Anaerobic Growth of Rhodopseudomonas Palustris on 4

JOURNAL OF BACrERIOLOGY, Sept. 1992, p. 5803-5813 Vol. 174, No. 18 0021-9193/92/185803-11$02.00/0 Copyright ©) 1992, American Society for Microbiology Anaerobic Growth of Rhodopseudomonas palustris on 4-Hydroxybenzoate Is Dependent on AadR, a Member of the Cyclic AMP Receptor Protein Family of Transcriptional Regulators MARILYN DISPENSA,1 CONSTANCE T. THOMAS,2 MIN-KYUNG KIM,1 JOSEPH A. PERROTTA,1 JANE GIBSON,2 AND CAROLINE S. HARWOOD13* Department ofMicrobiologyl* and Center for Biocatalysis and Bioprocessing,3 University of Iowa, Iowa City, Iowa 52242, and Section ofBiochemistry, Molecular and Cell Biology, Cornell University, Ithaca, New York 148532 Received 17 April 1992/Accepted 13 July 1992

The purple nonsulfur phototrophic bacterium Rhodopseudomonas palustris converts structurally diverse aromatic carboxylic acids, including lignin monomers, to benzoate and 4-hydroxybenzoate under anaerobic conditions. These compounds are then further degraded via aromatic ring-fission pathways. A gene termed aadR, for anaerobic aromatic degradation regulator, was identified by complementation of mutants unable to grow anaerobically on 4-hydroxybenzoate. The deduced amino acid sequence of the aadR product is similar to a family of transcriptional regulators which includes Escherichia coli Fnr and Crp, Pseudomonas aeruginosa Anr, and rhizobial FixK and FixK-like proteins. A mutant with a deletion in aadR failed to grow on 4-hydroxybenzoate under anaerobic conditions and grew very slowly on benzoate. It also did not express aromatic acid-coenzyme A ligase II, an enzyme that catalyzes the first step of 4-hydroxybenzoate degradation, and it was defective in 4-hydroxybenzoate-induced expression of benzoate-coenzyme A ligase. The aadR deletion mutant was unaffected in other aspects of anaerobic growth. It grew normally on nonaromatic carbon sources and also under nitrogen-fixing conditions. In addition, aerobic growth on 4-hydroxybenzoate was indistinguishable from that of the wild type. These results indicate that AadR functions as a transcriptional activator of anaerobic aromatic acid degradation.

In recent years, the major biochemical strategies used by CoA ligase that activates 4-hydroxybenzoate has been puri- bacteria to accomplish the anaerobic mineralization of ben- fied from cells grown on this compound (11). This enzyme, zene rings have started to emerge (10, 14). Work with several termed aromatic acid-coenzyme A ligase II (aroIl-CoA li- metabolic types, including fermentative bacteria, bacteria gase), is antigenically distinct from benzoate-CoA ligase. that grow by anaerobic respiration, and phototrophic bacte- The identification of genes required for anaerobic 4-hy- ria, suggests that degradation proceeds in two phases (14). droxybenzoate or benzoate degradation should help define First, aromatic ring substituents are removed or modified to individual enzymatic steps in the pathways and would also yield benzoate, 4-hydroxybenzoate, or their coenzyme A be helpful in determining how the pathways are regulated. In (CoA) derivatives. In the second phase, these compounds this report, we describe the generation and characterization enter central catabolic pathways of ring fission. The first ofR. palustrs mutants defective in growth on these aromatic detailed description of anaerobic benzene ring fission arose acids. We identified a fragment of R. palustris DNA that from studies of benzoate metabolism by the phototrophic complements these mutants and characterized a gene, aadR, bacterium Rhodopseudomonas palustris (9), and the main which is required for wild-type growth on benzoate and features proposed have since been validated by studies with 4-hydroxybenzoate. The deduced amino acid sequence of denitrifying bacteria (1, 7, 31), as well as with R. palustris. the aadR product suggests that it belongs to the Crp family Anaerobic benzoate degradation, as presently understood of transcriptional regulators. in R palustris, is shown in Fig. 1. After an initial activation of benzoate to benzoyl-CoA, the general stability of the MATERIALS AND METHODS benzene ring is overcome by reductive steps leading to the dearomatization of the ring (15). Further modifications by a Bacterial strains and plasmids. The bacterial strains and p-oxidation-like sequence of reactions leads, finally, to ring plasmids used are described in Table 1. All recombinant fission (9, 25). Although most of the enzymes of the benzoate plasmids were maintained in Escherichia coli DH5a. pathway have been studied in only a very limited way, the Media and growth conditions. Except where noted, E. coli initial step in benzoate degradation, its thioesterification to and R palustris were grown at 37 and 30°C, respectively. R. benzoyl-CoA, has been examined in some detail (20), and a palustris was grown in a defined mineral medium (PM) (30). benzoate-CoA ligase that catalyzes this reaction has been Carbon sources (3 mM final concentrations, except succi- purified and characterized (13). nate, malate, and acetate at 10 mM) were added at the time 4-Hydroxybenzoate degradation by R palustris also ap- of inoculation from sterile solutions that had been adjusted pears to be initiated by CoA thioester formation (36), and a to pH 7.0. When cells were grown under dinitrogen-fixing conditions, Na2SO4 (0.1%) was substituted for (NH4)2SO4 in PM. R palustris cells were also grown in a complete medium * Corresponding author. (CA), consisting of PM supplemented with 0.2% yeast ex- 5803 5804 DISPENSA ET AL. J. BACTERIOL.

O OH 04* SCoA Growth in liquid media was monitored by observing the CoA increase in A660, using a Spectronic 21 spectrophotometer (Bausch & Lomb, Rochester, N.Y.). Antibiotics were used at the following concentrations (in Benzoic acid Benzoyl-CoA micrograms per milliliter): for R. palustris, kanamycin, 100; tetracycline, 100; for E. coli, kanamycin, 100; tetracycline, 25; and ampicillin, 100. DNA methods. Chromosomal DNA was purified as de-

0 SCoA 0 SCoA scribed previously (17) from R. palustris cells that had been o#C OSCoA grown aerobically in 50 ml of CA broth for 3 to 4 days, 4- harvested by centrifugation, and resuspended in 2.8 ml of TES buffer (50 mM Tris, 100 mM Na2EDTA, 20% sucrose, A-3-Cydohexene- 1, 4-Cyclohexadiene- 2, 5-Cydohexadiene- pH 8.0). carboxyl -CoA 1-carboxyl-CoA 1-carboxyl-CoA Plasmid DNA for cloning and sequencing was purified by the method of Lee and Rasheed (32). E. coli was transformed 2114 with plasmid DNA by CaCl2 shock treatment (19). T4 DNA ligase and restriction enzymes were purchased from New 04C ,SCoA England Biolabs, Inc. (Beverly, Mass.) and used as directed by the manufacturer. DNA was dephosphorylated as de- A-1-Cyclohexene- scribed by Ausubel et al. (4) with calf intestinal phosphatase carboxyl-CoA from Boehringer Mannheim Biochemicals (Indianapolis,

H20 4 Ind.). Standard methods were used for DNA ligations, agarose gel electrophoresis, and colony hybridizations (34).

04 SCoA O,,C Southern hybridizations were done as described by Ausubel 0OH et al. (4). DNA fragments were purified from agarose gel 2-Hydroxycyclohexane- slices by using the GeneClean kit from Bio 101 (La Jolla, carboxyl-CoA Calif.). Radioactive probes were produced by random primer labeling of purified DNA fragments with the Mul- 2H tiprime random priming kit and [32P]dCTP from Amersham 0 *.SCoA Corp. (Arlington Heights, Ill.). Clone bank construction and storage. CGA009 genomic DNA was partially digested with EcoRI and then size 2-Ketocyclohexane- fractionated in a linear 10 to 40% sucrose gradient (prepared carboxyl-CoA in 1 M NaCl-20 mM Tris [pH 8.0]) by centrifugation for 20 h at 23,000 rpm in a Beckman SW40 rotor at 22°C. Fractions containing DNA fragments in the size range of 20 to 35 kb were pooled for use in clone bank construction. Size- C o SCoA fractionated R palustns DNA was ligated with EcoRI- cbo Pimelyl di-CoA digested, dephosphorylated pLAFR1. The ligated DNA was then packaged into X bacteriophage with a DNA-packaging kit obtained from Boehringer Mannheim Biochemicals. The phage particles were transduced into E. coli S17-1, and colonies were grown on L agar containing tetracycline. The Acetyl-CoA constructed clone bank (consisting of 870 tetracycline-resis- FIG. 1. Proposed pathway of anaerobic benzoate degradation by tant colonies) was stored in microtiter plates. Microtiter R. wells filled with Luria broth were inoculated with single palustris. colonies, and after an overnight incubation and the addition of 20% glycerol (final concentration) to each well, plates were stored at -20°C. tract, 0.5% Casamino Acids, and 10 mM succinate. Luria Matings. R palustns cells to be used as recipients were broth (37) was the complete medium used for E. coli. Media grown aerobically in CA medium for 1 to 2 days. Cultures (3 were solidified with 15 g of agar (Difco Laboratories, De- ml) were harvested and resuspended in 100 to 200 ,ul of CA. troit, Mich.) per liter. An overnight Luria broth culture of E. coli S17-1 donor Cells were usually grown anaerobically in screw-cap tubes harboring an appropriate conjugative plasmid was diluted to or bottles that were completely filled with liquid medium a slightly turbid suspension in PM broth. Matings were (20). Anaerobic growth under nitrogen-fixing conditions was performed by mixing drops of donor and recipient cultures tested in partially filled stoppered tubes containing either a on CA plates, incubating at 37°C overnight, and streaking on nitrogen or an argon atmosphere (21). Solid media were the appropriate selective agar medium. prepared aerobically, and inoculated plates were incubated Isolation of mutants. E. coli S17-1 colonies harboring an R. anaerobically in polycarbonate jars to which GasPak hydro- palustris genomic library constructed as described above gen plus carbon dioxide generator envelopes (BBL Microbi- were pooled and then mutagenized by transduction with ology Systems, Cockeysville, Md.) and sodium hydroxide A::TnS (8). Kanamycin-resistant transductants were mated pellets (to absorb carbon dioxide) had been added. Anaero- en masse with R. palustris CGA009, and transconjugants bic cultures were illuminated with 40-W incandescent lamps were selected on PM agar plates containing kanamycin, 1.0 at a distance of 20 to 40 cm. Cells were grown aerobically mM succinate, and 3 mM benzoate or 4-hydroxybenzoate. with vigorous shaking on a gyratory shaker. After an 8- to 10-day anaerobic incubation, small colonies VOL. 174, 1992 AadR REGULATES ANAEROBIC AROMATIC ACID DEGRADATION 5805

TABLE 1. Bacterial strains and plasmids Strain or Relevant characteristicsa Source or plasmid reference E. coli DH5a F- X- recAl A(1acZYA-argF)U169 hsdR17 thi-I gyrA96 supE44 endAl reLAI GIBCO-BRL 480dlacZAM15 S17-1 thi pro hdsR hdsM+ recA; chromosomal insertion of RP4-2 (Tc::Mu, Km::Tn7) 42 BL21(DE3) F- ompT rB- mB-. Phage DE3 carries the T7 RNA polymerase under control of lacLW5 46 promoter R. palustris CGA009 Wild-type strain, spontaneous Cmr derivative 30 RCHX100 aadR::TnS Kmr This study Plasmids pUC8 Apr 48 pRK415 IncPl, mobilizable cloning vector; Tcr 28 pLAFRl IncPl, mobilizable cosmid cloning vector; TcT 12 pT7-7 T7 RNA polymerase promoter followed by a strong ribosome binding site upstream of an 4 NdeI restriction site; Apr pCTl pLAFRl with 26.5-kb R palustris EcoRI fragment; Tcr This study pMK403 pRK415 with 2.1-kb EcoRI fragment from pCTl; Tcr This study pMK404 pRK415 with 3.9-kb EcoRI fragment from pCT1; Tcr This study pMK405 pRK415 with 4.2-kb EcoRI fragment from pCrl; Tcr This study pMK406 pRK415 with 7.2-kb EcoRI fragment from pCTl1; Tcr This study pHMK806 pUC8 with 7.2-kb EcoRI fragmnent from pCT1; Apr This study pMK407 pRK415 with 7.4-kb EcoRI fragment from pCT1; Tcr This study pMD2062 pRK415 with 4.0-kb EcoRI-HindIII fragment from pCT1; Tcr This study pMD2061 pRK415 with 3.2-kb HindIII-EcoRI fragment from pCT1; Tcr This study pMD8631 pUC8 with 3.2-kb HindIll-EcoRI fragment from pCT1. Used to determine the sequence This study of the 3.2-kb fragment; Apr pMK456 pMK406 with two Tn5 insertions in cloned R palustris DNA; Tcr Kmr This study pMD2561 pUC8 with 2.0-kb HindIII fragment from pMK456. Includes the IS50 element from the This study left side of the left-hand TnS (Fig. 7) and adjacent R palustris DNA. pMA101 pUC8 with 3.4-kb BamHI fragment from pMK456. Includes the IS50 element from the This study right side of the right-hand TnS (Fig. 7) and adjacent R. palustris DNA. pMD5B pT7-7 with the aadR gene on a 775-bp NdeI-EcoRI fragment amplified by PCR from This study pMD8631 with primers AADRNDEI and AADRB; Apr pTKll pRK415 with the aadR gene on a 926-bp EcoRI fragment amplified by PCR from This study pMD8631 with primers AADRA and AADRB; Tcr a Kmr, kanamycin resistance; Apr, ampicillin resistance; Tcr, tetracycline resistance.

were picked from the plates, purified by restreaking, and plasmid (pPHlJl) (24) belonging to the same incompatibility then tested for growth with benzoate or 4-hydroxybenzoate group as pLAFR1 was introduced by conjugation. as the sole carbon source. Almost all the mutant strains Clone bank screening by complementation. The initial isolated by this procedure carried R palustris clones that identification of the complementing clone, pCT1, was ac- had TnS insertions either in the cloned DNA or in the complished as follows. CGA104 cells (Table 2) grown in CA pLAFR1 vector. These strains retained their mutant pheno- plus kanamycin broth were spread on CA plates which were types and became kanamycin sensitive when a second then incubated anaerobically for 2 to 3 days, until a thin film

TABLE 2. R palustris anaerobic aromatic acid degradation mutants Anaerobic growth rate (h)a Class Strain AroII-CoA Complementationc 4-OHB Ben 1A-1 Suc ligaseb 7.2 kbd 3.2 kb Wild type CGA009 13 5 13 5 12 ± 6 7 ± 1 + NAe NA I CGA091 63 6 32 ± 12 9 1 - + - II CGA101 104 36 36 ± 8 17 ± 7 - + + III CGA104 87 27 13 2 9 ± 2 - + + a Doubling times. Numbers are averages of three to five determinations + SD. 4-OHB, 4-hydroxybenzoate; Ben, benzoate; A-1, A-1 cyclohexenecarboxylate; Suc, succinate. b As determined by immunoblot analysis of extracts of cells grown in PM broth plus succinate and 4-hydroxybenzoate. c Complementation was tested on anaerobic 4-hydroxybenzoate plates. d Plasmids pMK406 (carrying the 7.2-kb EcoRI fragment from pC`T1) and pMD2061 (carrying the 3.2-kb HindIII-EcoRI fragment of pC`T1) were used in the complementation tests. ' NA, not applicable. f-, no growth. 5806 DISPENSA ET AL. J. BACTrERIOL. of cells was visible. The R. palustris clone bank prepared as cells were incubated with rifampin (200 ,ug/ml, final concen- described above was then transferred with a 48-prong repli- tration) for 2 h at 30°C before pulse-labeling with L-[355]me- cator from microtiter wells to the lawn of CGA104 cells. The thionine (Amersham). plates were incubated aerobically at 37°C for an additional 12 Rates of oxygen utilization were measured at 30°C with a h to allow conjugation to occur. Transconjugants were Clark-type oxygen electrode (51), using R. palustris cells selected by replicating onto PM medium containing 4-hy- that had been grown aerobically on 4-hydroxybenzoate or droxybenzoate and incubating anaerobically in light for 8 to succinate and washed and resuspended in 50 mM phosphate 10 days. buffer (pH 7.0). Substrate-stimulated oxygen utilization was DNA sequencing and computer analysis. DNA sequencing initiated by the addition of 1 mM 4-hydroxybenzoate. was performed by the dideoxy-chain termination method Cell extracts were prepared and immunoblotting was done with the Sequenase sequencing kit from United States Bio- as described previously (30). Blots were incubated with a chemical Corp. (Cleveland, Ohio) and 35S-dATP from Am- 1:2,000 dilution of anti-benzoate-CoA ligase antiserum or ersham Corp. Some sequencing was done by the DNA with a 1:5,000 dilution of anti-aroII-CoA ligase antiserum. A Facility at the University of Iowa with an Applied Biosys- 1:5,000 dilution of secondary antibody (sheep anti-rabbit IgG tems 3734A Automated DNA Sequencer. The sequences of conjugated to horseradish peroxidase; Bio-Rad Laborato- both DNA strands were determined by using either universal ries, Richmond, Calif.) was used. or synthetic oligonucleotide primers. Plasmid DNA was Nucleotide sequence accession number. The nucleotide denatured and annealed to primers as described by Hattori sequence has been submitted to GenBank and assigned the and Sakaki (22). Primers were synthesized at the Northwest- accession number M92426. ern University Biotechnology Facility. Identification of restriction sites, open reading frame RESULTS (ORF) analysis, and determination of the amino acid sequences of predicted proteins were performed by using DNA Mutant isolation and characterization. We used three Inspector Ile, version 3.15 (Textco Inc., West Lebanon, methods to mutagenize R palustris. These were nitrosogua- N.H.). Protein similarities were detected by searching the nidine treatment coupled with ampicillin enrichment, direct SWISS-PROT protein sequence data bank (Release 21) and delivery of transposons by means of broad-host-range sui- the GenPept data base (Release 71.0) with the FASTA cide plasmids, and indirect delivery of transposons by con- program of Pearson and Lipman (38). Alignment of the jugating E. coli carrying a Tn5-mutagenized R. palustris predicted AadR protein with other Crp-like transcriptional clone bank with wild-type R. palustris. Although we isolated activators was performed by using the Pileup program on the a few benzoate and 4-hydroxybenzoate degradation mutants Genetics Computer Group sequence analysis package, ver- after chemical mutagenesis, all the mutants obtained had sion 7.0 (University of Wisconsin, Madison). Amino acid very high reversion rates, and this precluded their use in identities between pairs of proteins were determined by biochemical or complementation studies. Attempts to muta- using the BestFit program, also with the Genetics Computer genize R palustris directly with Tn3, TnS, Tn7, and TnlO did Group sequence analysis package. not result in increased numbers of antibiotic-resistant colo- Amplification of DNA by PCR. Polymerase chain reaction nies, and at this point, we have no evidence to indicate that (PCR) mixtures were prepared and amplifications were per- transposition of transposons occurs in R. palustris. The formed by the method of Ausubel et al. (4). The amplification indirect transposon mutagenesis procedure was the only reaction was performed for 30 cycles in a DNA Thermal method that generated a reasonable number of stable mu- Cycler (Perkin-Elmer Cetus, Norwalk, Conn.). The DNA tants; 14 transconjugants with defects in growth on 4-hy- was denatured at 94°C for 1 min, annealed for 30 s, and droxybenzoate and benzoate were identified from three extended at 72°C for 1 min. Annealing temperatures varied independent matings. depending on the nucleotide sequence of the primers used. The mutants fell into three classes. Two were distin- Primer melting temperatures were determined, and an an- guished by their relative rates of growth on the proposed nealing temperature that was 5°C lower than the primer with benzoate degradation intermediate, A-1 cyclohexenecarbox- the lowest melting temperature was used. PCR products ylate. A third mutant class (class I) was subsequently defined were analyzed on 1.5% agarose gels. by complementation studies. The characteristics of a repre- The Tn5-specific primer (P5022) used in PCR amplifica- sentative mutant from each class are summarized in Table 2. tions had the sequence 5'GGAAAGGTTCCGTTCAGGAC None of the mutants grew anaerobically with 4-hydroxy- GC3' (3). Since this sequence is part of the inverted repeat benzoate as the sole carbon source. In addition, none that is present at each end of TnS, this primer will amplify expressed aroIl-CoA ligase, the enzyme proposed to cata- DNA flanking each side of the transposon insertion. The lyze the initial step of 4-hydroxybenzoate degradation. The following additional synthetic oligonucleotides were used in mutants also shared the property of slow growth on ben- PCR amplifications (all sequences are 5' to 3'): AADRA, zoate; all had doubling times that were at least four times GGGAATTC/ACCATGCATGACGGTCGTGG; AADRB, longer than that of the wild-type parent. The growth yields of GGGAATTC/TGGGATTCCGGGCGGATGCG; BOT4, GG the mutants on benzoate were the same as those of the wild GCCACCATGCTCCAAT; and AADRNDEI, GCGCCCAT/ type, indicating that cells were not excreting significant ATGCCGCATCTCGCTTAT. The nucleotides to the left of amounts of benzoate degradation intermediates. When the slash are absent in the gene sequence and were added to grown on benzoate, all the mutants synthesized wild-type the primer to create appropriate restriction sites. Additional levels of benzoate-CoA ligase, the enzyme proposed to nucleotides were also added to the 5' end to facilitate binding catalyze the first step of benzoate degradation. and restriction. Some of the mutants (class II, exemplified by CGA101) PCR products were sequenced directly. grew exceptionally slowly on benzoate, with doubling times Other methods. The aadR gene cloned into pT7-7 was that were typically in excess of 100 h. These mutants also expressed in E. coli BL21(DE3) as described previously (4) grew slowly on A-1 cyclohexenecarboxylate. except that the heat induction step was not included and All the mutants grew aerobically on 4-hydroxybenzoate VOL. 174, 1992 AadR REGULATES ANAEROBIC AROMATIC ACID DEGRADATION 5807

pCT1 E E E E _ E E EE - 1 I r I .- 12.11 I 7I .,*4 1I 3.9j . -7 1 7.2 1I a1 4.3 I

E H 40 3.2 t--- 1.0 kb pM06 m

\ pMD2061 ii ~~~ SC Hc A P B _ _ _ 4 6 I . I _- J-- b._ _ _

ORF 1-.> aadR ORF 3 > I 0.5 kb I FIG. 2. Restriction maps of the cosmid clone pCT1 and of two subclones (pMK406 and pMD2061) which complemented mutants defective in anaerobic growth on aromatic acids. The restriction sites as well as the locations and orientations of the three coding regions present on the 3.2-kb HindIII-EcoRI fragment were determined by DNA sequencing. Restriction enzyme sites: A, AccI; B, BamHI; E, EcoRI; H, HindIII; Hc, HincII; P, PstI; Sc, SacI.

and succinate and all grew anaerobically on succinate, both sides of the HindIII site is required for use of these acetate, and malate with doubling times similar to those of substrates. the wild type. The mutant defects appeared, therefore, to be DNA sequencing and identification ofaadR. The nucleotide specific to anaerobic aromatic acid catabolism. sequence of the 3.2-kb HindIII-EcoRI insert had three ORFs Although we expected that the mutants were generated by (Fig. 2). Each had an AUG start site preceded by a putative the homologous recombination of cloned, transposon-dis- ribosome binding site (41). Each ORF also had a G+C- rupted R palustnis DNA with wild-type chromosomal DNA, biased predicted codon usage as would be expected for R. Southern blots of chromosomal DNA from each of the palustris, which has G+C content of 64.8 to 66.3 mol% (26). mutants failed to substantiate this simple view. We found, Searches of the SWISS-PROT and the GenPept data bases for example, that only one of the mutants harbored a revealed that one of the R. palustris translated ORFs was chromosomal TnS insertion, and further analyses showed very similar in sequence to a group of transcriptional regu- that the DNA disrupted by the transposon was not required lators which includes the FixK proteins of several symbiotic for aromatic acid degradation. nitrogen-fixing bacteria and the E. coli Fnr and Crp proteins. Identification and analysis of complementing plasmid pCT1. Subsequent work showed that the R. palustris ORF is also To identify wild-type genes required for anaerobic aromatic likely to function as a regulatory protein, and we therefore acid degradation, an R palustris genomic library was con- named the gene aadR, for anaerobic aromatic degradation structed and mated from E. coli into mutant CGA104 with regulator. selection for anaerobic growth on 4-hydroxybenzoate. A The ORF upstream of aadR encodes a predicted protein was single complementing clone, designated pCT1, isolated. with a molecular weight of 20,771 and 181 amino acids. No was also Subsequent experiments showed that this clone proteins with sequences homologous to ORFi were detected able to complement all the other R palustris mutants, in data base searches. ORF3, which is distal to aadR, to grow on both benzoate and 4-hy- restoring their ability encodes a protein predicted to be 410 amino acids with a droxybenzoate with wild-type generation times. molecular weight of 45,835 (Fig. 2). The N-terminal 250- in was 26 kb in size The R. palustris insert carried pCT1 amino-acid segment of the predicted ORF3 product showed seven EcoRI fragments (Fig. 2). Southern and included to the conserved core region of a family experiments indicated that these fragments significant similarity hybridization of potassium-channel proteins from Drosophila and mam- were contiguous on the R palustris chromosome (data not values were from a comparison of the A series of plasmids (pMK403 to -407) carrying the mals (50). Highest shown). ORF3 and Drosophila Shabll; optimal alignments five EcoRI fragments was prepared, and each mem- product largest these revealed 29% amino acid identity was mated into each of the 14 mutants, with between proteins ber of this series acid residues. on benzoate and 4-hydroxy- over a stretch of 250 amino selection for anaerobic growth of benzoate plates. Of the plasmids tested, only pMK406, The nucleotide and deduced amino acid sequences carrying the subcloned 7.2-kb EcoRI fragment from pCT1, aadR are given in Fig. 3. The nucleotide sequences of the ORFi and aadR and between restored growth on aromatic acids. All 14 mutants were intergenic regions between by aadR and ORF3 are also given. The aadR gene is 716 bp long complemented pMK406. has Additional experiments showed that a 3.2-kb HindIll- and has a G+C content of 62.0%. The translated product EcoRI subclone of the 7.2-kb EcoRI fragment fully comple- 239 amino acids and a molecular weight of 26,666. mented mutants in classes II and III (Table 2). Neither the The aadR gene product. A protein with an apparent mo- 3.2-kb HindIII-EcoRI subclone (pMD2061) nor the adjacent lecular weight of 27,000 was produced when the aadR gene 4.0-kb EcoRI-HindIII fragment (pMD2062) from pMK406 was cloned into the expression vector pT7-7 such that the restored the ability of the class I mutant (CGA091) to grow phage T7 promoter was in the correct orientation to drive on aromatic acids, indicating that genetic information on aadR transcription and the AUG start site of aadR was 5808 DISPENSA ET AL. J. BACTERIOL.

511 GAGTCGCGGCGGCCGCTTGACCCGCTATCATCAGCAGGATCGCCGCACAGGCGAGTAGTC pT7-7 pMD5B S R G G R L T R Y H Q Q D R R T G E - -97.4 571 GTCTCATGAGCCGCCCGTGGTAAAAAAGTCGCCAAACAACGACTTGCACCATGCATG 631 ACGGTCGTGGCATGACCOOTTGMGT GCTGCCTTGACGAATTGCCGACATATTAA 691 CTCTTCTGGCGCAGAGTGGGCGGTCAGTTGACGGCGATGCGCGCCAGGAGAGTTCAGTCT -66.2

751 GGCGACCGCATGGaTGATGGXTGCCGCATCTCGCTTATCCGACGACGACTTGCGAGGGA -42.7 M P H L A Y P T T T C E G de let ion CGA09 1 811 TTTCGCTGTGAGACGCACTGCGCGGTGCGTGGGCTGGCGAATCTGTGGCGAACTCGGCCCT F R C E T H C A V R G L A I C G E L G P 871 GCCGACCACGAAGAGTTCGAACGTCTTGCCCAGCATGTCCGCTATGGGCCGAAGGAAGCG -31 0 A D H E E F E R L A Q H V R Y G P K E A 931 CTGTTCTCCGAGGACGAAGTCGCTGATTCGGTCTACAGCCTGATCGAAGGGATCGCCCGT L F S E D E V A D S V Y S L I E G I A R 991 CTGTACAAGCTGCTTCCCGATGGCCGTCGCCAGATCATCGGTTTTGCGCTTCCCGGCGAT -21.5 L Y K L L P D G R R Q I I G F A L P G D 1051 TTCCTCGGAATGGCACCGGGTAACCGCTACTCCTTCTCGGCCGATTCGATCGGCGGCGTC F L G M A P G N R Y S F S A D S I G G V 14.4 1111 ACCGTCTGCAAATTTTTCCGCGGTCCGTTCCTGCGCTTCATCGAAAACCGCCCACAGATG T V C K F F R G P F L R F I E N R P Q M 1171 CTGCTCCGCATGAACGATTTCGCAACCCGCGAACTCAGCCTCGCCCAGGATCAGATGTTG FIG. 4. Expression of the AadR protein in E. coli. A T7 RNA L L R M N D F A T R E L S L A Q D Q M L polymerase expression system was used as described in the text. An 1231 CTGCTCGGCCGCeGCTCGGCCGAAGAGAAGGTTGCTGCCTTCCTGGTCGGTTGGCGTGAT autoradiogram of a sodium dodecyl sulfate-12% polyacrylamide gel L L G R R S A E E K V A A F L V G W R D is shown. pMD5B contains the aadR gene cloned into pT7-7 in the 1291 CGTCTGGCCCGACTGGAGGGCGTCACTAAAACCGTCAGCCTGCCGATGGGCCGTCAGGAC correct transcriptional orientation with respect to the T7 RNA R L A R L E G V T K T V S L P M G R Q D polymerase promoter. The migrations of molecular mass standards are indicated to the in kilodaltons. 1351 ATTGCCGACTTCCTCGGCCTGACGATCGAAACCGTAAGCCGCACCTTCACCAAGTTGGAG right I A D F L G L T I E T V S R T F T K L E inserted, CGA104 1411 CGGGAAAAACTGATCGTGATCGTTCCGGACGGGGTACGCG'TGCTGGACCCGAAACGCTTC R E K L I V I V P D G V R V L D P K R F binding (43, 45). This helix-turn-helix motif is especially 1471 GACGCGCTCGCCGCGGCCTGAAACGCTTCACTTTCGGCCGCGCATCCGCCCGGAATCCCA highly conserved between AadR and B. japonicum FixK, D A L A A A * with 22 of 24 of the amino acid residues being identical (Fig. 1531 CCCQOMCCACCGATGCGCGACGAAACGCCGGCCTATCTCCGAGCCCGGCATTACTTCTA M R D E T P A Y L R A R H Y F 5). Glycine residues in the N-terminal part of Crp are an important feature of the 13-roll structure of this protein (49). FIG. 3. Nucleotide and deduced amino acid sequences of the Four of these glycine residues are conserved among all the aadR gene. The nucleotide sequences of the intergenic regions between aadR and ORF1 and ORF3 are also shown. Potential homologous proteins, including AadR (Fig. 5). These highly ribosome binding sites are underlined. Horizontal arrows indicate conserved features, as well as the high overall amino acid the sequence which resembles the Fnr and FixK consensus binding sequence similarities, suggest that AadR is a transcriptional sites and therefore defines a possible binding site for the AadR regulator. protein. The vertical arrowhead indicates the site of the Tn5 In addition, a sequence (TTGATC--TGTCAA) that is very insertion in RCHX100. The sites of the mutations in strains similar to the proposed consensus binding sites for Fnr CGA091, CGA101, and CGA104 (see text) are also indicated. (TTGAT--A-ATCAA) and FixK (TTGATC--GATCAA) (6, 44) is present upstream of the aadR translational start site (Fig. 3). Conceivably, AadR binds to this site to autoregulate spaced 8 bases from the ribosome binding site of pT7-7 (Fig. its synthesis. 4). Sequences of aadR genes from aromatic acid degradation Similarity of AadR to the Crp family of regulators. The mutants. DNA sequencing of PCR-amplified aadR DNA deduced amino acid sequence of AadR showed strong sim- revealed that mutant strains CGA091, CGA101, and ilarity to a family of transcriptional regulators that fall into CGA104 all had aadR mutations. CGA091 had a 10-bp three subgroups. These include FixK and FixK-like pro- deletion at the 5' end of the gene, CGA101 had an 11-bp teins, some of which have been shown to activate genes deletion near the middle of the gene, and CGA104 harbored involved in nitrogen fixation (2, 5, 6, 27), a second group that a single base insertion near the 3' end of the gene (Fig. 3). includes proteins (Fnr, Anr, and HlyX) that can activate The ability of strains CGA104 and CGA101 to grow anaero- genes required for anaerobic respiration (33, 39, 44, 52), and bically on 4-hydroxybenzoate was restored when cloned third, Crp, which controls the expression of catabolite- wild-type aadR (carried on pTK11) was supplied to cells in sensitive genes in response to intracellular cyclic AMP levels trans. This plasmid did not complement CGA091, however. (45, 49). AadR was most similar to proteins in the FixK Generation of an aadR deletion mutant. We further exam- group. When the sequences of the proteins were aligned ined the role of AadR in anaerobic aromatic acid degradation optimally, AadR showed 59, 40, and 37% amino acid identity by constructing and characterizing in detail an aadR deletion with the FixK proteins from Bradyrhizobium japonicum, mutant. Plasmid pMK456 (see Fig. 7), carrying two TnS Azorhizobium caulinodans, and Rhizobium meliloti, as well insertions in the complementing 7.2-kb fragment, was gen- as 32% identity with Rhizobium leguminosarum ORF240 (2, erated by mutagenesis with XTn5 in E. coli and then trans- 5, 6, 27). AadR shared 29% amino acid identity with both the ferred to wild-type R. palustris. From among the kanamycin- Anr protein from Pseudomonas aeruginosa and E. coli Fnr, resistant transconjugants that arose, we identified two and it was 24% identical to the Actinobacillus pleuropneu- strains, RCHX100 and RCHX130, which were unable to moniae HlyX protein (33, 39, 44, 52). E. coli Crp and AadR grow on 4-hydroxybenzoate. Subsequent experiments indi- were 22% identical. Identities among all these proteins were cated that these strains were identical. Therefore, through- particularly striking in the region of the C terminus, which out most of this communication, we have reported only the has been shown in Crp and Fnr to be involved in DNA data obtained with RCHX100. Southern blots indicated that VOL. 174, 1992 AadR REGULATES ANAEROBIC AROMATIC ACID DEGRADATION 5809

1 + *+ *+ 50 Tn5 Probe 7.2 Kb Probe AadR ... MPHLAYP TTT.EGFRCE TH.CAVRGLAI CGELGPADHE BFB. RLAQHV CSSLDAAELR ZFB.HLGRRV Bj f ixK .MKPSVVM IEPNGHFCSD ..CAIRTSAV CD O CD GPR.LVA... °0) C0o ° FixK ...... MYAAAQAKPQSIE VEHLGPAPMS °: On aw Fnr MIPEKRIIRR IQSGGCAIHC QDCSISQLCI PFTLNEHELD QLDNIIERKK $) x x Y CD x x c:I I ,)o Crp ...... MV LGKPQTDPTL IWFLSHCHIH oC0 G a: C0C C 51 =* AadR RYGPINALFB IDNVADSVYS LINGIARLYK LLPDGRRQII QFALPGDFLG Bj f ixK HFSSG8TVF8 8EDITT8FYN VLBGVMRLYK LLPDGRRQIV GFALPGDFLG FixK TYKPGREIYA QGDLNDKCYQ VSTGAVRIYR LLSDGRRQVV SFHLPGEMFG Fnr PIQKGQTLFK AGDELKSLYA IRSGTIKSYT ITEQGDEQIT GFHLAGDLVG -23.1 Kb Crp KYPSXSTLIH QGZKAETLYY IVKGSVAVLI KDEEGKEMIL SYLNQGDFIG .w4. -12.1 Kb 101 + 150 AadR MAP. ..G.GNR YBFBADSIGG VTVCKFFRGP FLRPFIINRPQ MLLRMNDFAT

Bj f ixK INL .... SGR HNFSADAIGA VTVCQFAKAP FGRFIBERPQ LLRRINELAI 7.2 Kb FixK FEA GSN HSFFAEAITE TTLAIFGR.. RNMQERSR ELL ALAL Fnr FDAI. .GSGH HPSFAQALET SMVCEIPFET LDDLSGKMPN LRQQIMRLMS Crp ELGLFEEGQE RSAWVRAKTA CEVAEISYKK FRQLIQVNPD ILMRLSSQMA

* * 200 AadR RELSLAQDQM L LR KVAAFLVGWR DRLARLEGVT KTVSLPMGRQ Bj f ixK R8LSQARDHM VLLGRRSADU XVAALLGCR ERLLALKGAS DTVPLPMSRQ FixK TGMARAQQHL LVIGRQCAVI RIAAFLVDLC ER QGGG RQLRLPMSRQ Fnr GNIKGDQDMI LLLSKKNA88 RLAAFIYNLS RRFAQRGFSP REFRLTMTRG Crp RRLQVTSEKV GNLAFLDVTG RIAQTLLNLA KQPDAM. THP DGMQIKITR9 201 250 AadR DIADFLGLTI ETV8RTFTKL EREKLIVIVP D GVRVLDPK RFDALAAA.. Bj f ixK DIADYLGLTI BTVSRTFTKL IRHGAIAIIH G GISLLDPA RVEALAA&.. FixK DIADYLGLTI BTVSRVVTKL KERSLIALRD ARTIDIMKPE ALRSLCN... Fnr DIGNYLGLTV BTISRLLGRF QKSGMLAV. K GKYITIENND ALAQLAGHTR Crp EIGQIVGCSR FTVGRILKML LDQNLISA.H GKTIVVYGTR ...... FIG. 6. Southern hybridization analysis of chromosomal DNA from R. palustris wild-type (CGA009) and aromatic acid degradation 251 mutant (RCHX100 and RCHX130) cells. Total chromosomal DNA AadR ... Bj f ixK ... from each of the three strains was digested with EcoRI. The 7.2-kb FixK ... Fnr NVA EcoRI fragment from pHMK806 was the 7.2-kb probe. The BglII Crp ... fragment internal to TnS (obtained from plasmid pBR322::TnS) was as FIG. 5. Alignment of the amino acid sequence of AadR from R. used the TnS probe. palustris with those of Fnr and Crp from E. coli, FixK from R. meliloti, and the FixK-like protein from B. japonicum (BjFixK). Boldface letters indicate amino acids identical to those of AadR. The N-terminal cysteine residues in AadR are underlined. The cysteine 450-bp product. The right-hand junction of the TnS insertion residues essential for Fnr activity (35) are indicated by a plus in RCHX100 was ascertained by sequencing the P5022- symbol. Sites of Fnr mutations contributing to Fnr expression in the BOT4 PCR-amplified fragment. The most straightforward presence of oxygen (29, 35) are indicated by an asterisk. Glycine explanation for these results is that R palustris DNA residues conserved among all five proteins are indicated by an insertions motif in corresponding to the region between the two TnS equals symbol (=). The DNA recognition helix-turn-helix the two the C-terminal parts of the proteins is underlined. in pMK456 was deleted by a recombination between copies of the transposon when RCHX100 was generated. Southern hybridizations with HindIlI-digested RCHX100 chromosomal DNA and an aadR probe also indicated that RCHX100 and RCHX130 had single chromosomal TnS in- this strain was an aadR deletion mutant (data not shown). sertions in the complementing 7.2-kb EcoRI fragment (Fig. RCHX100 cells carrying the cloned aadR gene (pTK11) in 6). To determine the position of the TnS insertion in trans grew on 4-hydroxybenzoate under anaerobic condi- RCHX100, we did a series of PCR amplifications with tions, indicating that the ORF3 deletion did not contribute to various primer pairs and analyzed the products generated. the mutant phenotype. These experiments, which are summarized below and in Fig. Characterization of aadR deletion mutant. RCHX100 did 7, showed that RCHX100 had a TnS inserted at the transla- not grow photoheterotrophically on 4-hydroxybenzoate and tional start site of aadR, as well as an adjacent deletion grew slowly on benzoate, with a doubling time of 40 h. which extended across the entire aadR coding region and Photoheterotrophic growth rates of RCHX100 on the nonar- into the proximal portion of the adjacent ORF3. omatic substrates A-3 cyclohexenecarboxylate, A-1 cyclo- When a primer (AADRA) complementary to DNA up- hexenecarboxylate, and pimelate, all proposed benzoate stream of aadR and a TnS-specific primer (P5022) were used degradation intermediates, were the same as those of the in PCR amplifications, a 200-bp product was generated, as wild-type parent. Wild-type growth rates were also achieved would be predicted if the TnS at position 771 in pMK456 had by RCHX100 cells supplied with malate, acetate, butyrate, entered the R. palustris chromosome by homologous recom- or valerate as carbon sources. bination. The precise left-hand junction of the chromosomal RCHX100 had no major impairment in its ability to grow TnS insertion was confirmed by sequencing the PCR prod- on succinate under nitrogen-fixing conditions. The doubling uct. Assuming that a straightforward homologous recombi- times of the aadR mutant and the wild type in liquid medium nation took place between the chromosome and the DNA that was free of combined nitrogen but supplied with an flanking the left-hand TnS in pMK456, we also predicted that atmosphere of nitrogen gas were 14 and 23 h, respectively. a primer (AADRB) complementary to DNA downstream RCHX100 had a doubling time of 50 h when grown on from aadR and a TnS-specific primer would generate an benzoate under nitrogen-fixing conditions. The correspond- 800-bp PCR product. However, we failed to detect any ing doubling time for wild-type cells was 21 h. Neither product at all when this primer combination was used. A RCHX100 or CGA009 grew in nitrogen-free PM liquid under primer (BOT4) more distal to the aadR gene was therefore an argon atmosphere. used in conjunction with the Tn5-specific primer to amplify RCHX100 was unimpaired in aerobic growth on 4-hydrox- RCHX100 DNA. This primer combination, predicted to ybenzoate. Wild-type cells initiate the degradation of this yield a product about 1,600 bp in size, instead generated a compound by performing two oxygenase-catalyzed reac- 5810 DISPENSA ET AL. J. BACT1ERIOL.

Tn5 (771) Tn5(1896) H B I H B H

pMR456

P B E RCHX100 I I - - - - -_ AADRA (621) ADB1530) BT344 AADRB(1530) BOT4 (2344)

/AADRB AADRA/ P5 02 2 - P5022 Predicted - 200 80b PCR Products bp P5022/BOT 4 1600 bp

AADRA/P5022 Actual _ 200 bp P5022/BOT 4 PCR Products 450 bp

H E SC Hc A P B CGAOO9 I I I

ORF 1 -- aadR -*- ORF 3

0.5 kb I FIG. 7. Map of the aadR mutant RCHX100 as deduced from the sizes and sequences of PCR-amplified products. The mutant was generated when plasmid pMK456 was conjugated into the wild-type strain, CGA009. The locations of PCR oligonucleotide primers, Tn5 insertions, and relevant restriction sites are indicated. The dashed line represents deleted DNA. Numbers refer to distances in base pairs as determined from the sequence of the 3.2-kb HindIII-EcoRI fragment in pMD8631. A downward-pointing arrow indicates that the primer was complementary to the bottom strand, and an upward-pointing arrow indicates that the primer was complementary to the top strand. The locations of the TnS insertions in pMK456 were determined by restriction mapping and sequencing of the subclones pMD2561 and pMA101 (Table 1). The PCR products predicted to be generated from RCHX100 with various primer pairs, assuming that a straightforward homologous recombination took place between CGA009 and the DNA flanking the left-hand Tn5 in pMK456, are indicated diagrammatically. The sizes of the actual PCR products that were amplified from RCHX100 chromosomal DNA with various primer pairs are also indicated. No PCR product was generated when the P5022-AADRB primer combination was used. The precise site of the Tn5 insertion in RCHX100 was determined by sequencing the AADRA-P5022 and P5022-BOT4 PCR-amplified products. Restriction enzyme sites: A, AccI; B, BamHI; E, EcoRI; H, HindIII; Hc, HincII; P, PstI; Sc, Sacl. tions (23), and 4-hydroxybenzoate-grown cells of both the ligase gene was intact. Benzoate-CoA ligase antigen was wild-type strain and the aadR mutant consumed oxygen at present at wild-type levels in RCHX100 grown in the pres- similar rates (2.0 nmol of oxygen consumed per min per mg ence of benzoate. Unlike the parent CGA009, however, of protein) in response to an addition of 4-hydroxybenzoate. RCHX100 did not express this ligase when grown in the There was no measurable 4-hydroxybenzoate-stimulated ox- presence of 4-hydroxybenzoate (Fig. 8). We have shown ygen consumption by succinate-grown cells of either the previously that 4-hydroxybenzoate itself elicits the synthesis wild-type strain or strain RCHX100, indicating that AadR is of benzoate-CoA ligase (30). These results indicate that probably not a negative regulator of aerobic aromatic com- AadR is a positive regulator of aroII-CoA ligase gene expres- pound catabolism. sion and that it also plays a role in 4-hydroxybenzoate-, but The aadR deletion in RCHX100 affected expression of not benzoate-, induced expression of benzoate-CoA ligase. both known aromatic acid-CoA ligases as determined by immunoblotting. At most, only traces of aroll-CoA ligase DISCUSSION were found in extracts of cells grown under any conditions, including succinate supplemented with 4-hydroxybenzoate Data presented here indicate that AadR regulates the as an inducer (Fig. 8). Although no antigen is visible in Fig. synthesis of benzoate-CoA ligase and aroIl-CoA ligase, 8, traces of protein, amounting to no more than 10%, were enzymes that catalyze the initial reactions in the anaerobic seen in some immunoblots, indicating that the aroII-CoA degradation of benzoate and 4-hydroxybenzoate, respec- VOL. 174, 1992 AadR REGULATES ANAEROBIC AROMATIC ACID DEGRADATION 5811 of its se- A CGA009 RCHX100 fixK-like gene was designated as such because SUC BEN POB SUC BEN POB quence similarity to other rhizobial fixK genes and because its expression depends on the two-component regulator 106.0 system FixLJ (2). However, a B. japonicum fixK mutant - 80 0 differed fromfixK mutants of other rhizobium species in that 49.5 it was not defective in symbiotic nitrogen fixation (2). This suggests either that there is a second fixK homolog in this - 32.5 species or that the major function of the fixK-like gene is to regulate an anaerobic process other than nitrogen fixation itself. The extraordinarily high amino acid identity between B. japonicum FixK and R. palustris AadR suggests that they B AG RCHX100 could have similar functions. SUC BEN POB SUC BEN POB A variety of hydroxyl- and methyl-substituted benzoates, partially reduced alicyclic compounds A-i- and -1 06.0 as well as the 80 0 A-3 cyclohexenecarboxylate, induce expression of benzoate- CoA ligase in wild-type R palustris (30), and it is possible - 49.5 that gene expression in response to these multiple inducers is - 32.5 mediated by multiple regulatory proteins. This would ex- plain the observation that aadR is required for benzoate- CoA ligase expression in cells grown anaerobically on 4-hy- R. palustris droxybenzoate but not benzoate (Fig. 8). It may be that FIG. 8. Western blot (immunoblot) analysis of or indirectly to sense levels of CGA009 and RCHX100 extracts prepared from cells grown with 10 AadR functions directly mM succinate (SUC), with 10 mM succinate plus 3 mM benzoate 4-hydroxybenzoate. It also may be that the expression of the (BEN), or with 10 mM succinate plus 3 mM 4-hydroxybenzoate aadR gene is itself regulated by other proteins responding to (POB). Cells were harvested in the mid-logarithmic phase of growth. environmental conditions, as has been shown for some of the (A) Immunoblot probed with aroII-CoA ligase antiserum. The fixK genes (2, 5, 27). arrowhead indicates the position of the aroll-CoA ligase protein. AadR almost certainly regulates the expression of other Twenty micrograms of protein was loaded per lane. (B) Immunoblot anaerobic aromatic degradation genes in addition to the two probed with benzoate-CoA ligase antiserum. The arrowhead indi- aromatic acid-CoA ligases. Since the aadR mutant cates the position of the benzoate-CoA ligase protein. Five micro- of molecular RCHX100 expresses wild-type levels of both ligases when grams of protein was loaded per lane. The migrations it would seem that defects in the mass standards are indicated to the right in kilodaltons. grown on benzoate, expression of additional functions must be responsible for the slow growth of this mutant on benzoate. The large excess of benzoyl-CoA, compared with the concentrations of par- tively. The deduced amino acid sequence of AadR is similar tially reduced thioesters in the intracellular pools of expo- to those of several other prokaryotic transcriptional activa- nentially growing R. palustris (15), suggests that the initial tors, the best studied of which are Crp and Fnr from E. coli. reductive step is rate limiting in vivo and therefore a likely By analogy with what is known about the mechanism of target for AadR regulation. action of these proteins, it is likely that AadR functions by The inability of cells to express aroII-CoA ligase may be binding to DNA to activate the transcription of aromatic acid sufficient to prevent growth on 4-hydroxybenzoate. At ligase genes in response to an environmental signal. Since present, we do not know whether R. palustris degrades aadR affects the expression of anaerobic pathways, one 4-hydroxybenzoate by dehydroxylating 4-hydroxybenzoyl- obvious signal would be oxygen deprivation. AadR has some CoA to benzoyl-CoA, as has been shown for denitrifying of the features that are important for normal Fnr-mediated bacteria (16), or whether a reaction sequence that is at least gene expression in response to oxygen. These include a partially independent of the benzoate pathway is involved. conserved cysteine residue at position 122 (Fnr numbering) Members of all three classes of aromatic acid degradation and a cluster of four cysteines in the N-terminal part of the mutants that we isolated (Table 2) are aadR mutants. Class protein (Fig. 5). The four cysteine residues present in the N I, which includes only one strain (CGA091), is very similar terminus of Fnr, three of which (Cys-20, -23, and -29) are phenotypically to class II mutants. However, we were essential for activity (35, 40), have been proposed to define unable to complement CGA091 with either the aadR gene or an iron-chelating redox-sensing domain that may function to the 3.2-kb HindIII-EcoRI fragment which includes aadR sense oxygen indirectly (18, 47). It is possible that the AadR (Fig. 2). This suggests that CGA091 carries another mutation cysteine cluster plays a similar role, although the AadR and in addition to an aadR defect. Since the 7.2-kb EcoRI Fnr proteins differ with respect to the spacings between the fragment, but not the 4.0-kb EcoRI-HindIII or the 3.2-kb cysteines, a feature that is important for full activity of Fnr HindIII-EcoRI fragments of which the larger fragment is (35). Mutations affecting five different amino acids in Fnr composed (Fig. 2), complemented CGA091, it seems likely have been identified which allow the protein to function in that DNA on both sides of the HindIII site that bisects the the presence of oxygen (29, 35). Only two of them change 7.2-kb fragment is required to restore growth on 4-hydroxy- amino acids that are conserved in AadR (Fig. 5). The strain benzoate. The promoter region of ORF1 (Fig. 2) falls in this of R palustris studied here, like most strains of R. palustris, region. We are presently determining whether R. palustris does not perform anaerobic respiration. requires ORF1 to degrade aromatic compounds anaerobi- AadR is most similar in sequence to the FixK and FixK- cally. like proteins from nitrogen-fixing bacteria (2, 5, 6, 27). We do not understand how the aadR mutants that we However, since aadR mutants grow normally under nitro- isolated after the conjugation of a TnS-mutagenized R. gen-fixing conditions, AadR does not appear to have a palustris clone bank into strain CGA009 were generated, but function analogous to that of FixK. The B. japonicum since this indirect procedure is the only mutagenesis proto- 5812 DISPENSA ET AL. J. BACT1EFRIOL.

col that yielded stable mutants, it seems probable that TnS zoate. J. Bacteriol. 170:1709-1714. played a role. It is possible that the deletions in CGA101 and 14. Gibson, J., and C. S. Harwood. Anaerobic utilization of aro- CGAO91 represent the results of aborted transposition at- matic acids by bacteria. In R. Chaudhry (ed.), Biological tempts. degradation and bioremediation technology of toxic chemicals, Molecular tools that can be used to clone and in press. manipulate 15. Gibson, K. J., and J. Gibson. 1992. Potential early intermediates genes in R. palustris have now been identified. These in anaerobic benzoate degradation by Rhodopseudomonas enabled us to identify aadR, which is required for the palustris. Appl. Environ. Microbiol. 58:696-698. expression of genes involved in anaerobic 4-hydroxyben- 16. Glockler, R., A. Tschech, and G. Fuchs. 1989. Reductive dehy- zoate and benzoate degradation. This is a first step toward droxylation of 4-hydroxybenzoyl-CoA to benzoyl-CoA in a elucidating the molecular basis for aromatic ring fission in denitrifying, phenol-degrading Pseudomonas species. FEBS the absence of oxygen. Lett. 251:237-240. 17. Gray, K. M., and E. P. Greenberg. 1992. Physical and functional ACKNOWLEDGMENTS maps of the luminescence gene cluster in an autoinducer- deficient Vibriofisheri strain isolated from a squid light organ. J. We thank Ellen Neidle for helpful discussions and for construct- Bacteriol. 174:4384-4390. ing pTK11. 18. Green, J., M. Trageser, S. Six, G. Unden, and J. R. Guest. 1991. This work was supported by a cofunded grant from the Depart- Characterization of the FNR protein of Eschenchia coli, an ment of Energy, Division of Energy Biosciences (DE-AI105- iron-binding transcriptional regulator. Proc. R. Soc. Lond. B 89ER13999), and the U.S. Army Research Office (DAAL03-89-K- Biol. Sci. 244:137-144. 0121) to C.S.H. and by grant DE-FG02-86ER13495 from the 19. Hanahan, D. 1985. Techniques for transformation of E. coli, p. Department of Energy, Division of Energy Biosciences, to J.G. 109-135. In D. M. Glover (ed.), DNA cloning, a practical approach, vol. 1. IRL Press, Oxford. REFERENCES 20. Harwood, C. S., and J. Gibson. 1986. Uptake of benzoate by 1. Altenschmidt, U., B. Oswald, and G. Fuchs. 1991. Purification Rhodopseudomonas palustris grown anaerobically in light. J. and characterization of benzoate-coenzyme A ligase and 2-ami- Bacteriol. 165:504-509. nobenzoate-coenzyme A ligases from a denitrifying Pseudomo- 21. Harwood, C. S., and J. Gibson. 1988. Anaerobic and aerobic nas sp. J. Bacteriol. 173:5494-5501. metabolism of diverse aromatic compounds by the photosyn- 2. Anthamatten, D., B. Scherb, and H. Hennecke. 1992. Character- thetic bacterium Rhodopseudomonas palustris. Appl. Environ. ization of a fixLJ-regulated Bradyrhizobium japonicum gene Microbiol. 54:712-717. sharing similarity with the Escherichia coli fnr and Rhizobium 22. Hattori, M., and Y. Sakaki. 1986. Dideoxy sequencing method meliloti fixK genes. J. Bacteriol. 174:2111-2120. using denatured plasmid templates. Anal. Biochem. 152:232- 3. Auerswald, E. A., G. Ludwid, and H. Schaller. 1981. Structural 238. analysis of Tn5. Cold Spring Harbor Symp. Quant. Biol. 45:107- 23. Hegeman, G. D. 1967. The metabolism ofp-hydroxybenzoate by 113. Rhodopseudomonas palustris and its regulation. Arch. Mikro- 4. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. biol. 59:143-148. Seidman, J. A. Smith, and K. Struhl. 1987. Current protocols in 24. Hirsch, P. R., and J. E. Beringer. 1984. A physical map of molecular biology. Greene Publishing Associates and Wiley pPHlJ1 and pJB4J4. Plasmid 12:139-141. Interscience, New York. 25. Hutber, G. N., and D. W. Ribbons. 1983. Involvement of 5. Batut, J., M.-L. Daveran-Mingot, M. David, J. Jacobs, A. M. coenzyme A esters in the metabolism of benzoate and cyclo- Garnerone, and D. Kahn. 1989. fixK, a gene homologous with hexanecarboxylate by Rhodopseudomonas palustris. J. Gen. fnr and crp from Escherichia coli, regulates nitrogen fixation Microbiol. 129:2413-2420. genes both positively and negatively in Rhizobium meliloti. 26. Imhoff, J. F., and H. G. Truper. 1989. Purple nonsulfur bacteria, EMBO J. 8:1279-1286. p. 1658-1682. In W. R. Hehsyl (ed.), Bergey's manual of 6. Colonna-Romano, S., W. Arnold, A. Schliiter, P. Boistard, A. systematic bacteriology, vol. 3. The Williams & Wilkins Co., Puihler, and U. B. Priefer. 1990. An Fnr-like protein encoded in Baltimore. Rhizobium leguminosarum biovar viciae shows structural and 27. Kaminski, P. A., K. Mandon, F. Arigoni, N. Desnoues, and C. functional homology to Rhizobium meliloti FixK. Mol. Gen. Elmerich. 1991. Regulation of nitrogen fixation inAzorhizobium Genet. 223:138-147. caulinodans: identification of a fixK-like gene, a positive regu- 7. Dangel, W., R. Brackmann, A. Lack, M. Mohamed, J. Koch, B. lator of nifA. Mol. Microbiol. 5:1983-1991. Oswald, B. Seyfried, A. Tschech, and G. Fuchs. 1991. Differen- 28. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. tial expression of enzyme activities initiating anoxic metabolism Improved broad-host-range plasmids for DNA cloning in Gratn- of various aromatic compounds via benzoyl-CoA. Arch. Micro- negative bacteria. Gene 70:191-197. biol. 155:256-262. 29. Kiley, P. J., and W. S. Reznikoff. 1991. Fnr mutants that activate 8. deBruUn, F. J., and J. R. Lupski. 1984. The use of transposon gene expression in the presence of oxygen. J. Bacteriol. 173: Tn5 mutagenesis in the rapid generation of correlated physical 16-22. and genetic maps of DNA segments cloned into multicopy 30. Kim, M.-K., and C. S. Harwood. 1991. Regulation of benzoate- plasmids-a review. Gene 27:131-149. CoA ligase in Rhodopseudomonas palustris. FEMS Microbiol. 9. Dutton, P. L., and W. C. Evans. 1969. The metabolism of Lett. 83:199-204. aromatic compounds by Rhodopseudomonas palustns. Bio- 31. Koch, J., and G. Fuchs. 1992. Enzymatic reduction of benzoyl- chem. J. 113:525-535. CoA to alicyclic compounds, a key reaction in anaerobic 10. Evans, W. C., and G. Fuchs. 1988. Anaerobic degradation of aromatic metabolism. Eur. J. Biochem. 205:195-202. aromatic compounds. Annu. Rev. Microbiol. 42:289-317. 32. Lee, S., and S. Rasheed. 1990. A simple procedure for maximum 11. Fogg, G. C., and J. Gibson. 1990. 4-Hydroxybenzoate-coen- yield of high-quality plasmid DNA. BioTechniques 9:676-679. zyme A ligase from Rhodopseudomonaspalustris. Abstr. Annu. 33. Maclnnes, J. I., J. E. Kim, C.-J. Lian, and G. A. Soltes. 1990. Meet. Am. Soc. Microbiol. 1990, K 137. Actinobacillus pleuropneumoniae hlyX gene homology with the 12. Friedman, A. M., S. R. Long, S. E. Brown, W. J. Buikema, and fnr gene of Escherichia coli. J. Bacteriol. 172:4587-4592. F. M. Ausubel. 1982. Construction of a broad host range cosmid 34. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning vector and its use in the genetic analysis of Rhizobium cloning: a laboratory manual. Cold Spring Harbor Laboratory, mutants. Gene 18:289-296. Cold Spring Harbor, N.Y. 13. Geissler, J. F., C. S. Harwood, and J. Gibson. 1988. Purification 35. Melville, S. B., and R. P. Gunsalus. 1990. Mutations inftur that and properties of benzoate-coenzyme A ligase, a Rhodopseudo- alter anaerobic regulation of electron transport-associated genes monas palustris enzyme involved in the degradation of ben- in Escherichia coli. J. Biol. Chem. 265:18733-18736. VOL. 174, 1992 AadR REGULATES ANAEROBIC AROMATIC ACID DEGRADATION 5813

36. Merkel, S. M., A. E. Eberhard, J. Gibson, and C. S. Harwood. 45. Steitz, T. A. 1990. Structural studies of protein-nucleic acid 1989. Involvement of coenzyme A thioesters in anaerobic interaction: the sources of sequence specific binding. Q. Rev. metabolism of 4-hydroxybenzoate by Rhodopseudomonas Biophys. 23:205-280. palustris. J. Bacteriol. 171:1-7. 46. Studier, F. W., A. H. Rosenberg, J. J. Dann, and J. W. 37. Miller, J. H. 1972. Experiments in molecular genetics. Cold Dubendorff. 1990. Use of T7 polymerase to direct expression of Spring Harbor Laboratory, Cold Spring Harbor, N.Y. cloned genes. Methods Enzymol. 185:60-89. 38. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for 47. Trageser, M., and G. Unden. 1989. Role of cysteine residues and biological sequence comparison. Proc. Natl. Acad. Sci. USA of metal ions in the regulatory functioning of FNR, the tran- 85:2444-2448. scriptional regulator of anaerobic respiration in Escherichia 39. Sawers, R. G. 1991. Identification and molecular characteriza- coli. Mol. Microbiol, 3:593-599. tion of a transcriptional regulator from Pseudomonas aerugi- 48. Vieira, J., and J. Messing. 1982. The pUC plasmids, an nosa PAO1 exhibiting structural and functional similarity to the M13mp7-derived system for insertion mutagenesis and sequenc- FNR protein of Escherichia coli. Mol. Microbiol. 5:1469-1481. ing with synthetic universal primers. Gene 19:259-268. 40. Sharrocks, A. D., J. Green, and J. R. Guest. 1990. In vivo and in 49. Weber, I. T., and T. A. Steitz. 1987. The structure of a complex vitro mutants of FNR, the anaerobic transcriptional regulator of catabolite gene activator protein and cyclic AMP refined at 2.5 E. coli. FEBS Lett. 270:119-122. A resolution. J. Mol. Biol. 198:311-326. 41. Shine, J., and L. Dalgarno. 1975. Determination of cistron 50. Wei, A., M. Covarrubias, A. Butler, K. Baker, M. Pak, and specificity in bacterial ribosomes. Nature (London) 254:34-38. L. Salkoff. 1990. K' current diversity is produced by an ex- 42. Simon, R., U. Priefer, and A. Puihler. 1983. A broad host range tended gene family conserved in Drosophila and mouse. Sci- mobilization system for in vivo genetic engineering: transposon ence 248:599-603. mutagenesis in gram-negative bacteria. BioFTechnology 1:784- 51. Wood, W. A. 1981. Physical methods, p. 286-327. In P. Ger- 791. hardt, R. G. E. Murray, R. N. Costilow, E. W. Nester, W. A. 43. Spiro, S., K. L. Gaston, A. I. Bell, R. E. Roberts, S. J. W. Busby, Wood, N. R. Krieg, and G. B. Phillips (ed.), Manual of methods and J. R. Guest. 1990. Interconversion of the DNA-binding for general bacteriology. American Society for Microbiology, specificities of two related transcriptional regulators, CRP and Washington, D.C. FNR. Mol. Microbiol. 4:1831-1838. 52. Zimmermann, A., C. Reimmann, M. Galimand, and D. Haas. 44. Spiro, S., and J. R. Guest. 1990. FNR and its role in oxygen- 1991. Anaerobic growth and cyanide synthesis ofPseudomonas regulated gene expression in Escherichia coli. FEMS Microbiol. aeruginosa depend on anr, a regulatory gene homologous with Rev. 75:399-428. fnr of Escherichia coli. Mol. Microbiol. 5:1483-1490.