100215 (317) Biosci. Biotechnol. Biochem., 74 (9), 100215-1–8, 2010 The ALG-2 Binding Site in Sec31A Influences the Retention Kinetics of Sec31A at the Endoplasmic Reticulum Exit Sites as Revealed by Live-Cell Time-Lapse Imaging y Hideki SHIBATA,1; Tatsutoshi INUZUKA,1 Haruna YOSHIDA,1 Hirofumi SUGIURA,1 Ikuo WADA,2 and Masatoshi MAKI1 1Department of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan 2Department of Cell Science, Institute of Biomedical Sciences, Fukushima Medical University School of Medicine, 1 Hikariga-oka, Fukushima 960-1295, Japan Received March 24, 2010; Accepted June 2, 2010; Online Publication, September 7, 2010 [doi:10.1271/bbb.100215] ALG-2, a member of the penta-EF-hand protein 2 functions as a downstream effecter of the Ca2þ- family, interacts Ca2þ-dependently with a COPII com- signaling pathway under these physiological conditions ponent, Sec31A. In this study, we first established HeLa remain largely unknown. The fifth EF-hand of ALG-2 cells stably expressing green fluorescent protein-fused mediates the formation of the homodimer or the ALG-2 (GFP-ALG-2) and red fluorescent protein-fused heterodimer with peflin,9) whereas the first and the Sec31AAdvance (Sec31A-RFP). After inducing Ca2þ-mobiliza- View third EF-hands have a physiologically crucial role in tion, the cytoplasmic distribution of GFP-ALG-2 Ca2þ-binding, which drives conformational changes in changed from a diffuse to a punctate pattern, which the protein10) and mediates Ca2þ-dependent interaction extensively overlapped with the Sec31A-RFP-positive with multiple proteins, most of which have Pro-rich structures, indicating that ALG-2 is recruited to the regions.11) endoplasmic reticulum exit sites (ERES) in living cells. A number of target proteins for ALG-2 have been Next, overlay experiments with biotin-labeled ALG-2 reported. They can be classified into two groups based were done to dissect the ALG-2 binding site (ABS). They on their binding ability to an alternatively spliced shorter revealed that a sequence comprising amino acid resi- isoform of ALG-2, ALG-2GF122, which lacks Gly121 dues 839–851 in the Pro-rich region was necessary and and Phe122.12) Alix (also named AIP1), annexin A7, sufficient for direct binding to ALG-2. Finally, fluores- annexin A11, TSG101,Proofs scotin, and mucolipin-1 lack the cence recovery after photobleaching analysis indicated ability to bind ALG-2GF122, whereas phospholipid that the ABS deletion reduced the high-affinity popula- scramblase (PLSCR) 3, PLSCR4, and Sec31A interact tion of Sec31A to the ERES, suggesting that the ABS is with both isoforms.12–14) Among these target proteins, one of the key determinants of the retention kinetics of we determined precisely the ALG-2 binding sites (ABS) Sec31A at ERES. in Alix15) and PLSCR3.12) Alix is a cytoplasmic adaptor protein that was the first target protein identified for Key words: ALG-2; Sec31A; endoplasmic reticulum ALG-2.16,17) The characteristic PxY repeats in the (ER) exit sites; time-lapse imaging; fluores- C-terminal Pro-rich region of Alix is a critical element cence recovery after photobleaching in ALG-2-binding.15,18) Deletion of the ABS changes the (FRAP) distribution of the overexpressed C-terminal half region of Alix fused with enhanced green fluorescent protein ALG-2 (apoptosis-linked gene 2), a product of the from a punctate to a diffuse pattern in HeLa cells,15) and PDCD6 gene, is a Ca2þ-binding protein possessing five abolishes the effects of the overexpressed full-length and serially repetitive EF-hand motifs in its C-terminal C-terminal half versions of Alix on neuronal survival.18) region. It belongs to the penta-EF-hand (PEF) protein We identified PLSCR3 as a target for ALG-2 by family, including the large and small subunits of typical searching for proteins that contain a region homologous calpains, sorcin, glancalcin, and peflin.1,2) While ALG-2 to the ABS of Alix.12) Although the homologous site in was originally identified as a proapoptotic gene product PLSCR3, ABS-1, was sufficient for binding to ALG-2, in a cell-death study of mouse T-cell hybridoma,3) ALG- a mutant lacking the ABS-1 showed the ability to 2-deficient mice develop normally, with no abnormal- bind ALG-2 as well as ALG-2GF122. Further deletion ities in the immune system.4) Nonetheless, the potential analyses of PLSCR3 identified another region, ABS-2, involvement of ALG-2 in regulating endoplasmic that contributes to interaction with both ALG-2 and reticulum (ER)-stress-induced apoptosis,5) neuronal cell ALG-2GF122. death during development,6) and cancer7,8) has been In the present study, we focused on another ALG-2- reported, but the molecular mechanisms by which ALG- interactive target, Sec31A, which is a component of the y To whom correspondence should be addressed. Fax: +81-52-789-5542; E-mail: [email protected] Abbreviations: GFP, green fluorescent protein; RFP, red fluorescent protein; ERES, endoplasmic reticulum exit site; ABS, ALG-2 binding site; PEF, penta-EF-hand; PLSCR, phospholipid scramblase; FRAP, fluorescence recovery after photobleaching; WT, wild type; GST, glutathione-S- transferase; ROI, region of interest; bio-, biotin-labeled; GAP, GTPase-activating protein; CBB, Coomassie Brilliant Blue 100215-2 H. SHIBATA et al. COPII coat of ER-to-Golgi transport vesicles. We and gccaataagctgggtgtggatccggacagccccgg-30 and reverse 50-ccggggctgtcc- others have reported that ALG-2 localizes at the ggatccacacccagcttattggc-30. The EcoRI/BamHI fragment excised from Sec31A-positive ER exit sites (ERES) in a Ca2þ- the resulting plasmid was inserted between the EcoRI and BamHI sites of pSGFP2-N-SGG and pTagRFP-T-N-SGG to construct pSec31A- dependent manner, as detected by indirect immuno- SGFP2 and pSec31A-TagRFP-T respectively. To introduce the MluI 19,20) fluorescence. RNAi-mediated knockdown experi- site in the 50-untranslated region of the Sec31A-SGFP2-coding ments have indicated that ALG-2 is required to maintain sequence by PCR, pFP 50 MluI as forward primer and pEGFP-N lower normal Sec31A levels at the ERES.20) Here, we primer, 50-tgaacagctcctcgccct-30, as reverse primer were used, and the confirmed the dynamic recruitment of ALG-2 to the PCR product was inserted into pCR-BluntII-TOPO. The MluI/NotI ERES in HeLa cells stably expressing fluorescent fragment digested from the resulting plasmid, which encodes Sec31A protein-fused ALG-2 and Sec31A by time-lapse fluo- and SGG-linker, was inserted between the MluI and NotI sites of pCX4bsr to construct pCX4bsr/Sec31A-SGG. Then the NotI fragments rescence microscopy. Further, the ALG-2 binding site of digested from pSGFP2-N-SGG and pTagRFP-T-N-SGG, which encode Sec31A was identified, and the effects of deletion of this SGFP2 and TagRFP-T respectively, was inserted into the NotI site of site on the recycling kinetics of Sec31A proteins on and pCX4bsr/Sec31A-SGG to construct pCX4bsr/Sec31A-SGFP2 and off the ERES structures were examined by fluorescence pCX4bsr/Sec31A-TagRFP-T. pCX4bsr/Sec31A839{851-SGFP2 was recovery after photobleaching (FRAP) analysis. constructed by replacing the Sec31A wild-type coding sequence of pCX4bsr/Sec31A-SGFP2 with the deletion mutant-coding sequence of pFLAG-Sec31A839{851 using the EcoRI and the SphI sites. An Materials and Methods Escherichia coli expression plasmid for GST-His, designated pGST- His, encoding two flexible GGS linkers between the GST-coding Cells and antibodies. HeLa cells were purchased from the RIKEN sequence and the multiple cloning site and between the multiple cloning Cell Bank (Tsukuba, Japan), and one of the cell lines isolated by site and the 8xHis-coding sequence, and an expression plasmid for 19) limited dilution cloning, designated HeLa SS4, was used. An GST-Alix801{812-His, designated pGST-Alix801{812-His, were described amphotropic murine leukemia virus-packaging cell line, PLAT-A, was previously.10) pGST-Sec31A837{849-His and pGST-Sec31A839{851-His, kindly provided by Dr. Toshio Kitamura (Institute of Medical Science, for the expression of GST- and His-tagged Sec31A (amino acids University of Tokyo). Mouse anti-FLAG monoclonal antibody (M2) 837–849) and Sec31A (amino acids 839–851) were constructed was purchased from Sigma (St. Louis, Mo). Peroxidase-conjugated by inserting a combination of the following oligonucleotides into the goatAdvance anti-mouse IgG antibody was from Jackson Immuno View Research 837{849 0 BglI site of pGST-His: for pGST-Sec31A -His, forward 5 - Laboratories (West Grove, PA). cggcaccgccaccaggcttcattatgcatggcaacgtgaatccggcctcgg-30 and reverse 50-aggccggattcacgttgccatgcataatgaagcctggtggcggtgccgaac-30; and for Plasmid constructions. An expression plasmid for FLAG-tagged pGST-Sec31A839{851-His, forward 50-cggcaaatccgccaccgccaggcttcatt- Sec31A in mammalian cells, pFLAG-Sec31A, was reconstructed from atgcatggcaacgtggcctcgg-30 and reverse 50-aggccacgttgccatgcataatgaa- an isolated clone encoding a putative alternative splicing isoform by gcctggcggtggcggatttgccgaac-30. two rounds of PCR-based site-directed mutagenesis using a combina- tion of the following primers: for the first round, 50-cttagggaacagaca- ctttcaccaacaatcaccag-30 and 50-ctggtgattgttggtgaaagtgtctgttccctaag-30; Transfection and retroviral infection. HEK293T cells were trans- and for the second round, 50-ctgcgtcccaaagaacaggtcctcagaatggttgg-30 fected by the conventional calcium phosphate precipitation method. and 50-ccaaccattctgaggacctgttctttgggacgcag-30. The resulting plasmid HeLa cell lines expressing fluorescent protein-fused