DOCSLIB.ORG

The ALG-2 Binding Site in Sec31a Influences the Retention Kinetics Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The ALG-2 Binding Site in Sec31a Influences the Retention Kinetics Of 100215 (317) Biosci. Biotechnol. Biochem., 74 (9), 100215-1–8, 2010 The ALG-2 Binding Site in Sec31A Influences the Retention Kinetics of Sec31A at the Endoplasmic Reticulum Exit Sites as Revealed by Live-Cell Time-Lapse Imaging y Hideki SHIBATA,1; Tatsutoshi INUZUKA,1 Haruna YOSHIDA,1 Hirofumi SUGIURA,1 Ikuo WADA,2 and Masatoshi MAKI1 1Department of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan 2Department of Cell Science, Institute of Biomedical Sciences, Fukushima Medical University School of Medicine, 1 Hikariga-oka, Fukushima 960-1295, Japan Received March 24, 2010; Accepted June 2, 2010; Online Publication, September 7, 2010 [doi:10.1271/bbb.100215] ALG-2, a member of the penta-EF-hand protein 2 functions as a downstream effecter of the Ca2þ- family, interacts Ca2þ-dependently with a COPII com- signaling pathway under these physiological conditions ponent, Sec31A. In this study, we first established HeLa remain largely unknown. The fifth EF-hand of ALG-2 cells stably expressing green fluorescent protein-fused mediates the formation of the homodimer or the ALG-2 (GFP-ALG-2) and red fluorescent protein-fused heterodimer with peflin,9) whereas the first and the Sec31AAdvance (Sec31A-RFP). After inducing Ca2þ-mobiliza- View third EF-hands have a physiologically crucial role in tion, the cytoplasmic distribution of GFP-ALG-2 Ca2þ-binding, which drives conformational changes in changed from a diffuse to a punctate pattern, which the protein10) and mediates Ca2þ-dependent interaction extensively overlapped with the Sec31A-RFP-positive with multiple proteins, most of which have Pro-rich structures, indicating that ALG-2 is recruited to the regions.11) endoplasmic reticulum exit sites (ERES) in living cells. A number of target proteins for ALG-2 have been Next, overlay experiments with biotin-labeled ALG-2 reported. They can be classified into two groups based were done to dissect the ALG-2 binding site (ABS). They on their binding ability to an alternatively spliced shorter revealed that a sequence comprising amino acid resi- isoform of ALG-2, ALG-2GF122, which lacks Gly121 dues 839–851 in the Pro-rich region was necessary and and Phe122.12) Alix (also named AIP1), annexin A7, sufficient for direct binding to ALG-2. Finally, fluores- annexin A11, TSG101,Proofs scotin, and mucolipin-1 lack the cence recovery after photobleaching analysis indicated ability to bind ALG-2GF122, whereas phospholipid that the ABS deletion reduced the high-affinity popula- scramblase (PLSCR) 3, PLSCR4, and Sec31A interact tion of Sec31A to the ERES, suggesting that the ABS is with both isoforms.12–14) Among these target proteins, one of the key determinants of the retention kinetics of we determined precisely the ALG-2 binding sites (ABS) Sec31A at ERES. in Alix15) and PLSCR3.12) Alix is a cytoplasmic adaptor protein that was the first target protein identified for Key words: ALG-2; Sec31A; endoplasmic reticulum ALG-2.16,17) The characteristic PxY repeats in the (ER) exit sites; time-lapse imaging; fluores- C-terminal Pro-rich region of Alix is a critical element cence recovery after photobleaching in ALG-2-binding.15,18) Deletion of the ABS changes the (FRAP) distribution of the overexpressed C-terminal half region of Alix fused with enhanced green fluorescent protein ALG-2 (apoptosis-linked gene 2), a product of the from a punctate to a diffuse pattern in HeLa cells,15) and PDCD6 gene, is a Ca2þ-binding protein possessing five abolishes the effects of the overexpressed full-length and serially repetitive EF-hand motifs in its C-terminal C-terminal half versions of Alix on neuronal survival.18) region. It belongs to the penta-EF-hand (PEF) protein We identified PLSCR3 as a target for ALG-2 by family, including the large and small subunits of typical searching for proteins that contain a region homologous calpains, sorcin, glancalcin, and peflin.1,2) While ALG-2 to the ABS of Alix.12) Although the homologous site in was originally identified as a proapoptotic gene product PLSCR3, ABS-1, was sufficient for binding to ALG-2, in a cell-death study of mouse T-cell hybridoma,3) ALG- a mutant lacking the ABS-1 showed the ability to 2-deficient mice develop normally, with no abnormal- bind ALG-2 as well as ALG-2GF122. Further deletion ities in the immune system.4) Nonetheless, the potential analyses of PLSCR3 identified another region, ABS-2, involvement of ALG-2 in regulating endoplasmic that contributes to interaction with both ALG-2 and reticulum (ER)-stress-induced apoptosis,5) neuronal cell ALG-2GF122. death during development,6) and cancer7,8) has been In the present study, we focused on another ALG-2- reported, but the molecular mechanisms by which ALG- interactive target, Sec31A, which is a component of the y To whom correspondence should be addressed. Fax: +81-52-789-5542; E-mail: [email protected] Abbreviations: GFP, green fluorescent protein; RFP, red fluorescent protein; ERES, endoplasmic reticulum exit site; ABS, ALG-2 binding site; PEF, penta-EF-hand; PLSCR, phospholipid scramblase; FRAP, fluorescence recovery after photobleaching; WT, wild type; GST, glutathione-S- transferase; ROI, region of interest; bio-, biotin-labeled; GAP, GTPase-activating protein; CBB, Coomassie Brilliant Blue 100215-2 H. SHIBATA et al. COPII coat of ER-to-Golgi transport vesicles. We and gccaataagctgggtgtggatccggacagccccgg-30 and reverse 50-ccggggctgtcc- others have reported that ALG-2 localizes at the ggatccacacccagcttattggc-30. The EcoRI/BamHI fragment excised from Sec31A-positive ER exit sites (ERES) in a Ca2þ- the resulting plasmid was inserted between the EcoRI and BamHI sites of pSGFP2-N-SGG and pTagRFP-T-N-SGG to construct pSec31A- dependent manner, as detected by indirect immuno- SGFP2 and pSec31A-TagRFP-T respectively. To introduce the MluI 19,20) fluorescence. RNAi-mediated knockdown experi- site in the 50-untranslated region of the Sec31A-SGFP2-coding ments have indicated that ALG-2 is required to maintain sequence by PCR, pFP 50 MluI as forward primer and pEGFP-N lower normal Sec31A levels at the ERES.20) Here, we primer, 50-tgaacagctcctcgccct-30, as reverse primer were used, and the confirmed the dynamic recruitment of ALG-2 to the PCR product was inserted into pCR-BluntII-TOPO. The MluI/NotI ERES in HeLa cells stably expressing fluorescent fragment digested from the resulting plasmid, which encodes Sec31A protein-fused ALG-2 and Sec31A by time-lapse fluo- and SGG-linker, was inserted between the MluI and NotI sites of pCX4bsr to construct pCX4bsr/Sec31A-SGG. Then the NotI fragments rescence microscopy. Further, the ALG-2 binding site of digested from pSGFP2-N-SGG and pTagRFP-T-N-SGG, which encode Sec31A was identified, and the effects of deletion of this SGFP2 and TagRFP-T respectively, was inserted into the NotI site of site on the recycling kinetics of Sec31A proteins on and pCX4bsr/Sec31A-SGG to construct pCX4bsr/Sec31A-SGFP2 and off the ERES structures were examined by fluorescence pCX4bsr/Sec31A-TagRFP-T. pCX4bsr/Sec31A839{851-SGFP2 was recovery after photobleaching (FRAP) analysis. constructed by replacing the Sec31A wild-type coding sequence of pCX4bsr/Sec31A-SGFP2 with the deletion mutant-coding sequence of pFLAG-Sec31A839{851 using the EcoRI and the SphI sites. An Materials and Methods Escherichia coli expression plasmid for GST-His, designated pGST- His, encoding two flexible GGS linkers between the GST-coding Cells and antibodies. HeLa cells were purchased from the RIKEN sequence and the multiple cloning site and between the multiple cloning Cell Bank (Tsukuba, Japan), and one of the cell lines isolated by site and the 8xHis-coding sequence, and an expression plasmid for 19) limited dilution cloning, designated HeLa SS4, was used. An GST-Alix801{812-His, designated pGST-Alix801{812-His, were described amphotropic murine leukemia virus-packaging cell line, PLAT-A, was previously.10) pGST-Sec31A837{849-His and pGST-Sec31A839{851-His, kindly provided by Dr. Toshio Kitamura (Institute of Medical Science, for the expression of GST- and His-tagged Sec31A (amino acids University of Tokyo). Mouse anti-FLAG monoclonal antibody (M2) 837–849) and Sec31A (amino acids 839–851) were constructed was purchased from Sigma (St. Louis, Mo). Peroxidase-conjugated by inserting a combination of the following oligonucleotides into the goatAdvance anti-mouse IgG antibody was from Jackson Immuno View Research 837{849 0 BglI site of pGST-His: for pGST-Sec31A -His, forward 5 - Laboratories (West Grove, PA). cggcaccgccaccaggcttcattatgcatggcaacgtgaatccggcctcgg-30 and reverse 50-aggccggattcacgttgccatgcataatgaagcctggtggcggtgccgaac-30; and for Plasmid constructions. An expression plasmid for FLAG-tagged pGST-Sec31A839{851-His, forward 50-cggcaaatccgccaccgccaggcttcatt- Sec31A in mammalian cells, pFLAG-Sec31A, was reconstructed from atgcatggcaacgtggcctcgg-30 and reverse 50-aggccacgttgccatgcataatgaa- an isolated clone encoding a putative alternative splicing isoform by gcctggcggtggcggatttgccgaac-30. two rounds of PCR-based site-directed mutagenesis using a combina- tion of the following primers: for the first round, 50-cttagggaacagaca- ctttcaccaacaatcaccag-30 and 50-ctggtgattgttggtgaaagtgtctgttccctaag-30; Transfection and retroviral infection. HEK293T cells were trans- and for the second round, 50-ctgcgtcccaaagaacaggtcctcagaatggttgg-30 fected by the conventional calcium phosphate precipitation method. and 50-ccaaccattctgaggacctgttctttgggacgcag-30. The resulting plasmid HeLa cell lines expressing fluorescent protein-fused
Load more

Recommended publications
  • Old Data and Friends Improve with Age: Advancements with the Updated Tools of Genenetwork
    bioRxiv preprint doi: https://doi.org/10.1101/2021.05.24.445383; this version posted May 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Old data and friends improve with age: Advancements with the updated tools of GeneNetwork Alisha Chunduri1, David G. Ashbrook2 1Department of Biotechnology, Chaitanya Bharathi Institute of Technology, Hyderabad 500075, India 2Department of Genetics, Genomics and Informatics, University of Tennessee Health Science Center, Memphis, TN 38163, USA Abstract Understanding gene-by-environment interactions is important across biology, particularly behaviour. Families of isogenic strains are excellently placed, as the same genome can be tested in multiple environments. The BXD’s recent expansion to 140 strains makes them the largest family of murine isogenic genomes, and therefore give great power to detect QTL. Indefinite reproducible genometypes can be leveraged; old data can be reanalysed with emerging tools to produce novel biological insights. To highlight the importance of reanalyses, we obtained drug- and behavioural-phenotypes from Philip et al. 2010, and reanalysed their data with new genotypes from sequencing, and new models (GEMMA and R/qtl2). We discover QTL on chromosomes 3, 5, 9, 11, and 14, not found in the original study. We narrowed down the candidate genes based on their ability to alter gene expression and/or protein function, using cis-eQTL analysis, and variants predicted to be deleterious. Co-expression analysis (‘gene friends’) and human PheWAS were used to further narrow candidates.
    [Show full text]
  • Leukaemia Section
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Leukaemia Section Short Communication t(4;9)(q21.22;p24) SEC31A/JAK2 Julie Sanford Biggerstaff Idaho Cytogenetics Diagnostic Laboratory, Boise, ID 83706, USA; [email protected] Published in Atlas Database: April 2017 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0409q21p24ID1682.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/68905/04-2017-t0409q21p24ID1682.pdf DOI: 10.4267/2042/68905 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2018 Atlas of Genetics and Cytogenetics in Oncology and Haematology Abstract Cytogenetics Review on t(4;9)(q21.22;p24) SEC31A/JAK2, with data on clinics, and the genes involved. Cytogenetics morphological KEYWORDS JAK2 breakapart (commonly available). Chromosome 4; chromosome 9; translocation; SEC31A; JAK2; Hodgkin Lymphoma Genes involved and Clinics and pathology proteins SEC31A (SEC31 homolog A, COPII Disease coat complex component) Hodgkin Lymphoma Location Phenotype/cell stem origin 4q21.22 Hodgkin and Reed-Sternberg cells, which derive DNA/RNA from pre-apoptotic crippled germinal center (GC) B- gene is 72,606 bp with 25 exons; transcribed from cells, are positive for CD30, CD15, CD40 and the - strand; coding region is 62,863 bp with 24 IRF4/MUM1 exons Epidemiology Protein Hodgkin lymphoma itself is common, but this 1166 amnio acids. Protein transport protein SEC31A particular translocation may be rare within the is ubiquitously expressed and forms part of the coat disorder. However, it is not often assayed for; found protein complex II (COPII) which is comprised of at in 2/131 cHL cases examined: a M/31 with nodular least four other proteins in addition to SEC31A this sclerosis cHL, alive 60 mths after diagnosis; and a complex is involved in formation of transport M/83 with lymphocyte-depleted cHL who died at vesicles from the ER to Golgi.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Cytogenetically Complex SEC31A-ALK Fusions Are Recurrent
    Letters to the Editor A 1.5 30 Takashi Uchiyama from the Deptartment of Hematology/Oncology, ETV6-ABL1 WBC Kyoto University Hospital, Japan for following the patient in Japan, Tony Deblasio for collecting and storing the samples, and Emily 1.0 20 Dolezal for generating the database that facilitated our analysis. ETV6-ABL1 WBC (fold-change in (x109/ L) Correspondence: Stephen D. Nimer, MD, Memorial Sloan transcript level) μ Kettering Cancer Center, 1275 York Avenue, New York, NY 0.5 10 10065, USA. Phone: international +1.646.8883040. Fax: international +1.646.4220246. E-mail: [email protected] Key words: myeloproliferative, neoplasm, imatinib, molecular 0.0 0 response. 2.7.06 5.9.06 1.25.05 9.13.05 5.20.08 4.28.09 Citation: Perna F, Abdel-Wahab O, Levine RL, Jhanwar SC, 08.09.05 11.01.05 Imada K, and Nimer SD. ETV6-ABL1-positive “chronic myeloid 1.5 leukemia”: clinical and molecular response to tyrosine kinase inhibi- B c-myc tion with imatinib. Haematologica 2011; 96(02):342-343. BCL-XL doi:10.3324/haematol.2010.036673 ld1 1.0 NuP98 Fold-change (relative to References HPRT1) 0.5 1. Andreasson P, Johansson B, Carlsson M, Jarlsfelt I, Fioretos T, Mitelman F, et al. BCR/ABL-negative chronic myeloid leukemia with ETV6/ABL fusion. Genes Chromosomes Cancer. 1997;20(3): 0.0 299-304. 2. Barbouti A, Ahlgren T, Johansson B, Hoglund M, Lassen C, 2.7.06 5.9.06 1.25.05 9.13.05 Turesson I, et al. Clinical and genetic studies of ETV6/ABL1-posi- 08.09.05 11.01.05 tive chronic myeloid leukaemia in blast crisis treated with imatinib mesylate.
    [Show full text]
  • 1 the TRAPP Complex Mediates Secretion Arrest Induced by Stress Granule Assembly Francesca Zappa1, Cathal Wilson1, Giusepp
    bioRxiv preprint doi: https://doi.org/10.1101/528380; this version posted February 5, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. The TRAPP complex mediates secretion arrest induced by stress granule assembly Francesca Zappa1, Cathal Wilson1, Giuseppe Di Tullio1, Michele Santoro1, Piero Pucci2, Maria Monti2, Davide D’Amico1, Sandra Pisonero Vaquero1, Rossella De Cegli1, Alessia Romano1, Moin A. Saleem3, Elena Polishchuk1, Mario Failli1, Laura Giaquinto1, Maria Antonietta De Matteis1, 2 1 Telethon Institute of Genetics and Medicine, Pozzuoli (Naples), Italy 2 Federico II University, Naples, Italy 3 Bristol Renal, Bristol Medical School, University of Bristol, UK Correspondence to: [email protected], [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/528380; this version posted February 5, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. The TRAnsport-Protein-Particle (TRAPP) complex controls multiple membrane trafficking steps and is thus strategically positioned to mediate cell adaptation to diverse environmental conditions, including acute stress. We have identified TRAPP as a key component of a branch of the integrated stress response that impinges on the early secretory pathway. TRAPP associates with and drives the recruitment of the COPII coat to stress granules (SGs) leading to vesiculation of the Golgi complex and an arrest of ER export.
    [Show full text]
  • Identification of Prognosis Biomarkers of Prostatic Cancer in a Cohort Of
    Current Problems in Cancer 43 (2019) 100503 Contents lists available at ScienceDirect Current Problems in Cancer journal homepage: www.elsevier.com/locate/cpcancer Identification of prognosis biomarkers of prostatic cancer in a cohort of 498 patients from TCGA ∗ Zhiqiang Chen , Haiyi Hu Department of Urology, Sir Run Run Shaw Hospital, Medical College of Zhejiang University, Hangzhou, China a b s t r a c t Objective: Prostatic cancer (PCa) is the first common cancer in male, and the prognostic variables are ben- eficial for clinical trial design and treatment strategies for PCa. This study was performed to identify more potential biomarkers for the prognosis of patients with PCa. Methods and results: The transcriptome data and survival information of a cohort including 498 subjects with PCa were downloaded from TCGA . A total of 4293 differentially expressed genes (DEGs), including 1362 prognosis-related DEGs, were identified in PCa tissues compared with normal tissues. Upregulated genes, including serine/arginine-rich splicing factors (SRSFs; such as SRSF2, SRSF5, SRSF7 and SRSF8 ), and ubiquitin conjugating enzyme E2 (UBE2) members (such as UBE2D2, UBE2G2, UBE2J1 and UBE2E1 ), were identified as negative prognostic biomarkers of PCa, as the high expression of them correlated with poor overall survival of PCa patients. Several downregulated Golgi-ER traffic mediators (such as SEC31A, TMED2, and TMED10 ) were identified as positive prognostic biomarkers of PCa, as the high expression of them correlated with good overall survival of PCa patients. Conclusions: These genes were of great interests in prognosis of PCa, and some of them may be constructive for the augmentation of clinical trial design and treatment strategies for PCa.
    [Show full text]
  • Gene- and Tissue-Level Interactions in Normal Gastrointestinal Development and Hirschsprung Disease
    Gene- and tissue-level interactions in normal gastrointestinal development and Hirschsprung disease Sumantra Chatterjeea,b,1, Priyanka Nandakumara,1, Dallas R. Auera,b, Stacey B. Gabrielc, and Aravinda Chakravartia,b,2 aCenter for Complex Disease Genomics, McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine, Baltimore, MD 21205; bCenter for Human Genetics and Genomics, New York University School of Medicine, New York, NY 10016; and cGenomics Platform, Broad Institute of MIT and Harvard, Cambridge, MA 02142 Contributed by Aravinda Chakravarti, November 1, 2019 (sent for review May 21, 2019; reviewed by William J. Pavan and Tatjana Sauka-Spengler) The development of the gut from endodermal tissue to an organ between the longitudinal and circular muscles, and the sub- with multiple distinct structures and functions occurs over a mucosal (Meissner’s) plexus, between the circular muscle and prolonged time during embryonic days E10.5–E14.5 in the mouse. the submucosal layer. The myenteric and submucoal plexuses During this process, one major event is innervation of the gut by provide motor innervation to both muscular layers of the gut, enteric neural crest cells (ENCCs) to establish the enteric nervous and secretomotor innervation of the mucosa nearest the lumen system (ENS). To understand the molecular processes underpinning of the gut, respectively (6). gut and ENS development, we generated RNA-sequencing profiles The many stages of gut development require numerous initiat- from wild-type mouse guts at E10.5, E12.5, and E14.5 from both ing signaling events activating transcription factors (TFs) targeting sexes. We also generated these profiles from homozygous Ret null diverse genes and pathways varying across development (7, 8).
    [Show full text]
  • Profiling APOL1 Nephropathy Risk Variants in Genome-Edited Kidney
    Original Investigation Profiling APOL1 Nephropathy Risk Variants in Genome-Edited Kidney Organoids with Single-Cell Transcriptomics Esther Liu,1 Behram Radmanesh,1 Byungha H. Chung,2 Michael D. Donnan,1 Dan Yi,1 Amal Dadi,1 Kelly D. Smith,3 Jonathan Himmelfarb,2 Mingyao Li,4 Benjamin S. Freedman,2,3 and Jennie Lin 1,5 Abstract Background DNA variants in APOL1 associate with kidney disease, but the pathophysiologic mechanisms remain incompletely understood. Model organisms lack the APOL1 gene, limiting the degree to which disease states can be recapitulated. Here we present single-cell RNA sequencing (scRNA-seq) of genome-edited human kidney organoids as a platform for profiling effects of APOL1 risk variants in diverse nephron cell types. Methods We performed footprint-free CRISPR-Cas9 genome editing of human induced pluripotent stem cells (iPSCs) to knock in APOL1 high-risk G1 variants at the native genomic locus. iPSCs were differentiated into kidney organoids, treated with vehicle, IFN-g, or the combination of IFN-g and tunicamycin, and analyzed with scRNA-seq to profile cell-specific changes in differential gene expression patterns, compared with isogenic G0 controls. Results Both G0 and G1 iPSCs differentiated into kidney organoids containing nephron-like structures with glomerular epithelial cells, proximal tubules, distal tubules, and endothelial cells. Organoids expressed detectable APOL1 only after exposure to IFN-g. scRNA-seq revealed cell type–specific differences in G1 organoid response to APOL1 induction. Additional stress of tunicamycin exposure led to increased glomerular epithelial cell dedifferentiation in G1 organoids. Conclusions Single-cell transcriptomic profiling of human genome-edited kidney organoids expressing APOL1 risk variants provides a novel platform for studying the pathophysiology of APOL1-mediated kidney disease.
    [Show full text]
  • Transposable Element Expression at Unique Loci in Single Cells with CELLO-Seq
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.02.322073; this version posted October 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transposable element expression at unique loci in single cells with CELLO-seq Rebecca V Berrens*1, Andrian Yang #2, Christopher E Laumer #2, Aaron TL Lun 1,4, Florian Bieberich 1,5, Cheuk-Ting Law 1,6, Guocheng Lan 1,7, Maria Imaz 3,8, Daniel Gaffney 3,9, John C Marioni *1,2,3 1 Cancer Research UK Cambridge Institute, University of Cambridge, Cambridge, UK. 2 European Molecular Biology Laboratory, European Bioinformatics Institute, Wellcome Genome Campus, CB10 1SD Hinxton, Cambridge, UK. 3 Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton CB10 1SA, UK. # = equal contribution * = corresponding authors For correspondence = [email protected], [email protected] Current addresses: 4 Genentech, 1 DNA Way, South San Francisco, CA 94080, United States 5 ETH Zürich, D-BSSE, Mattenstrasse 26, 4058 Basel, Switzerland 6 Department of Pathology, Li Ka Shing Faculty of Medicine, University of Hong Kong 7 School of Biomedical Sciences,Stem Cell and Regenerative Consortium, Centre for PanorOmic Sciences, Li Ka Shing Faculty of Medicine, The University of Hong Kong 8 Division of Cardiovascular Medicine, University of Cambridge, United Kingdom 9 Genomics Plc, King Charles House, Park End St, Oxford OX1 1JD 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.02.322073; this version posted October 2, 2020.
    [Show full text]
  • Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets
    www.nature.com/scientificreports OPEN Assessment of a complete and classifed platelet proteome from genome‑wide transcripts of human platelets and megakaryocytes covering platelet functions Jingnan Huang1,2*, Frauke Swieringa1,2,9, Fiorella A. Solari2,9, Isabella Provenzale1, Luigi Grassi3, Ilaria De Simone1, Constance C. F. M. J. Baaten1,4, Rachel Cavill5, Albert Sickmann2,6,7,9, Mattia Frontini3,8,9 & Johan W. M. Heemskerk1,9* Novel platelet and megakaryocyte transcriptome analysis allows prediction of the full or theoretical proteome of a representative human platelet. Here, we integrated the established platelet proteomes from six cohorts of healthy subjects, encompassing 5.2 k proteins, with two novel genome‑wide transcriptomes (57.8 k mRNAs). For 14.8 k protein‑coding transcripts, we assigned the proteins to 21 UniProt‑based classes, based on their preferential intracellular localization and presumed function. This classifed transcriptome‑proteome profle of platelets revealed: (i) Absence of 37.2 k genome‑ wide transcripts. (ii) High quantitative similarity of platelet and megakaryocyte transcriptomes (R = 0.75) for 14.8 k protein‑coding genes, but not for 3.8 k RNA genes or 1.9 k pseudogenes (R = 0.43–0.54), suggesting redistribution of mRNAs upon platelet shedding from megakaryocytes. (iii) Copy numbers of 3.5 k proteins that were restricted in size by the corresponding transcript levels (iv) Near complete coverage of identifed proteins in the relevant transcriptome (log2fpkm > 0.20) except for plasma‑derived secretory proteins, pointing to adhesion and uptake of such proteins. (v) Underrepresentation in the identifed proteome of nuclear‑related, membrane and signaling proteins, as well proteins with low‑level transcripts.
    [Show full text]
  • Regulation of Sec16 Levels and Dynamics Links Proliferation And
    ß 2015. Published by The Company of Biologists Ltd | Journal of Cell Science (2015) 128, 670–682 doi:10.1242/jcs.157115 RESEARCH ARTICLE Regulation of Sec16 levels and dynamics links proliferation and secretion Kerstin D. Tillmann1,2, Veronika Reiterer1, Francesco Baschieri1,2, Julia Hoffmann3, Valentina Millarte1,2, Mark A. Hauser1, Arnon Mazza4, Nir Atias4, Daniel F. Legler1, Roded Sharan4, Matthias Weiss3,* and Hesso Farhan1,2,* ABSTRACT proteins to downstream sites of the secretory pathway (Budnik and Stephens,2009; Lee et al., 2004; Zanetti et al., 2012). Sec16A We currently lack a broader mechanistic understanding of the (hereafter called Sec16) plays an important role in ERES integration of the early secretory pathway with other homeostatic homeostasis as it interacts with several COPII components and processes such as cell growth. Here, we explore the possibility regulates their function (Bhattacharyya and Glick, 2007; that Sec16A, a major constituent of endoplasmic reticulum exit Connerly et al., 2005; Farhan et al., 2008; Ivan et al., 2008; sites (ERES), acts as an integrator of growth factor signaling. Supek et al., 2002; Watson et al., 2006; Espenshade et al., 1995; Surprisingly, we find that Sec16A is a short-lived protein that is Gimeno et al., 1996; Whittle and Schwartz, 2010; Kung et al., regulated by growth factors in a manner dependent on Egr family 2012). Various post-translational modifications, such as transcription factors. We hypothesize that Sec16A acts as a central phosphorylation (Farhan et al., 2010; Koreishi et al., 2013; node in a coherent feed-forward loop that detects persistent growth Lord et al., 2011; Sharpe et al., 2011), ubiquitylation (Jin et al., factor stimuli to increase ERES number.
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]