PKA-Chromatin Association at Stress Responsive Target Genes from Saccharomyces Cerevisiae

View metadata, citation and similar papers at core.ac.uk brought to you by CORE Published in %LRFKLPLFDHW%LRSK\VLFD$FWD %%$ *HQH5HJXODWRU\0HFKDQLVPV ± provided by RERO DOC Digital Library which should be cited to refer to this work.

PKA-chromatin association at stress responsive target genes from Saccharomyces cerevisiae

Leticia Baccarini a, Fernando Martínez-Montañés c, Silvia Rossi a, Markus Proft b, Paula Portela a,⁎

a Departamento de Química Biológica, Facultad de Ciencias Exactas y Naturales, IQUIBICEN-CONICET, Universidad de Buenos Aires, Buenos Aires, Argentina b Instituto de Biomedicina CSIC, Valencia, Spain c Department of Biology, University of Fribourg, Fribourg, Switzerland

Gene expression regulation by intracellular stimulus-activated protein kinases is essential for cell adaptation to environmental changes. There are three PKA catalytic subunits in Saccharomyces cerevisiae: Tpk1, Tpk2, and Tpk3 and one regulatory subunit: Bcy1. Previously, it has been demonstrated that Tpk1 and Tpk2 are associated with coding regions and promoters of target genes in a carbon source and oxidative stress dependent manner. Here we studied ﬁve genes, ALD6, SED1, HSP42, RPS29B,andRPL1B whose expression is regulated by saline stress. We found that PKA catalytic and regulatory subunits are associated with both coding regions and promoters of the analyzed genes in a stress dependent manner. Tpk1 and Tpk2 recruitment was completely abolished in catalytic inactive mutants. BCY1 deletion changed the binding kinetic to chromatin of each Tpk isoform and this strain displayed a deregulated gene expression in response to osmotic stress. In addition, yeast mutants with high PKA activity exhibit sustained association to target genes of chromatin-remodeling complexes such as Snf2-catalytic subunit of the SWI/SNF complex and Arp8-component of INO80 complex, leading to upregulation of gene expression during osmotic stress. Tpk1 accumulation in the nucleus was stimulated upon osmotic stress, while the nuclear localization of Tpk2 and Bcy1 showed no change. We found that each PKA subunit is transported into the nucleus by a different β-karyopherin pathway. Moreover, β-karyopherin mutant strains abolished the chromatin association of Tpk1 or Tpk2, suggesting that nuclear localization of PKA catalytic subunits is required for its association to target genes and properly gene expression.

1. Introduction slow respiratory growth or stationary phase [9]. There are three PKA catalytic subunits in S. cerevisiae: Tpk1, Tpk2, and Tpk3 and one regulatory Signal transduction pathways play an important function in proper subunit: Bcy1 [10,11]. cellular response against extracellular injuries. Cellular adaptation to PKA signaling pathway controls the expression of several genes, http://doc.rero.ch environmental changes involves a strict regulation of gene expression. both positively and negatively. PKA is known to inhibit Rim15, a positive In eukaryotic cells, stress-activated protein kinases (SAPKs) have an regulator of the transcription factor Gis1, which induces genes required essential role in adaptation to an extracellular stimulus [1]. for postdiauxic growth [12], PKA also inhibits the transcription factors In response to stress or nutritional conditions, protein kinases can Msn2/4, which induces general stress responsive gene expression [13]. regulate gene expression by association to chromatin both in promoters Nuclear localization of Msn2/4 is controlled by PKA [14]. On the other and/or actively transcribed regions and further phosphorylation of hand, it has been described that PKA negatively regulates the activity transcription factors, histones, chromatin-modifying complexes, and/ of the RNA polymerase II machinery by direct phosphorylation of or the transcription machinery. In Saccharomyces cerevisiae protein Srb9, a component of the Srb Mediator complex [15], and also promot- kinases such as Hog1 [2,3], Fus3, Kss1, Tor1 [4], Sch9 [5],andPKA[6,7] ing the accumulation of inactive RNA Pol II at ribosome biogenesis genes as well as Schizosaccharomyces pombe Sty1 [8] have been described as [16]. Recently, it has been described that in response to glucose, PKA chromatin-associated kinases. phosphorylates the transcription factor Rgt1 promoting its dissociation Yeast PKA acts positively on phenotypes associated with rapid from HXT promoters, resulting in the upregulation of HXT genes [17].Fi- fermentative growth and negatively on phenotypes associated with nally, PKA controls FLO11 gene expression not only positively by Tpk2 [18,19], but also negatively via Tpk1 through the kinase Yak1 [20]. Genome wide ChIP-on-Chip experiments in S. cerevisiae revealed ⁎ Corresponding author at: Laboratorio de Biología Molecular y Transducción de that Tpk1 and Tpk2 interacted with chromatin. Tpk1 was found physi- Señales, Departamento de Química Biológica, Facultad de Ciencias Exactas y Naturales — UBA, Ciudad Universitaria Pabellón II Piso 4, Buenos Aires, Argentina. cally associated with genes that are actively transcribed during glucose E-mail address: [email protected] (P. Portela). growth or under low oxidative stress. Tpk2 was found mainly associated

1 with the promoter regions of ribosomal protein genes under oxidative CCCAAC3′ and Rev: 5′GATTCCGACCTTGTTTGGAGC3′. TPK2 gene: For 5′ stress. Occupancy of the Tpk3 subunit was not detected due its low pro- ACTGCAGATTTGACAAGAAG3′ and Rev: 5′GTGCGCCAGATTTTGGTGGA tein expression level [6]. 3′. BCY1 gene: For 5′AGACCATGATTATTTCGGTG3′ and Rev: 5′GTAGTA Subcellular localization of PKA subunits is strongly regulated by nu- ACAGCAGTAGTAGA3′SNF2 gene: For 5′ACTTCAAGCGTGGCTGAATC3′ trient availability and stress conditions. In exponentially glucose- and Rev: 5′CATCCCAACTCGGTTAATGG3′. ARP8 gene: For 5′CGTGATAT growing cells, Bcy1 and Tpk2 localization is mainly nuclear, whereas GAATCCCGCTCT3′ and Rev: 5′TGCTTCGTTGATGTCTGCAA3′ employing Tpk1 and Tpk3 show a nucleus-cytoplasmic distribution [21,22]. Cell genomic DNA from the corresponding strain (see Table 1). DNA in stationary phase of growth or stressed cells show re-localization of sequence was confirmed by sequencing and expression of tagged protein all PKA subunits towards the cytoplasm, where Tpk2 and Tpk3, in par- was monitored by western-blot and fluorescence accordingly. Strains ticular, are accumulated in RNP (RiboNucleoProtein) granules [21,23]. were grown in rich medium containing 2% bactopeptone, 1% yeast The traffic of RNA and protein between nucleus and cytoplasm is extract, and 2% glucose (YPGlu) at 30 °C. Solid media contained 2% agar. mediated by specialized carriers that translocate these macromolecules across the nuclear membrane. The budding yeast S. cerevisiae has 14 2.1.1. Osmotic stress, expression levels, and cell viability members of the β-karyopherin family which are classified into Osmotic stress was performed by addition of 0.4 M NaCl. Aliquots importins and exportins, depending on whether they transport the were taken at different times and processed according to each determi- cargo in or out of the nucleus. Most β-karyopherins directly bind the nation. The zero time point corresponds to samples taken immediately NLS (Nuclear Localization Signals) of their cargos. The importin-β path- before NaCl addition. Expression level analysis: crude extracts of the way (Kap95 in yeast) recognizes the classical NLS through the adaptor strains indicated on each graph were prepared according to Materials protein importin-α (Kap60 in yeast). The β-karyopherins Kap108, and methods, and were subjected to SDS/PAGE, Western blotting Kap120, Kap123, and Kap114 are functionally redundant and act as using an anti-GFP antibody (Supplementary Fig. S1A) or anti-TAP anti- importins or exportins [24–26]. Not only the β-karyopherins can recog- body (Supplementary Fig. S3A) and quantified by densitometry as de- nize more than one cargo and potentially also more than one NLS, but scribed below. The expression levels of each tagged protein in also one cargo can be recognized by more than one β-karyopherin different strains for each condition were expressed relative to the ex- [27,28]. The nuclear-cytoplasmic transport of proteins is a flexible pression levels under normal condition. The bars represent the mechanism that responds to nutrient availability and stress [29,30]. mean ± SEM from two independent experiments. Cell viability: strains The β-karyopherin pathway responsible of the nuclear trafficof were grown to exponential phase at 30 °C and treated with 0.4 M NaCl S. cerevisiae PKA subunits has not been previously analyzed. during 40 min. Cell viability of wild type and mutant strains after NaCl Here we determined that Tpk1 accumulates in the nucleus post- treatment was verified by spot assay method (Supplementary Fig. S1B osmotic stress, however Tpk2 and Bcy1 did not change their nucleus- and Supplementary Fig. S3B). cytoplasmic distribution, being preferentially nuclear. We found that each PKA subunit is actively transported into the nucleus by different 2.1.2. Osmosensitivity assay β-karyopherins pathways. We found that PKA subunits associate with Serial dilutions of exponentially growing cells on YPGlu were spot- different gene regions in response to osmotic stress. Catalytically inac- ted directly onto the plates containing different NaCl concentrations. tive versions of Tpk1 and Tpk2 do not associate with the analyzed Plates were photographed after 2 days at 30 °C. gene regions. A strain with a deletion of the BCY1 gene showed a higher Tpk1 recruitment in comparison with a WT strain, and abolished the 2.1.3. Energy dependent import assay Tpk2 association with chromatin. Deregulated PKA activity, as displayed The protocol was performed as described [34,35]. Cells were grown in a bcy1Δ strain, caused a deregulated gene expression in response to on YPGlu until exponential growth at 30 °C. Cells were harvested at osmotic stress and an increased osmosensitivity. Yeast mutants ex- room temperature by pelleting at 3500 ×g. Cell pellets were washed pressing Tpk1 or Tpk2 as a sole kinase source suggest that each Tpk cat- with and resuspended in 1 ml of 10 mM sodium azide, 10 mM 2- alytic isoform could play different roles in the gene expression deoxy-o-glucose in glucose-free YP medium and incubated for 60 min regulation in response to osmotic stress. Particularly, Tpk2 deregulated at 30 °C to allow nucleocytoplasmic equilibration of GFP-tagged PKA http://doc.rero.ch kinase activity promoted high sustained association to target genes of subunits fluorescence. After 60 min, the cultures were pelleted and re- Snf2 and Arp8 in correlation with an up regulation of mRNA levels. suspended in 30 °C pre warmed YPGlu fresh medium and incubated Using β-karyopherin mutant strains we observed that gene expres- for 60 min. Aliquots of each culture were processed at indicated times sion response to osmotic stress is dependent on the proper nuclear lo- for fluorescence microscopy. calization of PKA subunits and its physical interaction with chromatin. In summary, our results indicate that PKA might be involved in gene 2.1.4. Doxycycline treatment regulation by association to genomic regions in response to osmotic Glucose exponentially growing cells expressing Bcy1-GFP, Tpk1-GFP stress. or Tpk2-GFP in wild type or tetO::KAP95 genetic background (described in SupplementaryTable 1) were treated or not with 5 μg/ml doxycycline 2. Materials and methods for 6 h. The lack of expression of gene KAP95 was assayed by the sensi- tivity to zymolyase treatment assay: cells were resuspended in water 2.1. Yeast strains, plasmids, media and growth conditions and digested with 1 mg/ml zymolyase 20 T and the OD 600 nm was determined; the repression of gene KAP95 was verified by Northern blot. Yeast strains and plasmids used in this study are described in Sup- plementary Tables 1 and 2 respectively. The inactive version of Tpk1 2.2. SDS-PAGE and Western blot and Tpk2 were expressed by pTD55 and pTD53 respectively [31]. Yeast strains were transformed using the lithium acetate methods The pelleted cells were disrupted in an appropriate buffer with glass [32], and transformants were selected on SD medium lacking the appro- beads and the lysate was clarified. Samples of crude extracts were priate amino acid supplement. Epitope tagging was constructed using separated by 10% SDS-PAGE. The gels were blotted onto nitrocellulose the cellular repair machinery to incorporate the PCR fragment into the membranes. Blots were probed with anti-TAP (Open Biosynthesis) or genomic locus [33]. A fragment containing the C-terminal coding region anti-GFP (Santa Cruz antibodies). The blots were developed with of the corresponding gene fused to GFP or TAP epitope carrying the HIS3 Chemiluminescence Luminol reagent, and immunoreactive bands selectable marker was amplified by PCR from genomic DNA using the were visualized by autoradiography and analyzed by digital imaging following primers: TPK1 gene: For 5′TTGTTAAGGAAAGCCCAAAGATTT using Bio-Imaging Analyzer Bas-1800II. To quantify Western blots,

2 Fig. 1. Kinetics of subcellular localization of PKA subunits in response to osmotic stress. Cells expressing Bcy1-GFP, Tpk1-GFP or Tpk2-GFP were grown until exponential phase and stressed with 0.4 M NaCl. Aliquots of cultures pre- and post-different time of NaCl addition were processed; nuclei were stained with DAPI and visualized by fluorescence microscopy. Left graph shows a quantification of localization pattern: N N C cells with nuclear fluorescence stronger than cytoplasmic fluorescence. Each value represents the mean ± SEM, from two independent experiments (brackets denote significant differences P b 0.05 Time 0 versus Time 10 min Tpk1-GFP). The right panels show representative images.

short exposures were scanned and quantified using Image Gauge 3.12 analyzed using 32P-labeled PCR fragments of ALD6 (+662+1150), software. SED1 (+643+977), HSP42 (+245+417), RPL1B (+61+421), RPS29B (+1+171) and KAP95 (+2167+2413). The membranes were devel- 2.3. Fluorescence microscopy oped by autoradiography using a PhosphoImager. The mRNA levels were quantified by densitometric analysis and normalized to the 25S Cells used for fluorescence microscopy were grown to early logarith- rRNA ribosomal RNA using ImageJ (National Institutes of Health). mic phase, fixed with 7.4% formaldehyde, washed with PBS buffer, and re-suspended in 0.05% Triton plus 1 μgml−1 DAPI (4,6-diamidino-2- 2.6. Reproducibility of the results phenylindol) for 30 min to stain the nuclei. Microscopy was performed using an epi-fluorescence microscope (Nikon Eclipse E600W). The im- All the experiments were repeated several times (indicated in each ages were processed using ImageJ (National Institute of Health) and figure) using independent cultures. Results shown in Figs. 1, 2BandD, Adobe Photoshop CS2 software. 3D, and 4 were analyzed using repeated measures ANOVA Bonferroni post-test, P b 0.05. Results shown in Figs. 2A, C and 5 were analyzed 2.4. ChIP assays using ANOVA-Tukey HSD, P b 0.05. ChIP was performed as described previously [36]. Briefly, yeast cultures were grown to exponential phase. Aliquots of the culture were ex- 3. Results posed to osmotic-stress treatment (0.4 M NaCl) for various different times. For cross-linking, yeast cells were treated with 1% formaldehyde 3.1. PKA subunit localization in response to osmotic stress for 20 min at room temperature. Immunoprecipitation was performed with magnetic Dynabeads (Invitrogen). We studied the dynamic changes of PKA subunits subcellular localiza- From the ChIP-on-Chip raw data published by Pokholok et al., 2006, tion during osmotic stress evoked by NaCl addition. Bcy1-GFP, Tpk1-GFP, we selected the 5 gene regions with highest binding by Tpk1/2: open and Tpk2-GFP subcellular localization was analyzed using genomically reading frame regions: ALD6: chromosome 16, position 433,366; GFP-tagged strains. Exponentially growing cells in YPGlu were stressed SED1: chromosome 4, position 601,413; HSP42: chromosome 4, position with 0.4 M NaCl during 60 min and nuclei were stained with DAPI as 807,396. The intragenic regions were selected corresponding to described in Materials and methods. Cell viability and the expression http://doc.rero.ch chromosome 4, position 341,449 assigned as RPS29B promoter and levels of the tagged PKA subunits were similar after NaCl treatment chromosome 7, position 254,309 assigned as RPL1B promoter. The oli- (see Materials and methods, Supplementary Fig. S1A and B). gonucleotides used to amplify open reading frame regions were: As previously described [20], in cells growing at exponential phase ALD6/YPL061W (+730+842) For 5′AGCTGGCTTTTACCGGTTCT3′ Rev: on glucose (Fig. 1, time 0 min) Bcy1 and Tpk2 show predominantly 5′ ACCAAATGGGCGGACTTAC3′; SED1/YDR077W (+827+921) For 5′ nuclear localization (N N C 76% and 70% respectively) while Tpk1 is GGGCACTACCACCAAAGAAA3′ Rev: 5′AGAGGATGAAACTGGGACGA3′; distributed between nucleus and cytoplasm (N N C 40%). In response to HSP42/YDR171W (+865+1014) For 5′AGAGTGGGCATTGATGAAAA3′ osmotic stress, Tpk2 and Bcy1 do not change their nuclear localization, Rev: 5′AGGCACCTTAATTTGTAGTAGAC3′. The oligonucleotides used to while Tpk1 is mainly nuclear 5 min post-stimulus (N N C65%)(Fig. 1). amplify intragenic regions were: RPS29B (−750−603) For 5′ATCAAC Inhibition of protein translation by the addition of cycloheximide, previ- TTCTAACTCACACA3′ Rev: 5′CCCCCAAGTGAAATAAATAG3′; RPL1B ous to osmotic stress, does not affect the subcellular localization pattern (−295−371) For 5′CTTCGGCCCCACAAACTC3′ Rev: 5′CGCTTTCCTTGG of PKA subunits (results not shown). This result suggests that Tpk1 trans- ATCAACATAC3′. locates from the cytoplasm to the nucleus in response to osmotic stress. Quantitative PCR analysis of the indicated chromosomal loci was There is no information regarding the mechanism by which PKA performed using a real-time Applied Biosystems 7000 sequence detec- subunits translocate to the nuclei. To begin the study of this mechanism tor. PCR reactions were performed using Eva Green qPCR Basic HS Mix we analyzed whether the cytoplasmic-nuclear transport of PKA subunit (Biotum). Each immunoprecipitation was performed two or three was an active process or not. Cell cultures expressing Bcy1-GFP, Tpk1- times with different chromatin samples. Enrichment of immunoprecip- GFP or Tpk2-GFP were grown up to exponential phase in glucose rich itation is represented by ΔCt (Ct value (IP sample) minus Ct value medium, depleted of ATP by incubation with glucose-free medium (input)) relative to the untagged control samples. with the addition of sodium azide and 2-deoxy-D-glucose during 40 min and energetically restored by addition of fresh rich medium. 2.5. Northern blot analysis Subcellular localization of PKA subunits was analyzed (Supplementary Fig. S2). Nuclear accumulation of PKA subunits decreased as time of Northern analysis was carried out as described previously [37].Total ATP depletion progressed and was restored upon cellular energy resti- RNA was prepared using the hot phenol method. Gene expression was tution suggesting an active nuclear-cytoplasmic transport of PKA

3 http://doc.rero.ch

4 subunits. In response to energy restitution, nuclear accumulation of change in subcellular distribution could have a role in the gene expres- Tpk1 was similar to Tpk2 and Bcy1 (N N C 60%). sion of yeast to saline stress. To study this possibility, we chose to ana- In order to identify the members of the β-karyopherin family in- lyze genes which have been identified in genomic arrays as responsive volved in the nuclear import of PKA subunits in vivo, we constructed to NaCl [39,40]. It has already been demonstrated that Tpk1 and Tpk2 β-karyopherin defective strains kap114Δ, kap123Δ, kap108Δ, are recruited to these locus under fermentative metabolism or oxidative kap114Δkap123Δ and tetO::KAP95 expressing Bcy1-GFP, Tpk1-GFP or stress suggesting a role of PKA in gene expression regulation during Tpk2-GFP from its chromosomal locus (Supplementary Table 1). Since stress [6]. the deletion of KAP95 gene is lethal a strain tetO::KAP95 was used. In We measured the mRNA levels of ALD6, SED1, HSP42, RPS29B, and this strain the KAP95 expression is inhibited by TetR repressor in the RPL1B genes during osmotic stress, in wild type and bcy1Δ strains to as- presence of doxycycline. The lack of expression of the gene KAP95 affects sess the effect of a deregulated PKA activity on their expression cell wall integrity and cells become highly sensitive to zymolyase treat- (Fig. 3A). In the bcy1Δ strain, ALD6 mRNA level increased at 5 min ment [38].Weverified the repression of KAP95 gene expression induced post-stress, like in the WT strain, but the increase was not transient by doxycycline treatment both by measuring the relative hypersensitiv- and the levels remained high. SED1 gene expression was transiently ac- ity of this strain to zymolyase lysis as compared to control conditions tivated with a maximum at 5 min post-stress in wild type strain; how- (Fig. 2A left panel) and by Northern blot (Fig. 2A right panel). Fig. 2B ever in bcy1Δ strain SED1 mRNA levels were upregulated later than in and C show that the nuclear localization of Bcy1-GFP in the tetO::KAP95 WT. Expression levels of HSP42, RPS29B and RPL1B mRNA showed a strain was highly decreased upon doxycycline treatment. The control strong down regulation during osmostress in the wild type strain. The using the Bcy1-GFP tetO::KAP109 strain indicated that the observed loss of Bcy1 function promoted an upregulation of HSP42 and RPS29B mislocalization of Bcy1 was a consequence of KAP95 gene repression genes in a transient or constant manner respectively. Finally, RPL1B and not due to doxycycline treatment (Fig. 2B). Fig. 2C additionally showed a low and sustained expression in bcy1Δ strain during stress. shows that nuclear localization of the Tpk1-GFP subunit was affected The results indicate that PKA activity modulates the gene expression ki- only in the double mutant kap114Δkap123Δ and not in the correspond- netics of these genes in response to osmotic stress. ing single mutant strains. Finally, the nuclear localization of Tpk2-GFP The role of PKA activity was also assessed on cell adaptation to os- was partially prevented in a strain defective in Kap108. All together, motic stress. Serial dilution aliquots of bcy1Δ and wild type strains these results show that Bcy1, Tpk1, and Tpk2 are ferried to the nucleus grown up to exponential phase in YPGlu were loaded on plates contain- in vivo by different transport factors of the β-karyopherin family. ing different concentrations of NaCl. As previously described [41], the It has been described that β-karyopherin activities can be affected bcy1Δ strain showed hypersensitivity to osmotic stress (Fig. 3B) indicat- by stress [29]. In order to analyze which β-karyopherins were in- ing that a deregulated PKA activity is deleterious to cell survival upon volved in PKA subunit nuclear accumulation in response to osmotic osmotic stress. stress we assessed the distribution of each PKA subunit, Bcy1-GFP, Since a high PKA activity promoted the induction of its target genes, Tpk1-GFP, and Tpk2-GFP, in yeast cells subjected to osmotic stress we examined the individual contribution of Tpk1 or Tpk2 catalytic (Fig. 2D). PKA subunits expression levels and cell viability were sim- isoforms to the regulation of expression of osmostress genes (Fig. 3C). ilar before and after stress treatment in β-karyopherin mutant Expression of ALD6 and RPS29B genes was analyzed in strains express- strains (Supplementary Fig. S1A and B) except for the strain ing only Tpk1 or Tpk2 in a bcy1Δ background. In a strain with tetO::KAP95 which was omitted from this analysis since cellular via- deregulated Tpk1 activity (Tpk1tpk2Δtpk3Δbcy1Δ) there was a strong bility was severely affected (data not shown). Bcy1-GFP did not reduction in both genes analyzed in response to osmotic stress. The modify its nuclear accumulation in the mutant strains assayed in re- expression analysis in cells harboring deregulated Tpk2 activity sponse to osmotic stress. In a kap114Δkap123Δ mutant strain, Tpk1- (Tpk2tpk1Δtpk3Δbcy1Δ) showed that ALD6 gene expression was tran- GFP showed a very slight increment in nuclear localization with the siently activated, like in wild type cells, although with two differences: 0.4 M NaCl treatment (Fig. 2D). However, Tpk2-GFP reached a nucle- a delay in the activation time and a higher up regulated activity after ar accumulation similar to WT in kap108Δ strain post-60 min of NaCl the maximum level was attained at 10 min post-osmotic stress. A strong addition. The results indicate that upon osmotic stress, Tpk1 trans- effect on RPS29B gene was observed, the deregulated Tpk2 activity, in http://doc.rero.ch port to the nucleus is regulated by the combined activity of Kap114 clear difference with deregulated Tpk1, promoted a rapid and sustained and Kap123 whereas Kap108 has not a major role in Tpk2 import gene upregulation in response to osmostress. These results suggest that to the nucleus after 40–60 min of osmotic stress. Future studies each Tpk catalytic isoform could play different roles in the gene expres- will have to determine whether an alternative β-karyopherin path- sion regulation in response to osmotic stress. way is involved in Tpk2 nuclear accumulation in response to Considering that deregulated PKA activity increased osmostress osmotic stress. gene expression, we tested if the recruitment of chromatin remodelers changed in osmo-responsive genes by high PKA activity. Snf2, the cata- 3.2. Role of PKA activity on gene expression and cellular survival in response lytic subunit of the SWI/SNF chromatin remodeling complex has been to osmostress shown to be recruited to osmotically inducible genes [42]. Arp8, component of INO80 chromatin-remodeling enzyme complexes, has an acti- Taking into account the previous results which showed that saline vating function for transcription [43], but also seems to be relevant for stress increased Tpk1 nuclear localization we wondered whether this efficient downregulation of gene expression under stress conditions

Fig. 2. (A) Validation of KAP95 mutant cells. Left panel, cell integrity defect in tetO::KAP95 mutant cells. Glucose exponentially growing cells from Bcy1-GFP and tetO::KAP95 Bcy1-GFP strains were treated (+DOX) or not with 5 μg/ml doxycycline; after 6 h cells were resuspended in water, digested with 1 mg/ml zymolyase 20 T and OD 600 nm was determined. Values represent the mean ± SEM of three independent experiments. Right panel, KAP95 mRNA expression level was determined by Northern-Blot on aliquots of cultures before and after treatment with 5 μg/ml doxycycline during 6 h. Values represent the mean ± SEM of two independent experiments (*P b 0.005). (B) Bcy1-GFP localization in tetO::KAP95 strain. TetO::KAP95 Bcy1-GFP, tetO::KAP109 Bcy1-GFP (as a control) and Bcy1-GFP strains were treated or not with 5 μg/ml doxycycline for up to 6 h. At different times after doxycyline additions Bcy1-GFP subcellular localization was analyzed as described in Materials and methods. Values represent the mean ± SEM of three independent experiments. 300 cells were counted in each exper- iment (brackets denote significant differences P b 0.005 Time 0 versus Time 6 h). (C) Analysis of β-karyopherins involved in in vivo nuclear import of PKA subunits. Wild type and β- karyopherin mutant strains expressing Tpk1-GFP, Tpk2-GFP or Bcy1-GFP were grown until exponential phase at 30 °C on YPGlu. Cells were fixed with formaldehyde, nuclei stained with DAPI and location analyzed by fluorescence microscopy. The strain tetO::KAP95 was pre-incubated with doxycycline during 4 h as described in Materials and methods. The graph indicates the percentage of cells with nuclear localization N N C. 100 cells were counted for each determination. Values represent the mean ± SEM of three independent experiments (*P b 0.005). (D) Kinetics of nuclear-cytoplasmatic transport of PKA subunits in response to osmotic stress. Strains used in C (except tetO::KAP95) were grown to exponential phase on YPGlu and osmostressed by the addition of 0.4 M NaCl. Aliquots were taken at the indicated times and subcellular localization was determined as described before. Values represent the mean ± SEM of four independent experiments (brackets denote significant differences P b 0.005 Time 0 versus Time 30 min or Time 60 min kap108Δ).

5 http://doc.rero.ch

Fig. 3. (A) Analysis of PKA role on gene expression. The mRNA expression level was determined by Northern-Blot on aliquots of cultures before and after 0.4 M NaCl addition as indicated. The strains used were wild type (WT) and bcy1Δ. The mRNA levels were quantiﬁed by densitometric analysis and normalized to the 25S rRNA ribosomal. (B) Osmosensitivity of yeast mutant bcy1Δ and wild type strains. The osmosensitivity was determined by spot assay. Serial dilutions (1/10) of the wild type and bcy1Δ strains were spotted on plates containing 0.5 or 1 M NaCl and grown for 48 h (see Materials and methods). (C) Analysis of the role of Tpk1 and Tpk2 on gene expression. The mRNA expression level for ALD6 and RPS29B genes was analyzed as described in (A) using the strains Tpk1tpk2Δtpk3Δbcy1Δ and Tpk2tpk1Δ tpk3Δbcy1Δ. The values of WT and bcy1Δ were re-plotted from Fig. 3A for comparison. (D) Kinetic ChIP analysis of chromatin remodeling complexes association in response to osmotic stress. Exponentially growing yeast cells expressing Snf2-TAP, Snf2-TAP Tpk2tpk1Δtpk3Δbcy1Δ, Arp8-TAP and Arp8-TAP Tpk2tpk1Δ tpk3Δbcy1Δ were used. ChIP analysis of indicated protein association to the ALD6 and RPS29B chromatin regions were performed before and after different time points of osmostress (0.4 M NaCl). Fold IP was calculated as reported previously. Each bar represents the mean ± SEM, from two independent experiments (brackets denote signiﬁcant differences P b 0.005 ALD6 gene Time 5 min versus Time 0 and 20 min Snf2-TAP and Arp8-TAP; Time 0 min versus Time 5 and 20 min Snf2-TAP Tpk2tpk1Δtpk3Δbcy1Δ and Arp8-TAP and Arp8-TAP Tpk2tpk1Δ tpk3Δbcy1Δ. RPS29B gene Time 0 min versus Time 10 and 20 min Snf2-TAP and Arp8-TAP).

6 [44]. We therefore analyzed the kinetic recruitment of the remodeler PKA activity Tpk2tpk1Δtpk3Δbcy1Δ. Wild type and mutant strains were subunits Snf2 and Arp8 to the ALD6 coding and the RPS29B promoter re- treated with 0.4 M NaCl and used in ChIP assays. No change in the ex- gions in wild type cells and cells expressing deregulated PKA activity in pression levels of Arp8-TAP and Snf2-TAP proteins expressed from response to osmostress (Fig. 3D). In order to do this, we constructed wild type or from a Tpk2tpk1Δtpk3Δbcy1Δ background was observed strains expressing Snf2-TAP or Arp8-TAP in cells expressing deregulated after osmotic stress as veriﬁed by Western blot (Supplementary http://doc.rero.ch

Fig. 4. Kinetic analysis of PKA subunits recruitment to the open reading frame regions and the promoter regions in response to osmotic stress in vivo. Exponentially growing yeast cells expressing Tpk1-TAP, Tpk2-TAP, Bcy1-TAP, tpk1dead-TAP, tpk2dead-TAP, Tpk1-TAP bcy1Δ or Tpk2-TAP bcy1Δ were used. ChIP analysis of the indicated protein to ALD6 (A), SED1 (B), HSP42 (C), RPS29B (D) and RPL1B (E) was performed before and at the indicated times after 0.4 M NaCl addition as osmostressor. A schematic representation of the ampliﬁed regions in the ChIP experiments is indicated. PKA subunits abundance was calculated as ΔCt (Ct value (IP sample) minus Ct value (input)) relative to the untagged control samples. Each bar represents the mean ± SEM, from three independent experiments (brackets denote signiﬁcant differences P b 0.005).

7 Fig. 4 (continued).

Fig. S3A) and spot assays showed that the cell viability of these strains the transiently ALD6 mRNA expression (Fig. 3C). On the contrary, in http://doc.rero.ch was not affected by the NaCl treatment (Supplementary Fig. S3B). The the strain with deregulated kinase activity, Tpk2tpk1Δtpk3Δbcy1Δ,a results in Fig. 3D show that in response to osmotic stress Snf2 was re- sustained association of Snf2 and Arp8 in correlation with upregulation cruited transiently to the ALD6 coding region with a maximum at of ALD6 mRNA expression was observed. 5 min, while Arp8 was transiently recruited with a maximum at 5– At the RPS29B promoter region the basal occupancy of these 10 min post-osmotic stress. This association pattern correlated with remodelers decreased with NaCl treatment in correlation with mRNA

Fig. 5. Effect of nuclear mislocalization of Tpks on its association with osmoresponsive genes and gene expression. Tpk1-TAP, Tpk1-TAP kap114Δ/kap123Δ, Tpk2-TAP and Tpk2- TAP kap108Δ strains were grown to exponential phase in YPGlu and subjected to osmotic stress by the addition of 0.4 M NaCl during 20 min. Aliquots were taken at the indicated times and the association of PKA to the ALD6 gene was analyzed as described in Materials and methods (brackets denote signiﬁcant differences P b 0.005 Time 10 min Tpk1-TAP versus Tpk1-TAP kap114Δ kap123Δ; P b 0.005 Time 10 min Tpk2-TAP versus Tpk2-TAP kap108Δ). The mRNA expression level for ALD6 gene was determined by Northern-Blot on aliquots of cultures before and after 0.4 M NaCl addition as indicated using the strains kap114Δkap123Δ and kap108Δ. The values of WT, from Fig. 3A, were re-plotted for comparison.

8 downregulation (Fig. 3C). Deregulated kinase activity promoted high wild type strain. However, in the kap114Δkap123Δ strain, the Tpk1- sustained association of Snf2 and Arp8 in correlation with upregulation chromatin association was not detected. A similar result was obtained of RPS29B mRNA expression. for Tpk2-TAP kap108Δ compared to the wild type strain. These results Thus the kinase activity, particularly Tpk2, regulates the remodelers demonstrate that nuclear localization of catalytic subunits would be association to promoters and coding regions to downregulate the gene necessary for its association with chromatin. To test the consequence expression during osmotic stress. of a reduction in nuclear Tpk1 or Tpk2 accumulation on gene expression, we measured the mRNA levels of ALD6 gene in kap114Δkap123Δ 3.3. Genomic recruitment of PKA in response to osmotic stress or kap108 mutant strains. In kap114Δkap123Δ strain ALD6 mRNA was up regulated whereas kap108Δ strain sowed a reduced gene induction It has been previously shown that Tpk1 and Tpk2 associated with upon osmotic stress. These results suggest that, at least in a gene region chromatin [6], particularly to the genomic loci analyzed previously, in analyzed, the gene expression in response to osmotic stress is depen- response to oxidative stress and glucose growth. At this point our re- dent on the proper nuclear localization of PKA subunits and its physical sults demonstrate that in response to osmotic stress, Tpk1 translocates interaction with chromatin. towards the nucleus, while Tpk2 and Bcy1 remain in their nuclear localization and that PKA is involved in the gene expression response of osmostress responsive genes. Taking into account these results, we 4. Discussion wondered whether PKA catalytic and regulatory subunits physically associated with chromatin in response to osmotic stress in vivo. 4.1. Chromatin association of PKA subunits in response to osmotic stress We assessed by ChIP assays the in vivo kinetic recruitment of PKA subunits to genomic regions whose expression profile was modified In response to changes in environmental salinity, cell physiology is by PKA activity in response to osmotic stress (Fig. 3A), namely ALD6, reprogrammed to survive in the new extracellular conditions. Osmotic SED1,andHSP42 coding regions and RPS29B and RPL1B promoter responsive genes show a transient expression pattern. The transcrip- regions. The coordinates corresponding to the analyzed regions are de- tional induction of most genes whose transcription responds to salt tailed in Materials and methods. Strains expressing each PKA subunit stress is dependent on the presence of the stress-activated protein ki- TAP-tagged from its chromosomal locus: Bcy1-TAP, Tpk1-TAP or nase Hog1 [45]. PKA activity negatively regulates the efficient adapta- Tpk2-TAP in a wild type or bcy1Δ background was used in ChIP assays. tion to osmotic stress [41,46,47]. Additionally, Tpk kinase-dead versions with a mutation in the active site Genome wide ChIP-on-Chip experiments in S. cerevisiae revealed causing inactive catalytic subunits, tpk1dead-TAP or tpk2dead-TAP that Tpk1 and Tpk2 interact with chromatin, both in coding and in pro- mutants, were also used in order to analyze the requirement of PKA cat- moter regions under fermentative metabolism or oxidative stress [6]. alytic activity for chromatin association. The expression levels of each We have studied in this work the kinetics of association of PKA subunits PKA subunit, analyzed by western-blot, and cell viability, assayed by to the osmo-responsive gene regions. Our results show that both Tpk1 spot assays, showed no change by exposure of cells to osmotic stress and Tpk2 associate with gene coding regions of ALD6, HSP42,andSED1 (Supplementary Fig. S3A and B). Fig. 4 shows Tpk and Bcy1 recruitment genes in response to osmotic stress. Surprisingly, we also found Bcy1 as- during osmotic stress to the ALD6, SED1, and HSP42 coding regions. In sociated with chromatin in response to osmotic stress (Fig. 4). On pro- response to NaCl addition, Tpk1, Tpk2, and Bcy1 association reached a moter regions RPL1B and RPS29 of ribosomal genes, we found mainly maximum at 10 min post-stress. In the absence of BCY1 function, an ear- Tpk2 association in response to osmotic stress. Unlike coding regions, lier and higher Tpk1 association (5 min) than in wild type cells was ob- no association of Bcy1 of the analyzed promoters was observed served in the three coding regions analyzed. Tpk2 showed a different (Fig. 4). The Tpk catalytic activity is required for their association to recruitment behavior in HSP42 and SED1 regions, since no association chromatin, as occurs with protein kinases Hog1 [39] and Sty1 [5].Dele- was detected in the absence of BCY1. However, ALD6 coding region tion of BCY1 gene not only affects which catalytic subunit isoform binds showed the same behavior as Tpk1 in the bcy1Δ strain; that is an to chromatin in response to osmotic stress, but also modulates the ki- early and high association of Tpk2. Finally, strains expressing catalyti- netics of Tpk association with chromatin (Fig. 4). http://doc.rero.ch cally inactive versions of Tpk1 or Tpk2, tpk1dead and tpk2dead, showed We analyzed the PKA role on gene expression of five gene regions, no association of the subunits with the chromatin under osmotic stress, which are transcriptionally regulated during osmotic stress. Deletion indicating the requirement of catalytic activity for their association. of the regulatory subunit with the consequent constitutive activation ChIP analysis of PKA subunits at RPS29B and RPL1B promoter regions of the cAMP-PKA pathway impairs the transient stress gene expression during osmotic stress is shown in Fig. 4. Both promoter regions are and therefore severely affects the cell survival under osmotic stress mainly occupied by Tpk2 after 5 min post-osmostress. The tpk2dead mu- (Fig. 3). These results are in agreement with previous evidences show- tant and Bcy1 were not found associated with chromatin in these gene ing that the adaptive stress response must be temporarily restricted, regions. The deletion of Bcy1 highly affected the catalytic subunit re- as it has been observed that constitutive activation of stress responsive cruitment since Tpk1 instead of Tpk2 was found associated with both ri- pathways has a detrimental effect on cell growth. For example, bosomal protein gene promoters in a bcy1Δ strain. sustained SAPK activation in both yeast and mammals, leads to cell Overall, the results indicate that in response to osmotic stress both cycle delay and apoptosis [48–50]. Our results suggest that the kinetics Tpk catalytic subunits and Bcy1 regulatory subunit can be recruited to of association of Tpk1 and Tpk2 observed in wild type cells is critical for the coding regions of osmoinducible genes while only Tpk2 catalytic the regulation of the transient expression of osmo-responsive genes. subunit can be recruited to promoter regions of ribosomal protein In wild type cells, the temporal association during osmotic stress of genes. The Tpk association to all gene regions assayed was completely chromatin remodeling factors belonging to SWI/SNF and INO80 com- dependent on their kinase activity. The absence of Bcy1 affected these plexes, to both a coding and a promoter region, correlates with transient interactions. gene expression. We made several observations that suggest that suit- Finally, we studied the relationship between nuclear localization of able temporal association of PKA might negatively regulate the chroma- Tpk1 and Tpk2, its association with chromatin and gene expression tin association of remodelers to efficiently promote down regulation of (Fig. 5). We constructed the kap114Δkap123Δ and kap108Δ strains ex- gene expression. First, Bcy1 negatively regulates the binding of Tpk1 pressing Tpk1 or Tpk2 fused to the TAP tag. The strains were grown to and positively regulates the association of Tpk2 (Fig. 4). Second, the exponential phase on YPGlu, stressed by addition of NaCl and assessed contribution of each Tpk catalytic isoforms in the osmostress gene ex- for Tpk recruitment to the ALD6 coding region by ChIP. In response to pression is different; Tpk2 promotes a sustained gene expression osmotic stress, Tpk1 was associated with an ALD6 coding region in the while Tpk1 activity induces a reduction in gene expression (Fig. 3C).

9 Finally, in strains with deregulated Tpk2 activity chromatin remodelers kinase activity location near the putative substrates such as transcrip- show a high and stable association to target genes (Fig. 3D). tion factors or chromatin regulators. An increased association of Hog1 with stress-responsive genes Supplementary data to this article can be found online at http://dx. strongly correlates with chromatin remodeling and increased gene doi.org/10.1016/j.bbagrm.2015.09.007. expression [51]. Particularly, ALD6, HSP42 and SED1 are examples of genes affected by Hog1 activity which show an increase in transcription after 5 min of stress treatment [6]. In the present work, we show that Transparency document PKA associates to the same genomic regions 10–20 min after stimula- tion with a concomitant downregulation of their expression. In the The Transparency document associated with this article can be found, in online version. light of our findings, we speculate that rapid and transient stress- adaptive response could be regulated by primary association of the Hog1 kinase and the subsequent association of PKA. The in vivo kinetic Acknowledgments analysis of Hog1 and Tpk association to osmotic responsive genes needs to be examined to understand their combined mechanism of We are grateful to S. Moreno for critical reading of manuscript and action. helpful comments. We are very grateful to J.C. Igual, J. Thevelein, G. Schlenstedt, and S. M. Bailer, for kindly supplying yeast strains. This 4.2. Mechanism of nuclear accumulation of PKA in response to osmotic work was supported by a PhD fellowship from CONICET to L. Baccarini; stress and by grants from Agencia Nacional de Promoción Científica y Tecnológica (PICT 2195), from the University of Buenos Aires (UBA X- At present, it is known that a single protein kinase distributed 528), from CONICET (PIP 0519), and from Ministerio de Economía y dynamically between cytoplasm and nucleus can regulate target gene Competitividad, Spain (BFU2011-23326). S. Rossi and P. Portela are expression by both nuclear and cytoplasmic signaling mechanisms. Con- researchers from CONICET. sequently, nuclear-cytoplasmic kinases transport would be important to regulate differential activity in both compartments. A selective nuclear- cytoplasmic transport maintains a specific composition of each com- References partment and offers the possibility of transient regulation of different [1] J.M. Kyriakis, J. Avruch, Mammalian mitogen-activated protein kinase signal transduc- processes. Protein nuclear transport is mediated by the interaction of tion pathways activated by stress and inflammation, Physiol. Rev. 81 (2001) 807–869. the nuclear localization sequence (NLS) or nuclear export sequence [2] M. Proft, K. Struhl, Hog1 kinase converts the Sko1-Cyc8-Tup1 repressor complex (NES) of the cargoes with importin and exportin, respectively [52,53]. into an activator that recruits SAGA and SWI/SNF in response to osmotic stress, Mol. Cell 9 (2002) 1307–1317. Subcellular localization of PKA in S. cerevisiae depends on the envi- [3] E. De Nadal, M. Zapater, P.M. Alepuz, L. Sumoy, G. Mas, F. Posas, The MAPK Hog1 re- ronmental conditions such as carbon source and stress [21,23,54]. cruits Rpd3 histone deacetylase to activate osmoresponsive genes, Nature 427 Several post-translational modifications on regulatory and catalytic (2004) 370–374. [4] H. Li, C.K. Tsang, M. Watkins, P.G. Bertram, X.F. Zheng, Nutrient regulates Tor1 nucle- subunits of yeast PKA affect its nuclear-cytoplasmic localization ar localization and association with rDNA promoter, Nature 442 (2006) 1058–1061. [55–57]. The transport mechanism of PKA subunits through nuclear [5] A. Pascual-Ahuir, M. Proft, The Sch9 kinase is a chromatin-associated transcriptional membrane has not been previously characterized. Here, we describe activator of osmostress-responsive genes, EMBO J. 26 (2007) 3098–3108. [6] D.K. Pokholok, J. Zeitlinger, N.M. Hannett, D.B. Reynolds, R.A. Young, Activated signal that the nuclear accumulation of the PKA catalytic and regulatory sub- transduction kinases frequently occupy target genes, Science 313 (2006) 533–536. unitsisanactiveprocessmediatedthroughdifferentβ-karyopherin pro- [7] A. Schaekel, P.R. Desai, J.F. Ernst, Morphogenesis-regulated localization of protein ki- teins (Fig. 2). This observation suggests an individual and specificPKA nase A to genomic sites in Candida albicans, BMC Genomics 14 (2013) 842. [8] W. Reiter, S. Watt, K. Dawson, C.L. Lawrence, J. Bahler, N. Jones, C.R. Wilkinson, Fis- subunit transport mechanism through the nuclear envelope, as has sion yeast MAP kinase Sty1 is recruited to stress-induced genes, J. Biol. Chem. 283 been observed for Tpk1 nuclear accumulation in response to osmotic (2008) 9945–9956. stress (Fig. 1). [9] J.M. Thevelein, J.H. de Winde, Novel sensing mechanisms and targets for the cAMP- protein kinase A pathway in the yeast Saccharomyces cerevisiae, Mol. Microbiol. 33 We describe that the accumulation of Tpk1 in the nucleus was stim- – http://doc.rero.ch (1999) 904 918. ulated upon osmotic stress, while the nuclear localization of Tpk2 and [10] T. Toda, S. Cameron, P. Sass, M. Zoller, J.D. Scott, B. McMullen, M. Hurwitz, E.G. Krebs, Bcy1 showed no change (Fig. 1). A decrease in cAMP levels following os- M. Wigler, Cloning and characterization of BCY1, a locus encoding a regulatory sub- motic stress [46] would promote an increment of Tpk1-Bcy1 interaction unit of the cyclic AMP-dependent protein kinase in Saccharomyces cerevisiae,Mol. Cell. Biol. 7 (1987) 1371–1377. causing nuclear accumulation of Tpk1 in response to osmotic stress. [11] T. Toda, S. Cameron, P. Sass, M. Zoller, M. Wigler, Three different genes in The in silico analysis of Tpk1, Tpk2 and Bcy1 in search of classical NLS S. cerevisiae encode the catalytic subunits of the cAMP-dependent protein kinase, consensus sequences [58] was unsuccessful. However, the specificity Cell 50 (1987) 277–287. β [12] I. Pedruzzi, N. Burckert, P. Egger, C. De Virgilio, Saccharomyces cerevisiaeRas/cAMP determinants of -karyopherin for the recognition of nuclear targeting pathway controls post-diauxic shift element-dependent transcription through the signals has recently been revised [59] indicating that it will be necessary zinc finger protein Gis1, EMBO J. 19 (2000) 2569–2579. to characterize the NLS sequences of each PKA subunit experimentally. [13] M.T. Martinez-Pastor, G. Marchler, C. Schuller, A. Marchler-Bauer, H. Ruis, F. Estruch, The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for Our results suggest that the gene expression response to osmotic transcriptional induction through the stress response element (STRE), EMBO J. 15 stress is dependent on the proper nuclear localization of PKA subunits (1996) 2227–2235. and its physical interaction with chromatin (Fig. 5). However, the chro- [14] W. Gorner, E. Durchschlag, M.T. Martinez-Pastor, F. Estruch, G. Ammerer, B. fi matin protein kinases association seems to be regulated by different Hamilton, H. Ruis, C. Schuller, Nuclear localization of the C2H2 zinc nger protein Msn2p is regulated by stress and protein kinase A activity, Genes Dev. 12 (1998) mechanisms. For example, a chromatin association of Hog1 fused to a 586–597. generic nuclear import signal (NLS) is mainly dependent on its phos- [15] Y.W. Chang, S.C. Howard, P.K. Herman, The Ras/PKA signaling pathway directly tar- phorylation more than on its nuclear accumulation [60]. Furthermore, gets the Srb9 protein, a component of the general RNA polymerase II transcription apparatus, Mol. Cell 15 (2004) 107–116. the nuclear localization of Tor1 is apparently important for its associa- [16] V. Pelechano, S. Jimeno-Gonzalez, A. Rodriguez-Gil, J. Garcia-Martinez, J.E. Perez- tion with rDNA promoter, however, there is an import-independent Ortin, S. Chavez, Regulon-specific control of transcription elongation across the mechanism that regulates the DNA-binding activity of Tor1 [4]. yeast genome, PLoS Genet. 5 (2009) e1000614. [17] A. Roy, Y.J. Shin, K.H. Cho, J.H. Kim, Mth1 regulates the interaction between the Rgt1 Evidences indicate that signaling complexes associated with chro- repressor and the Ssn6-Tup1 corepressor complex by modulating PKA-dependent matin in some cases include upstream kinase, downstream effectors phosphorylation of Rgt1, Mol. Biol. Cell 24 (2013) 1493–1503. and their regulatory protein phosphatases [61,62]. The presence of the [18] L.S. Robertson, G.R. Fink, The three yeast a kinases have specific signaling functions in pseudohyphal growth, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 13783–13787. PKA holoenzyme as part of a protein complex associated with chroma- [19] X. Pan, J. Heitman, Cyclic AMP-dependent protein kinase regulates pseudohyphal tin suggests a participation in the local genic regulation through the differentiation in Saccharomyces cerevisiae,Mol.Cell.Biol.19(1999)4874–4887.

10 [20] M. Malcher, S. Schladebeck, H.U. Mosch, The Yak1 protein kinase lies at the center of [42] A. Saha, J. Wittmeyer, B.R. Cairns, Chromatin remodeling by RSC involves ATP- a regulatory cascade affecting adhesive growth and stress resistance in Saccharomy- dependent DNA translocation, Genes Dev. 16 (2002) 2120–2134. ces cerevisiae, Genetics 187 (2011) 717–730. [43] J. Ford, O. Odeyale, C.H. Shen, Activator-dependent recruitment of SWI/SNF and [21] V. Tudisca, V. Recouvreux, S. Moreno, E. Boy-Marcotte, M. Jacquet, P. Portela, Differ- INO80 during INO1 activation, Biochem. Biophys. Res. Commun. 373 (2008) ential localization to cytoplasm, nucleus or P-bodies of yeast PKA subunits under 602–606. different growth conditions, Eur. J. Cell Biol. 89 (2010) 339–348. [44] E. Klopf, L. Paskova, C. Sole, G. Mas, A. Petryshyn, F. Posas, U. Wintersberger, G. [22] G. Griffioen, P. Anghileri, E. Imre, M.D. Baroni, H. Ruis, Nutritional control of Ammerer, C. Schuller, Cooperation between the INO80 complex and histone nucleocytoplasmic localization of cAMP-dependent protein kinase catalytic and reg- chaperones determines adaptation of stress gene transcription in the yeast ulatory subunits in Saccharomyces cerevisiae, J. Biol. Chem. 275 (2000) 1449–1456. Saccharomyces cerevisiae, Mol. Cell. Biol. 29 (2009) 4994–5007. [23] V. Tudisca, C. Simpson, L. Castelli, J. Lui, N. Hoyle, S. Moreno, M. Ashe, P. Portela, PKA [45] F. Posas, J.R. Chambers, J.A. Heyman, J.P. Hoeffler, E. de Nadal, J. Arino, The transcrip- isoforms coordinate mRNA fate during nutrient starvation, J. Cell Sci. 125 (2012) tional response of yeast to saline stress, J. Biol. Chem. 275 (2000) 17249–17255. 5221–5232. [46] J.A. Marquez, R. Serrano, Multiple transduction pathways regulate the sodium- [24] D.M. Leslie, W. Zhang, B.L. Timney, B.T. Chait, M.P. Rout, R.W. Wozniak, J.D. extrusion gene PMR2/ENA1 during salt stress in yeast, FEBS Lett. 382 (1996) 89–92. Aitchison, Characterization of karyopherin cargoes reveals unique mechanisms of [47] A. Pascual-Ahuir, F. Posas, R. Serrano, M. Proft, Multiple levels of control regulate the Kap121p-mediated nuclear import, Mol. Cell. Biol. 24 (2004) 8487–8503. yeast cAMP-response element-binding protein repressor Sko1p in response to [25] A. Bakhrat, K. Baranes, O. Krichevsky, I. Rom, G. Schlenstedt, S. Pietrokovski, D. stress, J. Biol. Chem. 276 (2001) 37373–37378. Raveh, Nuclear import of ho endonuclease utilizes two nuclear localization signals [48] G. Yaakov, M. Bell, S. Hohmann, D. Engelberg, Combination of two activating muta- and four importins of the ribosomal import system, J. Biol. Chem. 281 (2006) tions in one HOG1 gene forms hyperactive enzymes that induce growth arrest, Mol. 12218–12226. Cell. Biol. 23 (2003) 4826–4840. [26] S. Caesar, M. Greiner, G. Schlenstedt, Kap120 functions as a nuclear import receptor [49] A. Vendrell, M. Martinez-Pastor, A. Gonzalez-Novo, A. Pascual-Ahuir, D.A. Sinclair, M. for ribosome assembly factor Rpf1 in yeast, Mol. Cell. Biol. 26 (2006) 3170–3180. Proft, F. Posas, Sir2 histone deacetylase prevents programmed cell death caused by [27] N. Mosammaparast, Y. Guo, J. Shabanowitz, D.F. Hunt, L.F. Pemberton, Pathways me- sustained activation of the Hog1 stress-activated protein kinase, EMBO Rep. 12 diating the nuclear import of histones H3 and H4 in yeast, J. Biol. Chem. 277 (2002) (2011) 1062–1068. 862–868. [50] I. Dolado, A.R. Nebreda, AKT and oxidative stress team up to kill cancer cells, Cancer [28] M. Greiner, S. Caesar, G. Schlenstedt, The histones H2A/H2B and H3/H4 are imported Cell 14 (2008) 427–429. into the yeast nucleus by different mechanisms, Eur. J. Cell Biol. 83 (2004) 511–520. [51] E. de Nadal, F. Posas, Osmostress-induced gene expression — a model to understand [29] X. Quan, J. Yu, H. Bussey, U. Stochaj, The localization of nuclear exporters of the how stress-activated protein kinases (SAPKs) regulate transcription, FEBS J. (2015). importin-beta family is regulated by Snf1 kinase, nutrient supply and stress, [52] A.C. Strom, K. Weis, Importin-beta-like nuclear transport receptors, Genome Biol. 2 Biochim. Biophys. Acta 1773 (2007) 1052–1061. (2001) (REVIEWS3008). [30] U. Stochaj, R. Rassadi, J. Chiu, Stress-mediated inhibition of the classical nuclear pro- [53] K. Weis, Nucleocytoplasmic transport: cargo trafficking across the border, Curr. tein import pathway and nuclear accumulation of the small GTPase Gsp1p, FASEB J. Opin. Cell Biol. 14 (2002) 328–335. 14 (2000) 2130–2132. [54] G. Griffioen, S. Swinnen, J.M. Thevelein, Feedback inhibition on cell wall integrity [31] C.M. Demlow, T.D. Fox, Activity of mitochondrially synthesized reporter proteins is signaling by Zds1 involves Gsk3 phosphorylation of a cAMP-dependent protein lower than that of imported proteins and is increased by lowering cAMP in kinase regulatory subunit, J. Biol. Chem. 278 (2003) 23460–23471. glucose-grown Saccharomyces cerevisiae cells, Genetics 165 (2003) 961–974. [55] C.A. Solari, V. Tudisca, M. Pugliessi, A.D. Nadra, S. Moreno, P. Portela, Regulation of [32] H. Ito, Y. Fukuda, K. Murata, A. Kimura, Transformation of intact yeast cells treated PKA activity by an autophosphorylation mechanism in Saccharomyces cerevisiae, with alkali cations, J. Bacteriol. 153 (1983) 163–168. Biochem. J. 462 (2014) 567–579. [33] W.K. Huh, J.V. Falvo, L.C. Gerke, A.S. Carroll, R.W. Howson, J.S. Weissman, E.K. [56] S. Haesendonckx, V. Tudisca, K. Voordeckers, S. Moreno, J.M. Thevelein, P. Portela, O'Shea, Global analysis of protein localization in budding yeast, Nature 425 The activation loop of PKA catalytic isoforms is differentially phosphorylated by (2003) 686–691. Pkh protein kinases in Saccharomyces cerevisiae, Biochem. J. 448 (2012) 307–320. [34] N. Shulga, N. Mosammaparast, R. Wozniak, D.S. Goldfarb, Yeast nucleoporins in- [57] A. Soulard, A. Cremonesi, S. Moes, F. Schutz, P. Jeno, M.N. Hall, The rapamycin- volved in passive nuclear envelope permeability, J. Cell Biol. 149 (2000) 1027–1038. sensitive phosphoproteome reveals that TOR controls protein kinase A toward [35] P.M. Roberts, D.S. Goldfarb, In vivo nuclear transport kinetics in Saccharomyces some but not all substrates, Mol. Biol. Cell 21 (2010) 3475–3486. cerevisiae, Methods Cell Biol. 53 (1998) 545–557. [58] S. Kosugi, M. Hasebe, M. Tomita, H. Yanagawa, Systematic identification of cell cycle- [36] L. Kuras, K. Struhl, Binding of TBP to promoters in vivo is stimulated by activators dependent yeast nucleocytoplasmic shuttling proteins by prediction of composite and requires Pol II holoenzyme, Nature 399 (1999) 609–613. motifs, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 10171–10176. [37] M. Proft, A. Pascual-Ahuir, E. de Nadal, J. Arino, R. Serrano, F. Posas, Regulation of the [59] Y.M. Chook, K.E. Suel, Nuclear import by karyopherin-betas: recognition and inhibi- Sko1 transcriptional repressor by the Hog1 MAP kinase in response to osmotic tion, Biochim. Biophys. Acta 1813 (2011) 1593–1606. stress, EMBO J. 20 (2001) 1123–1133. [60] P.M. Alepuz, A. Jovanovic, V. Reiser, G. Ammerer, Stress-induced map kinase Hog1 is [38] B. Martinez-Bono, I. Quilis, E. Zalve, J.C. Igual, Yeast karyopherins Kap123 and Kap95 part of transcription activation complexes, Mol. Cell 7 (2001) 767–777. are related to the function of the cell integrity pathway, FEMS Yeast Res. 10 (2010) [61] J.D. Nelson, R.C. LeBoeuf, K. Bomsztyk, Direct recruitment of insulin receptor and 28–37. ERK signaling cascade to insulin-inducible gene loci, Diabetes 60 (2011) 127–137. [39] D.B. Berry, A.P. Gasch, Stress-activated genomic expression changes serve a prepar- [62] M.C. Lawrence, C. Shao, K. McGlynn, B. Naziruddin, M.F. Levy, M.H. Cobb, Multiple ative role for impending stress in yeast, Mol. Biol. Cell 19 (2008) 4580–4587. chromatin-bound protein kinases assemble factors that regulate insulin gene tran- [40] H.C. Causton, B. Ren, S.S. Koh, C.T. Harbison, E. Kanin, E.G. Jennings, T.I. Lee, H.L. True, scription, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 22181–22186. http://doc.rero.ch E.S. Lander, R.A. Young, Remodeling of yeast genome expression in response to environmental changes, Mol. Biol. Cell 12 (2001) 323–337. [41] J. Norbeck, A. Blomberg, The level of cAMP-dependent protein kinase A activity strongly affects osmotolerance and osmo-instigated gene expression changes in Saccharomyces cerevisiae, Yeast 16 (2000) 121–137.