A New Peritrich Ciliate from a Hypersaline Habitat in Northern China

A New Peritrich Ciliate from a Hypersaline Habitat in Northern China

Zootaxa 4169 (1): 179–186 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2016 Magnolia Press ISSN 1175-5334 (online edition) http://doi.org/10.11646/zootaxa.4169.1.10 http://zoobank.org/urn:lsid:zoobank.org:pub:0B9BA229-A1B1-4552-A933-9BFF363EE485 A new Peritrich Ciliate from a Hypersaline Habitat in Northern China YUAN ZHUANG1, JOHN C. CLAMP2, ZHENZHEN YI3 & DAODE JI1, 4 1Ocean School, Yantai University, Yantai 264005, China 2Department of Biological and Biomedical Sciences, North Carolina Central University, Durham, NC 27707, USA 3Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, South China Normal University, Guangzhou 510631, China 4Corresponding author. E-mail: [email protected] Abstract A new peritrichous ciliate, Cothurnia salina n. sp., collected from a brine pond of a salt factory in Yantai, China, was in- vestigated based on live observations, silver staining method and molecular phylogenetic analysis. The diagnosis for this new taxon: body elongated columnar, in vivo 80–98 × 12–19 µm; lorica barrel-shaped, with aboral part heavily thickened; stalk extremely short, with approximately ½ of its length within the lorica; macronucleus wormlike, longitudinally orient- ed; single contractile vacuole ventrally located; pellicle with conspicuous parallel transverse striations, 62–73 from aboral trochal band to peristome and 32–38 from aboral trochal band to scopula; infundibular polykinety 3 (P3) consisting of two ciliary rows, which are equal length, parallel to each other and terminate adstomally between P1 and P2. Small subunit (SSU) rRNA gene trees revealed that the new species clustered with other members of the family Vaginicolidae as expect- ed. Key words: morphology, phylogeney, hypersaline, ciliate, Peritrichia, Cothurnia Introduction Ciliates are a large, diverse group of protists and are known from a wide variety of aquatic and terrestrial habitats. There are over 15 species of ciliates from a broad range of higher taxa have been found in moderately hypersaline (40–80‰) environments (Esteban & Finlay 2003); however, species rarely appear to inhabit extremely (80‰– 340‰) hypersaline environments (Cho et al. 2008). The genus Cothurnia is one of the largest genera of peritrichs, and contains over 90 nominal species (Kahl 1933, 1935; Küsters 1974; Warren & Paynter 1991). Unfortunately, only a few of them have been well-described based upon both live observations and silver impregnation methods (Foissner et al. 1992, 2009; Norf & Foissner 2010). During a survey of ciliate fauna in Yantai coast, a species of Cothurnia was collected from a brine pond of a salt factory, with salinity up to 120‰. Careful morphological investigation and comparison with similar congeners revealed it as new to science; consequently, it is named Cothurnia salina n. sp. and the present paper provides its description as well as an analysis of its phylogenetic position. Material and methods Collection and isolation of samples. Cothurnia salina n. sp. was found several times in the years 2010–2011 in a brine pond in Yantai, China (37°25'33.80"N, 121°45'14.20"E). Samples were collected with framed slides, which were immersed in water for 10 days before being retrieved for examination. Slides with ciliates attached were transferred to Petri dishes, and individual ciliates were detached from the slide surface using microdissecting needles under a stereo-microscope. Accepted by M. Shin: 15 Aug. 2016; published: 19 Sept. 2016 179 Morphological methods. The morphology of living and fixed specimens of Cothurnia salina n. sp. was observed with an optical microscope (Olympus DP72) at magnifications of 40× – 1000×. Protargol staining (Wilbert 1975) was used to reveal the infraciliature. Illustrations were done by direct observation and from photomicrographs. Terminology and classification follow Warren (1986) and Ji et al. (2015). DNA extraction, PCR amplification and sequencing. Genomic DNA was extracted using the RED Extract- N-Amp Tissue PCR Kit (Sigma, St. Louis, USA) following the manufacturer’s instructions, except that the reaction volume was reduced to on-tenth of that suggested (Gong et al. 2007). DNA samples were stored at -20°C (Yi et al. 2008). The universal eukaryotic forward primer 18S−82F (5′−GAAACTGCGAATGGCTC−3′) and reverse primer 18S−EukB (5′−TGATCCTTCTGCAGGTTCACCTAC−3′) were used to amplify the SSU rRNA gene (Medlin et al. 1988). Cycling parameters were as follows: 3 min at 95°C followed by 35 cycles comprising 30 s at 95°C, 15 s at 56°C, 1 min 30 s at 72°C. This was followed by a final extension of 10 min at 72°C. Cloning and sequencing were performed according to Miao et al. (2011) and Chen et al. (2014). Phylogenetic analysis. The SSU rRNA sequence of the new species and 47 related SSU rRNA sequences obtained from the NCBI database (http://www.ncbi.nlm.nih.gov/) were aligned using ClustalW implemented in BioEdit version 7.0.0 (Hall 1999), followed by allowed half gap positions using Gblocks v0.91b (Castresana 2000). The best-fit model GTR + I (=0.4119) + G (=0.4745), selected by MrModeltest v2.2 (Nylander 2004), was used to construct a Bayesian Inference (BI) tree using MrBayes v3.2.2 (Ronquist & Huelsenbeck 2003). The species Ichthyophthirius multifiliis, Glaucoma chattoni, Tetrahymena australis and Tetrahymena nanneyi were selected as the outgroup taxa and their sequences were retrived from the GenBank. Four Markov Chain Monte Carlo chains (one cold and three heated) with default heating parameter were run for 1,000,000 generations with a sampling frequency of 100 generations. The first 25% of sampled trees were discarded as burn-in. A Maximum Likelihood (ML) tree was constructed using PhyML v3.0 (Guindon et al. 2010) under the best evolutionary model GTR + I (=0.4119) + G (=0.4745) selected by Modeltest v3.7 (Posada & Buckley 2004) and with with 1,000 bootstrapping replicates. Tree topologies were visualized in MEGA 5.0 (Tamura et al. 2011). Results Morphology of Cothurnia salina n. sp. (Figs. 1, 2; Table 1) Diagnosis. Body elongated columnar, in vivo 80–98 × 12–19 µm; lorica barrel-shaped, with aboral part heavily thickened; stalk extremely short, with approximately ½ of its length within the lorica; macronucleus wormlike, longitudinally oriented; single contractile vacuole ventrally located; pellicle conspicuously striated, with 62–73 transverse and parallel striations between peristome and aboral trochal band, 32–38 between aboral trochal band and scopula; infundibular polykinety 3 (P3) consisting of two rows of kinetosomes, which are equal in length, parallel to each other and terminate adstomally between P1 and P2. Type location. Muping Salt Factory, Yantai, China (37°25'33.80"N, 121°45'14.20"E). Type material. A slide (registration number 11102201–01) containing the holotype specimen (protargol preparation, marked by ink circle) and a paratype slide with protargol-stained specimens (registration number 11102201–02) have been deposited in the Laboratory of Protozoology, Ocean University of China. Etymology. The specific epithet salina refers to the special hypersaline habitat of the new species. Description. Solitary, with slender, cylindroid cell body measuring 80–98 × 12–19 µm (Fig. 1A, 2A, D, E); body widest at the peristomial lip and not constricted below it (Fig. 1A, 2A, E). Peristomial lip lacks medial infolding and measures 21–27 µm in diameter. Pellicular striae visible above ×400 magnification (Fig. 2E), with 62–73 striations from peristome to aboral trochal band and 32–38 from aboral trochal band to scopula (Table 1). Cytoplasm colorless or slightly grayish, usually containing several food vacuoles (diameter 5–10 µm) located in center of body. Single contractile vacuole located adorally, beneath peristomial lip and near ventral wall of infundibulum (Fig. 1A, 2D). Macronucleus slender, cylindroid, longitudinally oriented (Fig. 1A, 2F, G); micronucleus not observed. Lorica colorless, transparent, truncate pyriform, measuring 62–74 × 30–35 µm and aperture diameter of 21–30 µm. Aboral part of lorica thickened; wall 3 µm thick. Stalk 10 µm long, with approximately ½ of length exterior to lorica wall. 180 · Zootaxa 4169 (1) © 2016 Magnolia Press ZHUANG ET AL. FIGURE 1. Morphology of Cothurnia salina n. sp. and similar species (F–I after Kahl, 1933; J, K after Kahl, 1935; L after Küsters, 1974). A. A typical individual. B. Formation of a telotroch after binary fission. C, D. Varieties of body shape. E. Oral infraciliature, arrow marks the epistomial membrane. F. Cothurnia cyclopis Kahl, 1933. G. Cothurnia ceramicola Kahl, 1933. H. Cothurnia fibripes Kahl, 1933. I. Cothurnia simplex Kahl, 1933. J. Vaginicola sp. Kahl, 1935. K. Cothurnia sp. Kahl, 1935. L. Cothurnia ceramicola sensu Küsters, 1974. G, germinal kinety; H, haplokinety; P1–3, infundibular polykineties 1–3; Po, polykinety. Scale bars: 40µm. A NEW CILIATE COTHURNIA SALINA Zootaxa 4169 (1) © 2016 Magnolia Press · 181 FIGURE 2. Photomicrographs of Cothurnia salina n. sp. from life (A–E) and after staining with protargol (F–H). A. Individual at low magnification. B. Formation of a telotroch after binary fission. C. Contracted cell. D. Individual at higher magnification, arrow marks the contractile vacuole. E. Individual under ×1000 magnification, showing pellicular striae and aboral trochal band (arrow). F, G. Macronucleus in fixed and stained cells. H. Oral infraciliature. Scale bars: 40µm. Oral infraciliature as shown in Fig. 1E, 2H. Haplokinety and polykinety make approximately one and one-half circuits together around peristome before entering infundibulum. Haplokinety and polykinety parallel to one another on peristome, diverging within infundibulum to lie on opposite walls (Fig. 1E). Three infundibular polykineties (P1–3), with P1 and P2 consisting of three rows of kinetosomes and P3 of two rows. Adstomal ends of rows in P1 terminate at different levels, with inner row slightly shortened; P2 terminates adstomally above adstomal ends of P1 and P3, with row 3 not merging with P1 abstomally and significantly divergent from other two rows abstomally (Fig. 1E). Rows of P3 parallel and equal in length, terminating adstomally at point approximately midway between adstomal ends of P2 and P1 (Fig.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    8 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us