100215 (317)

Biosci. Biotechnol. Biochem., 74 (9), 100215-1–8, 2010

The ALG-2 Binding Site in Sec31A Influences the Retention Kinetics of Sec31A at the Endoplasmic Reticulum Exit Sites as Revealed by Live-Cell Time-Lapse Imaging

y Hideki SHIBATA,1; Tatsutoshi INUZUKA,1 Haruna YOSHIDA,1 Hirofumi SUGIURA,1 Ikuo WADA,2 and Masatoshi MAKI1

1Department of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan 2Department of Cell Science, Institute of Biomedical Sciences, Fukushima Medical University School of Medicine, 1 Hikariga-oka, Fukushima 960-1295, Japan

Received March 24, 2010; Accepted June 2, 2010; Online Publication, September 7, 2010 [doi:10.1271/bbb.100215]

ALG-2, a member of the penta-EF-hand protein 2 functions as a downstream effecter of the Ca2þ- family, interacts Ca2þ-dependently with a COPII com- signaling pathway under these physiological conditions ponent, Sec31A. In this study, we first established HeLa remain largely unknown. The fifth EF-hand of ALG-2 cells stably expressing green fluorescent protein-fused mediates the formation of the homodimer or the ALG-2 (GFP-ALG-2) and red fluorescent protein-fused heterodimer with peflin,9) whereas the first and the Sec31AAdvance (Sec31A-RFP). After inducing Ca2þ View-mobiliza- third EF-hands have a physiologically crucial role in tion, the cytoplasmic distribution of GFP-ALG-2 Ca2þ-binding, which drives conformational changes in changed from a diffuse to a punctate pattern, which the protein10) and mediates Ca2þ-dependent interaction extensively overlapped with the Sec31A-RFP-positive with multiple proteins, most of which have Pro-rich structures, indicating that ALG-2 is recruited to the regions.11) endoplasmic reticulum exit sites (ERES) in living cells. A number of target proteins for ALG-2 have been Next, overlay experiments with biotin-labeled ALG-2 reported. They can be classified into two groups based were done to dissect the ALG-2 binding site (ABS). They on their binding ability to an alternatively spliced shorter revealed that a sequence comprising amino acid resi- isoform of ALG-2, ALG-2GF122, which lacks Gly121 dues 839–851 in the Pro-rich region was necessary and and Phe122.12) Alix (also named AIP1), annexin A7, sufficient for direct binding to ALG-2. Finally, fluores- annexin A11, TSG101,Proofs scotin, and mucolipin-1 lack the cence recovery after photobleaching analysis indicated ability to bind ALG-2GF122, whereas phospholipid that the ABS deletion reduced the high-affinity popula- scramblase (PLSCR) 3, PLSCR4, and Sec31A interact tion of Sec31A to the ERES, suggesting that the ABS is with both isoforms.12–14) Among these target proteins, one of the key determinants of the retention kinetics of we determined precisely the ALG-2 binding sites (ABS) Sec31A at ERES. in Alix15) and PLSCR3.12) Alix is a cytoplasmic adaptor protein that was the first target protein identified for Key words: ALG-2; Sec31A; endoplasmic reticulum ALG-2.16,17) The characteristic PxY repeats in the (ER) exit sites; time-lapse imaging; fluores- C-terminal Pro-rich region of Alix is a critical element cence recovery after photobleaching in ALG-2-binding.15,18) Deletion of the ABS changes the (FRAP) distribution of the overexpressed C-terminal half region of Alix fused with enhanced green fluorescent protein ALG-2 (apoptosis-linked gene 2), a product of the from a punctate to a diffuse pattern in HeLa cells,15) and PDCD6 gene, is a Ca2þ-binding protein possessing five abolishes the effects of the overexpressed full-length and serially repetitive EF-hand motifs in its C-terminal C-terminal half versions of Alix on neuronal survival.18) region. It belongs to the penta-EF-hand (PEF) protein We identified PLSCR3 as a target for ALG-2 by family, including the large and small subunits of typical searching for proteins that contain a region homologous calpains, sorcin, glancalcin, and peflin.1,2) While ALG-2 to the ABS of Alix.12) Although the homologous site in was originally identified as a proapoptotic gene product PLSCR3, ABS-1, was sufficient for binding to ALG-2, in a cell-death study of mouse T-cell hybridoma,3) ALG- a mutant lacking the ABS-1 showed the ability to 2-deficient mice develop normally, with no abnormal- bind ALG-2 as well as ALG-2GF122. Further deletion ities in the immune system.4) Nonetheless, the potential analyses of PLSCR3 identified another region, ABS-2, involvement of ALG-2 in regulating endoplasmic that contributes to interaction with both ALG-2 and reticulum (ER)-stress-induced apoptosis,5) neuronal cell ALG-2GF122. death during development,6) and cancer7,8) has been In the present study, we focused on another ALG-2- reported, but the molecular mechanisms by which ALG- interactive target, Sec31A, which is a component of the

y To whom correspondence should be addressed. Fax: +81-52-789-5542; E-mail: [email protected] Abbreviations: GFP, green fluorescent protein; RFP, red fluorescent protein; ERES, endoplasmic reticulum exit site; ABS, ALG-2 binding site; PEF, penta-EF-hand; PLSCR, phospholipid scramblase; FRAP, fluorescence recovery after photobleaching; WT, wild type; GST, glutathione-S- transferase; ROI, region of interest; bio-, biotin-labeled; GAP, GTPase-activating protein; CBB, Coomassie Brilliant Blue 100215-2 H. SHIBATA et al. COPII coat of ER-to-Golgi transport vesicles. We and gccaataagctgggtgtggatccggacagccccgg-30 and reverse 50-ccggggctgtcc- others have reported that ALG-2 localizes at the ggatccacacccagcttattggc-30. The EcoRI/BamHI fragment excised from Sec31A-positive ER exit sites (ERES) in a Ca2þ- the resulting plasmid was inserted between the EcoRI and BamHI sites of pSGFP2-N-SGG and pTagRFP-T-N-SGG to construct pSec31A- dependent manner, as detected by indirect immuno- SGFP2 and pSec31A-TagRFP-T respectively. To introduce the MluI 19,20) fluorescence. RNAi-mediated knockdown experi- site in the 50-untranslated region of the Sec31A-SGFP2-coding ments have indicated that ALG-2 is required to maintain sequence by PCR, pFP 50 MluI as forward primer and pEGFP-N lower normal Sec31A levels at the ERES.20) Here, we primer, 50-tgaacagctcctcgccct-30, as reverse primer were used, and the confirmed the dynamic recruitment of ALG-2 to the PCR product was inserted into pCR-BluntII-TOPO. The MluI/NotI ERES in HeLa cells stably expressing fluorescent fragment digested from the resulting plasmid, which encodes Sec31A protein-fused ALG-2 and Sec31A by time-lapse fluo- and SGG-linker, was inserted between the MluI and NotI sites of pCX4bsr to construct pCX4bsr/Sec31A-SGG. Then the NotI fragments rescence microscopy. Further, the ALG-2 binding site of digested from pSGFP2-N-SGG and pTagRFP-T-N-SGG, which encode Sec31A was identified, and the effects of deletion of this SGFP2 and TagRFP-T respectively, was inserted into the NotI site of site on the recycling kinetics of Sec31A proteins on and pCX4bsr/Sec31A-SGG to construct pCX4bsr/Sec31A-SGFP2 and off the ERES structures were examined by fluorescence pCX4bsr/Sec31A-TagRFP-T. pCX4bsr/Sec31A839{851-SGFP2 was recovery after photobleaching (FRAP) analysis. constructed by replacing the Sec31A wild-type coding sequence of pCX4bsr/Sec31A-SGFP2 with the deletion mutant-coding sequence of pFLAG-Sec31A839{851 using the EcoRI and the SphI sites. An Materials and Methods Escherichia coli expression plasmid for GST-His, designated pGST- His, encoding two flexible GGS linkers between the GST-coding Cells and antibodies. HeLa cells were purchased from the RIKEN sequence and the multiple cloning site and between the multiple cloning Cell Bank (Tsukuba, Japan), and one of the cell lines isolated by site and the 8xHis-coding sequence, and an expression plasmid for 19) limited dilution cloning, designated HeLa SS4, was used. An GST-Alix801{812-His, designated pGST-Alix801{812-His, were described amphotropic murine leukemia virus-packaging cell line, PLAT-A, was previously.10) pGST-Sec31A837{849-His and pGST-Sec31A839{851-His, kindly provided by Dr. Toshio Kitamura (Institute of Medical Science, for the expression of GST- and His-tagged Sec31A (amino acids University of Tokyo). Mouse anti-FLAG monoclonal antibody (M2) 837–849) and Sec31A (amino acids 839–851) were constructed was purchased from Sigma (St. Louis, Mo). Peroxidase-conjugated by inserting a combination of the following oligonucleotides into the goatAdvance anti-mouse IgG antibody was from Jackson Immuno View Research 837{849 0 BglI site of pGST-His: for pGST-Sec31A -His, forward 5 - Laboratories (West Grove, PA). cggcaccgccaccaggcttcattatgcatggcaacgtgaatccggcctcgg-30 and reverse 50-aggccggattcacgttgccatgcataatgaagcctggtggcggtgccgaac-30; and for Plasmid constructions. An expression plasmid for FLAG-tagged pGST-Sec31A839{851-His, forward 50-cggcaaatccgccaccgccaggcttcatt- Sec31A in mammalian cells, pFLAG-Sec31A, was reconstructed from atgcatggcaacgtggcctcgg-30 and reverse 50-aggccacgttgccatgcataatgaa- an isolated clone encoding a putative alternative splicing isoform by gcctggcggtggcggatttgccgaac-30. two rounds of PCR-based site-directed mutagenesis using a combina- tion of the following primers: for the first round, 50-cttagggaacagaca- ctttcaccaacaatcaccag-30 and 50-ctggtgattgttggtgaaagtgtctgttccctaag-30; Transfection and retroviral infection. HEK293T cells were trans- and for the second round, 50-ctgcgtcccaaagaacaggtcctcagaatggttgg-30 fected by the conventional calcium phosphate precipitation method. and 50-ccaaccattctgaggacctgttctttgggacgcag-30. The resulting plasmid HeLa cell lines expressing fluorescent protein-fused ALG-2 and encodes the longest isoform of Sec31A (GenBank accession Sec31A were established by infection with recombinant retroviruses, as described previously.Proofs21,26) Briefly, PLAT-A cells were transfected no. AAF67836) tagged with a FLAG epitope. Deletions of the regions WT R encoding amino acid residues 839–851 and 869–912 were introduced with pCX4pur/SGFP2-ALG-2 /RNAi , pCX4bsr/Sec31A-TagRFP- ABS by PCR-base site-directed mutagenesis using a combination of the T, pCX4bsr/Sec31A-SGFP2, or pCX4bsr/Sec31A -SGFP2 using following primers and pFLAG-Sec31A as template: for pFLAG- FuGENE6 (Roche Diagnostics, Mannheim, Germany) following the Sec31A839{851,50-ccccatggagaaaatcctaatgctgctggtcag-30 and 50-ctg- manufacturer’s instructions to produce the retroviruses. Two d after accagcagcattaggattttctccatgggg-30; and for pFLAG-Sec31A869{912, transfection, the culture supernatant was collected, centrifuged to 50-ggtcatatgcacacccaggtaatatcttctgcttcttcctatac-30 and 50-gtataggaagaa- remove the cell debris, filtered through a 0.20-mm filter (Advantech, gcagaagatattacctgggtgtgcatatgacc-30. pCX4pur and pCX4bsr were Tokyo), supplemented with 8 mg/ml of polybrene (hexadimethrine kindly provided by Dr. Toshio Kitamura.21) The construction of bromide, Sigma), and used for infection. To establish HeLa cell lines pSGFP2-C1 and pVSV-G(tsO45)-TagRFP-T will be described else- stably expressing GFP-ALG2 and Sec31A-RFP, a mixture of the where. The retroviral vector expressing ALG-2 N-terminally fused supernatants from the cell independently transfected with pCX4pur/ with SGFP222) was constructed as follows: pSGFP2-ALG-2WT/RNAiR SGFP2-ALG-2 or pCX4bsr/Sec31A-TagRFP-T was used. Two d after was constructed first by ligating the EcoRI/XhoI fragment of pFLAG- infection, drug selection of infected cells was started using 1 mg/ml ALG-2WT/RNAiR23) into the EcoRI and SalI sites of pSGFP2-C1. To of puromycin (Cayla, Toulouse, France) and 10 mg/ml of blasticidin introduce the MluI site in the 50- and the NotI site in the 30-untranslated S (Cayla). region of the SGFP2-ALG-2-coding sequence by PCR, the forward primer containing the MluI site (underlined) designated pFP 50 MluI, Time-lapse and FRAP analyses. For live-cell time-lapse imaging, 50-cgacgcgtagtgaaccgtcagatccgc-30, and the reverse primer containing cells were imaged using an Olympus FV1000-D laser-scanning the NotI site (underlined), 50-taagcggccgccagggtcatacgatactg-30, were confocal microscope equipped with an IX81 microscope with used, and the PCR product was inserted into pCR-BluntII-TOPO a60, 1.35 numerical aperture (NA) oil-immersion objective (Invitrogen, Carlsbad, CA). The MluI/NotI fragment was then (UPLSAPO60XO) and a stage incubator system. The stage was heated obtained, and was inserted between the MluI and NotI sites of at 37 C and cells were imaged for <3 h on the microscope stage. For pCX4pur, and the resulting plasmid was designated pCX4pur/SGFP2- imaging of GFP-ALG-2 and Sec31A-RFP, 2–3 d after cells were ALG-2WT/RNAiR. Retroviral vectors expressing Sec31A C-terminally seeded in glass-bottomed dish (Asahi Glass, Tokyo), the medium was fused with SGFP2 or TagRFP-T24) were constructed as follows: replaced with Leibovitz’s L15 medium (Invitrogen, Grand Island, NY) pSGFP2-N-SGG was constructed by replacing the mEGFP-coding containing 1% fetal bovine serum. After administration of histamine, sequence of pmGFP-N-SGG25) with the SGFP2-coding sequence of time-lapse images were acquired. SGFP2 was exited using the 488 nm pSGFP2-C1 using the AgeI and the BsrGI sites. Similarly, pTagRFP-T- line of an argon laser set at 0.1–0.3% transmission, and the emission N-SGG was constructed by replacing the mEGFP-coding sequence of was collected using the variable bandpass filter set at 500–545 nm. pmGFP-N-SGG with the Tag-RFP-T-coding sequence of pVSV- TagRFP-T was exited a 559 nm-diode laser set at 0.1% transmission, G(tsO45)-TagRFP-T using the AgeI and the AflII sites. A mutation and the emission was collected using a 575–675 nm bandpass filter. of the stop codon in Sec31A-coding sequence was introduced by PCR- The pinhole diameter was set for 3 Airy units, and the line sequential based mutagenesis using pFLAG-Sec31A as a template and a pair of scanning mode was used to eliminate the possibility of cross-talk primers containing an additional BamHI site (underlined): forward 50- between channels. An optical zoom of 1.3 was used and images were ALG-2 Binding Site in Sec31A 100215-3 acquired every 2.083 s at a 510 180 resolution (Fig. 1B–D). A single and Sec31A C-terminally fused with TagRFP-T24) image of the whole cell was then acquired at 1;024 1;024 resolution. (Sec31A-RFP). Cell lines having low to middle expres- For quantitative analysis, the fluorescence intensities in the regions of sion levels of both GFP-ALG-2 and Sec31A-RFP were interest (ROI) were determined using ImageJ software (National Institutes of Health, Bethesda, MD). Background levels were obtained subcloned and investigated by confocal microscopy. by measuring the mean intensity of the region outside the cell. The area When the cells were cultured under low serum con- visualized with Sec31A-RFP as a spot was defined as a single ditions, GFP-ALG-2 signals were detected throughout endoplasmic reticulum exit site (ERES). To express the fluctuations the cytoplasm and in the nucleus, whereas Sec31A-RFP of the fluorescence intensity of GFP-ALG-2 and Sec31A-RFP within signals were observed throughout the cytoplasm, espe- each ROI, the ratio of fluorescence intensity in the ROI to that in cially in the perinuclear area, in a punctate pattern. The the whole cell was determined, and was plotted as a function of application of histamine, an agonist for endogenous H1 time. Alternatively, images were processed with ImageJ to make avi movie files. receptors that causes the generation of inositol 1,4,5- 2þ For photobleach and fluorescence recovery after the photobleaching trisphosphate and thus a release of Ca from the (FRAP) experiments, 3 d after HeLa cells stably expressing endoplasmic reticulum (ER), induced reversible, tran- Sec31AWT-GFP or Sec31AABS-GFP had been seeded into glass- sient redistribution of GFP-ALG-2 (Fig. 1). In most bottomed dish, the medium was replaced with Leibovitz’s L15 medium cells, the distribution of GFP-ALG-2 within the nucleus containing 10% fetal bovine serum. SGFP2 was exited using the was essentially unaltered, whereas in the cytoplasm, 488 nm line of an argon laser set at 0.2–0.5% transmission, and the discrete puncta of GFP-ALG-2 fluorescence appeared emission was collected using a bandpass filter set to 505–550 nm. The pinhole diameter was set to 6 Airy units. For each time-lapse series, an to be enhanced (Fig. 1B, right column, first row). These optical zoom of 1.3 was used, and images were acquired every 227 ms cytoplasmic green fluorescent foci were primarily at 192 32 resolution. GFP-fusion proteins at the ERES were Sec31A-RFP-positive (Fig. 1B, right column, and photobleached using a SIM scanner in ellipse scan mode with the Fig. 1D). Accumulation of GFP-ALG-2 simultaneously 488 nm line of the argon laser set at 100% transmission for 390 ms. The occurred throughout the cytoplasm (Fig. 1B right col- bleached region was a circle 11 pixels in diameter located in the umn, Fig. 1C, and Supplemental movie 1; see Biosci. perinuclear area. Fluorescence intensities within the bleached region Biotechnol. Biochem. Web site), and were completed andAdvance the cell-free area (background) were measured using View Olympus FV10-ASW software. After background subtraction, the fluorescence within approximately 30 s after the increase in GFP- intensity of the bleach region over time was normalized with an ALG-2 fluorescence was detected (Fig. 1C and D). The average fluorescence intensity of 10 frames before photobleaching, and striking increase in GFP-ALG-2 signals in the Sec31A- was plotted as a function of time. For quantitative analysis, RFP-positive structures was accompanied by a slight independent normalized data from 57 (Sec31AWT-GFP) and 48 ABS decrease in GFP-ALG-2 fluorescence in the Sec31A- (Sec31A -GFP) cells were averaged and fitted globally to a two- free regions (Fig. 1C, ROI-3, arrowheads), consistently phase exponential FðtÞ¼A þ A ð1 ek1tÞþA ð1 ek2tÞ, where 0 1 2 with translocation of ALG-2 from cytosolic pool to the A0 is the offset of the curve, A1 and A2 are the relative amplitude of the recovery curve, and k1 and k2 are the rate constants of fluorescence ERES. In a subset of cells, transient translocation of recovery, corresponding to dissociation rates from which t1=2 values ALG-2 was repeatedly observed after histamine appli- are determined: t1=2 ¼ lnð2Þ=k. These analyses were achieved with cation, as shown in Fig. 1C and Supplemental movie 1. OriginPro 8J software (OriginLab, Northampton, MA). In contrast, theProofs majority of individual Sec31A-RFP signals exhibited no obvious change or only small Bio-ALG-2 overlay. An overlay assay using biotin-labeled ALG-2 fluctuations, which were apparently independent of (bio-ALG-2) was carried out as described previously27,28) using immunoprecipitates of mouse anti-FLAG monoclonal antibody from repetitive GFP-ALG-2 translocation. cleared lysate of HEK293 cells that had been transfected with pFLAG- Sec31A, pFLAG-Sec31AABS, or pFLAG-Sec31A869{912. Alterna- Identification of the ALG-2 binding site in Sec31A tively, recombinant proteins of GST-His, GST-Alix800{812-His, GST- ALG-2 interacts with a variety of proteins that contain Sec31A837{849-His, and GST-Sec31A839{851-His expressed in Esche- conspicuous Pro-rich sequences.11) Recently we identi- richia coli BL21 (DE3) were purified first with TALON beads fied two different types of ALG-2 binding sites in the N- (Clontech, Takara Bio, Otsu, Shiga, Japan) and then further purified with Glutathione Sepharose 4B beads (GE Healthcare, Uppsala, terminal Pro-rich region of phospholipid scramblase Sweden) following the manufacturer’s instructions. The purified (PLSCR) 3: ABS-1 (the Alix-type), 9-GYAPSPPP- proteins were used for modified overlay assay, as described previously.10) PYPVTPGYPEPA-28, and ABS-2 (the non Alix-type), 41-QVPAPAPGFALFPSPGPVA-59 (Fig. 2A).12) While Results the non Alix-type sequence binds both ALG-2 and an alternatively spliced isoform that lacks residues Gly121 ALG-2 was transiently recruited to Sec31A-positive and Phe122, ALG-2GF122, the Alix-type sequence lacks structures in the HeLa cells after histamine adminis- binding ability to the shorter isoform. Both isoforms of tration ALG-2 interact with Sec31A.12,19) Although the Pro-rich La Cour et al. found that external physiological stimuli region in Sec31A ranging from 800 to 1,113 has been caused a redistribution of an EGFP-tagged version of found to interact with ALG-2,20) the precise sites ALG-2 from the cytosol to a punctate localization responsible for ALG-2 binding have not been identified. unitemporally with Ca2þ-oscillation.29) Although indi- Using the LALIGN program (http://www.ch.embne- rect immunofluorescence microscopic analysis revealed t.org/software/LALIGN form.html),30) we found short that endogenous ALG-2 localizes at the Sec31A-positive homologous regions in Sec31A to PLSCR3 ABS-2 (the punctate structures,19,20,29) it remains uncertain whether non Alix-type) and Alix ABS, 801-PPYPTYPGYPGY- ALG-2 is recruited to the Sec31A-resident endoplasmic 812 (the Alix-type) respectively (Fig. 2A). To determine reticulum exit sites (ERES) or to other organelles in whether these regions in Sec31A are necessary for direct living cells after Ca2þ-mobilization. To address this interaction with ALG-2, we constructed expression issue, we established HeLa cell lines stably expressing vectors encoding FLAG-tagged truncated mutants of ALG-2 N-terminally fused with SGFP222) (GFP-ALG-2) Sec31A and performed an in vitro overlay assay using 100215-4 H. SHIBATA et al. A C

B

D Advance View

Fig. 1. Transient and Reversible Translocation of GFP-ALG-2 from the Cytosol to Sec31A-RFP-Positive Structures after Histamine Administration. HeLa cells stably co-expressing GFP-ALG-2 (ALG-2 fused N-terminally with SGFP2) and Sec31A-RFP (Sec31A fused C-terminally with TagRFP-T) were incubated for 30 min in Leibovitz’s L15 medium containing 1% fetal bovine serum. After administration of histamine (final 10 mM), time-lapse images were acquired every 2.083 s using a confocal microscope. The corresponding movie 1 is shown in the Supplemental material; see Biosci. Biotechnol. Biochem. Web site. A, Micrographs show fluorescence (left) and differential interference contrast (DIC, right) images of the cell. The area captured in the time-lapse images is indicated by a white rectangle in the left micrograph. Bar, 20 mm. B, Two representative images showing a diffuse pattern (left) and a punctate pattern (right) of cytoplasmic GFP-ALG-2 were extracted from time-lapse images at the time points indicated by gray arrows in C. The fluorescence intensities of the threeProofs regions of interest (ROIs) indicated by white boxes are quantified in C, two for the ERES including single Sec31A-RFP-positive dot (ROI-1 and ROI-2) and one for the cytosol that was close to ROI-2 but free from Sec31A-RFP-positive puncta (ROI-3). Bar, 20 mm. C, Plots of the relative contents of GFP-ALG-2 (green) and Sec31A- RFP (magenta) within each ROI indicated in B are shown as functions of time for 5 min during 10 min 20 s of the time-lapse data set (from 3 min 20 s to 8 min 20 s). The relative fluorescence content within each ROI (F) is expressed as a percentage of the fluorescence content in the whole cell recorded after capture of the time-lapse images. Gray arrows indicate the time point at which images are shown in B. The gray line represents the time period during which time-lapse sequential images of ROI-1 and ROI-2 are shown in D. Decreases in cytosolic GFP-ALG-2 signals are indicated by arrowheads in ROI-3. D, Sequential time-lapse images of ROI-1 and ROI-2 during the time periods indicated in C were extracted and arranged at 4-s intervals. Bar, 2 mm. biotin-labeled ALG-2 (bio-ALG-2). FLAG-tagged full- Sec31A839{851 (lane 4) than with the positive control, length Sec31A (FLAG-Sec31AWT) or truncated mutants Alix801{812 and Sec31A837{849 (lanes 2 and 3). No (FLAG-Sec31A839{851 and FLAG-Sec31A869{912) bio-ALG-2 binding signal was detected with unfused expressed in HEK293T cells was immunoprecipitated GST-His proteins (lane 1). These results indicate that from the cell lysates using anti-FLAG antibody. As the region between 839 and 851 is necessary and shown in Fig. 2B, bottom panel, comparable amounts of sufficient for direct interaction with ALG-2. We named FLAG-tagged proteins were detected in the immuno- this region Sec31A ABS (ALG-2 binding site). precipitates with anti-FLAG antibody. For overlay assay, equivalent signal intensities of bio-ALG-2 bind- Deletion of the Sec31A ABS caused a decrease in the ing were obtained with FLAG-Sec31AWT (Fig. 2B, top, half-time of Sec31A at the ERES lane 1) and FLAG-Sec31A869{912 (lane 3). In contrast, To determine whether Sec31A localization and turn- there was only a barely detectable signal with FLAG- over at the ERES are affected by deletion of the Sec31A Sec31A839{851, which lacks core amino acids of the ABS, we established HeLa cell lines stably expressing a non Alix-type-like sequence (lane 2). To test whether C-terminally SGFP2-fused Sec31A (Sec31AWT-GFP) or this region of Sec31A is sufficient to mediate inter- Sec31AABS (Sec31AABS-GFP). There was no dis- action with ALG-2, bacterial recombinant proteins of cernible difference in distribution pattern between the Sec31A837{849 and Sec31A839{851 with a GST at the wild type and the deletion mutant of Sec31A-GFP N-terminus and a (His)8-tag at the C-terminus were (Fig. 3A). To measure the exchange rates of these purified (Fig. 2C, bottom), and their abilities to bind proteins at the ERES, we photobleached a region ALG-2 were assessed by overlay assay (Fig. 2C, top). A including the puncta labeled with GFP-fusion proteins stronger signal of bio-ALG-2 was obtained with and followed the recovery of GFP fluorescence in the ALG-2 Binding Site in Sec31A 100215-5 A A

B B C

C

Fig. 2. Identification of the ALG-2 Binding Site in Sec31A. AdvanceA, A schematic representation of the structure of human View Sec31A is represented at the top. Amino acid numbers are shown relative to the longest isoform of Sec31A (GenBank accession no. AAF67836). The gray box represents the WD40 domain. The black box is the Pro-rich region wherein sequences similar to the non Alix-type ALG-2-binding site of PLSCR3 and the Alix-type ALG-2-binding site of Alix are at the positions indicated by black and gray bars Fig. 3. Florescence Photobleaching of Sec31AWT-GFP and respectively. Alignments of the sequences of Sec31A similar to the Sec31AABS-GFP at the ERES in Stably Expressing HeLa Cells. previously identified ALG-2 binding sites in PLSCR3 (non Alix- This figure illustrates a typical experiment to explore the effects type and Alix-type) and Alix (Alix-type) are shown underneath. of ABS deletion on the recycling kinetics of Sec31A on and off the Identical amino acid residues are marked by asterisks. B, HEK293T ERES structures. The corresponding movie 2 is shown in the cells transiently expressing FLAG-Sec31A (WT), FLAG- Supplemental material; see Biosci. Biotechnol. Biochem. Web site. Sec31A839{851 (ABS), and FLAG-Sec31A869{912 were lysed A, Single plane imagesProofs of a HeLa cell stably expressing Sec31AWT- and immunoprecipitated with an anti-FLAG antibody. The immu- GFP (left) and Sec31AABS-GFP (right) are displayed. The white noprecipitates were subjected to SDS–PAGE and transferred to box represents the magnified region shown in B. Bars, 20 mm. B, The PVDF membranes. The membrane was then probed with biotin- white circle in image (i) was photobleached, and fluorescence labeled ALG-2 in the presence of Ca2þ (top) or with an anti-FLAG recovery was measured over time. Images from selected time points antibody (bottom). C, The affinity purified bacterial recombinant indicated by open arrowheads in C are shown: (i) pre-bleaching; (ii) proteins of GST-His (Ctrl), GST-Alix801{812-His, GST- immediately after bleaching; (iii)–(vii) fluorescence recovery. Bars, Sec31A837{849-His, and GST-Sec31A839{851-His (ABS) were sub- 2 mm. C, Plots of the normalized fluorescence profiles of Sec31AWT- jected to SDS–PAGE and transferred to a PVDF membrane. The GFP (open circle) and Sec31AABS-GFP (solid circle) are shown membrane was then probed with biotin-labeled ALG-2 in the as functions of time. The arrow indicates the photobleaching time presence of Ca2þ (top). The proteins on the membrane were (time 0). visualized by staining with Coomassie Brilliant Blue R-250 (bottom). ABS deletion. In this analysis, we noticed that the region. In this fluorescence recovery after the photo- recovery profile of the wild type required a two- bleaching (FRAP) experiment, recovery indicates that component model, since it did not fit well with a one- the bleached molecules of the ERES are exchanged with component model. We assumed that Sec31A interacts the cytosolic population, whereas a lack of recovery with the ERES with two different binding constants indicates that the bleached molecules are immobile, i.e., (Supplemental Fig. S1; see Biosci. Biotechnol. Biochem. that they cannot dissociate from the ERES. Figure 3B Web site). When we analyzed the effects of ABS and Supplemental movie 2 (see Biosci. Biotechnol. deletion on the binding constants, we found that deletion Biochem. Web site) show time-lapse images of repre- reduced the high affinity (slow mobile) population to sentative ERES in the juxtanuclear area before and after nearly half (Table 1). These data clearly indicate that the photobleaching. Immediate recovery of both Sec31AWT- ABS of Sec31A constitutes a high affinity binding site GFP and Sec31AABS-GFP in the photobleached region for the ERES. was observed. It reached a plateau within approximately 50 s post-bleach (Fig. 3C). Figure 4 plots averaged Discussion recovery rates after photobleaching in multiple cells (Sec31AWT-GFP, n ¼ 57; Sec31AABS-GFP, n ¼ 48). ERES have been defined as structures comprising the The maximum recovery rates of the Sec31AWT-GFP and transitional ER, in which COPII vesicle budding occurs, Sec31AABS-GFP fluorescence were almost the same. In and the immediate post-ER compartments.31) COPII is a contrast, the kinetics of recovery were clearly altered by multi-subunit complex consisting of five components, 100215-6 H. SHIBATA et al. structures indicates that physiological stimuli evoke the translocation of ALG-2 from the cytosol to the ERES. Translocation of GFP-ALG-2 was observed in cells treated with other physiological stimuli, including ATP and epidermal growth factor (data not shown). Further, when the cells were cultured in a medium supplemented with 10% fetal bovine serum, the transient GFP-ALG-2 redistribution appeared in an oscillatory mannar (data not shown). Thus oscillating accumulation of ALG-2 at the ERES can occur in cells under normal culture conditions. The ERES is the major site of ALG-2 localization upon Ca2þ-mobilization, and an accumu- lation of ALG-2 may be required in order for it to realize Fig. 4. Quantitative FRAP Analysis of Sec31AWT-GFP and its function at the ERES. Sec31AABS-GFP. In contrast to the dramatic redistribution of GFP- Normalized mean recovery rates after photobleaching for ALG-2, there was no striking difference in the distribu- Sec31AWT-GFP (n ¼ 57, open circle) and Sec31AABS-GFP tion pattern of Sec31A-RFP as between the cells before (n ¼ 48, solid circle) are plotted as a function of time for 60 s. Gray and after histamine administration in our imaging data and black error bars represent the 95% confidence intervals for Sec31AWT-GFP and Sec31AABS-GFP respectively. The inset shows (Fig. 1 and Supplemental movie 1). Previous biochem- k t fits to a two-phase exponential FðtÞ¼A0 þ A1 ¼ð1 e 1 Þþ ical fractionation experiments and indirect immuno- k t WT ABS A2ð1 e 2 Þ for Sec31A -GFP (gray line) and for Sec31A - fluorescence microscopic analysis suggest that treatment GFP (black line), from which the relative sizes of the immobile of cells with A23187, a Ca2þ-ionophore, induces a fractions and the half-time of recovery were calculated (Table 1). Best- 1 redistribution of Sec31A from the cytosol to the ERES fit values: k1 ¼ 0:323 0:010 s (low affinity site), k2 ¼ 0:070 19) 1 WT membranes. In most but not all of the cells stably 0:018 s (high affinity site); Sec31A -GFP, A0 ¼ 0:424 0:002, Advance ViewABS A1 ¼ 0:184 0:008, A2 ¼ 0:301 0:006; Sec31A -GFP, expressing GFP-ALG-2 and Sec31A-RFP, administra- A0 ¼ 0:437 0:003, A1 ¼ 0:305 0:006, A2 ¼ 0:184 0:006. tion of A23187 (10 mM) induced a persistent accumu- lation of GFP-ALG-2 on Sec31A-RFP-positive struc- tures and an increase in the fluorescence intensities of Table 1. Relative Sizes of Immobile, Fast, and Slow Mobile Sec31A-RFP within some but not all of the areas labeled Populations of Sec31AWT-GFP and Sec31AABS-GFP with both GFP-ALG-2 and Sec31A-RFP (Supplemental Fast (%) Slow (%) Fig. S2, ROIs 1 and 2, and movie 3). The data suggest Immobile (%) 2þ (t1=2 ¼ 2:1 s) (t1=2 ¼ 9:8 s) that sustained elevation of cytosolic Ca due to Sec31AWT 9:1 1:618:4 0:830:1 0:6 A23187 leads to an increase in the Sec31A protein 2þ Sec31AABS 7:5 1:530:5 0:618:4 0:6 level at the ERES. In the case of Ca -transients and Ca2þ-oscillationsProofs induced by physiological stimuli such Using the best-fit parameters, described in Fig. 4, the relative immobile as histamine, greater temporal and spatial resolution and fractions and t1=2 values of the fast and the slow mobile populations were calculated as follows: immobile (%) ¼ 100ð1 A0 A1 A2Þ, more sensitive analysis is needed to detect in more detail t1=2 ¼ lnð2Þ=k. the fluctuation of Sec31A-RFP signal intensities at the ERES. It is also important to emphasize that the the small GTPase Sar1, the Sec23/Sec24 inner coat response of GFP-ALG-2 translocation to the ERES complex, and the Sec13/Sec31 outer cage complex. The structures showed pleiotropic patterns among cells: GTP-bound form of Sar1 binds to ER membranes and single transient translocation, or oscillatory transloca- recruits the inner coat. This membrane-bound Sar1- tions with different frequencies. The effects of various Sec23/Sec24 pre-budding complex then recruits the ALG-2 translocation patterns on the protein levels of Sec13/Sec31 outer complex. Sec23 functions as a Sec31A at the ERES should be explored in future GTPase-activating protein (GAP) for Sar1, and the studies. outer coat is responsible for stimulating this GAP The presence of the non Alix-type sequence in human activity. The ERES can be visualized by immunocyto- Sec31A can be expected from previous data showing chemistry with antibodies for these COPII subunits and Ca2þ-dependent interaction with ALG-2GF122 as well their regulators. In the present study, we found that as ALG-2.12,19) In vitro binding analyses of Sec31A ALG-2 fused with SGFP2 (GFP-ALG-2) was trans- mutants using the bio-ALG-2 overlay technique were located from the cytosol to TagRFP-T-fused Sec31A successful in narrowing the region responsible for ALG- (Sec31A-RFP)-positive structures and transiently accu- 2 binding to 13 amino acids, ranging from 839 to 851 mulated there after histamine administration (Fig. 1). (Fig. 2). The identified region in Sec31A had markedly Expressed Sec31A proteins fused with TagRFP-T higher ALG-2 binding activity than the previously (Fig. 1) or SGFP2 (Fig. 3) were localized primarily to reported ALG-2 binding sequence of Alix in our assay small punctate structures that were distributed through- system (Fig. 2B). This is consistent with our previous out the cytoplasm but were most concentrated in the pulldown experiments using GST-fused ALG-2, in juxtanuclear area. These distribution patterns are char- which Sec31A proteins were more effectively pulled acteristic of ERES. The Sec31A-RFP-positive structures down than Alix.12,19) Sec31 proteins are conserved from in HeLa cells were labeled with an antibody for p125 yeast to humans, and two mammalian isoforms, Sec31A (data not shown), an interacting protein for Sec23 that and Sec31B, have been identified.33–35) Rodent and localizes principally to the ERES.32) Thus transient avian Sec31A proteins share sequences similar to the accumulation of GFP-ALG-2 on Sec31A-RFP-positive ALG-2 binding site of the human protein: Rattus ALG-2 Binding Site in Sec31A 100215-7 norvegicus (GenBank accession no. EDL99573), 839- decreased residency time for the Sec31A deletion PPPGFIMHGNVVP; Mus musculus (EDL20296), 838- mutant might partly reflect a rapid uncoating of the PPPGFIMQGNVIP; Gallus gallus (CAH65156), 845- mutant from the released COPII vesicles. We have PPPGFIMPGAINP, whereas there are no such sequences reported that ALG-2 mediates a Ca2þ-dependent inter- in amphibian, fish, and invertebrate Sec31A homologs, action between Alix and TSG101, in which the ALG-2 and in human Sec31B. Thus the interaction of ALG-2 homodimer serves as a Ca2þ-dependent adaptor by with Sec31A might be specific to mammalian and avian crossbridging the two proteins.23,40) The crucial next step species. Alternatively, the ALG-2 homolog of other in understanding the molecular mechanisms by which species might recognize different types of sequence in ALG-2 stabilizes the outer cage components of the the respective Sec31 proteins. COPII system is to identify the Ca2þ-dependent cross- We have found evidence that deletion of the ALG-2 bridging partner proteins of Sec31A mediated by the binding site affects the kinetics of Sec31A on and off the ALG-2 dimer. ERES structures by FRAP analysis (Figs. 3 and 4, Table 1). A significant reduction in slow mobile Acknowledgment populations due to ABS deletion indicates that the ABS of Sec31A is an element essential to high-affinity We thank Dr. Toshio Kitamura (University of Tokyo) binding to the ERES. The ABS is located in the N- and Dr. Katsuko Tani (Tokyo University of Pharmacy terminal part within the Pro-rich region (Fig. 2). Two- and Life Science) for providing valuable materials. We hybrid studies of yeast and mammalian proteins have are grateful to Dr. Kiyotaka Hitomi and the members of suggested the presence of a binding surface for Sec23 the Laboratory of Molecular and Cellular Regulation for also within the Pro-rich region of Sec31 proteins.33,36) the encouraging suggestions. This work was supported Further, Bi et al. have reported a sequence comprising partly by a research grant from the Uehara Memorial amino acid residues 907–942 of Saccharomyces cerevi- Foundation (to H. S.), a Grant-in-Aid for Young siaeAdvanceSec31p as the active fragment that interacts View with Scientist (B) (21770139) (to H. S.), and a Grant-in-Aid Sec23p and stimulates the GAP activity of Sec23/ for Scientific Research (B) (20380059) (to M. M.) from Sec24p for the small GTPase Sar1p.37) The correspond- the Ministry of Education, Culture, Sports, Science, and ing sequence in Homo sapiens Sec31A (GenBank Technology of Japan. accession no. AAF67836), residues 980–1,015, is located in the C-terminal part of the Pro-rich region References (see Fig. 2A). Since the ABS is far from the predicted active fragment for Sec23, it is possible that both ALG-2 1) Maki M, Narayana SV, and Hitomi K, Biochem. J., 328, 718– and Sec23 interact simultaneously with Sec31A. A 720 (1997). crystallographic study of the structure of yeast Sec13/ 2) Maki M, Kitaura Y, Satoh H, Ohkouchi S, and Shibata H, Sec31p heterotetramer has documented that the Pro-rich Biochim. Biophys. Acta, 1600, 51–60 (2002). 3) Vito P, Lacana` E, and D’Adamio L, Science, 271, 521–525 region of Sec31p is unstructured within the assembly Proofs (1996). unit, and it might lie outside the architectural core of the 4) Jang IK, Hu R, Lacana` E, D’Adamio L, and Gu H, Mol. Cell. COPII outer cage.38) Although it remains untested Biol., 22, 4094–4100 (2002). whether the Ca2þ-dependent interaction of ALG-2 with 5) Rao RV, Poksay KS, Castro-Obregon S, Schilling B, Row RH, Sec31A affects the GAP stimulation activity of Sec31A, del Rio G, Gibson BW, Ellerby HM, and Bredesen DE, J. Biol. the ABS can provide an interaction platform for signal- Chem., 279, 177–187 (2004). ing molecules, including ALG-2, which might regulate 6) Mahul-Mellier AL, Hemming FJ, Blot B, Fraboulet S, and Sadoul R, J. Neurosci., 26, 542–549 (2006). the retention kinetics of Sec31A at the ERES by 7) la Cour JM, Mollerup J, Winding P, Tarabykina S, Sehested M, modulating GAP stimulation activity. and Berchtold MW, Am. J. Pathol., 163, 81–89 (2003). In contrast to the significant effect on recycling 8) Subramanian L and Polans AS, Biochem. Biophys. Res. kinetics, ABS deletion did not affect the distribution Commun., 322, 1153–1165 (2004). pattern (Fig. 3A) or the size of the immobile fraction on 9) Kitaura Y, Satoh H, Takahashi H, Shibata H, and Maki M, Arch. FRAP analysis (Table 1). Thus comparable percentages Biochem. Biophys., 399, 12–18 (2002). 10) Suzuki H, Kawasaki M, Inuzuka T, Okumura M, Kakiuchi T, of the deletion mutant to that of the wild type at the Shibata H, Wakatsuki S, and Maki M, Structure, 16, 1562–1573 ERES can be released to the cytosol and the equivalent (2008). cytosolic mutant proteins are recruited to the ERES. 11) Maki M and Shibata H, Calcium Binding Proteins, 2, 4–10 Indeed, the N-terminal region required for outer cage (2007). formation with Sec13 and the predictive fragment that 12) Shibata H, Suzuki H, Kakiuchi T, Inuzuka T, Yoshida H, interacts with Sec23 remained intact in the Sec31AABS. Mizuno T, and Maki M, J. Biol. Chem., 283, 9623–9632 (2008). It is also conceivable that endogenous Sec31A proteins 13) Draeby I, Woods YL, la Cour JM, Mollerup J, Bourdon JC, and Berchtold MW, Arch. Biochem. Biophys., 467, 87–94 influence the recycling rates of the mutant by forming a (2007). heterotetramer complex with the mutant and Sec13. A 14) Vergarajauregui S, Martina JA, and Puertollano R, J. Biol. more drastic effect might be detectable when endogenous Chem., 284, 36357–36366 (2009). Sec31A proteins are replaced by the mutant in the cell. 15) Shibata H, Yamada K, Mizuno T, Yorikawa C, Takahashi H, Bentley et al. reported recently that ALG-2 plays an Satoh H, Kitaura Y, and Maki M, J. Biochem., 135, 117–128 inhibitory role in the fusion of released COPII vesicles (2004). by stabilizing Sec31A on the vesicles in vitro.39) Since 16) Vito P, Pellegrini L, Guiet C, and D’Adamio L, J. Biol. Chem., 274, 1533–1540 (1999). in vivo COPII vesicle fusion is thought to occur in an 17) Missotten M, Nichols A, Rieger K, and Sadoul R, Cell Death area closely proximate to budding sites within the Differ., 6, 124–129 (1999). ERES, the FRAP data in the present study showing a 18) Trioulier Y, Torch S, Blot B, Cristina N, Chatellard-Causse C, 100215-8 H. SHIBATA et al. Verna JM, and Sadoul R, J. Biol. Chem., 279, 2046–2052 29) la Cour JM, Mollerup J, and Berchtold MW, Biochem. Biophys. (2004). Res. Commun., 353, 1063–1067 (2007). 19) Shibata H, Suzuki H, Yoshida H, and Maki M, Biochem. 30) Huang X and Miller W, Adv. Appl. Math., 12, 337–357 (1991). Biophys. Res. Commun., 353, 756–763 (2007). 31) Budnik A and Stephens DJ, FEBS Lett., 583, 3796–3803 (2009). 20) Yamasaki A, Tani K, Yamamoto A, Kitamura N, and Komada 32) Shimoi W, Ezawa I, Nakamoto K, Uesaki S, Gabreski G, Aridor M, Mol. Biol. Cell, 17, 4876–4887 (2006). M, Yamamoto A, Nagahama M, Tagaya M, and Tani K, J. Biol. 21) Akagi T, Sasai K, and Hanafusa H, Proc. Natl. Acad. Sci. USA, Chem., 280, 10141–10148 (2005). 100, 13567–13572 (2003). 33) Shugrue CA, Kolen ER, Peters H, Czernik A, Kaiser C, 22) Kremers GJ, Goedhart J, van den Heuvel DJ, Gerritsen HC, and Matovcik L, Hubbard AL, and Gorelick F, J. Cell Sci., 112, Gadella TWJr, Biochemistry, 46, 3775–3783 (2007). 4547–4556 (1999). 23) Okumura M, Ichioka F, Kobayashi R, Suzuki H, Yoshida H, 34) Tang BL, Zhang T, Low DY, Wong ET, Horstmann H, and Shibata H, and Maki M, Biochem. Biophys. Res. Commun., 386, Hong W, J. Biol. Chem., 275, 13597–13604 (2000). 237–241 (2009). 35) Stankewich MC, Stabach PR, and Morrow JS, J. Cell Sci., 119, 24) Shaner NC, Lin MZ, McKeown MR, Steinbach PA, Hazelwood 958–969 (2006). KL, Davidson MW, and Tsien RY, Nat. Methods, 5, 545–551 36) Shaywitz DA, Espenshade PJ, Gimeno RE, and Kaiser CA, (2008). J. Biol. Chem., 272, 25413–25416 (1997). 25) Horii M, Shibata H, Kobayashi R, Katoh K, Yorikawa C, 37) Bi X, Mancias JD, and Goldberg J, Dev. Cell, 13, 635–645 Yasuda J, and Maki M, Biochem. J., 400, 23–32 (2006). (2007). 26) Hatsuzawa K, Tamura T, Hashimoto H, Hashimoto H, Yokota 38) Fath S, Mancias JD, Bi X, and Goldberg J, Cell, 129, 1325– S, Miura M, Nagaya H, and Wada I, Mol. Biol. Cell, 17, 3964– 1336 (2007). 3977 (2006). 39) Bentley M, Nycz DC, Joglekar A, Fertschai I, Malli R, Graier 27) Satoh H, Shibata H, Nakano Y, Kitaura Y, and Maki M, WF, and Hay JC, Mol. Biol. Cell, 21, 1033–1046 (2010). Biochem. Biophys. Res. Commun., 291, 1166–1172 (2002). 40) Ichioka F, Takaya E, Suzuki H, Kajigaya S, Buchman VL, 28) Katoh K, Suzuki H, Terasawa Y, Mizuno T, Yasuda J, Shibata Shibata H, and Maki M, Arch. Biochem. Biophys., 457, 142–149 AdvanceH, and Maki M, Biochem. J., 391, 677–685 (2005). View(2007).

Proofs