Zootaxa 4169 (1): 179–186 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2016 Magnolia Press ISSN 1175-5334 (online edition) http://doi.org/10.11646/zootaxa.4169.1.10 http://zoobank.org/urn:lsid:zoobank.org:pub:0B9BA229-A1B1-4552-A933-9BFF363EE485 A new Peritrich Ciliate from a Hypersaline Habitat in Northern China

YUAN ZHUANG1, JOHN C. CLAMP2, ZHENZHEN YI3 & DAODE JI1, 4 1Ocean School, Yantai University, Yantai 264005, China 2Department of Biological and Biomedical Sciences, North Carolina Central University, Durham, NC 27707, USA 3Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, South China Normal University, Guangzhou 510631, China 4Corresponding author. E-mail: [email protected]

Abstract

A new peritrichous ciliate, Cothurnia salina n. sp., collected from a brine pond of a salt factory in Yantai, China, was in- vestigated based on live observations, silver staining method and molecular phylogenetic analysis. The diagnosis for this new taxon: body elongated columnar, in vivo 80–98 × 12–19 µm; lorica barrel-shaped, with aboral part heavily thickened; stalk extremely short, with approximately ½ of its length within the lorica; macronucleus wormlike, longitudinally orient- ed; single contractile vacuole ventrally located; pellicle with conspicuous parallel transverse striations, 62–73 from aboral trochal band to peristome and 32–38 from aboral trochal band to scopula; infundibular polykinety 3 (P3) consisting of two ciliary rows, which are equal length, parallel to each other and terminate adstomally between P1 and P2. Small subunit (SSU) rRNA gene trees revealed that the new species clustered with other members of the family Vaginicolidae as expect- ed.

Key words: morphology, phylogeney, hypersaline, ciliate, Peritrichia, Cothurnia

Introduction

Ciliates are a large, diverse group of protists and are known from a wide variety of aquatic and terrestrial habitats. There are over 15 species of ciliates from a broad range of higher taxa have been found in moderately hypersaline (40–80‰) environments (Esteban & Finlay 2003); however, species rarely appear to inhabit extremely (80‰– 340‰) hypersaline environments (Cho et al. 2008). The genus Cothurnia is one of the largest genera of peritrichs, and contains over 90 nominal species (Kahl 1933, 1935; Küsters 1974; Warren & Paynter 1991). Unfortunately, only a few of them have been well-described based upon both live observations and silver impregnation methods (Foissner et al. 1992, 2009; Norf & Foissner 2010). During a survey of ciliate fauna in Yantai coast, a species of Cothurnia was collected from a brine pond of a salt factory, with salinity up to 120‰. Careful morphological investigation and comparison with similar congeners revealed it as new to science; consequently, it is named Cothurnia salina n. sp. and the present paper provides its description as well as an analysis of its phylogenetic position.

Material and methods

Collection and isolation of samples. Cothurnia salina n. sp. was found several times in the years 2010–2011 in a brine pond in Yantai, China (37°25'33.80"N, 121°45'14.20"E). Samples were collected with framed slides, which were immersed in water for 10 days before being retrieved for examination. Slides with ciliates attached were transferred to Petri dishes, and individual ciliates were detached from the slide surface using microdissecting needles under a stereo-microscope.

Accepted by M. Shin: 15 Aug. 2016; published: 19 Sept. 2016 179 Morphological methods. The morphology of living and fixed specimens of Cothurnia salina n. sp. was observed with an optical microscope (Olympus DP72) at magnifications of 40× – 1000×. Protargol staining (Wilbert 1975) was used to reveal the infraciliature. Illustrations were done by direct observation and from photomicrographs. Terminology and classification follow Warren (1986) and Ji et al. (2015). DNA extraction, PCR amplification and sequencing. Genomic DNA was extracted using the RED Extract- N-Amp Tissue PCR Kit (Sigma, St. Louis, USA) following the manufacturer’s instructions, except that the reaction volume was reduced to on-tenth of that suggested (Gong et al. 2007). DNA samples were stored at -20°C (Yi et al. 2008). The universal eukaryotic forward primer 18S−82F (5′−GAAACTGCGAATGGCTC−3′) and reverse primer 18S−EukB (5′−TGATCCTTCTGCAGGTTCACCTAC−3′) were used to amplify the SSU rRNA gene (Medlin et al. 1988). Cycling parameters were as follows: 3 min at 95°C followed by 35 cycles comprising 30 s at 95°C, 15 s at 56°C, 1 min 30 s at 72°C. This was followed by a final extension of 10 min at 72°C. Cloning and sequencing were performed according to Miao et al. (2011) and Chen et al. (2014). Phylogenetic analysis. The SSU rRNA sequence of the new species and 47 related SSU rRNA sequences obtained from the NCBI database (http://www.ncbi.nlm.nih.gov/) were aligned using ClustalW implemented in BioEdit version 7.0.0 (Hall 1999), followed by allowed half gap positions using Gblocks v0.91b (Castresana 2000). The best-fit model GTR + I (=0.4119) + G (=0.4745), selected by MrModeltest v2.2 (Nylander 2004), was used to construct a Bayesian Inference (BI) tree using MrBayes v3.2.2 (Ronquist & Huelsenbeck 2003). The species Ichthyophthirius multifiliis, Glaucoma chattoni, Tetrahymena australis and Tetrahymena nanneyi were selected as the outgroup taxa and their sequences were retrived from the GenBank. Four Markov Chain Monte Carlo chains (one cold and three heated) with default heating parameter were run for 1,000,000 generations with a sampling frequency of 100 generations. The first 25% of sampled trees were discarded as burn-in. A Maximum Likelihood (ML) tree was constructed using PhyML v3.0 (Guindon et al. 2010) under the best evolutionary model GTR + I (=0.4119) + G (=0.4745) selected by Modeltest v3.7 (Posada & Buckley 2004) and with with 1,000 bootstrapping replicates. Tree topologies were visualized in MEGA 5.0 (Tamura et al. 2011).

Results

Morphology of Cothurnia salina n. sp. (Figs. 1, 2; Table 1)

Diagnosis. Body elongated columnar, in vivo 80–98 × 12–19 µm; lorica barrel-shaped, with aboral part heavily thickened; stalk extremely short, with approximately ½ of its length within the lorica; macronucleus wormlike, longitudinally oriented; single contractile vacuole ventrally located; pellicle conspicuously striated, with 62–73 transverse and parallel striations between peristome and aboral trochal band, 32–38 between aboral trochal band and scopula; infundibular polykinety 3 (P3) consisting of two rows of kinetosomes, which are equal in length, parallel to each other and terminate adstomally between P1 and P2. Type location. Muping Salt Factory, Yantai, China (37°25'33.80"N, 121°45'14.20"E). Type material. A slide (registration number 11102201–01) containing the holotype specimen (protargol preparation, marked by ink circle) and a paratype slide with protargol-stained specimens (registration number 11102201–02) have been deposited in the Laboratory of Protozoology, Ocean University of China. Etymology. The specific epithet salina refers to the special hypersaline habitat of the new species. Description. Solitary, with slender, cylindroid cell body measuring 80–98 × 12–19 µm (Fig. 1A, 2A, D, E); body widest at the peristomial lip and not constricted below it (Fig. 1A, 2A, E). Peristomial lip lacks medial infolding and measures 21–27 µm in diameter. Pellicular striae visible above ×400 magnification (Fig. 2E), with 62–73 striations from peristome to aboral trochal band and 32–38 from aboral trochal band to scopula (Table 1). Cytoplasm colorless or slightly grayish, usually containing several food vacuoles (diameter 5–10 µm) located in center of body. Single contractile vacuole located adorally, beneath peristomial lip and near ventral wall of infundibulum (Fig. 1A, 2D). Macronucleus slender, cylindroid, longitudinally oriented (Fig. 1A, 2F, G); micronucleus not observed. Lorica colorless, transparent, truncate pyriform, measuring 62–74 × 30–35 µm and aperture diameter of 21–30 µm. Aboral part of lorica thickened; wall 3 µm thick. Stalk 10 µm long, with approximately ½ of length exterior to lorica wall.

180 · Zootaxa 4169 (1) © 2016 Magnolia Press ZHUANG ET AL. FIGURE 1. Morphology of Cothurnia salina n. sp. and similar species (F–I after Kahl, 1933; J, K after Kahl, 1935; L after Küsters, 1974). A. A typical individual. B. Formation of a telotroch after binary fission. C, D. Varieties of body shape. E. Oral infraciliature, arrow marks the epistomial membrane. F. Cothurnia cyclopis Kahl, 1933. G. Cothurnia ceramicola Kahl, 1933. H. Cothurnia fibripes Kahl, 1933. I. Cothurnia simplex Kahl, 1933. J. Vaginicola sp. Kahl, 1935. K. Cothurnia sp. Kahl, 1935. L. Cothurnia ceramicola sensu Küsters, 1974. G, germinal kinety; H, haplokinety; P1–3, infundibular polykineties 1–3; Po, polykinety. Scale bars: 40µm.

A NEW CILIATE COTHURNIA SALINA Zootaxa 4169 (1) © 2016 Magnolia Press · 181 FIGURE 2. Photomicrographs of Cothurnia salina n. sp. from life (A–E) and after staining with protargol (F–H). A. Individual at low magnification. B. Formation of a telotroch after binary fission. C. Contracted cell. D. Individual at higher magnification, arrow marks the contractile vacuole. E. Individual under ×1000 magnification, showing pellicular striae and aboral trochal band (arrow). F, G. Macronucleus in fixed and stained cells. H. Oral infraciliature. Scale bars: 40µm.

Oral infraciliature as shown in Fig. 1E, 2H. Haplokinety and polykinety make approximately one and one-half circuits together around peristome before entering infundibulum. Haplokinety and polykinety parallel to one another on peristome, diverging within infundibulum to lie on opposite walls (Fig. 1E). Three infundibular polykineties (P1–3), with P1 and P2 consisting of three rows of kinetosomes and P3 of two rows. Adstomal ends of rows in P1 terminate at different levels, with inner row slightly shortened; P2 terminates adstomally above adstomal ends of P1 and P3, with row 3 not merging with P1 abstomally and significantly divergent from other two rows abstomally (Fig. 1E). Rows of P3 parallel and equal in length, terminating adstomally at point approximately midway between adstomal ends of P2 and P1 (Fig. 1E). Germinal kinety runs parallel to haplokinety in abstomal half of infundibulum (Fig. 1E). Aboral trochal band consisting of series of dikinetids encircling cell at point 2/3 of distance from peristome to scopula (Fig. 2E). Phylogenetic analysis based on SSU rRNA sequences (Fig. 3). The SSU rRNA gene sequence of Cothurnia salina (GenBank accession number KT956998) is 1,629 bp long and has a GC content of 43.09%. The sequence of

182 · Zootaxa 4169 (1) © 2016 Magnolia Press ZHUANG ET AL. C. salina differs from that of C. annulata (KU363275) by 38 nucleotides (sequence identity 97.4%); C. sp. 0924 (KU363268) by 69 nucleotides (sequence identity 95.2%). Topologies of BI and ML trees were basically congruent, and thus, only the topology of the BI tree is presented in Fig. 3, with support values from both analyses indicated on branches. In both BI and ML trees, C. salina n. sp. clustered in the family Vaginicolidae as expected. C. salina n. sp. clustered with C. annulata with full support (1.00 BI, 100% ML) and these two species are sisters to the species C. sp. 0924 with moderate support (0.80 BI, 57% ML).

FIGURE 3. BI tree based on SSU rRNA gene sequences. The first and second values at the nodes represent support values for BI and ML analyses, respectively; a ‘*’ indicates a disagreement in topology between ML and BI trees. The scale bar corresponds to ten substitutions per 100 nucleotide positions. The newly sequenced species in this work is in bold font and marked in red.

A NEW CILIATE COTHURNIA SALINA Zootaxa 4169 (1) © 2016 Magnolia Press · 183 TABLE 1. Morphometric characteristics on Cothurnia salina n. sp. Characters Min Max Mean SD CV n Body length (µm) 80 98 92.6 5.4 29.0 12 Body width (µm) 12 19 16.3 2.5 6.2 15 Diameter of peristomial lip (µm) 21 27 23.3 1.8 3.3 14 Lorica length (µm) 62 74 67.8 4.1 16.8 10 Lorica width (µm) 30 35 32.2 1.4 2.0 11 Diameter of lorica aperture (µm) 21 30 25.7 2.9 8.2 11 Number of striations, peristome to aboral trochal band 62 73 67 4.5 20.6 7 Number of striations, aboral trochal band to scopula 32 38 35 2.0 3.9 7

All data based on specimens in vivo. Abbreviations: Min, minimum; Max, maximum; Mean, arithmetic mean; SD, standard deviation; CV, coefficient of variation (%); n, number of individuals investigated.

Comparison and discussion

Cothurnia salina is mostly characterized by its hypersaline habitat, however, several closely similar species should be compared with it on the basis of morphology. Despite of the hypersaline habitat, the new species is similar to other Cothurnia spp. in body shape, lorica outline and stalk appearance, i.e. Cothurnia cyclopis Kahl, 1933, C. simplex Kahl, 1933, C. ceramicola Kahl, 1933 and C. fibripes Kahl, 1933. However, all above species can be separated from C. salina at least by their distinctly smaller body length (≤60 μm vs. 80–98 μm) (Kahl 1933, 1935; Figs. 1F–I; Table 2).

TABLE 2. Morphological comparison of Cothurnia salina n. sp. with closely related congeners. Species Body Body Lorica Lorica Diameter of Diameter Habitat Data Source length width length width peristomial of lorica (µm) (µm) (µm) (µm) lip (µm) aperture (µm) Cothurnia salina 80–98 12–19 62–74 30–35 21–27 21–30 hypersaline Present work C. cyclopis Kahl, 60 20 60 25 – – marine Kahl 1933; Warren 1933 & Paynter 1991 C. simplex Kahl, 60 15 50–60 23 20 18 marine Kahl 1933; Warren 1933 & Paynter 1991 C. ceramicola 60 – 65–77 30 20 25 marine Kahl 1933; Warren Kahl, 1933 & Paynter 1991 C. fibripes Kahl, 60 10 60 30 15–20 15 marine Kahl 1933; Warren 1933 & Paynter 1991 C. sp. Kahl, 1935 75 - - - - - marine Kahl 1935 C. ceramicola 100–150 15–17 67–102 29–35 26–28 23–31 marine Küsters 1974 sensu Küsters, 1974 Vaginicola sp. 65 - - - - - marine Kahl 1935 Kahl, 1935

- Data not available.

Other two unidentified forms according to Kahl (1935), Cothurnia sp. and Vaginicola sp., are also smaller than C. salina (75 μm and 65μm respectively vs. 80–98 μm), therefore they can not be conspecific with C. salina (Kahl 1935; Figs. 1J, K; Table 2). Küsters (1974) reported a Cothurnia species under the name of C. ceramicola, which also resembles C. salina

184 · Zootaxa 4169 (1) © 2016 Magnolia Press ZHUANG ET AL. in some degree. However, Küsters' population has much larger body length (80–98μm vs. 100–150 µm), from which it can be separated from C. salina (Küsters 1974; Fig. 1L; Table 2). The Family Vaginicolidae occupied the basal position in the crown clade of peritrichs (Sun et al. 2016; Fig. 3). In this clade, the genus Cothurnia clusters with the genus Vaginicola with high to moderate support (0.96 BI, 80% ML). This is consistent with the morphological similarity shared by these two genera, for example: 1) slender columnar shaped bodies; 2) contracting into a rigid, pseudochitinous lorica; 3) transversely striated pellicle (Kahl 1935).

Acknowledgements

This work was supported by the National Natural Science Foundation of China (Project No. 31172059) and the International Research Coordination Network for Biodiversity of Ciliates (National Science Foundation; DEB 1136580). Many thanks are due to reviewers and editors, their patience and careful check help us a lot.

References

Castresana, J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution, 17, 540–552. http://dx.doi.org/10.1093/oxfordjournals.molbev.a026334 Chen, Y., Zhao, Y., Pan, X., Ding, W., Al-Rasheid, K.A. & Qiu, Z. (2014) Morphology and phylogeny of a new Frontonia ciliate, F. paramagna spec. nov. (Ciliophora, Peniculida) from Harbin, northeast China. Zootaxa, 3827, 375–386. http://dx.doi.org/10.11646/zootaxa.3827.3.7 Cho, B.C., Park, J.S., Xu, K. & Choi, J.K. (2008) Morphology and molecular phylogeny of Trimyema koreanum n. sp., a ciliate from the hypersaline water of a solar saltern. Journal of Eukaryotic Microbiology, 55, 417–426. http://dx.doi.org/10.1111/j.1550-7408.2008.00340.x Esteban, G.F. & Finlay, B.J. (2003) Cryptic freshwater ciliates in a hypersaline lagoon. Protist, 154, 411–418. http://dx.doi.org/10.1078/143446103322454149 Foissner, W., Berger, H. & Kohmann, F. (1992) Taxonomische und okologische Revision der Ciliaten des Saprobiensystems – Band II: Peritrichida, Heterotrichida, Odontostomtida. Informationsberichte des Bayerischen Landesamtes für Wasserwirtschaft, 5, 1–502. Foissner, W., Blake, N., Wolf, K., Breiner, H.W. & Stoeck, T. (2009) Morphological and molecular characterization of some peritrichs (Ciliophora: Peritrichida) from tank bromeliads, including two new genera: Orborhabdostyla and Vorticellides. Acta Protozoologica, 48, 291–319. Gong, J., Kim, S., Min, G., Roberts, D., Warren, A. & Choi, J. (2007) Taxonomic redescriptions of two ciliates, Protogastrostyla pulchra n. g., n. comb. and Hemigastrostyla enigmatica (Ciliophora: Spirotrichea, Stichotrichia), with phylogenetic analyses based on 18S and 28S rRNA gene sequences. Journal of Eukaryotic Microbiology, 54, 468–478. http://dx.doi.org/10.1111/j.1550-7408.2007.00288.x Guindon, S., Lefort, J.F., Anisimova, M., Hordijk, W. & Gascuel, O. (2010) New algorithms and methods to estimate maximum-likelihood. Systematic Biology, 59, 307–321. http://dx.doi.org/10.1093/sysbio/syq010 Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98. Ji, D., Kim, J.H., Shahed, S.U.A., Sun, P., Li, L. & Shin, M.K. (2015) Two new species of Zoothamnium (Ciliophora, Peritrichia) from Korea, with new observations of Z. parahentscheli Sun et al., 2009. Journal of Eukaryotic Microbiology, 62, 505–518. http://dx.doi.org/10.1111/jeu.12205 Kahl, A. (1933) Ciliata libera et ectocommensalia. In: Grimpe, G. & Wagler, E. (Eds.), Die Tierwelt der Nordund Ostsee, Lief.

23 (Teil, II, c3), pp. 147–183. Kahl, A. (1935) Urtiere oder Protozoa I: Wimpertiere oder Ciliata (Infusoria) 4. Peritricha und Chonotricha. Tierwelt Deutschlands, 30, 651–886. Küsters, E. (1974) Ökologische und systematische Untersuchungen der Aufwuchs ciliaten im Königshafen bei List/Sylt. Archiv für Hydrobiology, 45 (Supplement), 121–211. Medlin, L., Elwood, H.J., Stickel, S. & Sogin, M.L. (1988) The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene, 71, 491–499. http://dx.doi.org/10.1016/0378-1119(88)90066-2 Miao, M., Shao, C., Chen, X. & Song, W. (2011) Evolution of discocephalid ciliates: molecular, morphological and ontogenetic

A NEW CILIATE COTHURNIA SALINA Zootaxa 4169 (1) © 2016 Magnolia Press · 185 data support a sister group of discocephalids and pseudoamphisiellids (Protozoa, Ciliophora) with establishment of a new suborder Pseudoamphisiellina subord. n. Science China Life Sciences, 54, 634–641. http://dx.doi.org/10.1007/s11427-011-4192-8 Norf, H. & Foissner, W. (2010) A new flagship peritrich (Ciliophora, Peritrichida) from the River Rhine, Germany: Apocarchesium arndti n. sp. Journal of Eukaryotic Microbiology, 57, 250–264. Nylander, J.A. (2004) MrModeltest v2. Evolutionary Biology Centre, Uppsala University, Uppsala. Penard, E. (1922) Études sur les Infusoires d’Eau Douce. George & Cie, Geneva, 331 pp. Posada, D. & Buckley, T. (2004) Model selection and model averaging in phylogenetics: advantages of Akaike Information Criterion and Bayesian approaches over likelihood ratio tests. Systematics and Biodiversity, 53, 793–808. http://dx.doi.org/10.1080/10635150490522304 Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. http://dx.doi.org/10.1093/bioinformatics/btg180 Sun, P., John, C., Xu, D., Huang, B. & Shin, M. (2016) An integrative approach to phylogeny reveals patterns of environmental distribution and novel evolutionary relationships in a major group of ciliates. Scientific Reports, 6, 21659. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2011) MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28, 2731–2739. http://dx.doi.org/10.1093/molbev/msr121 Warren, A. (1986) A revision of the genus Vorticella (Ciliophora: Peritrichida). Bulletin of the British Museum (Natural History). Zoology Series, 50, 1–57. Warren, A. & Paynter, J. (1991) A revision of Cothurnia (Ciliophora: Pertrichida) and its morphological relatives. Bulletin of the British Museum (Natural History). Zoology Series, 57 (1), 17–59. Wilbert, N. (1975) Eineverbesserte Technik der Protargol imprägnation für Ciliaten. Mikrokosmos, 64, 171–179. Yi, Z., Song, W., Warren, A., Roberts, D., Al-Rasheid, K.A.S., Chen, Z., Al-Farraj, S. & Hu, X. (2008) A molecular phylogenetic investigation of Pseudoamphisiella and Parabirojimia (Protozoa, Ciliophora, Spirotrichea), two genera with ambiguous systematic positions. European Journal of Protistology, 44, 45–53. http://dx.doi.org/10.1016/j.ejop.2007.08.002

186 · Zootaxa 4169 (1) © 2016 Magnolia Press ZHUANG ET AL.