DOCSLIB.ORG

Trinucleotide Repeats: a Structural Perspective

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Trinucleotide Repeats: a Structural Perspective REVIEW ARTICLE published: 20 June 2013 doi: 10.3389/fneur.2013.00076 Trinucleotide repeats: a structural perspective † † Bruno Almeida, Sara Fernandes , Isabel A. Abreu and Sandra Macedo-Ribeiro* Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto, Portugal Edited by: Trinucleotide repeat (TNR) expansions are present in a wide range of genes involved in sev- Thomas M. Durcan, McGill University, eral neurological disorders, being directly involved in the molecular mechanisms underlying Canada pathogenesis through modulation of gene expression and/or the function of the RNA or Reviewed by: Denis Soulet, Laval University, Canada protein it encodes. Structural and functional information on the role of TNR sequences in Thomas M. Durcan, McGill University, RNA and protein is crucial to understand the effect of TNR expansions in neurodegenera- Canada tion.Therefore, this review intends to provide to the reader a structural and functional view *Correspondence: ofTNR and encoded homopeptide expansions, with a particular emphasis on polyQ expan- Sandra Macedo-Ribeiro, Instituto de sions and its role at inducing the self-assembly, aggregation and functional alterations of Biologia Molecular e Celular, Universidade do Porto, Rua do Campo the carrier protein, which culminates in neuronal toxicity and cell death. Detail will be given Alegre 823, 4150-180 Porto, Portugal to the Machado-Joseph Disease-causative and polyQ-containing protein, ataxin-3, provid- e-mail: [email protected] ing clues for the impact of polyQ expansion and its flanking regions in the modulation of †Present address: ataxin-3 molecular interactions, function, and aggregation. Sara Fernandes, Shannon ABC, Keywords: amino acid-repeats, microsatellites, protein complexes, protein aggregation, amyloid, protein structure Limerick Institute of Technology, Limerick, Ireland; Isabel A. Abreu, GplantS, Instituto de Tecnologia Química e Biológica, Oeiras, Portugal. TRINUCLEOTIDE REPEATS AND HUMAN DISEASE act in concert to influence the pattern of selective cell toxic- Trinucleotide repeat (TNR) expansions and their association with ity. Some of those toxicity mechanisms will be briefly discussed neurological disorders have been known for the past 20 years below. (La Spada et al., 1991). Expansion of CAG, GCG, CTG, CGG, TRINUCLEOTIDE REPEATS AND RNA STRUCTURE and GAA repeats located in coding or non-coding sequences of different genes (summarized in Table 1; Figures 1 and 2) are asso- The formation of hairpin structures within the TNR RNA is related ciated with a diverse range of human monogenic diseases such to the gain in RNA toxic function, the major pathogenic mecha- as Spinobulbar Muscular Atrophy (SBMA, a.k.a. Kennedy dis- nism associated with CUG and CGG repeat expansions in non- ease), Huntington Disease (HD), Spinocerebellar Ataxias (SCAs), coding regions of DM1 and FXTAS transcripts, which was also Oculopharyngeal Muscular Dystrophy (OPMD), Myotonic Type 1 shown to contribute to pathogenesis in CAG repeat disorders such (DM1), Fragile X-Associated Tremor Ataxia Syndrome (FXTAS), as HD and Machado-Joseph disease (MJD, a.k.a. SCA3) (reviewed and Friedreich Ataxia (FRDA) (for a review see Orr and Zoghbi, in Krzyzosiak et al., 2012). These duplex structures, whose sta- 2007), with longer repeats being correlated with earlier age at onset bility is positively correlated with the repeat size (Napierala and and increased disease severity. These TNR are highly unstable Krzyzosiak, 1997), sequester dsRNA binding proteins involved in and the repeat tract length can change between affected indi- mRNA splicing such as CUG-binding protein (CUGBP) and mus- viduals within the same family and can be different in different cleblind protein 1 (MBNL1) (Miller et al., 2000), inducing aber- tissues (La Spada, 1997; Brouwer et al., 2009). More interestingly, rant splicing in affected cells, compromising multiple intracellular in the brain of patients affected by CAG expansions, differences pathways, affecting cell-quality control regulation, and ultimately in repeat instability have been found between specific cell types resulting in cell dysfunction (Li and Bonini,2010). Structural stud- (Pearson et al., 2005; Gonitel et al., 2008; Lopez Castel et al., ies on model trinucleotide CUG, CAG, and CGG repeats forming 2010). GCG repeats are usually shorter and reveal a higher sta- double-stranded chains revealed the features induced by peri- bility in different tissues and across generations than CAG repeats. odic U-U, A-A, and G-G mismatches, and provided hints into the The dynamic nature of these DNA repeat expansions is a con- structural details of pathogenic RNAs that are recognized by RNA- sequence of their capability to form different secondary struc- binding proteins (Mooers et al., 2005; Kiliszek et al., 2010, 2011; tures, which interfere with the cellular mechanisms of replication, Kumar et al., 2011; Parkesh et al., 2011). MBNL1 is composed repair, recombination and transcription (for a recent review see of four zinc-containing RNA-binding domains arranged in two Lopez Castel et al., 2010). The molecular mechanisms underly- tandem segments, with the C-terminal zinc-finger pair displaying ing pathogenesis in those disorders, either associated with mental a GC-sequence recognition motif (Teplova and Patel, 2008) and retardation, neuronal, or muscular degeneration, might result interacting with the stem region of expanded CUG RNAs (Yuan 136 from alterations in the levels of gene expression and/or the func- et al., 2007). Electron microscopy analysis of MBNL1:CUG tion of the RNA or protein it encodes, mechanisms that likely complexes showed that the pathogenic dsRNA forms a scaffold www.frontiersin.org June 2013 | Volume 4 | Article 76 | 1 Almeida et al. Frontiers in Neurology Table 1 | Human diseases associated with nucleotide repeat expansions (adapted from Messaed and Rouleau, 2009; Lopez Castel et al., 2010; Matos et al., 2011). Disease name Repeat Repeat Gene Protein (UniProt Biological Normal Disease Protein structure determined? type location identifier, number processa repeat repeat of residues) length length Spinal and bulbar CAG Protein coding AR Androgen receptor Transcription, transcription 9–36 38–62 Residues 20–30 and 671–919 (PDB | Neurodegeneration muscular atrophy region (polyQ) (P10275, 919 residues) regulation code 1xow) (SBMA) Huntington’s disease CAG Protein coding HTT Huntingtin (P42858, 3142 Apoptosis 6–34 36–121 Residues 5–18 (3lrh), Residues 1–17 (HD) region (polyQ) residues) (2ld0, 2ld2), Residues 1–64 (3io4, 3io6, 3ior, 3iot, 3iou, 3iov, 3iow) Dentatorubral- CAG Protein coding ATN1 atrophin 1 (P54259, 1190 Transcription, transcription 7–34 49–88 No structural information pallidouysian atrophy region (polyQ) residues) regulation (DRPLA) Spinocerebellar CAG Protein coding ATXN1 ataxin 1 (P54253, 815 Transcription, transcription 6–39 40–82 Residues 563–693 (1oa8) ataxia 1 (SCA1) region (polyQ) residues) regulation Spinocerebellar CAG Protein coding ATXN2 ataxin 2 (Q99700, 1313 No associated GO 15–24 32–200 Residues 912–928 (3ktr) ataxia 2 (SCA2) region (polyQ) residues) keywords for biological process Spinocerebellar CAG Protein coding ATXN3/MJD ataxin 3 (P54252, 364 Transcription, transcription 10–51 55–87 Residues 1–182 (1yzb), Residues ataxia 3 (SCA3) region (polyQ) residues) regulation, Ubl conjugation 222–263 (2klz) pathway Spinocerebellar CAG Protein coding CACNA1 A CACNA 1A, P/Q-type a1A Calcium transport, ion 4–20 20–29 Residues 1955–1975 (3bxk) ataxia 6 (SCA6) region (polyQ) calcium channel subunit transport, transport (O00555, 2505 residues) Spinocerebellar CAG Protein coding ATXN7 ataxin 7 (O15265, 892 Transcription, transcription 4–35 37–306 Residues 330–401 (2kkr) ataxia 7 (SCA7) region (polyQ) residues) regulation Structure and function of trinucleotide repeats Spinocerebellar CAG Protein coding ATXN17 TATA box binding protein Transcription, transcription 25–42 47–63 Residues 159–337 (1cdw, 1c9b, 1jfi, ataxia 17 (SCA17) region (polyQ) (TBP) (P20226, 339 regulation, Host-virus 1nvp, 1tgh) residues) interaction June 2013 | Volume 4 | Article 76 Multiple skeletal GAC Protein coding COMP cartilage oligomeric matrix Apoptosis, cell adhesion 5 4, 6, 7 Residues 225–757 (3fby). dysplasias (COMP) region protein (a.k.a (polyaspartate) Thrombospondin-5) (P49747, 757 residues) Synpolydactyly GCG Protein coding HOXD13 homeobox D13 (P35453, Transcription, transcription 15 22–29 No structural information | (HOXD13) region (polyA) 343 residues) regulation (Continued) 2 Almeida et al. www.frontiersin.org Table 1 | Continued Disease name Repeat Repeat Gene Protein (UniProt Biological Normal Disease Protein structure determined? type location identifier, number processa repeat repeat of residues) length length Oculopharyngeal GCG Protein coding PABPN1 Polyadenylate-binding mRNA processing 10 12–17 Residues 167–254 (3b4d, 3b4m, Muscular Dystrophy region (polyA) protein 2 (Q86U42, 306 3ucg) (OPMD) residues) Cleidocranial GCG Protein coding RUNX2 Runt-related transcription Transcription; transcription 17 27 No structural information dysplasia (CBFA1) region (polyA) factor 2 (Q13950, 521 regulation residues) Holoprosencephaly GCG Protein coding ZIC2 Zinc-finger protein ZIC 2 Differentiation, 15 25 No structural information (ZIC2) region (polyA) (O95409, 532 residues) neurogenesis, transcription, transcription regulation Hand-Foot-Genital GCG Protein coding HOXA13 homeobox A13 (P31271, Transcription, transcription 18 24–26 No structural information Syndrome/HOXA13)
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • PI4K-Beta and MKNK1 Are Regulators of Hepatitis C Virus
    www.nature.com/scientificreports OPEN PI4K-beta and MKNK1 are regulators of hepatitis C virus IRES-dependent translation Received: 26 March 2015 1,2 3 4 4 Accepted: 22 July 2015 Joachim Lupberger , Claudia Casanova , Benoit Fischer , Amelie Weiss , 1,2 1,2 5 4 4 Published: 01 September 2015 Isabel Fofana , Nelly Fontaine , Toshinobu Fujiwara , Mickael Renaud , Arnaud Kopp , Catherine Schuster1,2, Laurent Brino4, Thomas F. Baumert1,2,6 & Christian Thoma3 Cellular translation is down-regulated by host antiviral responses. Picornaviridae and Flaviviridae including hepatitis C virus (HCV) evade this process using internal ribosomal entry sequences (IRESs). Although HCV IRES translation is a prerequisite for HCV replication, only few host factors critical for IRES activity are known and the global regulator network remains largely unknown. Since signal transduction is an import regulator of viral infections and the host antiviral response we combined a functional RNAi screen targeting the human signaling network with a HCV IRES-specific reporter mRNA assay. We demonstrate that the HCV host cell cofactors PI4K and MKNK1 are positive regulators of HCV IRES translation representing a novel pathway with a functional relevance for the HCV life cycle and IRES-mediated translation of viral RNA. Hepatitis C virus (HCV) is a positive stranded RNA virus replicating in intracellular phospholipid-enriched membrane domains. Several unbiased RNAi screens identified a panel of host factors required for HCV entry, replication and assembly1–4 but none of these previous approaches discriminates effects on mRNA translation. Host protein translation is initiated with the recruitment of the 40S ribosomal subunit to mRNA. This process mostly involves the recognition of a 5′ m7GpppN cap structure by eIF4E of the cap binding complex eIF4F5.
    [Show full text]
  • Identification of DNA Response Elements Regulating Expression of CCAAT/Enhancer-Binding Protein (C/EBP) Β and Δ During Early A
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110114; this version posted May 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Identification of DNA response elements regulating expression of CCAAT/enhancer-binding protein (C/EBP) β and ẟ during early adipogenesis James E. Merrett1,2, Tao Bo1,4, Peter J. Psaltis1,3 and Christopher G. Proud1,2 * 1South Australian Health and Medical Research Institute, Lifelong Health, Adelaide, South Australia, Australia 2University of Adelaide, Department of Molecular and Biomedical Science, Adelaide, South Australia, Australia 3University of Adelaide, Adelaide Medical School, Adelaide, South Australia, Australia 4Shandong-South Australia Joint Laboratory of Metabolic Disease Research, Shandong Provincial Hospital affiliated to Shandong First Medical University *Corresponding author: Christopher Proud E-mail: [email protected] Running title: DNA response elements regulating early adipogenesis Keywords: adipogenesis, adipocyte, cyclic AMP (cAMP), cAMP response element-binding protein (CREB), CCAAT/enhancer-binding protein (C/EBP), glucocorticoid, glucocorticoid receptor, MAPK- interacting kinase (MNK) 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110114; this version posted May 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Abstract Given the high and increasing prevalence of obesity and associated disorders, such as type-2 diabetes, it is important to understand the mechanisms that regulate lipid storage and the differentiation of fat cells, a process termed adipogenesis.
    [Show full text]
  • Supplementary Table 1
    SI Table S1. Broad protein kinase selectivity for PF-2771. Kinase, PF-2771 % Inhibition at 10 μM Service Kinase, PF-2771 % Inhibition at 1 μM Service rat RPS6KA1 (RSK1) 39 Dundee AURKA (AURA) 24 Invitrogen IKBKB (IKKb) 26 Dundee CDK2 /CyclinA 21 Invitrogen mouse LCK 25 Dundee rabbit MAP2K1 (MEK1) 19 Dundee AKT1 (AKT) 21 Dundee IKBKB (IKKb) 16 Dundee CAMK1 (CaMK1a) 19 Dundee PKN2 (PRK2) 14 Dundee RPS6KA5 (MSK1) 18 Dundee MAPKAPK5 14 Dundee PRKD1 (PKD1) 13 Dundee PIM3 12 Dundee MKNK2 (MNK2) 12 Dundee PRKD1 (PKD1) 12 Dundee MARK3 10 Dundee NTRK1 (TRKA) 12 Invitrogen SRPK1 9 Dundee MAPK12 (p38g) 11 Dundee MAPKAPK5 9 Dundee MAPK8 (JNK1a) 11 Dundee MAPK13 (p38d) 8 Dundee rat PRKAA2 (AMPKa2) 11 Dundee AURKB (AURB) 5 Dundee NEK2 11 Invitrogen CSK 5 Dundee CHEK2 (CHK2) 11 Invitrogen EEF2K (EEF-2 kinase) 4 Dundee MAPK9 (JNK2) 9 Dundee PRKCA (PKCa) 4 Dundee rat RPS6KA1 (RSK1) 8 Dundee rat PRKAA2 (AMPKa2) 4 Dundee DYRK2 7 Dundee rat CSNK1D (CKId) 3 Dundee AKT1 (AKT) 7 Dundee LYN 3 BioPrint PIM2 7 Invitrogen CSNK2A1 (CKIIa) 3 Dundee MAPK15 (ERK7) 6 Dundee CAMKK2 (CAMKKB) 1 Dundee mouse LCK 5 Dundee PIM3 1 Dundee PDPK1 (PDK1) (directed 5 Invitrogen rat DYRK1A (MNB) 1 Dundee RPS6KB1 (p70S6K) 5 Dundee PBK 0 Dundee CSNK2A1 (CKIIa) 4 Dundee PIM1 -1 Dundee CAMKK2 (CAMKKB) 4 Dundee DYRK2 -2 Dundee SRC 4 Invitrogen MAPK12 (p38g) -2 Dundee MYLK2 (MLCK_sk) 3 Invitrogen NEK6 -3 Dundee MKNK2 (MNK2) 2 Dundee RPS6KB1 (p70S6K) -3 Dundee SRPK1 2 Dundee AKT2 -3 Dundee MKNK1 (MNK1) 2 Dundee RPS6KA3 (RSK2) -3 Dundee CHEK1 (CHK1) 2 Invitrogen rabbit MAP2K1 (MEK1) -4 Dundee
    [Show full text]
  • Supplementary Table 1. in Vitro Side Effect Profiling Study for LDN/OSU-0212320. Neurotransmitter Related Steroids
    Supplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Percent Inhibition Receptor 10 µM Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective -20.94% Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site -16.15% GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1 -5.54% Histamine, H2 16.54% Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal (-BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1 Percent Inhibition Receptor 10 µM Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (hERG) (h) -6.44% Sodium, Site 2 -0.39% Second Messengers Nitric Oxide, NOS (Neuronal-Binding) -17.09% Prostaglandins Leukotriene,
    [Show full text]
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
    [Show full text]
  • MNK1 (MKNK1) (AB000409) Human Untagged Clone – SC107659 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC107659 MNK1 (MKNK1) (AB000409) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: MNK1 (MKNK1) (AB000409) Human Untagged Clone Tag: Tag Free Symbol: MKNK1 Synonyms: MNK1 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF sequence for AB000409 edited ATGGTATCTTCTCAAAAGTTGGAAAAACCTATAGAGATGGGCAGTAGCGAACCCCTTCCC ATCGCAGATGGTGACAGGAGGAGGAAGAAGAAGCGGAGGGGCCGGGCCACTGACTCCTTG CCAGGAAAGTTTGAAGATATGTACAAGCTGACCTCTGAATTGCTTGGAGAGGGAGCCTAT GCCAAAGTTCAAGGTGCCGTGAGCCTACAGAATGGCAAAGAGTATGCCGTCAAAATCATC GAGAAACAAGCAGGGCACAGTCGGAGTAGGGTGTTTCGAGAGGTGGAGACGCTGTATCAG TGTCAGGGAAACAAGAACATTTTGGAGCTGATTGAGTTCTTTGAAGATGACACAAGGTTT TACTTGGTCTTTGAGAAATTGCAAGGAGGTTCCATCTTAGCCCACATCCAGAAGCAAAAG CACTTCAATGAGCGAGAAGCCAGCCGAGTGGTGCGGGACGTTGCTGCTGCCCTTGACTTC CTGCATACCAAAGGCATTGCTCATCGTGATCTGAAACCAGAAAATATATTGTGTGAATCT CCAGAAAAGGTGTCTCCAGTGAAAATCTGTGACTTTGACTTGGGCAGTGGGATGAAACTG AACAACTCCTGTACCCCCATAACCACACCAGAGCTGACCACCCCATGTGGCTCTGCAGAA TACATGGCCCCTGAGGTAGTGGAGGTCTTCACGGACCAGGCCACATTCTACGACAAGCGC TGTGACCTGTGGAGCCTGGGCGTGGTCCTCTACATCATGCTGAGTGGCTACCCACCCTTC GTGGGTCACTGCGGGGCCGACTGTGGCTGGGACCGGGGCGAGGTCTGCAGGGTGTGCCAG AACAAGCTGTTTGAAAGCATCCAGGAAGGCAAGTATGAGTTTCCTGACAAGGACTGGGCA CACATCTCCAGTGAAGCCAAAGACCTCATCTCCAAGCTCCTGGTGCGAGATGCAAAGCAG AGACTTAGCGCCGCCCAAGTTCTGCAGCACCCATGGGTGCAGGGGCAAGCTCCAGAAAAG
    [Show full text]
  • Comprehensive Assessment of Indian Variations in the Druggable Kinome Landscape Highlights Distinct Insights at the Sequence, Structure and Pharmacogenomic Stratum
    SUPPLEMENTARY MATERIAL Comprehensive assessment of Indian variations in the druggable kinome landscape highlights distinct insights at the sequence, structure and pharmacogenomic stratum Gayatri Panda1‡, Neha Mishra1‡, Disha Sharma2,3, Rahul C. Bhoyar3, Abhinav Jain2,3, Mohamed Imran2,3, Vigneshwar Senthilvel2,3, Mohit Kumar Divakar2,3, Anushree Mishra3, Priyanka Banerjee4, Sridhar Sivasubbu2,3, Vinod Scaria2,3, Arjun Ray1* 1 Department of Computational Biology, Indraprastha Institute of Information Technology, Okhla, India. 2 Academy of Scientific and Innovative Research (AcSIR), Ghaziabad, India. 3 CSIR-Institute of Genomics and Integrative Biology, Mathura Road, Delhi-110020, India. 4 Institute for Physiology, Charite-University of Medicine, Berlin, 10115 Berlin, Germany. ‡These authors contributed equally to this work. * [email protected] TABLE OF CONTENTS Name Title Supplemental_Figure_S1 Fauchere and Pliska hydrophobicity scale for variations in structure data Supplemental_Figure_S2 Phenotypic drug-drug correlogram Supplemental_Table_S1 545 kinase coding genes used in the study Supplemental_Table_S2 Classes and count of kinase coding genes Supplemental_Table_S3 Allele frequency Indian v/s other populations from 1000 genome data(1000g2015). Supplemental_Table_S4 IndiGen Structure Data- consisting of 12 genes and their 22 variants Supplemental_Table_S5 Genes, PDB ids, mutations in IndiGen data and associated drugs (FDA approved) Supplemental_Table_S6 Data used for docking and binding pocket similarity analysis Supplemental_Table_S7
    [Show full text]
  • A Novel JAK1 Mutant Breast Implant-Associated Anaplastic Large Cell Lymphoma Patient-Derived Xenograft Fostering Pre- Clinical Discoveries
    Cancers 2019 S1 of S18 Supplementary Materials: A Novel JAK1 Mutant Breast Implant-Associated Anaplastic Large Cell Lymphoma Patient-Derived Xenograft Fostering Pre- Clinical Discoveries Danilo Fiore, Luca Vincenzo Cappelli, Paul Zumbo, Jude M. Phillip, Zhaoqi Liu, Shuhua Cheng, Liron Yoffe, Paola Ghione, Federica Di Maggio, Ahmet Dogan, Inna Khodos, Elisa de Stanchina, Joseph Casano, Clarisse Kayembe, Wayne Tam, Doron Betel, Robin Foa’, Leandro Cerchietti, Raul Rabadan, Steven Horwitz, David M. Weinstock and Giorgio Inghirami A B C Figure S1. (A) Histology micrografts on IL89 PDTX show overall similarity between T1 T3 and T7 passages (upper panels). Immunohistochemical stains with the indicated antibodies (anti-CD3, anti- CD25 and anti-CD8 [x20]) (lower panels). (B) Flow cytometry panel comprehensive of the most represented surface T-cell lymphoma markers, including: CD2, CD3, CD4, CD5, CD8, CD16, CD25, CD30, CD56, TCRab, TCRgd. IL89 PDTX passage T3 is here depicted for illustration purposes. (C) Analysis of the TCR gamma specific rearrangement clonality in IL89 diagnostic sample and correspondent PDTX after 1 and 5 passages (T1 and T5). A WT Primary p.G1097D IL89 T1 p.G1097D IL89 T5 p.G1097D IL89 cell line B Figure S2. (A) Sanger sequencing confirms the presence of the JAK1 p.G1097D mutation in IL89 PDTX samples and in the cell line, but the mutation is undetectable in the primary due to the low sensitivity of the technique. (B) Manual backtracking of mutations in the primary tumor using deep sequencing data allowed for the identification of several hits at a very low VAF compared to the PDTX-T5. A B IL89 CTRL 30 CTRL Ruxoli?nib S 20 M Ruxoli?nib A R G 10 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 1 1 1 1 1 WEEKS AFTER ENGRAFTMENT Figure S3.
    [Show full text]
  • PRODUCTS and SERVICES Target List
    PRODUCTS AND SERVICES Target list Kinase Products P.1-11 Kinase Products Biochemical Assays P.12 "QuickScout Screening Assist™ Kits" Kinase Protein Assay Kits P.13 "QuickScout Custom Profiling & Panel Profiling Series" Targets P.14 "QuickScout Custom Profiling Series" Preincubation Targets Cell-Based Assays P.15 NanoBRET™ TE Intracellular Kinase Cell-Based Assay Service Targets P.16 Tyrosine Kinase Ba/F3 Cell-Based Assay Service Targets P.17 Kinase HEK293 Cell-Based Assay Service ～ClariCELL™ ～ Targets P.18 Detection of Protein-Protein Interactions ～ProbeX™～ Stable Cell Lines Crystallization Services P.19 FastLane™ Structures ～Premium～ P.20-21 FastLane™ Structures ～Standard～ Kinase Products For details of products, please see "PRODUCTS AND SERVICES" on page 1～3. Tyrosine Kinases Note: Please contact us for availability or further information. Information may be changed without notice. Expression Protein Kinase Tag Carna Product Name Catalog No. Construct Sequence Accession Number Tag Location System HIS ABL(ABL1) 08-001 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) BTN BTN-ABL(ABL1) 08-401-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ABL(ABL1) [E255K] HIS ABL(ABL1)[E255K] 08-094 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) HIS ABL(ABL1)[T315I] 08-093 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) [T315I] BTN BTN-ABL(ABL1)[T315I] 08-493-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ACK(TNK2) GST ACK(TNK2) 08-196 Catalytic domain
    [Show full text]
  • Figure 1B and S1A)
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.29.117531; this version posted May 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: The MNK1/2-eIF4E axis drives melanoma plasticity, progression, and resistance to immunotherapy. Authors: Fan Huang1, 2, Christophe Gonçalves2, Margarita Bartish1, 2, Joelle Rémy-Sarrazin1, Qianyu Guo1, 2, Audrey Emond2, William Yang1, 2, Dany Plourde2, Jie Su2, Marina Godoy Gimeno4, Yao Zhan1, 2, Mikhael Attias5, 6, Alba Galán2, Tomasz Rzymski7, Milena Mazan7, Magdalena Masiejczyk7, Jacek Faber7, Elie Khoury1, 2, Alexandre Benoit1, 2, Natascha Gagnon2, David Dankort8, 9, Ciriaco A. Piccirillo5, 6, Fabrice Journe10, 11, Ghanem Ghanem10, H. Uri Saragovi2, 12, Nahum Sonenberg9, 13, Ivan Topisirovic1, 2, 13, Wilson H. Miller, Jr1, 2, 3, 14, Sonia V. del Rincón1, 2, 3. Affiliations: 1 Division of Experimental Medicine, McGill University, Montréal, Québec, Canada. 2 Lady Davis Institute, Jewish General Hospital, McGill University, Montréal, Québec, Canada. 3 McGill Centre for Translational Research in Cancer (MCTRC), McGill University, Montréal, Québec, Canada. 4 University Veterinary Teaching Hospital Camden, Faculty of Science, the University of Sydney, Sydney, Australia. 5 Department of Microbiology & Immunology, McGill University, Montréal, Québec, Canada. 6 The Research Institute of the McGill University Health Centre, McGill University, Montréal, Québec, Canada. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.29.117531; this version posted May 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved.
    [Show full text]
  • MNK Inhibition Disrupts Mesenchymal Glioma Stem Cells and Prolongs Survival in a Mouse Model of Glioblastoma Jonathan B
    Published OnlineFirst June 30, 2016; DOI: 10.1158/1541-7786.MCR-16-0172 Signal Transduction Molecular Cancer Research MNK Inhibition Disrupts Mesenchymal Glioma Stem Cells and Prolongs Survival in a Mouse Model of Glioblastoma Jonathan B. Bell1, Frank D. Eckerdt1,2, Kristen Alley1, Lisa P. Magnusson1,2, Hridi Hussain1,2, Yingtao Bi3, Ahmet Dirim Arslan1,4, Jessica Clymer1,5, Angel A. Alvarez1, Stewart Goldman1,5, Shi-Yuan Cheng1, Ichiro Nakano6, Craig Horbinski1,2,7, Ramana V. Davuluri1,3, C. David James1,2, and Leonidas C. Platanias1,4,8 Abstract Glioblastoma multiforme remains the deadliest malignant a crucial effector for MNK-induced mRNA translation in cancer brain tumor, with glioma stem cells (GSC) contributing to treat- cells and a marker of transformation. Importantly, merestinib ment resistance and tumor recurrence. We have identified MAPK- inhibited growth of GSCs grown as neurospheres as determined interacting kinases (MNK) as potential targets for the GSC pop- by extreme limiting dilution analysis. When the effects of mer- ulation in glioblastoma multiforme. Isoform-level subtyping estinib were assessed in vivo using an intracranial xenograft mouse using The Cancer Genome Atlas revealed that both MNK genes model, improved overall survival was observed in merestinib- (MKNK1 and MKNK2) are upregulated in mesenchymal glioblas- treated mice. Taken together, these data provide strong preclinical toma multiforme as compared with other subtypes. Expression of evidence that pharmacologic MNK inhibition targets mesenchy- MKNK1 is associated with increased glioma grade and correlated mal glioblastoma multiforme and its GSC population. with the mesenchymal GSC marker, CD44, and coexpression of MKNK1 and CD44 predicts poor survival in glioblastoma multi- Implications: These findings raise the possibility of MNK forme.
    [Show full text]