 1

10(27%) 10(27%)

12(23%) 12(23%)

of of

et et

met14 met14

of of

and and

ditype; ditype;

0 0

0 0 ( 4

his2 his2

0 0

2(5%) 2(5%)

2(3%) 2(3%)

Diploids Diploids

1(5%) 1(5%)

minichromosome minichromosome

l+:3-

1(5%) 1(5%)

tetrads tetrads

(HINNEN (HINNEN

strain, strain,

Zl36-l-13C; Zl36-l-13C;

X3144-1Da(ade2 X3144-1Da(ade2

the the

in in

(adel (adel

Zl36-l-13Ca(arg4-2 Zl36-l-13Ca(arg4-2

(58%) (58%)

parental parental

SB17Ba/pYe(CDC10)1(adel SB17Ba/pYe(CDC10)1(adel

segregation segregation

minichromosome minichromosome

8(40%) 8(40%)

38(72%) 38(72%)

2+:2-

1979). 1979).

17(46%) 17(46%)

10(46%) 10(46%)

10(52%) 10(52%)

13(63%) 13(63%)

11 11

10(63%) 10(63%)

glycol glycol

2. 2.

with with

on on

PD, PD,

with with

follow follow

haploid haploid

al. al.

XSB52-23Ca/pYe(CDClO)l(cdc10 XSB52-23Ca/pYe(CDClO)l(cdc10

a a

0 0

to to

Meiotic Meiotic

et et

TRPl) TRPl)

3(8%) 3(8%)

3(13%) 3(13%) 2(15%) 2(15%)

3(14%) 3(14%)

ura3); ura3);

3+:1-

I. I.

1(5%) 1(5%)

1(2%) 1(2%)

marker marker

Distribution Distribution

2. 2.

with with

used used

crosses. crosses.

trpl trpl

ura3/TRP1) ura3/TRP1)

polyethylene polyethylene

(13%) (13%)

(6%) (6%)

Jl7a/pYe(CEN11)10 Jl7a/pYe(CEN11)10

0 0

were: were:

6(27%) 6(27%)

5 5

3(16%) 3(16%)

3(14%) 3(14%)

4(20%) 4(20%)

Table Table

4(21%) 4(21%)

1 1

4+:0-

(KINGSMAN (KINGSMAN

of of

above above

trpl trpl

8. 8.

ura3/MET14 ura3/MET14

marker marker

crossed crossed

met14 met14

the the

a/a) a/a)

the the

trpl trpl

are are

crosses crosses

leul leul

XSB52-23Ca/pYe(CEN3)41 XSB52-23Ca/pYe(CEN3)41

gal); gal);

met14 met14

in in

or or

presence presence

3. 3.

The The

they they

TRPl TRPl

LEU2 LEU2 TRPl TRPl

TRPl TRPl

his2 his2

scored scored

met14 met14

marker marker

Mini-

(a/a (a/a

used used

crosses crosses

the the

chromosome chromosome

in in

when when

his2 his2

gall gall

(adel (adel

RH218a(trpl RH218a(trpl

above above

parents. parents.

in in

yeast yeast

(adel (adel

the the

X2928-3D-1Aa; X2928-3D-1Aa;

with with

obtained obtained

of of both both

cross cross

transformants transformants

all all

in in

with with

In In

determined. determined.

pYe(CENll)l0 pYe(CENll)l0

pYe(CEN11)12 pYe(CEN11)12

pYe(MET14)2 pYe(MET14)2

pYe(CDCl0)l pYe(CDCl0)l

pYe(CEN3)30 pYe(CEN3)30 pYe(CECl0)l pYe(CECl0)l

pYe(CEN3)41 pYe(CEN3)41

Genetic Genetic

formation formation

X2928-3D-1Aa(adel X2928-3D-1Aa(adel

not not

haploid haploid

pYe(MET14)2 pYe(MET14)2

Jl7a/pYe(CEN3)30 Jl7a/pYe(CEN3)30

viability viability

7. 7.

6. 6.

2. 2.

diploid diploid 8. 8.

ura3/TRP1) ura3/TRP1) 5. 5.

3. 3.

TRPl) TRPl)

4. 4.

mutant mutant

Minichromosome Minichromosome 1. 1. 14 CLARKE, FITZGERALD-HAYES, BUHLER & CARBON

VII or XI. The plasmid was completely lost in about 30% of the asci in cross 1 (Table 2), and in one ascus was found in all four spores. Other aneuploid crosses and backcrosses of this nature employing strains carrying pYe(CDClO)l yielded similar results (cross 2, Table 2; CLARKE & CARBON 1980b). None of the asci analyzed in any cross consisted of 2 viable and 2 nonviable sister spores. Thus the minichromosome does not appear to pair with any of the other yeast chromosomes. We conclude, therefore, from the data presented above that pYe(CDClO)l contains functional centromeric DNA (CEN3) from chromosome III. ISOLATION OF CENTROMERIC DNA (CEN11} FROM CHROMOSOME XI Genetic mapping data have established that the met14 locus in yeast is very tightly linked to the centromere of chromosome XI (MORTIMER & HAWTHORNE 1975). In experiments analogous to those previously described with pYe(CDClO)l, a plasmid pYe(MET14)2 was isolated by complementation of trpl and met14 lesions in yeast from a pool of hybrid plasmid DNAs consisting of Sau3A partial digestion products of total yeast DNA cloned into the BamHl site of the TRPl-arsl shuttle_ye~tor, Y-rp-"7- (-STI-NCHCOMB--e1:aI-.- r979; NASMYTH & REED 1980; FITZGERALD HAYES, M., BUHLER, J.-M., COOPER, T.G. AND J. CARBON, manu script in preparation). Plasmid pYe(MET14)2 carries a 5.2- kilobase-pair insert which encodes the MET14 gene as well as a segment of DNA that behaves in a fashion analogous to CEN3.

The data summarized in Table 1 indicate that pYe(MET14)2 is mitotically stable in the host and is maintained through many generations of nonselective growth. The plasmid segre gates in the majority of asci analyzed in aneuploid crosses as an ordinary chromosome in both the first and second meiotic divisions (crosses 5 & 6, Table 2). The marker on the plasmid behaves as a centromere-linked marker and is unlinked to other reference centromere markers in the crosses. We thus conclude that pYe(MET14)2 carries centromeric DNA (CENll) from yeast chromosome XI. The 8-kilobase-pair DNA segment from pYe(CDClO)l does not hybridize in blot hybridization experiments to the 5.2-kbp segment from pYe(MET14)2 (HSIAO & CARBON 1981). The two minichromosomes do not, therefore, carry yeast segments with extensive regions of homology. SUBCLONING EXPERIMENTS TO LOCALIZE AND DEFINE CEN FUNCTION A number of subcloning experiments were carried out to determine the location of the GEN elements on pYe(CDClO)l and pYe(MET14)2. A 2-kilobase-pair DNA segment was excised from plasmid pYe(CDClO)l with the restriction enzymes BamHl and HindIII. The BamHl site of this fragment is derived from the leftmost BamHl site- in the yeast DNA insert of pYe(CDClO)l (see Fig. 2), and the HindIII site is derived from_ a _ H_indII.I - sr-t:e- irr-tne vector portion (pLC544), located about 400 base pairs from the end of the insert of yeast DNA. The 1.6-kbp segment of yeast DNA, which is thus included on the 2-kbp BamHl-HindIII fragment, was inserted into the LEU2-arsl-pBR322 shuttle vector, pGT12 (TSCHUMPER & CARBON 1980), also cut with YEAST CENTROMERES 15

BamHl and HindIII. The resulting plasmid, pYe(CEN3)41, trans forms Zeu2 yeast strains to Leu+ with high frequency, yielding transformants that are all mitotically stable (Table l; CLARKE & CARBON 1980b). In appropriate crosses, this plasmid behaves in a fashion analogous to the parent pYe(CDClO)l, is not integrated anywhere in the yeast genome as confirmed by South ern blot analysis (SOUTHERN 1975; CLARKE & CARBON 1980b), and thus carries CEN3 function on a 1.6-kilobase-pair segment of DNA (cross 3, Table 2). Similarly, a 627-base-pair Sau3A BamHl portion of the 1.6-kilobase-pair segment (illustrated in Fig. 2), when inserted into the BamHl site of Yrp7' to yield plasmid pYe(CEN3)30, also retains total CEN3 function (Tables 1 and 2), allowing pYe(CEN3)30 to be stably maintained mitot ically and segregate properly through meiosis. Additional subcloning, deletion, and directed mutagenesis experiments are in progress to further delineate the boundaries of CEN3 func tion.

CEN3 CDC IO YEAST CHROMOSOME 2.6 kb 0.9 1.6 kb 1.3kb III

··----6-~--f-+~-+--+- pYe (CDC IO) l

---11~ pYe(CEN3)4l

X HindIII pYe(CEN3)30 (627 bp) + EcoRI l:i. BamHI o Sau3A Fig. 2. Subcloning experiments to localize CEN3 function. Centromeric function analogous to that contained on the orig inal pYe(CDClO)l plasmid is retained on the 627-base-pair (bp) Sau3A-BamHl fragment shown. Only selected Sau3A sites are in cluded in the figure.

The 5.2-kilobase-pair insert of pYe(MET14)2 has also been reduced in size through successive subclonings (Fig. 3) to yield a 3.4-kbp BamHl-Sau3A fragment cloned in Yrp7' (pYe (MET14)27), a 1.6-kbp SaZI fragment (pYe(CEN11)12), and fi nally a 900-base-pair Sau3A fragment cloned in both orienta tions in Yrp7' (pYe(CEN11)5,10), all of which retain full CENll function with regard to mitotic stability and meiotic segregation (Table l; crosses 7 & 8, Table 2). Thus both CEN3 and CENll elements are contained on DNA segments that are less than one kilobase pair in length.

All the minichromosomes studied and described above con- 16 CLARKE , FITZGERALD-HAYES, BUHLER & CARBON

tain both a GEN element and the replicator segment, ars l . The need for a chromosomal replicator, such as ar sl or ars 2, for proper GEN function has been demonstrated, since GENS plasmids lacking an ars replicate poorly and are extremely unstable mitotically (CLARKE & CARBON 1980b) . A replicator must, therefore, accompany a GEN segment to permit centromere func tion, but the replicator alone, or a combination of replica tors do not stabilize a plasmid mitotically (Table 1).

CEN 11 (MET 14?) YEAST 1.4 1.6 I.I CHROMOSOME ~b~l( \E kb ikbi IO>-➔l(.....+I----t--ii~--lE11-r:ti.1------X_I __ _

~ p Ye ( MET 14) 2

~l( !( 10 pYe( MET1 4)27

X HindIII i_i pYe(CEN11)12 + EcoRI t,. BamHI i Sall 0--0 pYe(CEN l 1)5, 10 o Sau3A Fig. 3. Subcloning to localize GENll function . GENll function is contained on a 900-base-pair Sau 3A fragment excised from the 5 . 2-kbp insert carried by the original plasmid, pYe( MET14 )2 . The exact location of the MET14 gene on pYe( MET14 )2 is un c e rtain . Only sele cte d Sau 3A sites are indicate d.

The small circular chromosomes we have constructed have many properties that mimic the much larger parental chromo somes . They are stable in mitosis and, in most cases, segre gate as chromosomes in the first and second meiotic divisions. The small GEN segments are capable, therefore, of controlling copy number, thereby ensuring proper mitotic and meiotic segregation . In about 20-25% of the tetrads analyzed in crosses involving GEN plasmids the minichromosome is lost completely, the percentage varying somewhat among the crosses (Table 2). Generally, in yeast strains that are aneuploid for one or more chromosomes, the extra chromosomes are also some what unstable, although not always to the same degree shown by the circular minichromosomes (PARRY & COX 1971) .

In approximately 20 % of the tetrads examined from the crosses, the minichromosome is found in all four spores after meiosis (Table 2) . This may be caused by diploidization of the plasmid resulting from nondisjunction during mitotic growth of the haploids or diploids in the cross, or may in dicate loss of control of minichromosome replication . In YEAST CENTROMERES 17 several experiments, however, where more than one diploid from the same cross was sporulated and asci subsequently dissected, one diploid gave the 20% 4+:0- pattern, whereas another yielded no 4+:0- asci at all among 53 tetrads dissected (line 5, Table 2). Thus the presence or absence of 4+:0- asci seems to depend on the particular diploid colony from the cross , picked for sporulation. Apparently, diploidization of the rninichrornosorne occurs randomly and at relatively low frequency during growth of the yeast diploid culture. SEGREGATION PATTERNS OF TWO MINICHROMOSOMES IN THE SAME CROSS The genetic data show that rninichrornosornes do not pair with any of the normal yeast chromosomes, since asci contain ing two nonviable sister spores are not seen. However, in crosses involving two rninichrornosornes, each containing CEN3, but each carrying a different marker (LEU2, TRPl or ARG4) so that they might be followed individually (crosses 1 & 2, Table 3), the rninichrornosornes exhibit a strong preference to migrate to opposite poles in the first meiotic division. Also, as seen in Table 3, in the relatively rare cases where two mini chromosomes go to the same pole in meiosis I, they are not· physically linked in any way, since in backcrosses 3 and 4 (Table 3) they again segregate from each other and show a preference for migration to opposite poles. The same prefer ence for migration to opposite poles in meiosis I is seen when two rninichrornosornes, each carrying a different centrornere (CEN3 and CENll) and a different marker, are segregating in the same cross (cross 5, Table 3).

Table 3. Do rninichrornosornes pair in meiosis I?

In meiosis I Minichrornosornes in Marker Sarne pole Opp. pole cross followed (NPD) (PD)

pYe(CEN3)41 LEU2 2 17(89%) (1) X pYe(CDC10)1-(CEN3) TRPl

pYe(CDC10)1-(CEN3) TRPl 2 18(90%) (2) X pCL3- (CEN3) ARG4

Back-cross of TRPl 9 27(75%) (3) NPD progeny from ARG4 cross #2

(4) 3 9(75%)

pYe(MET14)2-(CEN11) TRPl 7 23(77%) (5) X pCL3- (CEN3) ARG4

The crosses were: (1) XSB52-23Ca/pYe(CEN3)41(cdc10 leu2- 3 leu2- 112 trpl gal/LEU2) with SB17Aa/pYe(CDC10)l(adel cdclO 18 CLARKE , FITZGERALD-HAYES, BUHLER & CARBON

leu2 - 3 leu2-112 met14 trpl/CDCl0 TRPl ); (2) SB-7980-lA/pYe (CDCl0 )l (arg4 - 2 adel cdcl0 trpl/TRPl CDCl0) with SB-7980-4B/ pCL3(arg4-2 leul trpl/ARG4); (3) SB-81380-2B/pYe (CDC10 )1/pCL3 (arg4- 2 leul trpl/CDCl0 TRP1/ARG4 ) with SB-81380-2D(arg4 - 2 adel trpl ); (4) SB-81380-20A/pYe( CDC10 )1/pCL3(arg4- 2 leul trpl/CDCl0 TRP1/ARG4 ) with SB-81380-20B(arg4-2 adel trpl ); (5) SB-8780-4B/pYe( MET14 )2(arg4 - 2 adel met14 trpl/MET14 TRPl ) with SB-7980-4B/pCL3(arg4-2 leul trpl/ARG4 ) . Only those tet rads where both minichromosomes segregated 2+ :2- are included in the above data; the percentages of total tetrads in this class are as follows : (1) 45%; (2) 59 %; (3) 69%; (4) 43 %; (5) 49% (see CLARKE & CARBON 1980b for details). In the re maining tetrads, one or both minichromosomes segregated 0+:4- or 4+:0-.

In all the crosses involving two minichromosomes, the plasmids used carry homologous DNA sequences, either CEN sequences, vector (pBR322) sequences, or both. Experiments are now underway to investigate this "pairing" property with minichromosomes carrying different centromeres and no addi tional homologous DNA sequences . Unlike the parental chromo somes, the small circular chromosomes do not always "pair," but as is the case in sporulating aneuploid yeast strains, absence·of pairing does not prevent the chromosomes from s egregating in meiosis. NUCLEOTIDE SEQUENCE OF THE 627-BASE-PAIR CEN3 FRAGMENT Detailed restriction maps have been constructed for both the 627-base-pair CEN3 and the 900-base-pair CENll segments described above. As shown in Figure 4, these two segments have no obvious pattern of sites in common, but both contain a region of 250 to 300 base pairs that contains no sites for 25 to 30 restriction enzymes tested. As is indicated below and in Figure 5, this region in CEN3 is very A+T rich.

The complete nucleotide sequence of the CEN3 fragment shown in Figure 5 was determined using both the rapid sequenc ing techniques of MAXAM and GILBERT (1980) and the dideoxy procedures described by SANGER and colleagues (SANGER et al. 1977; SMITH 1979) . One striking feature of the sequence is the extremely A+T rich region between nucleotide pairs 75 and 170 . Approximately 90% of the base pairs in this area are A•T pairs organized into blocks or runs of A or T . This region may be folded into the stem and loop structure seen in Figure 6, but there is no evidence as yet that such a structure plays a role in centromere function or even exists. Computer anal ysis has not revealed other regions of obvious secondary structure or direct or inverted repe at seq uences of a length greater than 9 or 10 base pairs. There is one small open reading frame in the top strand o f the sequence between nu cleotide pairs 223 and 379 with a coding capacity of 52 amino acids .

As discussed previously, Southern blot hybridizations to total genomic DNA indicate that the CEN3 fragment is unique YEAST CENTROMERES 19

and not repeated in the yeast genome (CLARKE & CARBON 1980a). Similar hybridizations show no cross homology of GEN3 with GENll (HSIAO & CARBON 1981). Preliminary sequence data ob tained for the GEN l l segment do reveal at least four limited regions of homology with GEN3 , however, the largest of which contains only 14 contiguous base pairs. Interestingly, three of these homologous regions are in the same relative order in the two centromeres and show the same relative spacing. Two of the homologous regions flank extremely A+T rich regions in both GEN elements, and one of these also has limited sequence homology with the Drosophila melanogas t er 1.688 g / cm 3 satel lite DNA (HSIEH & BRUTLAG 1979). Because 1.688 g/ cm 3 satel lite DNA is confined primarily to the centromere region of the sex chromosomes(HSIEH & BRUTLAG 1979), the intriguing possi bility is raised that centromere regions are in fact similar among different species. A number of experiments are now in progress to test whether yeast GEN elements will function in other organisms.

CEN3 A+ T Rich Region

o• )( .)( I )E i )( 6. CEN3 (627 bp)

i i 6-D )( □ ... •I )(. 0 CEN 11 ( ~900 bp)

A Hhal t Hphl • Alul Hinfl X Rsal 0• Sau3A + Fnudll t::. BamHI D Hincll Fig. 4. Comparison of the restriction maps of GEN3 and GEN l l segments. Both segments contain regions of 250 to 300 base pairs that lack sites for 25-30 different restriction enzymes. This region in the GEN 3 sequence is extremely A+T rich.

CONCLUSIONS We have identified small DNA elements from S . cerevisiae chromosomes III and XI that behave as functional centromeric DNA when pre sent on plasmids containing a yeast replicator segment (ars). These circular minichromosomes carrying func tional centromeres are stable in mitosis, and in most cases, segregate properly in the first and second meiotic divisions. N 0 Sau3A AZuIAluI RsaI . . . . • . • • . 100 GATCAGCGCCAAACAATATGGAAAATCCACAGAAAGCTAGCTTCATTGAAAAAATAGTACAAATAAGTCACATGATGATATTTGATTTTATTATATTTTT CTAGTCGCGGTTTGTTATACCTTTTAGGTGTCTTTCGATCGAAGTAACTTTTTTATCATGTTTATTCAGTGATACTACTATAAACTAAAATAATATAAAA I 200 AAAAAAAGTAAAAAATAAAAAGTAGTTTATTTTTAAAAAATAAAATTTAAAATATTAGTGTATTTGATTTCCGAAAGTTAAAAAAGAAATAGTAAGAAATn TTTTTTTCATTTTTTATTTTTCATCAAATAAAAATTTTTTATTTTAAATTTTATAATCACATAAACTAAAGGCTTTCAATTTTTTCTTTATCATTCTTTAf;;: 300 1:l t'l ATATATTTCATTGAATGGATATATGAAACGTTTACTGGTGGAACTTTTGCTCATATATTATTATTCAATAGAAGTAATAAAGAAAAAGTTGGTAAAGCAA TATATAAAGTAACTTACCTATATACTTTGCAAATGACCACCTTCAAAACGAGTATATAATAATAAGTTATCTTCATTATTTCTTTTTCAACCATTTCGTT"l H >-,3 DdeIAluI RsaI RsaI N G) 400 t'l CTTAACAGTAAAAAGGTAATGATTGAAAAAGTTTTTGAACATCTAAGCTATATGTTGATGGGTTTACAATTTTACCATTAGTACTCATGCCTAGTACTTT GAATTGTCATTTTTCCATTACTAACTTTTTCAAAAACTTGTAGATTCGATATACAACTACCCAAATGTTAAAATGGTAATCATGAGTACGGATCATGAAA~ tl I FnudII RsaI Hiner HincII 500 ~ t'l TCTGTTCGTCCTTAATGTCCGCGATTTAGAGCAATCATTGAAAGTACTAGATACATTTTAGCCAGAGAGGACTCGTTGACGTAGAATTAAAATTCAAATGCll AGACAAGCAGGAATTACAGGCGCTAAATCTCGTTAGTAACTTTCATGATCTATGTAAAATCGGTCTCTCCTGAGCAACTGCATCTTAATTTTAAGTTTAC t:D C: MboII RsaI ::i: ta -.-- 600 t'l AATTTCCGCCCCATTCATATACCCCAAATAACAAACATATTAAAACTTCATAATTATTCAAAATGTGGAGTAGTAATAGAAGAGCAGTACCTTCAAAATT!:U TTAAAGGCGGGGTAAGTATATGGGGTTTATTGTTTGTATAATTTTGAAGTATTAATAAGTTTTACACCTCATCATTATCTTCTCGTCATGGAAGTTTTAAll" n MboII BamHI :i,, --~ 627 6l GATTTCTTCAGTTTCCCACCCGGGATC(C) ~ CTAAAGAAGTCAAAGGGTGGGCCCTAG(G)

Fig. 5. Nucleotide sequence of the centromeric region from yeast chromosome III (627-base-pair frag ment). Numbers refer to the upper strand,which is oriented 5' to 3', left to right. Restriction sites are indicated and overlined. The high A+T region extends from the Rsal site at nucleotide 57 to the DdeI site at nucleotide 343. Region 1-100 is 72% A+T; 101-200 is 87% A+T; 201-300 is 75% A+T. YEAST CENTROMERES 21

AAAGT~ ~~~~~T~~~AAG AAAAT TTTTTATTTGAT T•A T•A T•A AT•A T I AT·A T·A A·T T·A T•A T·A T•A A·TT G T T•AA T•A T•A A•T T•A 5' A·T 3' GTCACATGATG TAGTGTATTTGATTTCCGAAAGTTA , cAGi-Gi-Aci-Ac Ai-cAcA;-,.;.,;.;..c+;.,.;.;..GGci-i-i-cAAi- , 3 . T•A 5 A·T T•A A•T A•T A•TT C A T•AA A•T A•T A•T A•T T•A A•T TA•T A I TA•T A•T A•T A•T TTTTT~ ~~~~~T~~~CTA TTcAT TTTTTATTTTTC

Fig. 6. Possible secondary structure configuration for nucleotide pairs 78 through 155 of the CEN3 sequence. This hypothetical stem and loop structure is comprised of a con tiguous region of base pairs found in the extremely A+T rich portion of the CEN3 sequence. The ~G calculated for the structure is approximately -15 Kcal/mole (TINOCO et al. 1973).

Taking advantage of the unique mitotic stability of CEN plasmids, a procedure has recently been developed that permits 22 CLARKE, FITZGERALD-HAYES, BUHLER & CARBON

the isolation of centromeric DNA directly from yeast DNA recombinant libraries (HSIAO & CARBON 1981). By direct selec tion in yeast for mitotic stabilization of unstable ars plas mids, DNA segments containing CEN3 and CEN11 have been re isolated from hybrid p lasmid DNA pools, and other unique DNA elements that behave in an identical manner to CEN3 and CEN11 have also been identified. Therefore, a number of centromere DNAs from yeast are now available for comparative studies. This selection procedure could also be applicable for the isolation of centromeres (or mitotic stabilizing DNA segments) from other organisms.

The GEN -containing minichromosomes are excellent probes into the events occurring in mitosis and meiosis, particularly with regard to protein-nucleic acid interactions occurring between the centromere and mitotic and meiotic spindle struc tures. They should provide key information about the struc tural organization of centromeric regions, a major step toward the goal of understanding the molecular mechanism of chromo some segregation.

ACKNOWLEDGEMENTS The authors thank Dr. Terrance G. Cooper for many produc tive discussions about the genetic data and for helping to initiate the CEN11 isolation. This research was supported by · a grant (CA-11034) from the National Cancer Institute, NIH.

LITERATURE CITED

CHINAULT, A.C. and J. CARBON 1979 Overlap hybridization screen ing : Isolation and characterization of overlapping DNA fragments surrounding the leu2 gene on yeast chromosome III. Gene 5 : 111-126. CLARKE, L. and J. CARBON 1980a Isolation of the centromere linked CDC10 gene by complementation in yeast. Proc. Nat. Acad . Sci. U.S.A. 77 : 2173-2177. CLARKE, L. and J. CARBON 1980b Isolation of a yeast centromere and construction of functional small circular chromosomes. Nature 287 : 504-509. CLARKE, L., HITZEMAN, R.A. and J, CARBON 1979 Selection of specific clones from colony banks by screening with radio active antibody. Meth. Enzym. 68 : 436-442. HINNEN, A., HICKS, J.R. and G.R. FINK 1978 Transformation of yeast. Proc. Nat. Acad. Sci. U.S.A. 75: 1929-1933. HITZEMAN, R.A., CLARKE, L. and J. CARBON 1980 Isolation and characterization of the yeast 3-phosphoglycerokinase gene (P GK ) by an immunological screening technique. J. Biol. Chem. 255 : 12073-12080. HSIAO, c.-L. and J. CARBON 1979 High frequency transformation of yeast by plasmids containing the cloned yeast AR04 gene. Proc . Nat. Acad. Sci. U.S.A. 76 3829-3833 . HSIAO, C.-L. and J. CARBON 1981 A direct selection procedure for the isolation of fundtional centromeric DNA. P~oc. Nat. Acad. Sci. U.S.A., in press. YEAST CENTROMERES 23

HSIEH, T. and D. BRUTLAG 1979 Sequence and sequence variation within the 1.688 g/cm 3 satellite DNA of Drosophilia melano gaster. J. Mol. Biol. 135: 465-481. KINGSMAN, A.J., CLARKE, L. MORTIMER, R.K. and J. CARBON 1979 Replication in Saccharomyces cerevisiae of plasmid pBR313 carrying DNA from the yeast trpl region. Gene 7: 141-152. MAXAM, A.M. and W. GILBERT 1980 Sequencing DNA by labeling the end and breaking at bases: DNA segments, end labels, cleav age reactions, polyacrylamide gels, and strategies. Meth ods Enzymol. 65: 499-560. MORTIMER, R.K. and D.C. HAWTHORNE 1975 Genetic mapping in yeast. Meth. Cell Biol. 11: 221-233. NASMYTH, K.A. and S.I. REED 1980 Isolation of genes by comple mentation in yeast: Molecular cloning of a cell-cycle gene. Proc. Nat. Acad. Sci. U.S.A. 77: 2119-2123. PARRY, E.M. and B.S. COX 1971 The tolerance of aneuploidy in yeast. Genet. Res. 16: 333-340. RATZKIN, B. and J. CARBON 1977 Functional expression of cloned yeast DNA in Escherichia coli. Proc. Nat. Acad. Sci. U.S.A. 74: 487-491. SANGER, F., NICKLEN, s. and A.R. COULSON 1977 DNA sequencing with chain terminating inhibitors. Proc. Nat. Acad. Sci. U.S.A. 74: 5463-5467. SMITH, A.J.H. 1979 The use of exonuclease III for preparing single stranded DNA for use as a template in the chain terminator sequencing method. Nuc. Acids Res. 6: 831-848. SOUTHERN, E.M. 1975 Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98: 503-517. STINCHCOMB, D.T., STRUHL, K. and R.W. DAVIS 1979 Isolation and characterization of a yeast chromosomal replicator. Nature 282: 39-43. TINOCO, I., BORER, P.N., DENGLER, B., LEVINE, M.D., UHLENBECK, O.C., CROTHERS, D.M. and J. GRALLA 1973 Improved estimation of secondary structure in ribonucleic acids. Nature New Biol. 246: 40-41. TSCHUMPER, G.J. and J. CARBON 1980 Sequence of a yeast DNA fragment containing a chromosomal replicator and the TRPl gene. Gene 10: 157-166. 24 STADLER SYMP . Vol. 13 (1981) University of Missouri, Columbia

John Carbon at an informal discussion session of the Symposium