DOCSLIB.ORG

A New Peritrich Ciliate from a Hypersaline Habitat in Northern China

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A New Peritrich Ciliate from a Hypersaline Habitat in Northern China Zootaxa 4169 (1): 179–186 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2016 Magnolia Press ISSN 1175-5334 (online edition) http://doi.org/10.11646/zootaxa.4169.1.10 http://zoobank.org/urn:lsid:zoobank.org:pub:0B9BA229-A1B1-4552-A933-9BFF363EE485 A new Peritrich Ciliate from a Hypersaline Habitat in Northern China YUAN ZHUANG1, JOHN C. CLAMP2, ZHENZHEN YI3 & DAODE JI1, 4 1Ocean School, Yantai University, Yantai 264005, China 2Department of Biological and Biomedical Sciences, North Carolina Central University, Durham, NC 27707, USA 3Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, South China Normal University, Guangzhou 510631, China 4Corresponding author. E-mail: [email protected] Abstract A new peritrichous ciliate, Cothurnia salina n. sp., collected from a brine pond of a salt factory in Yantai, China, was in- vestigated based on live observations, silver staining method and molecular phylogenetic analysis. The diagnosis for this new taxon: body elongated columnar, in vivo 80–98 × 12–19 µm; lorica barrel-shaped, with aboral part heavily thickened; stalk extremely short, with approximately ½ of its length within the lorica; macronucleus wormlike, longitudinally orient- ed; single contractile vacuole ventrally located; pellicle with conspicuous parallel transverse striations, 62–73 from aboral trochal band to peristome and 32–38 from aboral trochal band to scopula; infundibular polykinety 3 (P3) consisting of two ciliary rows, which are equal length, parallel to each other and terminate adstomally between P1 and P2. Small subunit (SSU) rRNA gene trees revealed that the new species clustered with other members of the family Vaginicolidae as expect- ed. Key words: morphology, phylogeney, hypersaline, ciliate, Peritrichia, Cothurnia Introduction Ciliates are a large, diverse group of protists and are known from a wide variety of aquatic and terrestrial habitats. There are over 15 species of ciliates from a broad range of higher taxa have been found in moderately hypersaline (40–80‰) environments (Esteban & Finlay 2003); however, species rarely appear to inhabit extremely (80‰– 340‰) hypersaline environments (Cho et al. 2008). The genus Cothurnia is one of the largest genera of peritrichs, and contains over 90 nominal species (Kahl 1933, 1935; Küsters 1974; Warren & Paynter 1991). Unfortunately, only a few of them have been well-described based upon both live observations and silver impregnation methods (Foissner et al. 1992, 2009; Norf & Foissner 2010). During a survey of ciliate fauna in Yantai coast, a species of Cothurnia was collected from a brine pond of a salt factory, with salinity up to 120‰. Careful morphological investigation and comparison with similar congeners revealed it as new to science; consequently, it is named Cothurnia salina n. sp. and the present paper provides its description as well as an analysis of its phylogenetic position. Material and methods Collection and isolation of samples. Cothurnia salina n. sp. was found several times in the years 2010–2011 in a brine pond in Yantai, China (37°25'33.80"N, 121°45'14.20"E). Samples were collected with framed slides, which were immersed in water for 10 days before being retrieved for examination. Slides with ciliates attached were transferred to Petri dishes, and individual ciliates were detached from the slide surface using microdissecting needles under a stereo-microscope. Accepted by M. Shin: 15 Aug. 2016; published: 19 Sept. 2016 179 Morphological methods. The morphology of living and fixed specimens of Cothurnia salina n. sp. was observed with an optical microscope (Olympus DP72) at magnifications of 40× – 1000×. Protargol staining (Wilbert 1975) was used to reveal the infraciliature. Illustrations were done by direct observation and from photomicrographs. Terminology and classification follow Warren (1986) and Ji et al. (2015). DNA extraction, PCR amplification and sequencing. Genomic DNA was extracted using the RED Extract- N-Amp Tissue PCR Kit (Sigma, St. Louis, USA) following the manufacturer’s instructions, except that the reaction volume was reduced to on-tenth of that suggested (Gong et al. 2007). DNA samples were stored at -20°C (Yi et al. 2008). The universal eukaryotic forward primer 18S−82F (5′−GAAACTGCGAATGGCTC−3′) and reverse primer 18S−EukB (5′−TGATCCTTCTGCAGGTTCACCTAC−3′) were used to amplify the SSU rRNA gene (Medlin et al. 1988). Cycling parameters were as follows: 3 min at 95°C followed by 35 cycles comprising 30 s at 95°C, 15 s at 56°C, 1 min 30 s at 72°C. This was followed by a final extension of 10 min at 72°C. Cloning and sequencing were performed according to Miao et al. (2011) and Chen et al. (2014). Phylogenetic analysis. The SSU rRNA sequence of the new species and 47 related SSU rRNA sequences obtained from the NCBI database (http://www.ncbi.nlm.nih.gov/) were aligned using ClustalW implemented in BioEdit version 7.0.0 (Hall 1999), followed by allowed half gap positions using Gblocks v0.91b (Castresana 2000). The best-fit model GTR + I (=0.4119) + G (=0.4745), selected by MrModeltest v2.2 (Nylander 2004), was used to construct a Bayesian Inference (BI) tree using MrBayes v3.2.2 (Ronquist & Huelsenbeck 2003). The species Ichthyophthirius multifiliis, Glaucoma chattoni, Tetrahymena australis and Tetrahymena nanneyi were selected as the outgroup taxa and their sequences were retrived from the GenBank. Four Markov Chain Monte Carlo chains (one cold and three heated) with default heating parameter were run for 1,000,000 generations with a sampling frequency of 100 generations. The first 25% of sampled trees were discarded as burn-in. A Maximum Likelihood (ML) tree was constructed using PhyML v3.0 (Guindon et al. 2010) under the best evolutionary model GTR + I (=0.4119) + G (=0.4745) selected by Modeltest v3.7 (Posada & Buckley 2004) and with with 1,000 bootstrapping replicates. Tree topologies were visualized in MEGA 5.0 (Tamura et al. 2011). Results Morphology of Cothurnia salina n. sp. (Figs. 1, 2; Table 1) Diagnosis. Body elongated columnar, in vivo 80–98 × 12–19 µm; lorica barrel-shaped, with aboral part heavily thickened; stalk extremely short, with approximately ½ of its length within the lorica; macronucleus wormlike, longitudinally oriented; single contractile vacuole ventrally located; pellicle conspicuously striated, with 62–73 transverse and parallel striations between peristome and aboral trochal band, 32–38 between aboral trochal band and scopula; infundibular polykinety 3 (P3) consisting of two rows of kinetosomes, which are equal in length, parallel to each other and terminate adstomally between P1 and P2. Type location. Muping Salt Factory, Yantai, China (37°25'33.80"N, 121°45'14.20"E). Type material. A slide (registration number 11102201–01) containing the holotype specimen (protargol preparation, marked by ink circle) and a paratype slide with protargol-stained specimens (registration number 11102201–02) have been deposited in the Laboratory of Protozoology, Ocean University of China. Etymology. The specific epithet salina refers to the special hypersaline habitat of the new species. Description. Solitary, with slender, cylindroid cell body measuring 80–98 × 12–19 µm (Fig. 1A, 2A, D, E); body widest at the peristomial lip and not constricted below it (Fig. 1A, 2A, E). Peristomial lip lacks medial infolding and measures 21–27 µm in diameter. Pellicular striae visible above ×400 magnification (Fig. 2E), with 62–73 striations from peristome to aboral trochal band and 32–38 from aboral trochal band to scopula (Table 1). Cytoplasm colorless or slightly grayish, usually containing several food vacuoles (diameter 5–10 µm) located in center of body. Single contractile vacuole located adorally, beneath peristomial lip and near ventral wall of infundibulum (Fig. 1A, 2D). Macronucleus slender, cylindroid, longitudinally oriented (Fig. 1A, 2F, G); micronucleus not observed. Lorica colorless, transparent, truncate pyriform, measuring 62–74 × 30–35 µm and aperture diameter of 21–30 µm. Aboral part of lorica thickened; wall 3 µm thick. Stalk 10 µm long, with approximately ½ of length exterior to lorica wall. 180 · Zootaxa 4169 (1) © 2016 Magnolia Press ZHUANG ET AL. FIGURE 1. Morphology of Cothurnia salina n. sp. and similar species (F–I after Kahl, 1933; J, K after Kahl, 1935; L after Küsters, 1974). A. A typical individual. B. Formation of a telotroch after binary fission. C, D. Varieties of body shape. E. Oral infraciliature, arrow marks the epistomial membrane. F. Cothurnia cyclopis Kahl, 1933. G. Cothurnia ceramicola Kahl, 1933. H. Cothurnia fibripes Kahl, 1933. I. Cothurnia simplex Kahl, 1933. J. Vaginicola sp. Kahl, 1935. K. Cothurnia sp. Kahl, 1935. L. Cothurnia ceramicola sensu Küsters, 1974. G, germinal kinety; H, haplokinety; P1–3, infundibular polykineties 1–3; Po, polykinety. Scale bars: 40µm. A NEW CILIATE COTHURNIA SALINA Zootaxa 4169 (1) © 2016 Magnolia Press · 181 FIGURE 2. Photomicrographs of Cothurnia salina n. sp. from life (A–E) and after staining with protargol (F–H). A. Individual at low magnification. B. Formation of a telotroch after binary fission. C. Contracted cell. D. Individual at higher magnification, arrow marks the contractile vacuole. E. Individual under ×1000 magnification, showing pellicular striae and aboral trochal band (arrow). F, G. Macronucleus in fixed and stained cells. H. Oral infraciliature. Scale bars: 40µm. Oral infraciliature as shown in Fig. 1E, 2H. Haplokinety and polykinety make approximately one and one-half circuits together around peristome before entering infundibulum. Haplokinety and polykinety parallel to one another on peristome, diverging within infundibulum to lie on opposite walls (Fig. 1E). Three infundibular polykineties (P1–3), with P1 and P2 consisting of three rows of kinetosomes and P3 of two rows. Adstomal ends of rows in P1 terminate at different levels, with inner row slightly shortened; P2 terminates adstomally above adstomal ends of P1 and P3, with row 3 not merging with P1 abstomally and significantly divergent from other two rows abstomally (Fig. 1E). Rows of P3 parallel and equal in length, terminating adstomally at point approximately midway between adstomal ends of P2 and P1 (Fig.
Load more

Recommended publications
  • Novel Contributions to the Peritrich Family Vaginicolidae
    applyparastyle “fig//caption/p[1]” parastyle “FigCapt” Zoological Journal of the Linnean Society, 2019, 187, 1–30. With 13 figures. Novel contributions to the peritrich family Vaginicolidae (Protista: Ciliophora), with morphological and Downloaded from https://academic.oup.com/zoolinnean/article-abstract/187/1/1/5434147/ by Ocean University of China user on 08 October 2019 phylogenetic analyses of poorly known species of Pyxicola, Cothurnia and Vaginicola BORONG LU1, LIFANG LI2, XIAOZHONG HU1,5,*, DAODE JI3,*, KHALED A. S. AL-RASHEID4 and WEIBO SONG1,5 1Institute of Evolution and Marine Biodiversity, & Key Laboratory of Mariculture, Ministry of Education, Ocean University of China, Qingdao 266003, China 2Marine College, Shandong University, Weihai 264209, China 3School of Ocean, Yantai University, Yantai 264005, China 4Zoology Department, College of Science, King Saud University, Riyadh 11451, Saudi Arabia 5Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266237, China Received 29 September 2018; revised 26 December 2018; accepted for publication 13 February 2019 The classification of loricate peritrich ciliates is difficult because of an accumulation of several taxonomic problems. In the present work, three poorly described vaginicolids, Pyxicola pusilla, Cothurnia ceramicola and Vaginicola tincta, were isolated from the surface of two freshwater/marine algae in China. In our study, the ciliature of Pyxicola and Vaginicola is revealed for the first time, demonstrating the taxonomic value of infundibular polykineties. The small subunit rDNA, ITS1-5.8S rDNA-ITS2 region and large subunit rDNA of the above species were sequenced for the first time. Phylogenetic analyses based on these genes indicated that Pyxicola and Cothurnia are closely related.
    [Show full text]
  • Ciliate Diversity, Community Structure, and Novel Taxa in Lakes of the Mcmurdo Dry Valleys, Antarctica
    Reference: Biol. Bull. 227: 175–190. (October 2014) © 2014 Marine Biological Laboratory Ciliate Diversity, Community Structure, and Novel Taxa in Lakes of the McMurdo Dry Valleys, Antarctica YUAN XU1,*†, TRISTA VICK-MAJORS2, RACHAEL MORGAN-KISS3, JOHN C. PRISCU2, AND LINDA AMARAL-ZETTLER4,5,*࿣ 1Laboratory of Protozoology, Institute of Evolution & Marine Biodiversity, Ocean University of China, Qingdao 266003, China; 2Montana State University, Department of Land Resources and Environmental Sciences, 334 Leon Johnson Hall, Bozeman, Montana 59717; 3Department of Microbiology, Miami University, Oxford, Ohio 45056; 4The Josephine Bay Paul Center for Comparative Molecular Biology and Evolution, Marine Biological Laboratory, Woods Hole, Massachusetts 02543; and 5Department of Earth, Environmental and Planetary Sciences, Brown University, Providence, Rhode Island 02912 Abstract. We report an in-depth survey of next-genera- trends in dissolved oxygen concentration and salinity may tion DNA sequencing of ciliate diversity and community play a critical role in structuring ciliate communities. A structure in two permanently ice-covered McMurdo Dry PCR-based strategy capitalizing on divergent eukaryotic V9 Valley lakes during the austral summer and autumn (No- hypervariable region ribosomal RNA gene targets unveiled vember 2007 and March 2008). We tested hypotheses on the two new genera in these lakes. A novel taxon belonging to relationship between species richness and environmental an unknown class most closely related to Cryptocaryon conditions
    [Show full text]
  • Protozoologica
    Acta Protozool. (2014) 53: 207–213 http://www.eko.uj.edu.pl/ap ACTA doi:10.4467/16890027AP.14.017.1598 PROTOZOOLOGICA Broad Taxon Sampling of Ciliates Using Mitochondrial Small Subunit Ribosomal DNA Micah DUNTHORN1, Meaghan HALL2, Wilhelm FOISSNER3, Thorsten STOECK1 and Laura A. KATZ2,4 1Department of Ecology, University of Kaiserslautern, 67663 Kaiserslautern, Germany; 2Department of Biological Sciences, Smith College, Northampton, MA 01063, USA; 3FB Organismische Biologie, Universität Salzburg, A-5020 Salzburg, Austria; 4Program in Organismic and Evolutionary Biology, University of Massachusetts, Amherst, MA 01003, USA Abstract. Mitochondrial SSU-rDNA has been used recently to infer phylogenetic relationships among a few ciliates. Here, this locus is compared with nuclear SSU-rDNA for uncovering the deepest nodes in the ciliate tree of life using broad taxon sampling. Nuclear and mitochondrial SSU-rDNA reveal the same relationships for nodes well-supported in previously-published nuclear SSU-rDNA studies, al- though support for many nodes in the mitochondrial SSU-rDNA tree are low. Mitochondrial SSU-rDNA infers a monophyletic Colpodea with high node support only from Bayesian inference, and in the concatenated tree (nuclear plus mitochondrial SSU-rDNA) monophyly of the Colpodea is supported with moderate to high node support from maximum likelihood and Bayesian inference. In the monophyletic Phyllopharyngea, the Suctoria is inferred to be sister to the Cyrtophora in the mitochondrial, nuclear, and concatenated SSU-rDNA trees with moderate to high node support from maximum likelihood and Bayesian inference. Together these data point to the power of adding mitochondrial SSU-rDNA as a standard locus for ciliate molecular phylogenetic inferences.
    [Show full text]
  • Diversity and Distribution of Peritrich Ciliates on the Snail Physa Acuta
    Zoological Studies 57: 42 (2018) doi:10.6620/ZS.2018.57-42 Open Access Diversity and Distribution of Peritrich Ciliates on the Snail Physa acuta Draparnaud, 1805 (Gastropoda: Physidae) in a Eutrophic Lotic System Bianca Sartini1, Roberto Marchesini1, Sthefane D´ávila2, Marta D’Agosto1, and Roberto Júnio Pedroso Dias1,* 1Laboratório de Protozoologia, Programa de Pós-graduação em Ciências Biológicas (Zoologia), ICB, Universidade Federal de Juiz de Fora, Juiz de Fora, Minas Gerais, 36036-900, Brazil 2Museu de Malacologia Prof. Maury Pinto de Oliveira, ICB, Universidade Federal de Juiz de Fora, Minas Gerais, 36036-900, Brazil (Received 9 September 2017; Accepted 26 July 2018; Published 17 October 2018; Communicated by Benny K.K. Chan) Citation: Sartini B, Marchesini R, D´ávila S, D’Agosto M, Dias RJP. 2018. Diversity and distribution of peritrich ciliates on the snail Physa acuta Draparnaud, 1805 (Gastropoda: Physidae) in a eutrophic lotic system. Zool Stud 57:42. doi:10.6620/ZS.2018-57-42. Bianca Sartini, Roberto Marchesini, Sthefane D´ávila, Marta D’Agosto, and Roberto Júnio Pedroso Dias (2018) Freshwater gastropods represent good models for the investigation of epibiotic relationships because their shells act as hard substrates, offering a range of microhabitats that peritrich ciliates can occupy. In the present study we analyzed the community composition and structure of peritrich epibionts on the basibiont freshwater gastropod Physa acuta. We also investigated the spatial distribution of these ciliates on the shells of the basibionts, assuming the premise that the shell is a topologically complex substrate. Among the 140 analyzed snails, 60.7% were colonized by peritrichs.
    [Show full text]
  • 1 Introduction and Background
    Ultrastructure and Adhesive Mechanisms of the Biological Spring, Vorticella Convallaria, Studied Via Atomic Force Microscopy By Rafael E. Bras Submitted to the Department of Materials Science and Engineering in Partial Fulfillment of the Requirements for the Degree of Bachelor of Science at the Massachusetts Institute of Technology June 2002 © 2002 Rafael E. Bras All rights reserved The author hereby grants MIT permission to reproduce and distribute publicly paper and electronic copies of this thesis document in whole or in part. Signature of Author ........................................................................................................................... Department of Materials Science and Engineering May 10, 2002 Certified by ....................................................................................................................................... Christine Ortiz Assistant Professor of Materials Science and Engineering Thesis Supervisor Accepted by ...................................................................................................................................... Ronald M. Latanision Chairman, Undergraduate Thesis Committee 1 Ultrastructure and Adhesive Mechanisms of the Biological Spring, Vorticella Convallaria, Studied Via Atomic Force Microscopy By Rafael E. Bras Submitted to the Department of Materials Science and Engineeringon May 10, 2002 in Partial Fulfillment of the Requirements for the Degree of Bachelor of Science in Materials Science and Engineering ABSTRACT The rod-like, contractile
    [Show full text]
  • Morphology of Four New Solitary Sessile Peritrich Ciliates from the Yellow Sea, China, with Description of an Unidentified Speci
    Available online at www.sciencedirect.com ScienceDirect European Journal of Protistology 57 (2017) 73–84 Morphology of four new solitary sessile peritrich ciliates from the Yellow Sea, China, with description of an unidentified species of Paravorticella (Ciliophora, Peritrichia) a,b c d b,∗ Ping Sun , Saleh A. Al-Farraj , Alan Warren , Honggang Ma a Key Laboratory of the Ministry of Education for Coastal and Wetland Ecosystem, Xiamen University, Xiamen 361005, China b Institute of Evolution and Marine Biodiversity, Ocean University of China, Qingdao 266003, China c Zoology Department, College of Science, King Saud University, Riyadh 11451, Saudi Arabia d Department of Life Sciences, Natural History Museum, London SW7 5BD, UK Received 23 June 2016; received in revised form 7 November 2016; accepted 7 November 2016 Available online 14 November 2016 Abstract Sessile peritrichs are a large assemblage of ciliates that have a wide distribution in soil, freshwater and marine waters. Here, we document four new and one unidentified species of solitary sessile peritrichs from aquaculture ponds and coastal waters of the northern Yellow Sea, China. Based on their living morphology, infraciliature and silverline system, four of the five forms were identified as new members belonging to one of three genera, Vorticella, Pseudovorticella and Scyphidia, representing two families, Vorticellidae and Scyphidiidae. The other isolate was found to be an unidentified species of the poorly known genus Paravorticella. Vorticella chiangi sp. nov. is characterized by its inverted bell-shaped zooid, short row 3 in infundibular polykinety 3 and marine habitat. Pseudovorticella liangae sp. nov. posseses a thin, broad peristomial lip and a granular pellicle.
    [Show full text]
  • Structure and Coiling of the Stalk in the Peritrich Ciliates Vorticella and Carchesium
    J. Cell Sci. io, 95-122 (1972) qr Printed in Great Britain STRUCTURE AND COILING OF THE STALK IN THE PERITRICH CILIATES VORTICELLA AND CARCHESIUM W. B. AMOS Tlte Department of Zoology, Downing Street, Cambridge, England SUMMARY The stalk of Carcliesium and Vorticella coils by the action of a contractile organelle. The organelle lies within a thread of cytoplasm which is encased in a complex extracellular tube. Study with the light microscope and the electron microscope suggests that the structure of the tube and the course of the organelle determine the form of the coiling. The contractile organelle contains a system of interconnected membranous tubules and the cytoplasm around it also contains membranous saccules. Both tubules and saccules extend along the length of the stalk. INTRODUCTION Vorticella and Carchesium have stalks which are capable of coiling helically. The coiling is brought about by the action of a contractile organelle which differs markedly from muscle in its physiological properties. This paper is concerned with the structure of the stalks and seeks to explain some aspects of the coiling in structural terms. Experiments on the activation of the stalks after glycerination are described elsewhere (Amos, 1971, and in preparation). Faure-Fremiet (1905) examined the stalks of both genera with the light microscope and found them to be similar. They consisted of a cylindrical sheath containing the contractile thread, or spasmoneme, which pursued a helical course throughout the length of the sheath. Longitudinal fibres lay on the inner surface of the sheath on the opposite side to the spasmoneme. Faure-Fremiet regarded these fibres, the bdtonnets, as stiffeners which, because of their position, ensured that the sheath would bend into a helix, rather than merely collapse, when the spasmoneme contracted.
    [Show full text]
  • Thioautotrophic Ectosymbiosis in Pseudovorticella Sp., a Peritrich
    Thioautotrophic ectosymbiosis in Pseudovorticella sp., a peritrich ciliate species colonizing wood falls in marine mangrove Adrien Grimonprez, Audrey Molza, Mélina C.Z Laurent, Jean-Louis Mansot, Olivier Gros To cite this version: Adrien Grimonprez, Audrey Molza, Mélina C.Z Laurent, Jean-Louis Mansot, Olivier Gros. Thioautotrophic ectosymbiosis in Pseudovorticella sp., a peritrich ciliate species colonizing wood falls in marine mangrove. European Journal of Protistology, Elsevier, 2018, 62, pp.43-55. 10.1016/j.ejop.2017.11.002. hal-01655933 HAL Id: hal-01655933 https://hal.sorbonne-universite.fr/hal-01655933 Submitted on 5 Dec 2017 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Thioautotrophic ectosymbiosis in Pseudovorticella sp., a peritrich ciliate species colonizing wood falls in marine mangrove Adrien Grimonpreza,∗, Audrey Molzab, Mélina C.Z. Laurenta, Jean-Louis Mansotb,c, Olivier Grosa,c aSorbonne Universités, UPMC Univ Paris 06, Univ Antilles Guyane, Univ Nice Sophia Antipolis, CNRS, Evolution Paris Seine—Institut de Biologie Paris Seine (EPS—IBPS), 75005 Paris, France bGTSI, département de physique, UFR des Sciences Exactes et Naturelles, BP 592, 97159 Pointe-à-Pitre Cedex, Guadeloupe, France cC3MAG, UFR des Sciences Exactes et Naturelles, Université des Antilles, BP 592, 97159 Pointe-à-Pitre, Guadeloupe (French West Indies), France Abstract Ciliates represent a diversified group of protists known to establish symbioses with prokaryotic micro-organisms.
    [Show full text]
  • The All-Data-Based Evolutionary Hypothesis Of
    www.nature.com/scientificreports OPEN The All-Data-Based Evolutionary Hypothesis of Ciliated Protists with a Revised Classification of the Received: 13 November 2015 Accepted: 05 April 2016 Phylum Ciliophora (Eukaryota, Published: 29 April 2016 Alveolata) Feng Gao1, Alan Warren2, Qianqian Zhang3,*, Jun Gong3,*, Miao Miao4,*, Ping Sun5,*, Dapeng Xu6,*, Jie Huang7,*, Zhenzhen Yi8 & Weibo Song1 The phylum Ciliophora plays important roles in a wide range of biological studies. However, the evolutionary relationships of many groups remain unclear due to a lack of sufficient molecular data. In this study, molecular dataset was expanded with representatives from 55 orders and all major lineages. The main findings are: (1) 14 classes were recovered including one new class, Protocruziea n. cl.; (2) in addition to the two main branches, Postciliodesmatophora and Intramacronucleata, a third branch, the Mesodiniea, is identified as being basal to the other two subphyla; (3) the newly defined order Discocephalida is revealed to be a sister clade to the euplotids, strongly suggesting the separation of discocephalids from the hypotrichs; (4) the separation of mobilids from the peritrichs is not supported; (5) Loxocephalida is basal to the main scuticociliate assemblage, whereas the thigmotrichs are placed within the order Pleuronematida; (6) the monophyly of classes Phyllopharyngea, Karyorelictea, Armophorea, Prostomatea, Plagiopylea, Colpodea and Heterotrichea are confirmed; (7) ambiguous genera Askenasia, CyclotrichiumParaspathidium and Plagiocampa show close affiliation to the well known plagiopyleans; (8) validity of the subclass Rhynchostomatia is supported, and (9) the systematic positions of Halteriida and Linconophoria remain unresolved and are thus regarded as incertae sedis within Spirotrichea. The ciliated protists are a large and diverse group of microbial eukaryotes that are of central importance in the functioning of microbial food webs by mediating the transfer of organic matter and energy between different trophic levels1,2.
    [Show full text]
  • Single-Cell Genomic Sequencing of Three Peritrichs
    fmars-07-602323 November 26, 2020 Time: 20:43 # 1 ORIGINAL RESEARCH published: 02 December 2020 doi: 10.3389/fmars.2020.602323 Single-Cell Genomic Sequencing of Three Peritrichs (Protista, Ciliophora) Reveals Less Biased Stop Codon Usage and More Prevalent Programmed Ribosomal Frameshifting Than in Other Ciliates Xiao Chen1†, Chundi Wang1†, Bo Pan2, Borong Lu2, Chao Li2, Zhuo Shen3,4, Alan Warren5 and Lifang Li1* 1 Marine College, Shandong University, Weihai, China, 2 Institute of Evolution & Marine Biodiversity, Ocean University of China, Qingdao, China, 3 Institute of Microbial Ecology and Matter Cycle, School of Marine Sciences, Sun Yat-sen Edited by: University, Zhuhai, China, 4 Southern Marine Science and Engineering Guangdong Laboratory (Zhuhai), Zhuhai, China, Zhijun Dong, 5 Department of Life Sciences, Natural History Museum, London, United Kingdom Yantai Institute of Coastal Zone Research, Chinese Academy of Sciences (CAS), China Peritrichs are one of the largest groups of ciliates with over 1,000 species described Reviewed by: so far. However, their genomic features are largely unknown. By single-cell genomic Carolina Bastidas, Massachusetts Institute sequencing, we acquired the genomic data of three sessilid peritrichs (Cothurnia of Technology, United States ceramicola, Vaginicola sp., and Zoothamnium sp. 2). Using genomic data from another Andreas Altenburger, 53 ciliates including 14 peritrichs, we reconstructed their evolutionary relationships Arctic University of Norway, Norway and confirmed genome skimming as an efficient approach for expanding sampling. In *Correspondence: Lifang Li addition, we profiled the stop codon usage and programmed ribosomal frameshifting [email protected] (PRF) events in peritrichs for the first time. Our analysis reveals no evidence of stop †These authors have contributed codon reassignment for peritrichs, but they have prevalent C1 or -1 PRF events.
    [Show full text]
  • Metatranscriptomic Census of Active Protists in Soils
    The ISME Journal (2015) 9, 2178–2190 © 2015 International Society for Microbial Ecology All rights reserved 1751-7362/15 www.nature.com/ismej ORIGINAL ARTICLE Metatranscriptomic census of active protists in soils Stefan Geisen1,2, Alexander T Tveit3, Ian M Clark4, Andreas Richter5, Mette M Svenning3, Michael Bonkowski1 and Tim Urich6 1Department of Terrestrial Ecology, Institute of Zoology, University of Cologne, Cologne, Germany; 2Department of Terrestrial Ecology, Netherlands Institute for Ecology, (NIOO-KNAW), Wageningen, The Netherlands; 3Department of Arctic and Marine Biology, UiT The Arctic University of Norway, Tromsø, Norway; 4Department of AgroEcology, Rothamsted Research, Harpenden, Hertfordshire, UK; 5Department of Microbiology and Ecosystem Sciences, University of Vienna, Vienna, Austria and 6Department of Ecogenomics and Systems Biology, University of Vienna, Vienna, Austria The high numbers and diversity of protists in soil systems have long been presumed, but their true diversity and community composition have remained largely concealed. Traditional cultivation-based methods miss a majority of taxa, whereas molecular barcoding approaches employing PCR introduce significant biases in reported community composition of soil protists. Here, we applied a metatranscriptomic approach to assess the protist community in 12 mineral and organic soil samples from different vegetation types and climatic zones using small subunit ribosomal RNA transcripts as marker. We detected a broad diversity of soil protists spanning across all known eukaryotic supergroups and revealed a strikingly different community composition than shown before. Protist communities differed strongly between sites, with Rhizaria and Amoebozoa dominating in forest and grassland soils, while Alveolata were most abundant in peat soils. The Amoebozoa were comprised of Tubulinea, followed with decreasing abundance by Discosea, Variosea and Mycetozoa.
    [Show full text]
  • Vorticella: a Protozoan for Bio-Inspired Engineering
    micromachines Review Vorticella: A Protozoan for Bio-Inspired Engineering Sangjin Ryu 1,*, Rachel E. Pepper 2, Moeto Nagai 3 and Danielle C. France 4 1 Department of Mechanical and Materials Engineering, University of Nebraska-Lincoln, Lincoln, NE 68588, USA 2 Department of Physics, University of Puget Sound, Tacoma, WA 98416, USA; [email protected] 3 Department of Mechanical Engineering, Toyohashi University of Technology, Toyohashi 441-8580, Japan; [email protected] 4 National Institute of Standards and Technology, Boulder, CO 80305, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-402-472-4313 Academic Editors: Hyoung Jin Cho and Sung Kwon Cho Received: 28 October 2016; Accepted: 20 December 2016; Published: 26 December 2016 Abstract: In this review, we introduce Vorticella as a model biological micromachine for microscale engineering systems. Vorticella has two motile organelles: the oral cilia of the zooid and the contractile spasmoneme in the stalk. The oral cilia beat periodically, generating a water flow that translates food particles toward the animal at speeds in the order of 0.1–1 mm/s. The ciliary flow of Vorticella has been characterized by experimental measurement and theoretical modeling, and tested for flow control and mixing in microfluidic systems. The spasmoneme contracts in a few milliseconds, coiling the stalk and moving the zooid at 15–90 mm/s. Because the spasmoneme generates tension in the order of 10–100 nN, powered by calcium ion binding, it serves as a model system for biomimetic actuators in microscale engineering systems. The spasmonemal contraction of Vorticella has been characterized by experimental measurement of its dynamics and energetics, and both live and extracted Vorticellae have been tested for moving microscale objects.
    [Show full text]