The Texas Medical Center Library DigitalCommons@TMC
The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences
5-2014
ROLE OF TALIN1 PHOSPHORYLATION IN BETA1 INTEGRIN ACTIVATION AND PROSTATE CANCER METASTASIS
Jung-Kang Jin
Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations
Part of the Cancer Biology Commons, and the Medicine and Health Sciences Commons
Recommended Citation Jin, Jung-Kang, "ROLE OF TALIN1 PHOSPHORYLATION IN BETA1 INTEGRIN ACTIVATION AND PROSTATE CANCER METASTASIS" (2014). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 445. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/445
This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. ROLE OF TALIN1 PHOSPHORYLATION IN β1 INTEGRIN
ACTIVATION AND PROSTATE CANCER METASTASIS
by
Jung-Kang Jin, M.S.
APPROVED:
______Gary E. Gallick, Ph.D., Supervisory Professor
______Sue-Hwa Lin, Ph.D.
______David J. McConkey, Ph.D.
______Bradley W. McIntyre, Ph.D.
______Jeffrey N. Myers, M.D., Ph.D.
APPROVED:
______Dean, The University of Texas Graduate School of Biomedical Sciences at Houston ROLE OF TALIN1 PHOSPHORYLATION IN β1 INTEGRIN
ACTIVATION AND PROSTATE CANCER METASTASIS
A
DISSERTATION
Presented to the Faculty of
The University of Texas
Health Science Center at Houston
and
The University of Texas
MD Anderson Cancer Center
Graduate School of Biomedical Sciences
in Partial Fulfillment
of the Requirements
for the Degree of
DOCTOR OF PHILOSOPHY
by
Jung-Kang Jin, M.S.
Houston, Texas
May 2014 Dedication
This dissertation is dedicated to my loving wife Huiling, my parents, my son Christopher
and my daughter Jasmina.
iii
Acknowledgements
I express my sincere appreciation to Dr. Gary E. Gallick, for his guidance, mentorship and support.
I wish to thank my committee members, Dr. Sue-Hwa Lin, Dr. David J. McConkey, Dr.
Bradley W. McIntyre and Dr. Jeffrey N. Myers for their time, supervision, and contributions.
I wish to thank members of Dr. Gallick's laboratory, past and present, including Dr. Scott
Kopetz, Nila U. Parikh, Dr. Farshid Dayyani, Dr. Jian Song, Dr. Lynnelle W Thorpe,
Sanchaika Gaur, Tanushree Chatterji and Linda Guerin. Special thanks to Pei-Chieh
(Patrick) Tien for his efforts and assistance in this work.
I wish to thank members of Dr. Sue-Hwa Lin's laboratory.
I wish to thank Dr. Chien-Jui Cheng at Department of Pathology, College of Medicine, Taipei Medical University, Taipei, Taiwan.
I wish to thank Dr. Cai Huang at Department of Molecular and Biomedical
Pharmacology, University of Kentucky, Lexington, Kentucky.
iv
ROLE OF TALIN1 PHOSPHORYLATION IN β1 INTEGRIN
ACTIVATION AND PROSTATE CANCER METASTASIS
Jung-Kang Jin, M.S.
Supervisory Professor: Gary E. Gallick, Ph.D.
Talins are adaptor proteins that regulate focal adhesion signaling by conjugating integrins to the cytoskeleton. Talins directly bind and activate integrins but the mechanism by which this occurs is unknown. As integrin activation and overexpression of talins promote prostate cancer metastasis, understanding the mechanism by which talins activate integrins will better elucidate their roles in Prostate cancer metastasis.
Phosphorylation of talins on serine 425 has been associated with β1 integrin functions.
Work in this dissertation tested the hypothesis that increased talin1 S425 phosphorylation was required for β1 integrin activation and promotion of prostate cancer metastasis.
I first used shRNA to knockdown talins and demonstrated that talin1, but not talin2, is required for β1 integrin activation. Furthermore, talin1 S425 phosphorylation, but not total talin1 expression, correlated with metastatic potential of cultured prostate cancer cells. To directly test whether talin1 phosphorylation activates β1 integrins, I generated talin1 S425 mutants. Expressing a non-phosphorylatable mutant, talin1 S425A in talin1-silenced PC3-MM2 and C4-2B4 prostate cancer cells decreased β1 integrin activation, adhesion, motility, and increased the sensitivity of cells to anoikis. In contrast, re-expression of the phosphorylation-mimicking mutant, talin1 S425D led to increased β1 integrin activation and generated biologic effects opposite to talin1 S425A expression.
v
Mechanistically, I demonstrated that increased Cdk5 kinase activity correlates with
expression of its activator p35, and is responsible for talin1 phosphorylation and β1
integrin activation.
Next, I demonstrated that talin1 phosphorylation is required for Prostate cancer
bone metastasis in vivo . In the metastatic PC3-MM2 cells, expression of a non- phosphorylatable mutant, talin1 S425A , in talin1-silenced PC3-MM2 cells, abolished their ability to colonize in bone following intracardiac injection, while re-expression of phosphorylation-mimicking mutant, talin1 S425D restored their ability to metastasize to bone. I further demonstrated by immunohistochemical staining that talin phosphorylation is significantly increased in human bone metastases when compared to normal tissues, primary tumors, or lymph node metastases, demonstrating the clinical relevance of talin
S425 phosphorylation.
In summary, I have identified a novel signaling pathway whereby overexpression of p35 leads to increased Cdk5 activity, resulting in talin phosphorylation and β1 integrin activation. This signaling axis is responsible for increased metastatic potential of prostate cancer cells. Therefore, talin1, Cdk5 and p35 may be new targets for development of therapies for prostate cancer bone metastasis.
vi
Table of Contents
Approval Sheet ...... i
Title Page ...... ii
Dedication ...... iii
Acknowledgements ...... iv
Abstract ...... v
Table of Contents ...... vii
List of Figures ...... viii
List of Tables ...... xii
Abbreviations ...... xiii
Chapter 1: Introduction ...... 1
Chapter 2: Materials and Methods ...... 36
Chapter 3: Constitutive activation of β1 integrins in metastatic prostate cancer cells ...... 49
Chapter 4: Talin1 phosphorylation regulates β1 integrin activation...... 64
Chapter 5: Effects of talin1 phosphorylation in prostate cancer cells ...... 80
Chapter 6: Cdk5 regulates talin1 S425 phosphorylation ...... 92
Chapter 7: Talin1 phosphorylation promotes prostate cancer bone metastasis in vivo ...102
Chapter 8: Talin1 phosphorylation in human prostate cancer ...... 111
Chapter 9: Discussion ...... 115
Appendix ...... 138
Bibliography ...... 147
Vita ...... 176
vii
List of Figures
Figure 1 Integrin domain structures 15
Figure 2 “Outside-in” and “inside-out” integrin signaling 17
Figure 3 Integrin subunits and their ligands 19
Figure 4 Inhibition of PC3-MM2 cells metastasis in vivo by anti-β1 integrin 23
antibody mAb 33B6.
Figure 5 Domain structure of talin 25
Figure 6 Talin-mediated integrin activation 27
Figure 7 Talin-mediated integrin activation and subsequent focal adhesion 29
formation
Figure 8 FACS analysis of total β1 integrins in prostate cancer cell lines 51
Figure 9 Immunoblotting of cell lysates for the expression of FAK and 52
phosphorylated FAK Y397
Figure 10 FACS analysis of activated β1 integrins in prostate cancer cell lines 54
Figure 11 Immunofluorescence staining of activated and total β1 integrins 55
Figure 12 Viable and dead cell number of prostate cancer cells in anoikis conditions 57
Figure 13 FACS analysis of propidium iodide-labeled apoptotic cells 58
Figure 14 Immunoblotting of PARP and cleaved PARP 59
Figure 15 Immunoblotting of β1 integrins, pFAK Y397, total FAK, pAkt 61
S473, and total Akt in β1 integrin knockdown cells
Figure 16 Viable cell number of β1 knockdown PC3-MM2 cells in anoikis 62
conditions
Figure 17 Immunoblotting of PARP and cleaved PARP in β1 integrin 63
viii
knockdown cells in anoikis conditions
Figure 18 Immunoblotting of talin1, talin2 and pan-talin in talin1-silenced cells 66
Figure 19 Effects of talin1 and talin2 silencing on cell spreading 67
Figure 20 Immunoblotting of talin2 and talin1 in talin2-silenced cells 68
Figure 21 Flow cytometric analysis of total β1 integrins and activated β1 69
integrins in talin1-silenced PC3-MM2 cells
Figure 22 Flow cytometric analysis of total β1 integrins and activated β1 70
integrins in talin2-silenced PC3-MM2 cells
Figure 23 Talin1 expression and talin S425 phosphorylation in prostate cancer cells 72
Figure 24 Phosphorylation of talin1 on S425 in prostate cancer cells 73
Figure 25 Expression of talin1 mutants in prostate cancer cells 75
Figure 26 Flow cytometric analysis of activated and total β1 integrins of 76
PC3-MM2 talin1 mutants
Figure 27 Flow cytometric analysis of activated and total β1 integrins of 77
C4-2B4 talin1 mutants
Figure 28 Immunofluorescence staining of GFP and activated β1 integrins 78
Figure 29 Effect of talin1 phosphorylation on activation of downstream 79
β1 integrin signaling
Figure 30 Effects of talin1 S425 phosphorylation on cell proliferation 82
Figure 31 Cell viability of PC3-MM2 cells expressing talin1 mutants in anoikis 83
conditions
Figure 32 Flow cytometric analysis of propidium iodide-labeled cells in sub-G0/G1 84
Figure 33 Immunoblotting of total and cleaved PARP of talin1 mutants in 85
ix
anoikis conditions
Figure 34 Talin1 S425 phosphorylation promotes cell adhesion in PC3-MM2 88
cells
Figure 35 Talin1 S425 phosphorylation promotes cell adhesion in C4-2B4 cells 89
Figure 36 Effect of talin1 S425 phosphorylation on cell migration 90
Figure 37 Effect of talin1 S425 phosphorylation on cell invasion 91
Figure 38 Expressions of Cdk5 and p35 in prostate cancer cells 94
Figure 39 Cdk5 kinase activity in prostate cancer cells 95
Figure 40 Talin1 phosphorylation was inhibited by roscovitine 96
Figure 41 Immunoblotting of Cdk5, ptalin S425 and total talin1 in Cdk5 98
knockdown cells
Figure 42 Immunoblotting of ptalin S425, talin1 and Myc-tag in cells expressing 99
dominant-negative Cdk5
Figure 43 Flow cytometric analysis of Cdk5 knockdown cells 100
Figure 44 Talin1 phosphorylation was mediated in Cdk5-induced β1 integrin 101
activation
Figure 45 Talin1 S425 phosphorylation promotes bone colonization in vivo 104
Figure 46 Bioluminescence imaging of luciferase-labeled talin1 mutants in mice 105
after intracardiac injection.
Figure 47 Tumor burden in the femur/tibia of mice following intracardiac 106
injection
Figure 48 Representative primary tumors when mice were sacrificed and 108
examined for lymph node metastases
x
Figure 49 Representative bioluminescence imaging of lymph node metastases 109
Figure 50 Validation of specificity of ptalin S425 antibody 113
Figure 51 Talin S425 phosphorylation in stages of human prostate cancer 114
Figure 52 Model of β1 integrin activation by talin1 S425 phosphorylation in 137
metastatic prostate cancer cells
xi
List of Table
Table 1 Effects of talin1 S425 phosphorylation on development of lymph node 110
metastases of talin1-expressing PC3-MM2 cells injected intraprostatically
xii
Abbreviations
AR Androgen receptor
CAM Cell adhesion molecule
Cdk5 Cyclin-dependent kinase 5
CGH Comparative genomic hybridization
CRPC Castration-resistant prostate cancer
CTC Circulating tumor cells
EMT Epithelial to mesenchymal transition
FACS Fluorescence-activated cell sorting
FAK Focal adhesion kinase
HBME Human bone marrow endothelial
IGF Insulin-like growth factor
ILK Integrin-linked-kinase
MAPK Mitogen-activated protein kinases
MET Mesenchymal to epithelial transition
PAK p21 activated kinase
PI3K Phosphoinositide 3-kinase
PIN Prostate intraepithelial neoplasia
PIP2 Phosphatidylinositol-4,5-bisphosphate
PIP3 Phosphatidylinositol-3,4,5-trisphosphate
PIPK1 γ Phosphatidylinositol 4-phosphate 5-kinase γ
PSA Prostate-specific antigen
xiii
PTB Phosphotyrosine-binding
SNPs Single-nucleotide polymorphisms
xiv
Chapter 1 Introduction
- 1 -
Prostate cancer is the second most common type of cancer in men in the United
States. The American Cancer Society estimates that approximately 233,000 men will be diagnosed of prostate cancer with an estimated 29,500 deaths in 2014 [1]. Many risk factors are associated with prostate cancer, including increasing age, family history and race [1-4]. For example, the incidence of rates of prostate cancer are especially higher
(~60%) in African Americans than in non-Hispanic whites [1, 5]. Other factors such as high fat diet and obesity may also increase the risk of developing prostate cancer [6].
However, the molecular mechanisms by which these risk factors contribute to prostate cancer are still not clear, and thus effective strategies to prevent the occurrence of prostate cancer are also lacking.
Unfortunately, men with early prostate cancer usually have no symptoms. Only when the disease advances, patients may have symptoms such as interrupted urine flow, inability to urinate or pain with urination. Therefore, detection of prostate cancer before these symptoms develop is critical to prevent cancer progression. Currently, the method commonly used to detect early prostate cancer is the prostate-specific antigen (PSA) blood test. PSA is secreted by cells in the prostate glands and can measured by ELISA from blood samples. An increased level of PSA concentration higher than 4 ng/ml indicates a higher chance of having prostate cancer [7, 8]. However, PSA levels can also be increased by other factors, such as medicines, and increasing age. On the contrary, a
PSA level below 4 ng/ml does not absolutely indicate that men do not have prostate cancer [1, 8]. In addition, results of clinical trials of using the PSA test to screen men, thereby reducing prostate cancer are inconsistent. While two European trials of PSA
- 2 - screening have been reported to reduce mortality about 20~30% [9, 10], one US study has found no reduction in mortality [8, 11]. Based on these results, there are insufficient data to recommend for or against PSA screening for detecting early prostate cancer.
Although the use of PSA test for screening early prostate cancer is still controversial [8], the American Cancer Society recommends that men at age 50 should discuss with their health care provider the benefits and limitations of PSA testing [1]. Men at high risk of developing prostate cancer, for example African Americans, should consult their health care provider beginning at age 45 or even earlier [1].
Patients with early stage prostate cancer usually have only local tumors and can be cured by surgery, external beam radiation or radioactive seed implants. The five-year survival rate for localized prostate cancer is close to 100% [1]. However, when metastasis has developed, the five-year survival rate decreases to 28% [1]. Prostate cancer can metastasize to multiple distant organs such as the lungs, liver and brain, but it has a high propensity for metastasizing to the bone. Bubendorf et. al. reported that 80% of the men who had died from prostate cancer had bone metastases [12]. Most current treatments for patients with bone metastases have little effect on improving long-term survival [13, 14].
Therefore, gaining a better understanding of cancer progression to bone metastasis and the mechanisms by which prostate cancer cells metastasize to the bone are critical to develop reagents and therapies for prostate cancer metastasis.
- 3 -
Genetic alterations in prostate cancer
Prostate cancer metastasis occurs as results of accumulation of genetic and
epigenetic alterations in tumor cells. In regard to genetic alterations in prostate cancer,
extensive genomic analyses have identified many copy number alterations and
chromosomal rearrangements. Several somatic alterations including, gain of chromosome
8q and losses at chromosomes 3p, 8p, 10q, 13q, and 17p have been identified by
comparative genomic hybridization (CGH) [15, 16]. Many key regulatory genes are
located within these region, including NKX3.1 at 8p21, MYC at 8q24 and PTEN at 10q23, and their roles in prostate cancer will be discussed below.
NKX3.1 down-regulation
Recent analyses have demonstrated that expression of NKX3.1 , a tumor
suppressor gene, is downregulated in nearly all prostate cancers and metastases [17].
NKX3.1 has been shown to be a critical regulator of prostate epithelial differentiation.
Deletion of a single NKX3.1 allele ( NKX3.1 +/-) or complete knockout ( NKX3.1 -/-) in
prostate epithelial results in hyperplasia and dysplasia in mice at 1 year of age [18]. In
older mice with NKX3.1 knockout (between 1 and 2 years of age), the prostate glands display more severe histopathological alterations resembling human prostate intraepithelial neoplasia (PIN) [19, 20]. Nkx3.1 null mutant mice recapitulate early stages of prostate carcinogenesis [20]. Therefore, these findings are consistent with the tumor suppressor activity of NKX3.1 , suggesting that NKX3.1 represents as a gatekeeper gene for prostate cancer initiation [17, 21].
- 4 -
MYC up-regulation
The 8q24 chromosomal region containing the MYC oncogene is often amplified in advanced prostate tumors suggesting that MYC plays a role in late stage prostate cancer
[22]. However, studies of prostate cancer have also showed increased MYC mRNA in low grade (e.g. Gleason score 6) tissues. Overexpression of MYC has been observed in luminal cells of PIN in the absent of gene amplification [23]. Therefore, these studies suggest a role for MYC overexpression in cancer initiation. Furthermore, the effect of
MYC overexpression has also been examined using MYC transgenic mice.
Overexpression of MYC in the mouse prostate induces formation of PIN followed by progression to invasive prostate adenocarcinoma [24]. Together, these results indicate that up-regulation of MYC is a critical oncogenic event associated with prostate cancer progression.
Loss of PTEN
PTEN was identified as a tumor suppressor gene, and is frequently mutated or deleted in many cancers, including prostate cancer [25-27]. The chromosomal region on
10q23 where PTEN is located frequently undergoes allelic loss in prostate cancer, which results in loss of PTEN expression in prostate tumors [28]. Recent studies have found that loss of PTEN expression is primarily due to bi-allelic deletion in local prostate cancer
[29]. PTEN loss has been observed in 20-30% of locally progressive prostate cancers specimens [29, 30]. To investigate the role of PTEN loss on prostate cancer development, genetically engineered mouse models have been generated. Prostate-specific deletion of
PTEN in these mice causes PIN, followed by progression to invasive adenocarcinoma
- 5 -
[31]. Loss of PTEN in heterozygous mutants or conditional PTEN deletion in the prostate epithelium also recapitulates many of the events associated with prostate cancer in humans [32]. Knockout of PTEN in prostate of mice also promotes progression to castration-resistance [33, 34]. These data indicate that PTEN loss in mice is sufficient to initiate prostate cancer and demonstrate the importance of PTEN during prostate cancer progression.
Progression of prostate cancer to castrate-resistance
During the progression of prostate cancer, tumors usually become resistant to treatments that reduce male hormones, i.e. androgens. The development and progression of prostate cancer are dependent on the androgens which mediate transcription through androgen receptor (AR). In prostate tumor cells, binding of androgen to AR forms a complex that translocates to the nucleus. This complex binds to AR-responsive elements and controls transcription of androgen-regulated genes [35]. Activation of androgen- regulated genes further stimulates cell proliferation and inhibits apoptosis of tumor cells
[35, 36]. This dependence of early stage prostate cancer on androgen stimulation serves as the basis for androgen-deprivation therapy [37]. Presently, androgen-deprivation therapy has been widely used by chemical astration to decrease tumor growth [38].
However, patients who have received androgen-deprivation therapy will ultimately progress after an average of 12 to 18 months, as their tumor adapts to the androgen- deprived environment and develops “castrate-resistant” disease [39].
- 6 -
The mechanism of developing castrate-resistant prostate cancer is not fully understood. In castrate-resistant prostate cancer (CRPC) cells, the AR can be activated, and androgen-responsive genes such as PSA [40] continue to be expressed. Several mechanisms have been proposed for the development of CRPC. First, prostate cancer cells can upregulate AR expression and become hypersensitive to androgen stimulation
[41], which may occur through selective outgrowth of castration-resistant cells during castration [42]. Second, the AR may be activated by other steroids such as estrogens or be activated in a ligand-independent pathway by receptor tyrosine kinases and growth factors [43-45]. For example, overexpression of HER-2/neu has been shown to activate
AR in CRPC cells [46]. Insulin-like growth factor (IGF) also can bind and activate AR during castration [42]. Furthermore, Src kinase is critical for bombesin-induced AR- mediated activity and is required for translocation and transactivation of AR [45]. In another mechanism, the production of androgen is upregulated through intratumoral synthesis by intracrine and paracrine pathways, which also contributes to castrate- resistant in CRPC cells [43]. Clearly, multiple mechanisms have been shown to contribute androgen-independence in CRPA. Currently, new AR antagonists such as
MDV3100 [47] and abiraterone [48] have shown promise results in clinical trials.
However, most patients treated with these AR antagonists ultimately develop resistance to these agents. More studies for the treatment of CRPC either using AR antagonists alone or in combination with other agents are urgently warranted.
- 7 -
Prostate cancer metastasis and microenvironment
Men with CRPC usually develop metastasis in distant organs and progress to metastatic CRPC. The process of cancer metastasis is very inefficient but highly selective and dependent on the interaction between tumor cells and the target organs. The classic model of metastasis of solid tumors, the “seed and soil hypothesis”, was first proposed by
Stephen Paget in 1889 [49]. In Paget’s model, the tumor cells (i.e. seeds) only metastasize to specific organs (i.e. soil) that are fertile for the tumor growth. This concept, while remaining a guiding principle for metastasis does not entirely explain the molecular bases for organ specific metastases. With the accumulation of knowledge from cancer metastasis studies, metastases of solid tumors including prostate cancer is now known to involve multiple steps. Metastatic cancer cells undergo a series of processes including angiogenesis, local migration, invasion, intravasation, circulation, extravasation and colonization in the distant organs. Thus, cancer cells must alter signaling to gain cell properties that are critical to ensure successful metastasis.
Moreover, metastasis is not solely dependent on alteration of cancer cell properties, but also requires bidirectional communication between cells and their surrounding environment. The tumor microenvironment is comprised of stromal cells including fibroblasts, endothelial cells, and immune cells, which are recruited to the tumor. A variety of growth factors, cytokines, chemokines and extracellular matrix (ECM) proteins secreted by stromal cells can promote growth of tumor cells and increase their metastatic potential [50, 51]. In contrast, tumor cells also interact with stromal cells to change their properties in favor of tumor growth. Therefore, interaction between tumor
- 8 - cells and the stromal compartment is critical to promote cancer progression and metastasis [52]. Most of these intercellular interactions are dependent on cell adhesion molecules (CAMs) and receptors on the cell surface including cadherin and integrins.
Various mechanisms of alteration in these molecules have been shown to promote metastasis, including reducing cell-matrix adhesion, increasing migratory ability, surviving in circulation, and colonization in the distant organs [53], which will be discussed below.
Epithelial plasticity
In the normal prostate gland, basal cells in the lumen attach to the basement membrane, forming a cell layer underneath normal epithelial cells. Adhesions of epithelial cells to each other and to ECM restrict the migratory capability of epithelial cells [54]. In the initial stage of metastasis, tumor cells have to detach from substratum and migrate from the primary tumor into the surrounding blood or lymphatic vessels. The adhesions of cell-cell and cell-matrix are mediated by forming of intercellular junctions that are composed of protein complexes with CAMs. Therefore, tumor cells must decrease the adhesiveness by altering the expression of different CAMs. For example, expression of most integrins and E-cadherin are decreased in primary prostate tumors [55,
56]. This process is a major feature of epithelial to mesenchymal transition (EMT), which allows cells to acquire a more mesenchymal phenotype, increasing their abilities to migrate and invade the ECM [57]. However, in the distant sites, cancer cells reverse this process for mesenchymal to epithelial transition (MET) to thereby regaining an epithelial phenotype allowing adherence to ECM and growth at the metastatic site. This ability of
- 9 - cancer cells to switch between different phenotypes through EMT and MET is a feature of “epithelial plasticity” [58, 59].
Survival in circulation
The metastatic process is not efficient because most disseminated cancer cells are rapidly destroyed in the circulation. Studies have demonstrated that cancer cells are frequently released from the tumor into the circulation [60]; but only less than 0.1% of these disseminated cancer cells can survive and metastasize [61]. Thus, survival of prostate cancer cells in the circulation is one of the rate-limiting steps in cancer metastasis [62]. Normally, epithelial cells require attachment to the ECM through integrin signaling for survival and growth. Disruption of cell-ECM interaction results in loss of attachment, which impairs integrin-mediated survival signaling and induces apoptosis, a process termed anoikis [63]. Thus, anoikis prevents disseminated normal epithelial cells from colonizing at inappropriate locations. For prostate cancer cells to metastasize in the bone, dislodged cells have to survive in the circulation before colonizing the bone [64]. Therefore, metastatic tumor cells must acquire the ability to survive in the circulation. Constitutive integrin signaling is one of the mechanisms by which prostate cancer cells develop anoikis resistance. In metastatic prostate cancer cells, integrin signaling is often increased leading to activation of downstream FAK/Src and
Akt pathways, promoting cell survival in circulation [65, 66].
- 10 -
Development of bone metastasis
Currently, studies of prostate cancer bone metastasis have focused on the bidirectional interactions of bone microenvironment and prostate cancer cells. In the bone microenvironment, surviving prostate cancer cells have to attach to capillary endothelial cells or sub-endothelial basement membranes and then extravasate and grow in the bone to complete the process of metastasis. These later steps in prostate cancer metastasis are the most poorly understood, but are specific to the bone compartment. For example, prostate cancer cells have a higher affinity to bind human bone marrow endothelial
(HBME) cells than they bind to other endothelial cells [67]. Thus, bone metastasis likely requires interaction of prostate cancer cells with bone microenvironment for metastasis to develop.
The bone matrix is composed of 95% of type I collagen and 5% of remaining non-collagen proteins and proteoglycans [68]. Type I collagen, as well as non-collagen matrix proteins such as osteopontin, bone sialoprotein and osteonectin, serve as ECM molecules that abet attachment of prostate cancer cells in the bone [69, 70]. Many of these bone matrix proteins are ligands of integrins, and have been implicated in facilitating colonization of prostate cancer cells in the bone [71]. The cells in the bone marrow include osteoblasts (for bone formation), osteoclasts (for bone resorption), hematopoietic cells, adipocytes and immune cells. Osteoblasts are derived from mesenchymal stem cells in the bone marrow stroma and differentiate to osteocytes when embedded in the bone [72]. The newly formed bone matrix will be hardened by mineralization with deposition of hydroxyapatite crystals to increase resistance to
- 11 - compression [68]. Differentiated osteoblasts secrete many growth factors, and some of those are embedded in the bone matrix. During bone resorption, osteoclasts secrete acids and proteases to resorb bone and also release these growth factors from bone matrix, which stimulate prostate cancer cells growth in bone [52, 73, 74]. In contrast, secreted factors from prostate cancer cells also stimulate proliferation and maturation of osteoblasts and osteoclasts that, in turn, produce or release even more growth factors and further stimulate metastatic growth of tumor in the bone. This interaction between prostate cancer cells and osteoblasts/osteoclasts and other cells in the bone microenvironment is commonly termed the “vicious cycle” in which tumor growth affects bone remodeling and bone remodeling contributes to tumor growth [52, 74, 75].
Therefore, the bidirectional interactions between bone cells and prostate cancer cells highlight the importance of the bone microenvironment in promoting bone metastasis.
Despite the complexity of the bone microenvironment and the experimental difficulty in understanding mechanisms by which prostate cancer cells home to bone, many adhesion molecules have been shown to promote prostate cancer bone metastasis. Among them, cadherin-11 is involved in the metastasis of prostate cancer cells to bone [76, 77].
Treatment of anti-cadherin-11 antibody mAb 2C7 effectively prevented metastasis of
PC3-MM2 cells to bone in vivo [78]. Integrin α2β1 has been shown to increase migration and adhesion of cancer cells on collagen, and to promote prostate tumor growth in bone
[79, 80].
- 12 -
Therapy resistance
Resistance to therapies is a recurrent problem in prostate cancer bone metastasis.
However, the molecular understanding of the mechanisms of resistance is still limited.
When disseminated tumor cells colonize distant organs, a small population of tumor cells
may enter a quiescent phase and become dormant for years [62, 81, 82]. Unfortunately,
most therapies target actively proliferating cells, and thus these quiescent tumor cells are
likely to be resistant to the therapies and persist [83]. Eventually, these cells will escape
from dormancy and grow leading to metastasis. Although the mechanism of breaking
dormancy is unknown, the interaction of microenvironment and tumor cells may be
responsible for dormancy and recurrence. Studies have shown that β1 integrin activation
is a key regulator to switch dormancy to proliferation and tumor recurrence when
supplementation of ECM proteins activates integrin signaling [84]. In breast cancer cells
resistant to multiple antitumor drugs, β1 integrin expression was decreased, which correlates drug resistance [85]. These findings suggest that reduced expression of β1 integrins may be important in cancer cell dormancy and resistance to drug treatment.
However, in proliferating cells, β1 integrin signaling is increased, leading to activation of the PI3K/Akt survival pathway. This signaling leads to resistance to cytotoxic chemotherapies in breast cancer cells [86]. In addition, β1 integrin expression was also increased upon exposure to ionizing radiation [87]. Therefore, these studies suggest that
β1 integrins play an important role in therapy resistance through multiple mechanisms.
- 13 -
Integrins: structure, activation and signaling
While numerous alterations in tumor cells are associated with integrins, aberrant
integrin expression or activation has been shown to be involved in nearly every step of
cancer metastasis. Thus, I focus on studying the role of integrins in prostate cancer
metastasis in this dissertation.
Structure of integrins
Integrins belong to a family of adhesion molecules consisting of 18 α and 8 β subunits that comprise 24 glycoprotein heterodimers [88, 89]. Integrins bind specific ligands in the ECM and promote diverse processes such as adhesion, migration, survival and proliferation [88, 89]. Although the precise structure for each integrin heterodimer has not been resolved, a study of the X-ray crystal structure of integrin αvβ3 provides a
model for integrin structure (Figure 1) [90]. Based on this model, the α and β subunits of integrins form an extracellular “headpiece” that is connected by a short transmembrane domain to a cytoplasmic tail. The headpiece of the integrin heterodimer is composed of a
βA-domain in the β subunit and a β-propeller domain in the α subunit [91]. The βA- domain is linked to the hybrid domain that acts as a lever, and the angle between the two domains controls ligand binding affinity. Therefore, the affinity of integrins to ligands is tightly regulated by the conformational changes of individual integrin heterodimers [92].
Integrins exist in three principal conformations with different affinities for ligands: an inactivated, “bent” conformation (low affinity), a partially activated, “extended” conformation with a closed headpiece (high affinity), and a “fully” activated conformation with an open headpiece (ligand occupied) [90].
- 14 -
Figure 1. Integrin domain structures. Integrins are heterodimers consisting of an α and a β subunit. The inactive integrins are in a bent conformation (see the figure; left), and can be unfolded once activated (see the figure; right). The N-terminal domains of α and β subunit interact and form a headpiece that provides a ligand binding site. The C-terminal domains of each subunit form two legs with transmembrane domains and cytoplasmic tails.
From Shattil SJ, Kim C, Ginsberg MH (2010) The final steps of integrin activation: the end game. Nat Rev Mol Cell Biol 11: 288-300. Reproduced with permission.
- 15 -
Activation of integrins Integrins can be activated by binding ligands or interacting with intracellular
proteins. Activation of integrins is regulated by bidirectional cellular signaling illustrated
in Figure 2 [91]. Traditionally, binding of ECM ligands induces a conformational change
leading to activation of integrins. Such activation is generally termed “outside-in”
activation, which results in conformational changes leading to opening the hinge between
the βA- and hybrid domains in the integrin headpiece as described above [93, 94]. In addition to ligands, other factors can also affect outside-in integrin activation. For example, Mg 2+ and Mn 2+ can activate and stabilize a high affinity conformation of
integrins, while Ca 2+ has an inhibitory effect and stabilizes a low affinity conformation
[95]. Although inactive integrins can be activated by ligand binding, the affinity of
inactive integrins to ligands is much lower than that of activated integrins. Hence,
another mechanism to activate integrins and increase binding affinity is through binding
intracellular proteins.
Cellular signaling can promote intracellular proteins, such as talins, to bind
integrins, which induces conformational changes in integrins leading to their activation.
This direction of integrin activation, through intracellular signaling, is usually termed
“inside-out” activation. Generally, the two directions of integrin activation stimulate
signaling pathways that have different biological consequences in cells. Inside-out
signaling is responsible for cell adhesion and controls interactions with ECM proteins,
and therefore regulates cell migration and ECM assembly. Outside-in signaling through
ECM ligand binding leads to transition of intracellular signaling, which controls cell
polarity, survival, proliferation, cytoskeletal structure and gene expression [91].
- 16 -
Figure 2. “Outside-in” and “inside-out” integrin signaling. There are two directions of integrin signaling. In “outside-in” signaling, integrins work as traditional receptors in binding ligands and transmitting signals into the cells (left figure), while in “inside-out” signaling, intracellular proteins, such as talin, bind to the integrin tail and induce a conformational change leading to activation of integrins (right figure). Molecules involved in these procedures are shown in the figure.
From Shattil SJ, Kim C, Ginsberg MH (2010) The final steps of integrin activation: the end game. Nat Rev Mol Cell Biol 11: 288-300. Reproduced with permission.
- 17 -
However, the two mechanisms of integrin activation are not mutually exclusive, nor
independently regulated. For example, inside-out activation of integrin can increase
integrin affinity for ligands. This process in turn promotes ligand binding of integrins
resulting in outside-in activation. Following activation, integrins bind variety of ligands
including collagens, laminins, or RGD-containing proteins (such as fibronectin) [96].
Certain integrin α subunits only pair with specific β subunits to form heterodimers and thus create specificity as to which ligands bind which integrins (Figure 3). For the 24 different heterodimers, 12 of them contain β1 subunits and only these pairing with α1, α2,
α10 and α11 can bind to collagens, the major component of bone (Figure 3). Thus, β1
integrins are likely to play an important role in prostate cancer bone metastasis.
Integrin signaling
Integrins have no intrinsic enzymatic activity; thus, their transmission of signaling
relies on integrin-associated effectors. Activation of integrins leads to recruitment of
focal adhesion kinase (FAK) to their cytoplasmic tails. When integrins cluster, the
integrin tails will be brought together, which leads to FAK interaction and auto-
phosphorylation of FAK on Y397. Subsequently, Src family kinase and PI3K bind to
pFAK Y397 and together induce phosphorylation of other focal adhesion components
including paxillin and p130 CAS to initiate signaling [97]. Activation of FAK/Src
through phosphorylation is known to activate additional signal pathways including
mitogen-activated protein kinases (MAPKs) and PI3K/Akt [98]. Integrin activation
induces phosphorylation of p21 activated kinase (PAK) that activates MAPK pathway
- 18 -
Figure 3. Integrin subunits and their ligands. Ligands for leukocyte integrins include E-cadherin, fibrinogen, factor X, intercellular adhesion molecule, inactive complement factor 3b, vascular cell adhesion molecule, and von Willebrand Factor. RGD-containing ligands include bone sialoprotein, fibronectin, latency-associated-peptide of transforming growth factor β1/3, nephronectin, osteopontin, thrombospondin, and vitronectin.
From Margadant C, Monsuur HN, Norman JC, Sonnenberg A (2011) Mechanisms of integrin activation and trafficking. Curr Opin Cell Biol 23: 607-614. Reproduced with permission.
- 19 -
through activating Raf. Another major result of integrin activation is stimulation of the
PI3K/Akt signaling pathway. PI3K catalyzes PIP2 to PIP3 that recruits and activates
other proteins, including the Akt kinase. While PTEN is frequently lost in prostate cancer
leading to activation of the PI3K pathway, integrin-mediated activation of PI3K/Akt has
also been shown to promote cancer cell migration and survival [99]. Studies showed that
osteopontin, an ECM protein in bone, increases cell migration and adhesion through
PI3K/Akt pathway in PC3 cells [100]. β1 integrins also increase the expression of survivin through the Akt pathway, which protects prostate cancer cells from apoptosis induced by the TNF-α [101]. In addition, integrins α5β1 and αvβ3 (but not αvβ1), protect cells from apoptosis by increasing Bcl-2 expression via FAK and PI3K pathways [102,
103].
β1 integrins in prostate cancer
In normal prostate glands, the basal cells express integrins that bind beneath the basement membrane. However, during the progression of prostate cancer, these basal cells are usually lost, and integrin expression is altered. Most α and β subunit expression is downregulated, whereas only α2, αIIb, α6, β1, β3 and β6 are upregulated [55]. Among these upregulated integrins, only α2, α6, β3 and β6 subunits have been shown to be overexpressed in metastases [55], but their roles in metastasis are unknown. In prostate cancer cells, β1 integrins contain five different alternatively spliced variants, β1A, β1B,
β1C, β1C-2, and β1D [104]. Among the five known β1 integrin cytoplasmic variants,
β1A integrins are ubiquitously expressed, whereas β1C levels are reduced in neoplastic
prostate epithelium [105]. In addition, prostate cancer cell lines, including PC3, LNCaP
- 20 - and DU145, mainly express β1A integrins that increase cell proliferation, whereas the
β1C variant (not expressed in prostate cancer cells) acted as an inhibitor of proliferation
[106].
Expression of β1 integrins has been shown to increase migration and invasion.
Several β1 integrins are associated with increased metastasis in prostate cancer, including
α5β1and α2β1 [79, 107, 108]. Trerotola et. al. showed that α5β1 integrins increase migration of prostate cancer cells by associating with talin and relocalizing from focal adhesions to the leading edges of cells [108]. In addition to migration, β1 integrins also form a complex with IGF-IR to promote proliferation of prostate cancer cells in 3D cultures [109]. Studies demonstrated that α5β1 integrins on prostate cancer cells interact with bone stroma, suggesting that they may play a critical role in tumor growth in the bone. Blocking α5β1 integrins by monoclonal antibodies inhibits adhesion of DU-145 prostate cancer cells to bone marrow stromal cells [107, 110]. Another β1 integrin family protein, α2β1, has been shown to increase migration and adhesion of cancer cells on collagen, and promotes prostate tumor growth in the bone [79, 80]. Similar to α5β1, α2β1 was found to mediate adhesion of malignant tumor-derived prostate epithelial cells to human bone marrow stroma, which can also be inhibited by antibodies targeting α2β1
[111].
Little is known about the role of β1 integrin activation in promoting prostate cancer metastasis. Very recently, Dr. Sue-Hwa Lin and collaborators have demonstrated that β1 integrins are constitutively activated in prostate cancer cell lines with high
- 21 -
metastatic potential, but not in cancer cell lines with low metastatic potential [112]. Dr.
Lin and collaborators also showed that blocking β1 integrins using a specific anti-β1
integrin antibody (33B6) inhibits adhesion, migration, survival and integrin signaling in
prostate cancer cells [112]. Furthermore, treatment of mAb 33B6 by intraprostatic
injection suppressed metastasis of PC3-MM2 from the prostate to distant lymph nodes in
a spontaneous metastasis mouse model. In an experimental metastasis mouse model
following intracardiac injection, blocking β1 integrins by systemic delivery of mAb 33B6
suppressed metastasis of PC3-MM2 cells to bone (Figure 4) [112]. Thus, these studies
demonstrated the importance of β1 integrin activation in prostate cancer bone metastasis,
and that blocking β1 integrin activation inhibits bone metastasis. Therefore, I focused on
studying the role of β1 integrin activation in prostate cancer bone metastasis in my
dissertation. Furthermore, I addressed how β1 integrin activation promotes prostate
cancer bone metastasis and hypothesized that talin may have a unique role in β1 integrin
activation that promotes metastasis of prostate cancer cells.
Talin in inside-out integrin activation
Talin is essential to activate integrins by directly binding to the cytoplasmic tail of
the β subunit. Although several integrin-associated proteins have been shown to facilitate integrin activation including kindlin and ILK, only talin can directly bind integrins and is sufficient to activate integrins [113]. Overexpression of talin has been observed in several solid tumors, including prostate cancer [114], oral squamous cell carcinoma [115] and ovarian serous carcinoma [116], and generally overexpression correlates with higher
- 22 -
A B
Figure 4. Inhibition of PC3-MM2 cells metastasis in vivo by anti-β1 integrin antibody mAb 33B6. (A) Inhibition of PC3-MM2 metastasis to lymph node in vivo by mAb 33B6. Luciferase-labeled PC3-MM2 cells were injected into the prostate of SCID mice. Mice were treated with IgG or mAb 33B6 (1 mg/kg) before tumor cell inoculation and twice a week subsequently by intraperitoneal injection. Bioluminescence imaging of mice was conducted weekly afterwards to monitor tumor growth and metastasis in vivo . Average numbers of lymph node ± SD metastases detected at the termination of the study. (B) Inhibition of disseminated PC3-MM2 cell metastasis in bone by mAb 33B6. Tumor burden in the femurs of the control and mAb 33B6-treated mice. Luciferase-labeled PC3- MM2 cells were injected into the left ventricle of SCID mice. Mice were treated with IgG or mAb 33B6 (1 mg/kg) before tumor cell inoculation and twice a week subsequently by intraperitoneal injection. Bioluminescence imaging was acquired as above setting. P < 0.05.
From Lee YC*, Jin JK*, Cheng CJ*, Huang CF, Song JH, Huang M, Brown WS, Zhang S, Yu-Lee LY, Yeh ET, McIntyre BW, Logothetis CJ, Gallick GE, Lin SH (2013) Targeting constitutively activated beta1 integrins inhibits prostate cancer metastasis. Mol Cancer Res 11: 405-417. *shared first authorship. Reproduced with permission.
- 23 - tumor grade and metastasis [114-116]. However, little is known about the role of talin in cancer. Studies have shown that knockdown of talin reduces cell migration in ovarian serous carcinoma cells [116]. Overexpression of a dominant-negative form of talin, talin
L325R, significantly reduces cell proliferation and increases apoptosis in oral squamous cells [115]. In prostate cancer, talin knockdown decreases cell adhesion, migration and invasion, while overexpression of talin increases anoikis resistance through focal adhesion signaling [114]. However, the role of talin in cancer metastasis and the mechanisms by which talin promotes cancer cell properties were unknown, prior to my work. I hypothesize talin’s role in tumorigenesis occurs through activating β1 integrins, which is a major topic of this dissertation.
Structure of talin
Two distinct talin genes ( TLN1 and TLN2 , 74% sequence identity) are expressed in vertebrates, with talin1 expressed in nearly every tissue and talin2 normally expressed primarily in the heart, brain, testis and muscles [117-119]. Talins are 270-kDa adaptor proteins that are localized in adhesion complexes between cells and the ECM, where they interact with the β integrin cytoplasmic tail and the actin cytoskeleton [120]. Structurally, talin (including talin1 and talin2) consists of an N-terminal 47-kDa head domain and a
220-kDa C-terminal flexible rod domain (Figure 5) [113, 121]. The talin head consists of an atypical FERM domain including three subdomains (F1, F2, and F3) and a F0 subdomain [122]. The talin head contains binding sites for β integrin tails [123, 124], F- actin [125], phosphatidylinositol 4-phosphate 5-kinase γ (PIPK1γ) [126] and acidic phospholipids such as phosphatidylinositol-4,5-bisphosphate (PIP2) [127]. The talin head
- 24 -
Figure 5. Domain structure of talin. Talin is composed of three major domains: FERM (head), linker and rod domain. The FERM domain includes F1, F2 and F3 subdomains. The rod domain includes multiple actin and vinculin binding sites. The Ser425 phosphorylation site in the linker domain is indicated by a red star.
From Bate N, Gingras AR, Bachir A, Horwitz R, Ye F, Patel B, Goult BT, Critchley DR (2012) Talin contains a C-terminal calpain2 cleavage site important in focal adhesion dynamics. PLoS One 7: e34461. Reproduced with permission.
- 25 -
and rod are linked via residues 401-481 amino acid, which contains a calpain cleavage
site at 432 amino acid [128]. The talin rod domain is composed of a series of helical
bundles that contain multiple actin-binding sites, vinculin binding sites and a second
integrin-binding site [129]. Therefore, talin functions as an adaptor protein, as it
conjugates integrins to the cytoskeleton [129], and further promotes integrin-mediated
Talin-mediated inside-out integrin activation
Major insights into the principal function of talin were derived from experiments
demonstrating that the talin head binds the cytoplasmic tails of β integrin subunits leading
to the final step in inside-out integrin activation [124, 130]. The major integrin-binding
site at the talin head is located within the F3 subdomain containing a phosphotyrosine-
binding (PTB) domain, which interacts with the membrane-proximal NPxY motif in the
cytoplasmic tails of the β integrins [131, 132]. Crystallographic data revealed that talin- mediated integrin activation is dependent on binding of the talin F3 subdomain to the β integrin tail in two steps. First, the talin head interacts with the β integrin tail by binding the NPxY motif through its PTB domain (Figure 6). Second, the loop region on the talin
F3 subdomain subsequently interacts with the membrane-proximal region within the β integrin tail to displace the integrin tail. The displacement of the integrin tail results in separating the two legs of integrin α/β subunits thereby inducing a conformational change from an inactive bent structure to an extended conformation [122] (Figure 6). Integrins in this ‘primed’, extended form, are activated with their extracellular domains extended and the ligand-binding site exposed, which increases the binding affinity to specific ECM
- 26 -
Figure 6. Talin-mediated integrin activation. (A) Inactive talin can be activated by binding of PIP2, calpain cleavage and possibly through phosphorylation (described in this dissertation) to release the autoinhibitory conformation. (B) During integrin activation, the F3 subdomain on the talin head binds the membrane proximal NPXY motif of β integrin tail. (C) The talin loop structure in the head interacts with the membrane- proximal α helix of the β integrin cytoplasmic tail and separates the connection between integrin α/β tails.
From Moser M, Legate KR, Zent R, Fassler R (2009) The tail of integrins, talin, and kindlins. Science 324: 895-899. Reprinted with permission from AAAS.
- 27 - proteins. Ligand binding induces full activation and clustering of integrins. The talin bound with integrin tails then recruits vinculin, FAK, actin and other focal adhesion proteins to form a focal adhesion complex that conjugates integrins with the cytoskeleton
(Figure 7).
- 28 -
Figure 7. Talin-mediated integrin activation and subsequent focal adhesion formation. (A) In the inactive state, integrins are in a bent conformation. (B) Binding of talin in the cytoplasmic tail of integrins promotes to a partially activated extended conformation with increased affinity to ECM. (C) Ligand-bound integrins are in a fully activated state. In the cytoplasm, several focal adhesion proteins such as FAK, Src, vinculin and paxillin are recruited to talin for assembly of focal adhesion complexes.
Modified from Legate KR, Montanez E, Kudlacek O, Fassler R (2006) ILK, PINCH and parvin: the tIPP of integrin signalling. Nat Rev Mol Cell Biol 7: 20-31. Reproduced with permission.
- 29 -
Because integrin activation has to be strictly regulated in normal cells, binding of
talin to integrin is tightly controlled. In the cytoplasm, talin forms an antiparallel dimer
via a single helix in the C-terminal rod [133]. In this autoinhibitory conformation, the C-
terminal talin rod binds the N-terminal PTB domain, which blocks the integrin binding
pocket [134]. Therefore, talin itself must be activated prior to binding integrins. How
talin is activated is not clear, but the mechanism must involve disruption of autoinhibitory
conformation. Several mechanisms have been proposed to relieve this inhibitory
conformation, including binding PIP2 [135, 136], calpain cleavage [137] and talin
phosphorylation [138]. PIP2 is a known to activate talin by inducing conformational
changes [135]. Studies of the talin crystal structure revealed that PIP2 on the plasma
membrane attracts the positively charged talin head and simultaneously repels the
negatively charged talin rod [136]. Such a “pull-push” process relieves the autoinhibitory
conformation. In the calpain cleavage model, talin is cleaved by calpain at amino acid
432, yielding an N-terminal 50-kDa globular head domain and a 220-kDa C-terminal rod
domain [137]. Thus, the N-terminal head cleaved product can bind to integrin with the
FERM domain and is sufficient to activate integrins.
Talin phosphorylation
In addition to the above described mechanisms, phosphorylation of talin has been proposed to induce an active conformation. Hence, in the phosphorylated residues in talin have been mapped using mass spectrometry. Talin is heavily phosphorylated on 30 sites including, serine, threonine and tyrosine residues [139]. Most of the sites are predicted to be phosphorylated by PKA, PKC and cyclin-dependent kinase 5 (Cdk5). Although the
- 30 - functions of these phosphorylated sites are unknown, talin phosphorylation has been implicated in regulation of membrane-cytoskeleton interactions [140-142]. One of the most heavily phosphorylated sites is on talin1 serine 425, which resides in the talin linker domain [143]. Phosphorylation of talin on S425 was shown to inhibit binding to Smurf1 and prevents talin head ubiquitylation and degradation [143]. Mutation of talin S425 to inhibit phosphorylation results in decreasing cell migration in neural cells [143]. Because talin S425 phosphorylation regulates cell properties associated with integrin functions, talin phosphorylation may plausibly regulate integrin activation. Structurally, phosphorylation of proteins can induce a conformational change [144]; therefore, talin phosphorylation could be one of the possible mechanisms to relieve the inhibitory conformation and lead to talin activation, thus promoting integrin binding and integrin activation. However, the potential role of talin phosphorylation in integrin binding and integrin-mediated signalings has not been assessed previously.
Cdk5 in talin phosphorylation
Studies of Huang et. al. have shown that talin is phosphorylated on S425 by Cdk5 in normal cells [143]. Cdk5 belongs to a member of the cyclin-dependent kinase family of proline-directed protein kinases. Cdk5 was originally isolated from screening of Cdk1 and is 58% and 62% sequence identical with Cdk1 and Cdk2, respectively [145].
Although Cdk5 was cloned as a homologue to other Cdk family proteins, Cdk5 is mostly expressed in terminally differentiated neurons of developing nervous system [146], and regulates the migration of post-mitotic neurons during embryogenesis [147], thus is not involved in cell cycle regulation. However, the mechanisms by which Cdk5 regulates
- 31 -
neuronal migration in the embryonic and adult brains are still unknown. One possible
mechanism is through altering microtubule dynamics by phosphorylating proteins that are
critical for nucleokinesis, such as Nudel1, FAK and PAK [148-151]. Cdk5 is activated by
two non-cyclin regulatory subunits, p35 and p39 [152, 153]. While p39 is specifically
expressed in the cerebellum, p35 is expressed in various tissues, including prostate [154-
156]. p35 does not show homology with other known cyclins and does not activate other
members of Cdk family [152]. Thus, p35 has high specificity for Cdk5 activation [152].
In addition to their roles in neurons, several studies have shown that Cdk5 is activated in
non-neuronal cells, including pancreatic cells [157] and corneal epithelial cells [158]. In
prostate cancer, Cdk5 and its activator p35 are highly expressed in primary tumors and
metastases compared with normal tissues [155, 156]. Cdk5 was shown activated in
prostate cancer cells, Strock et. al. demonstrated that overexpression of dominant-
negative Cdk5 in prostate cancer cells inhibits lung metastasis in xenograft mice [156].
These results suggest that Cdk5 activity promotes prostate cancer metastasis. Intriguingly,
Cdk5 has also been shown to increase migration and cell-matrix adhesion, i.e. functions
associated with β1 integrin activation [158, 159]. Recently, a study showed that Cdk5 and p35 are clustered with talin and β1 integrins into lamellipodia during cell spreading [160].
Inhibition of Cdk5 activity using the pan-Cdk inhibitor, roscovitine, prevents binding of
talin/integrin, which suggests that Cdk5 activation may be involved in integrin activation.
Thus, Cdk5 and p35 may play important roles in talin phosphorylation-mediated integrin
activation, which will be studied in this dissertation.
- 32 -
Summary of the problem and hypothesis
Prostate cancer is the most commonly diagnosed cancer in men in the western world with a nearly 29,500 deaths anticipated in 2014 in the United States [1, 161].
Although patients with organ-confined prostate cancer are usually successfully treated, for those with metastases, the 5-year survival decreases to 28% [1]. Prostate cancer has a high propensity for metastasizing to the bone. Thus, understanding the mechanisms by which prostate cancer cells metastasize to the bone will be critical for designing novel therapeutic strategies for metastasis prevention.
Recent studies have implicated β1 integrin signaling in promoting critical steps in prostate cancer metastasis, such as adhesion, migration, invasion and cellular survival.
Several β1 integrins on prostate cancer cells have been shown to interact with bone matrix and promote tumor growth in the bone [79, 80, 111]. However, the role of β1 integrins in prostate cancer bone metastasis remains unknown. A better understanding of the β1 integrin signaling pathway by which prostate cancer cells increase metastatic potential is needed. Moreover, the mechanism by which β1 integrins are activated in prostate cancer cells is also unknown. Although, talin has been shown to regulate integrin activation and thus is a candidate for activating β1 integrins in prostate cancer cells, the potential role of its phosphorylation in β1 integrin activation has not been assessed previously. In addition, talin, Cdk5 and p35 have been implicated in prostate cancer metastasis, but whether they are in a signaling axis that promotes β1 integrin activation leading to bone metastasis was not clear prior to my studies.
- 33 -
The goal of this Ph.D. dissertation work was to investigate the roles of talin1
phosphorylation in prostate cancer metastasis and specifically to understand the
mechanism of talin1 phosphorylation in activating β1 integrins and the effects in
promoting prostate cancer bone metastasis. Therefore, the first question addressed in the
dissertation work was whether β1 integrins are activated through inside-out β1 integrin activation in metastatic prostate cancer cells, and what would be the effects to cancer cells. The second question was whether talin1 phosphorylation promotes β1 integrin activation in metastatic prostate cancer cells, and what would be the effects of talin phosphorylation on cancer cells? The third question was what is the mechanism by which talin1 is phosphorylated in prostate cancer cells? The fourth question was whether talin1 phosphorylation promotes prostate cancer bone metastasis in vivo .
The hypothesis tested in this dissertation was that β1 integrins are constitutively activated in metastatic prostate cancer cells through talin1 S425 phosphorylation, which is required to promote prostate cancer metastasis. To test this hypothesis, I first determined the correlation of β1 integrin activation with metastatic potential of cancer cells, and whether β1 integrins were activated through inside-out signaling. Then, I investigated whether talin phosphorylation promotes β1 integrin activation in prostate
cancer cells by talin silencing and mutation, and examined the effects of talin
phosphorylation on integrin associated functions in cancer cells. For the third question, I
determined the potential mechanism that increased p35 expression promotes Cdk5
activity that phosphorylates talin resulting in β1 integrin activation in prostate cancer
cells. Finally, I assessed the effects of talin phosphorylation in prostate cancer metastasis
- 34 - in vivo and investigated the clinical relevance of talin phosphorylation in prostate cancer tissues. Together, this work addressed the mechanism and biological function of talin phosphorylation and provides a better understanding of the mechanism for prostate cancer metastasis.
- 35 -
Chapter 2 Materials and Methods
- 36 -
This chapter is based upon “Lee YC*, Jin JK*, Cheng CJ*, Huang CF, Song JH,
Huang M, Brown WS, Zhang S, Yu-Lee LY, Yeh ET, McIntyre BW, Logothetis CJ,
Gallick GE, Lin SH (2013) Targeting constitutively activated beta1 integrins inhibits prostate cancer metastasis. Mol Cancer Res 11: 405-417” with permission from AACR,
*shared first authorship, and based upon “Jin JK , Tien PC, Cheng CJ, Song JH, Huang C,
Lin SH, Gallick GE (2014) Talin1 phosphorylation activates β1 integrins: a novel mechanism to promote prostate cancer bone metastasis. Oncogene (in press)” with permission.
Cell lines and culture condition
The PC3 and PC3-MM2 cells were gifts from Dr. Isaiah J. Fidler at the M. D.
Anderson Cancer Center. The PC3-MM2 is a highly metastatic cell line derived following two passages of PC3-M cells in nude mice of selecting and re-passaging lymph node metastases [162]. LNCaP cells were obtained from the American Type Culture
Collection. The C4-2B4 cells were gifts from Dr. Sue-Hwa Lin at the M. D. Anderson
Cancer Center. The C4-2B4 cells derived from bone metastasis are a C4-2 subline derived from LNCaP [163]. These cell lines as well as those that were gene-silenced or engineered to express talin1 mutants were maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum. To increase cell attachment, β1 integrin knockdown, talin1 knockdown and talin1 S425A expressing cells were cultured on poly-D- lysine (Sigma, St. Louis, MO) coated plates. Cell lines were checked every six months and found to be mycoplasma free, and the identity of cell lines was authenticated at the M.
D. Anderson Cell Identification Core Facility.
- 37 -
Antibodies
Anti-talin1 (97H6) antibody was purchased from GeneTex (San Antonio, TX).
Anti-pan total talin (8d4) and β-actin antibodies were purchased from Sigma. Anti-ptalin
S425 antibody and blocking peptide were purchased from ECM Biosciences (Versailles,
KY). Anti-active β1 integrin (9EG7) and total β1 integrin (MAR4, 18) antibodies were purchased from BD Biosciences (San Jose, CA). Anti-active β1 integrin (12G10) and talin2 (68E7) antibodies were purchased from Abcam (Cambridge, MA). Anti-Cdk5 (C-8) and p35 (C-19) antibodies were purchased from Santa Cruz (Dallas, TX). Anti-FAK,
PARP, cleaved PARP, AKT, pAKT S473, p130 Cas, pp130 Cas Y165, GFP and Myc-tag antibodies were purchased from Cell Signaling (Danvers, MA). Anti-pFAK Y397 and
Alexa Fluor 647-conjugated secondary antibodies were purchased from Life
Technologies (Grand Island, NY).
Flow cytometric analysis of β1 integrins
Cultured cells (1 × 10 5) were detached by trypsin without EDTA, resuspended in
0.5 ml of ice-cold PBS buffer with 0.5% bovine serum albumin (BSA; Sigma Cat. no.
A7030) and 0.04% sodium azide, and incubated on ice for 10 min. Anti-active β1 integrin
(9EG7; 1:300), active β1 integrin (12G10; 1:300), total β1 integrin (MAR4; 1:300) antibodies or isotype IgG control were added and incubated on a rocker for 1 hr at 4 ℃.
Cells were centrifuged at 500 ×g for 5 min, washed with PBS three times, and then incubated with Alexa Fluor 647-conjugated secondary antibody (1:500) in 1 ml of PBS with 0.5% BSA on a rocker for 30 min at 4 ℃ in the dark. Labeled cells were washed twice with PBS and subjected to FACS analysis using a FACS Canto II flow cytometer
- 38 -
(BD Biosciences). Labeled cells were fixed and subjected to FACS analysis within one week. To fix cells, labeled cells were washed with PBS and resuspended in 1% paraformaldehyde for 5 min followed by washing with PBS containing 0.5% BSA and stored at 4 ℃ in the dark. Expression of activated and total β1 integrins was quantitated by geometric mean fluorescence intensity using FlowJo software (Tree Star, Ashland,
OR).
Immunoblotting
Cells were washed with PBS and lysed with RIPA buffer (10 mM Sodium phosphate, pH 7.2, 150 mM NaCl, 0.1% SDS, 0.5% deoxycholic acid, 2 mM EDTA, 1%
Triton X-100, 10% glycerol, protease inhibitor cocktail, and PhosSTOP phosphatase inhibitor cocktail; Roche, Indianapolis, IN). Cell lysates were sonicated (Bioruptor XL,
Diagenode, Denville, NJ) for 90 sec on ice and centrifuged at 14,000 ×g for 20 min at 4
℃. Protein concentration of the supernatants was measured using a DC protein assay kit
(Bio-Rad, Hercules, CA). The supernatants (30 µg) were mixed with Laemmli sample buffer, boiled for 5 min, and subjected to SDS-PAGE. Proteins were transferred on
PVDF membranes followed by blocking with 5% milk for 1 hr. For phospho-protein immunoblotting, membranes were blocked in 5% BSA for 2 hr. Membranes were incubated with primary antibodies for 1 hr at room temperature, or overnight at 4 ℃.
Then, horseradish peroxidase-conjugated secondary antibodies (1:6500) were incubated with membrane for 1 hr. Membranes were incubated with SuperSignal Femto Substrate
(Thermo) and exposed to X-ray films to detect proteins.
- 39 -
Immunofluorescence staining
Cells were cultured on coverglasses (Grace Bio-Labs, Bend, OR) for 18 hr, fixed in 4% paraformaldehyde for 15 min, washed with PBS, permeabilized with 0.1% Triton
X-100 in PBS for 10 min, and incubated in blocking buffer (LI-COR, Lincoln, NE) for 1 hr. Antibodies (anti-active β1 integrin 12G10, 1:100; anti-total β1 integrin clone 18,
1:100) were diluted in blocking buffer and incubated for 18 hr at 4 ℃. Slides were washed with PBS and incubated with Alexa Fluor 647-conjugated secondary antibody for
1 hr. Nuclei were stained using Hoechst 33342 (Life Technologies). Slides were treated with ProLong Gold antifade Reagent (Life Technologies) and images were acquired using a TCS SP5 confocal microscope (Leica, Buffalo Grove, IL) and analyzed using
Image-Pro Plus software (Media Cybernetics, Rockville, MD). For fluorescence area quantitation, a threshold of fluorescence intensity was used to define fluorescence area on images. The number of pixels in the area with an intensity above the threshold was counted and normalized to cell count for each image.
Anoikis assays
Cells (1 × 10 6) were detached by trypsin, resuspended in 13 ml of serum-free medium containing 0.05% BSA in a 15 ml conical tube with vent cap, and rotated in an incubator to prevent cell aggregation. For counting live and dead cells, 500 µl of cell suspension was incubated with 2 mM Calcein AM (BD Biosciences) for 30 min at 37 ℃ followed with 4 mM propidium iodide (BD Biosciences) and counted under a fluorescence microscope. For cells expressing talin mutants, live cells were counted by trypan blue exclusion using a Vi-Cell XR cell viability analyzer (Beckman Coulter,
- 40 -
Indianapolis, IN). The cells in the cell suspension were centrifuged at 500 ×g for 5 min
and lysed in RIPA buffer at specific times followed by immunoblotting for PARP and
cleaved PARP. To detect apoptotic cells using propidium iodide FACS analysis, the cell
suspension was centrifuged, fixed by resuspended in ice-cold 70% ethanol and incubated
at 4 ℃ for overnight (see appendix for protocol). Cells were centrifuged and washed with
PBS and resuspended in 50 µl of PBS with 2 mg/ml ribonuclease A and incubated for 5 min on ice. PBS (450 µl) containing 75 M propidium iodide was added and incubated
for 30 minutes on ice followed by analyzing using FACS analysis. Cells in the sub-
G0/G1 were quantitated using FlowJo software.
Lentivirus-mediated gene silencing
To decrease β1 integrin expression, a viral pLKO.1-puro plasmid (Sigma)
containing a shRNA sequence 5’-GCCCTCCAGATGACATAGAAA-3’ was used. Two
plasmids containing different shRNA sequences were used to decrease talin1 or talin2
expression. sh-Talin1 sequences used were 5’-CCCAGAGTATTAACGCTCCAA-3’
targeting UTR region, and 5’-GCCTCAGATAATCTGGTGAAA-3’ targeting CDS
region. sh-Talin2 sequences used were 5’-GACGAATCCAAACACGAAATC-3’ and 5’-
ACGATGCGTGTCGAGTCATTC-3’. To decrease Cdk5 expression, the sequence used
was 5’-CAGAACCTTCTGAAGTGTAAC-3’. A non-targeting shRNA sequence 5’-
GCGCGATAGCGCTAATAATTT-3’ in the same vector was used as a sh-control
plasmid. For lentivirus production, the pLKO.1-puro plasmid (3 µg) was co-transfected
with the packaging plasmid pCMV-dR8.2 dvpr (3 µg) and the envelope plasmid pCMV-
VSV-G (0.6 µg) in a ration of 5:5:1 into 293FT cells in one 100-mm plate (Life
- 41 -
Technologies) using Lipofectamine 2000 (Life Technologies). After 24 hr, medium was replaced with 20% FBS. The viral supernatant was collected after 24 h and again at 48 hr, filtered through 0.45 µm filters followed by centrifugation at 20,000 rpm for 2 hr at 4 ℃.
The viral pellet was resuspended in 200 µl of RPMI medium and stored at -80 ℃. Cells cultured in 48-well plates were incubated with 20 µl of virus supernatant in the present of
8 g/ml of polybrene (Sigma) and centrifuged at 500 ×g for 20 min and further incubated for 24 hr. The medium was changed after 24 h and replaced again with 5 g/ml puromycin after 48 hr and incubated for one week to select stable silenced cells. For
Cdk5 knockdown, cells were tranduced and lysed after 48 hrs without selection.
Immunoprecipitation
Cells were lysed in lysis buffer containing 50 mM Hepes, pH 7.4, 150 mM NaCl,
1% Triton X-100, 0.1% SDS, 1% deoxycholic acid, 10% glycerol, protease inhibitor cocktail, and phosphatase inhibitor cocktail. Lysates (500 µg protein) were diluted two- fold in immunoprecipitation buffer (50 mM Hepes, pH 7.4, 150 mM NaCl, 0.1% Triton
X-100, and 10% glycerol) and incubated with anti-talin1 (97H6) antibody (5 µg) plus 5
µM cytochalasin D for 3 h at 4 ℃. Protein G-coupled agarose beads (50 µl) were added into the mixture and incubated for 1 h at 4 ℃ followed by washing using lysis buffer once and immunoprecipitation buffer three times, and immunoblotting were subjected.
Mutagenesis
To express talin1 WT and mutants in prostate cancer cells, human full-length talin1 cDNA in pEZ-M29-talin1 plasmid was purchased from GeneCopoeia (Rockville, MD).
- 42 -
To generate pWPXL-GFP-talin1 WT , full-length talin1 DNA fragments were amplified by
PCR using pEZ-M29-talin1 as a template and
5’GCTGTACAAGTCCGGCATGGTTGCACTTTCACTGAAGA3’ (primer #1) and
5’GAGATCTGAGTCCGGACAAGAAAGCTGGGTTGCG3’ (primer #2; see appendix for subcloning protocol). The DNA fragments were subcloned into B sp EI partial-digested pWPXL-GFP vector (gift of Dr. Didier Trono, Addgene plasmid #12257) using In-
Fusion HD cloning system (Clontech, Mountain View, CA) according to the manufacturer’s instructions (see appendix for plasmid maps). To generate pWPXL-GFP- talin1 S425A , the pEZ-M29-talin1 was used as a template for PCR amplification and
5’GACTCAGTGGCCCCCAAAAAGTCAACAGTCCTG3’ and
5’GGGCCACTGAGTCCTCCAGCATAGTAGACTCCTC3’ (underline denotes mutated
site) as complementary mutagenic primers to generate linearized pEZ-M29-talin1 S425A ,
and then recircularized using the In-Fusion system (see appendix for mutagenesis
protocol). The pEZ-M29-talin1 S425A was then used as the template for PCR amplification
with primer #1 and #2 to generate full-length talin1 1-2542 S425A DNA fragments, which
were inserted into a B sp EI partial-digested pWPXL-GFP vector using In-Fusion enzyme.
The same procedures above were used to generate pWPXL-GFP-talin1 S425D with the
following complementary mutagenic primers:
5’GACTCAGTGGA CCCCAAAAAGTCAACAGTCCTG3’ and
5’GGTC CACTGAGTCCTCCAGCATAGTAGACTCCTC3’ for PCR amplification.
- 43 -
Transfection
To generate stable GFP-talin1 WT and mutant cells, pWPXL-GFP-talin1 WT , mutant plasmids and pWPXL-GFP (empty vector) were transiently transfected into talin1- silenced cells using jetPRIME (Polyplus-transfection, Illkirch, France) according to the manufacturer’s instructions. For talin1 knockdown in PC3-MM2 and C4-2B4 cells, a pLKO plasmid directing expression of shRNA to the talin1 UTR was used, therefore not interfering with expression of GFP-talin1 mutant proteins subsequently expressed.
Transient transfected GFP-talin1 mutant cells were sorted for GFP positive cells by a flow cytometer at the M. D. Anderson Flow Cytometry and Cellular Imaging Core
Facility to select stable transfected cells with similar levels of GFP expression. For Cdk5 overexpression, plasmids of empty vector (pEF4-myc-His), Cdk5 wild-type (pEF4-myc-
His-Cdk5), and dominant-negative Cdk5 (pEF4-myc-His-Cdk5-144N) [143] were transiently transfected using jetPRIME.
Proliferation assays
Cells (5 × 10 4) were cultured on 60-mm CellBind plates (Corning) in triplicate for
specific times. Cells were detached by trypsin and live cell number were counted by
trypan blue exclusion using a Vi-Cell XR cell viability analyzer.
Adhesion assays
Tissue culture treated 96-well plates were coated with fibronectin (5 g/cm 2; BD
Biosciences), or collagen I (5 g/cm 2; BD Biosciences) for 1 hr at 37 ℃, then blocked by
1% BSA. Cells were detached by trypsin without EDTA, resuspended in serum-free
- 44 -
medium and incubated in plates at 4 × 10 4 cells per well in triplicate for 5 min at 37 ℃.
Plates were washed three times by 100 µl of PBS to remove unattached cells. Attached cells were incubated with 1 M Calcein AM (BD Biosciences) in PBS for 5 min at 37 ℃.
Fluorescence-labeled cells were lysed in 100 µl of 1% Triton X-100, and the fluorescence intensity was measured using an Envision plate reader (PerkinElmer, Waltham, MA).
Migration and invasion assays
Migration assays were performed using collagen I coated (1 g/cm 2) polycarbonate transwell filters in 24-well plates (8- m pore size; Corning, Tewksbury,
MA). For invasion assays, Matrigel coated filters (BD Biosciences) were used. Cultured
cells were detached by trypsin, suspended in serum-free medium and incubated in the
upper chamber of transwell inserts at a density of 5 × 10 4 cells per well. The medium in
the bottom chamber was supplemented with 0.1% FBS as a chemoattractant. Cells were
allowed to migrate for 8 hr or to invade for 24 hr. Cells adhering to the bottom of the
filters were stained with HEMA 3 stain kit (Fisher Scientific, Kalamazoo, MI) and then
the cells on the upper side of the filter were removed by cotton tips. Images of filters
were acquired at 20× using a microscope with camera (Eclipse Ti-S; Nikon, Melville,
NY). Cell numbers on images were counted using Image-Pro Plus software.
Cdk5 kinase activity assays
Cdk5 kinase activity was measured using ADP-Glo kinase assay (Promega,
Madison, WI) according to the manufacturer’s instructions. Cells were lysed in a buffer
containing 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.5%
- 45 -
deoxycholic acid, 5 mM EDTA, protease inhibitor cocktail, and phosphatase inhibitor
cocktail. Cell lysate (500 g) was incubated with anti-Cdk5 antibody (5 g) in modified lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5% deoxycholic acid, 1 mM
DTT, 1 mM EDTA, 1 mM EGTA, protease inhibitor cocktail, and phosphatase inhibitor cocktail) for 1 h at 4 ℃ followed by incubated with 50 µl of protein A-coupled agarose beads for 3 h at 4 ℃. The agarose beads were washed using modified lysis buffer and resuspended in 10 l kinase reaction buffer (40 mM Tris-HCl, pH 7.5, 20 mM MgCl 2 and
0.1 g/ l BSA). Cdk5 enzyme reaction was initiated by incubating agarose beads in kinase reaction buffer for 30 min at 30 ℃ with 170 M histone H1 peptide
PKTPKKAKKL (Enzo Life Sciences, Farmingdale, NY) and 50 M ATP in a final volume of 25 l. ADP produced during kinase reaction was measured using ADP-Glo kinase assay according to the manufacturer’s instructions (see appendix for protocol).
The reaction mixture (20 µl) was transferred to a 384-well plate, and luminescence read using an Envision plate reader.
In vivo metastasis assays
PC3-MM2 sh-control, talin1-silenced with GFP, GFP-talin1 WT and GFP-talin1 mutant cells were transduced with lentivirus containing a plasmid directing luciferase expression (pLenti-PGK-Blast-V5-LUC [164], i.e. the Addgene plasmid #19166) as described above, and then incubated with 5 µg/ml blasticidin to select stable transduced cells. All animal studies were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) guidelines of M. D. Anderson Cancer Center. For intracardiac injection (experimental metastasis assays), the cells (1 × 10 6) were suspended
- 46 - in 50 µl of PBS and injected into left ventricle of male nude mice. Bioluminescence images were acquired immediately after intracardiac injection to proper ensure distribution of cells in mice, and then were used to monitor tumor growth. For bioluminescence imaging, mice were injected intraperitoneally with 100 µl of 15 mg/ml luciferin in PBS, imaging using a Xenogen IVIS 200 system (PerkinElmer) was performed 10 min later. X-ray and matched bioluminescence images were acquired and superimposed using a Kodak In-Vivo Multispectral Imaging System FX (Carestream,
Rochester, NY). For intraprostatic injections (spontaneous metastasis assays), the procedure of Kim et al. [165] was followed. Male athymic nude mice (NCr-nu/nu; ages
8–12 wk) were anesthetized placed in a supine position. A midline incision was made on the lower abdomen, and the prostate was exteriorized. Cells (5 × 10 5) in 10 µl of PBS were injected into the dorsolateral side of the prostate. The incision was closed with surgical metal clips. The growth of primary tumor was monitored by bioluminescence imaging. Mice with similar sized primary tumors were sacrificed, primary tumors were removed and the lymph node metastases were identified by bioluminescence imaging.
Immunohistochemistry
Human prostate cancer tissue samples from primary tumor, lymph node metastases and bone metastases were obtained from the prostate cancer tissue bank at M.
D. Anderson Cancer Center, under an approved IRB protocol. To validate the specificity of anti-ptalin S425 antibody, PC3-MM2 cells were fixed in 10% formalin, pelleted and embedded in agarose (see appendix for protocol). Sections of agarose cell blocks were incubated with ptalin S425 antibody alone or simultaneously with corresponding
- 47 -
blocking peptide (ECM Biosciences) followed by using the same procedures in tissue
staining. For tissue staining, formalin-fixed, paraffin-embedded sections in 4- m-thick were de-waxed with xylene, rehydrated in graded concentrations of alcohol followed by heat-induced epitope retrieval at 121 ℃ for 10 min in citrate buffer (pH 6.0) using a
pressure cooker. Tissue sections were treated with 3% hydrogen peroxide for 30 min,
washed with PBS, blocked with 5% normal horse serum for 30 min, and incubated at 4 ℃ overnight with anti-ptalin S425 antibody. Antibody binding was detected using biotin- streptavidin system (Vector Laboratories, Burlingame, CA) with 3,3’-diaminobenzidine as the chromogen. Hematoxylin was used as the counterstain. The immunostaining results were reviewed and scored by pathologists as described previously [112]. Tissues were defined as positive when over 10% of cells were stained.
Statistical analyses
Data are shown as means ± s.d. One-way ANOVA and post Tukey’s test were used to determine significance in metastasis assays. A chi-square test was used to evaluate immunohistochemical analysis. Other assays were determined by two-tailed
Student’s t-test. P-values less than 0.05 were considered statistically significant.
Statistical analyses were conducted using GraphPad Prism software (GraphPad Software,
La Jolla, CA).
- 48 -
Chapter 3 Constitutive activation of β1 integrins in metastatic prostate cancer cells
- 49 -
This chapter is based in partly upon “Lee YC*, Jin JK *, Cheng CJ*, Huang CF,
Song JH, Huang M, Brown WS, Zhang S, Yu-Lee LY, Yeh ET, McIntyre BW,
Logothetis CJ, Gallick GE, Lin SH (2013) Targeting constitutively activated beta1 integrins inhibits prostate cancer metastasis. Mol Cancer Res 11: 405-417” with permission from AACR, *shared first authorship, and based in partly upon “ Jin JK , Tien
PC, Cheng CJ, Song JH, Huang C, Lin SH, Gallick GE (2014) Talin1 phosphorylation activates β1 integrins: a novel mechanism to promote prostate cancer bone metastasis.
Oncogene (in press)” with permission.
Activation of β1 integrins correlates with metastatic potential of prostate cancer cells
To examine whether activation of β1 integrins plays a role in prostate cancer metastasis, I determined β1 integrin expression and activation in several available prostate cancer cell lines, including the lymph node-derived LNCaP and its variant C4-
2B4, as well as the PC3 and its metastatic variant PC3-MM2 cells. LNCaP and C4-2B4 cells are tumorigenic, however, with low metastatic potential when implanted orthotopically or intracardially. PC3 and PC3-MM2 are tumorigenic and highly metastatic, exhibiting high incidence of metastasis in both spontaneous and experimental bone metastasis models [77, 166]. Using anti-total β1 integrin mAb MAR4, FACS analysis showed that all 4 cell lines expressed high levels of β1 integrins (Figure 8). Next,
we examined integrin activation in these cell lines. Western blot showed that the levels of
phosphorylation of pFAK Y397 are higher in PC3 and PC3-MM2 than LNCaP and C4-
2B4 cells (Figure 9), suggesting that integrin signaling is in a more activated state in PC3
- 50 -
A
B
Figure 8. FACS analysis of total β1 integrins in prostate cancer cell lines. (A) FACS analysis using anti-total β1 integrin antibody, mAb MAR4. Cells incubated with secondary antibody only were used as negative controls. (B) Quantitation of geometric mean fluorescence intensity of total β1 integrins.
- 51 -
A B
Figure 9. Immunoblotting of cell lysates for the expression of FAK and phosphorylated FAK Y397. (A) Immunoblotting of pFAK Y397 and total FAK using cell lysates from prostate cancer cells. (B) Quantitation of band intensity in immunoblotting.
- 52 - and PC3-MM2 cells with higher metastatic potential. We further used the conformation- sensitive antibody 9EG7 to examine whether β1 integrins in these cells were present in the activated conformation. Monoclonal antibody 9EG7 recognizes the EGF-like repeats
1-4 that were exposed in activated β1 integrins [167-169]. The data showed that 9EG7 binds to PC3 and PC3-MM2 strongly (Figure 10). In contrast, 9EG7 showed only modest binding to LNCaP and C4-2B4 (Figure 10). β1 integrin activation was further examined by immunofluorescence staining using another conformation-specific antibody, mAb
12G10, that binds to exposed βA domain during β1 integrin activation [170, 171].
Activation of β1 integrins, determined by fluorescence area, was 20-fold higher in metastatic PC3-MM2 cells as compared to low metastatic C4-2B4 cells (Figure 11).
These observations suggest that β1 integrins are present in an activated conformation only in cell lines with high metastatic potential.
- 53 -
A
B
Figure 10. FACS analysis of activated β1 integrins in prostate cancer cell lines. (A) FACS analysis using a conformation-sensitive antibody, mAb 9EG7, targeting activated β1 integrins. Cells incubated with secondary antibody only were used as controls. (B) Quantitation of geometric mean fluorescence intensity of activated β1 integrins.
- 54 -
A
B
Figure 11. Immunofluorescence staining of activated and total β1 integrins. (A) PC3- MM2 and C4-2B4 cells were stained using a conformation-sensitive antibody for activated β1 integrins (mAb 12G10) and total β1 integrins (mAb 18; bottom panels). Nuclei were counterstained by Hoechst 33342. Scale bar represents 25 µm. (B) Differences in expression by quantitating pixels of immunofluorescence area. *PC3- MM2 compared to C4-2B4, P < 0.05. **PC3-MM2 compared to C4-2B4, P < 0.001.
- 55 -
β1 integrin activation correlates with anoikis resistance in prostate cancer cells
Integrin signaling is critical to increase cell survival [172]. Thus, I examined whether increased β1 integrin activation in metastatic prostate cancer cells correlated with cell survival by using an anoikis assay. Single cells from prostate cancer cell lines were placed in suspension with serum-free medium and constantly rotated for 24 and 48 hours to prevent aggregation-induced outside to inside integrin aggregation. The number of viable and dead cells was then determined. As shown in Figure 12, PC3-MM2 has the highest number of viable cells at 48 hours, whereas LNCaP and C4-2B4 cells did not survive in these anoikis conditions. The decreases in viable cell number corresponded to the increases in dead cell number (Figure 12). Analysis of nuclear integrity by FACS of propidium iodide staining showed that the increased dead cell number in anoikis- sensitive cell lines correlated with an increase in the sub-G1 fractions (Figure 13), suggesting that these cells had undergone apoptosis. Consistent with this result, western blot analysis showed a correlation between anoikis sensitivity and increases in PARP cleavage (Figure 14). These observations indicate that the ability of prostate cancer cells to survive in anoikis conditions correlates with the activation status of β1 integrins and also the metastatic potential of these cell lines.
- 56 -
A
B
Figure 12. Viable and dead cell number of prostate cancer cells in anoikis conditions. Cells were grown in anoikis condition as described in Materials and Methods. (A) Viable and (B) dead cell numbers were determined by Calcein AM and propidium iodide staining under a microscope, respectively.
- 57 -
A
B
Figure 13. FACS analysis of propidium iodide-labeled apoptotic cells. (A) Cells were grown in anoikis conditions for 24 and 48 hr. Cell counts of propidium iodide-labeled cells after 24 hr suspension. Percentage indicated apoptotic cell population in sub-G1. (B) Quantitation of apoptotic cells in sub-G1.
- 58 -
Figure 14. Immunoblotting of PARP and cleaved PARP. PC3 or PC3-MM2 cells grown under anoikis conditions for various lengths of times. Cells were lysed and subjected to immunoblotting.
- 59 -
Silencing of β1 integrins in PC3-MM2 cells by expression of shRNA abrogates anoikis resistance
To examine the causal effect of β1 integrin signaling on prostate cancer cell
survival, I used stable expression of shRNA to knockdown β1 integrins in PC3-MM2
cells. As shown in Figure 15, transfection of β1 integrin-specific shRNA reduced the
expression of β1 integrins by more than 90%, whereas control non-targeting shRNA did
not have significant effects on β1 integrin expression. To examine the effects on integrin-
mediated survival pathways, phosphorylation of FAK Y397 and AKT S473 were
examined. Knockdown of integrin greatly reduced pFAK Y397 and pAKT S473
phosphorylation (Figure 15). Furthermore, the β1 integrin knockdown cells in suspension
were sensitized to anoikis (Figure 16), with a concomitant increase in PARP cleavage
(Figure 17). These results suggest that β1 integrin signaling plays a critical role in the
survival of highly metastatic PC3-MM2 cells.
- 60 -
Figure 15. Immunoblotting of β1 integrins, pFAK Y397, total FAK, pAkt S473, and total Akt in β1 integrin knockdown cells. A stable PC3-MM2 cell line was derived in which β1 integrins are reduced by expression of shRNA as described in Materials and Methods.
- 61 -
Figure 16. Viable cell number of β1 knockdown PC3-MM2 cells in anoikis conditions. Control and β1 knockdown PC3-MM2 cells were grown in anoikis conditions for 24 and 48 hr as described in Materials and Methods. Viable cell numbers were determined by Calcein AM staining.
- 62 -
Figure 17. Immunoblotting of PARP and cleaved PARP in β1 integrin knockdown cells in anoikis conditions. β1 integrin knockdown PC3-MM2 cells were cultured under anoikis conditions for indicated times. Cell lysates were used for immunoblotting for PARP and cleaved PARP.
- 63 -
Chapter 4 Talin1 phosphorylation regulates β1 integrin activation
- 64 -
This chapter is based in partly upon “Jin JK , Tien PC, Cheng CJ, Song JH,
Huang C, Lin SH, Gallick GE (2014) Talin1 phosphorylation activates β1 integrins: a novel mechanism to promote prostate cancer bone metastasis. Oncogene (in press)” with permission.
Talin1, but not talin2, activates β1 integrins in prostate cancer cells
Talin is required for inside-out integrin activation and is overexpressed in prostate cancer [114]. Therefore, I determined whether talin expression contributes to constitutive
β1 integrin activation in metastatic prostate cancer cells. Because talins are expressed from two genes, TLN1 and TLN2 , I first compared the effect of talin1 and talin2 in β1 integrin activation by gene silencing in PC3-MM2 cells. Silencing of talin1 did not affect the expression of talin2 (Figure 18). While both talin1 and talin2 are expressed in PC3-
MM2 cells, talin1 is far more abundant as total talin detected by the pan-talin antibody,
8D4, was significantly reduced in talin1-silenced cells (Figure 18). In addition, talin1- silenced cells possessed a rounded morphology and impaired spreading (Figure 19), a phenotype not observed in talin2-silenced cells (Figure 19, 20). Next, the levels of total and activated β1 integrins in talin1 and talin2-silenced PC3-MM2 cells were determined.
Flow cytometric analysis demonstrated that silencing of talin1 (Figure 21), but not talin2
(Figure 22), reduced β1 integrin activation, without affecting expression of total β1 integrins. These results demonstrate that talin1, but not talin2, was primarily responsible for β1 integrin activation in prostate cancer cells.
- 65 -
Figure 18. Immunoblotting of talin1, talin2 and pan-talin in talin1-silenced cells. Silencing of talin1 in PC3-MM2 cells by shRNA expression using two sequences as described in Materials and Methods. A non-targeting shRNA sequence in the same vector was used as an sh-control.
- 66 -
Figure 19. Effects of talin1 and talin2 silencing on cell spreading. Morphology of talin1- and talin2-silenced PC3-MM2 cells were observed using a light microscope. Scale bar represents 100 µm.
- 67 -
Figure 20. Immunoblotting of talin2 and talin1 in talin2-silenced cells. Silencing of talin2 in PC3-MM2 cells by shRNA expression using two sequences as described in Materials and Methods.
- 68 -
Figure 21. Flow cytometric analysis of activated β1 integrins and total β1 integrins in talin1-silenced PC3-MM2 cells. FACS analysis using conformation-sensitive antibodies for activated β1 integrins and for total β1 integrins (top panels). Relative expression of activated and total β1 integrins quantitated by fluorescence intensity is shown in the bottom panels. *sh-Talin1 compared to sh-control, P < 0.005.
- 69 -
Figure 22. Flow cytometric analysis of total β1 integrins and activated β1 integrins in talin2-silenced PC3-MM2 cells. FACS analysis using conformation-sensitive antibodies for activated β1 integrins and for total β1 integrins (top panels). Relative expression of activated and total β1 integrins quantitated by fluorescence intensity is shown in the bottom panels.
- 70 -
Talin1 S425 phosphorylation correlates with activated β1 integrins in PC3-MM2 cells
Talin1 has been shown to increase metastatic properties associated with β1 integrin functions in prostate cancer cells [114]. Therefore, I determined whether talin1 expression correlates with β1 integrin activation. I collaborated with the laboratory of Dr.
Sue-Hwa Lin to examine talin1 expression in low metastatic LNCaP, C4-2B4, metastatic
PC3 and PC3-MM2 cells. The level of talin1 expression was similar in each cell line
(Figure 23). These results suggest that increased talin1 expression alone is insufficient to activate β1 integrins. Since talin phosphorylation on S425 is also associated with some integrin functions such as migration [143], we next examined talin1 and talin2 phosphorylation on S425 by immunoblotting. Talin (comprising talin1 and talin2) was highly phosphorylated on S425 in metastatic PC3 and PC3-MM2 cells compared to low metastatic LNCaP and C4-2B4 cells (Figure 23). To examine talin1 phosphorylation specifically, cell lysates were immunoprecipitated with a talin1-specific antibody, followed by immunoblotting with an antibody recognizes talin S425 phosphorylation.
Talin1 was highly phosphorylated in PC3 and PC3-MM2 cells (Figure 24), consistent with immunoblotting observed from whole cell lysates (Figure 23). These results demonstrate that levels of talin1 S425 phosphorylation correlate with activated β1 integrins in PC3-MM2 cells.
- 71 -
A B
Figure 23. Talin1 expression and talin S425 phosphorylation in prostate cancer cells. (A) Immunoblotting of total talin1 and talin S425 phosphorylation using whole cell lysates from prostate cancer cells. (B) Quantitation of band intensity from immunoblotting.
- 72 -
A B
Figure 24. Phosphorylation of talin1 on S425 in prostate cancer cells. (A) Immunoprecipitation of talin1 followed by immunoblotting of talin S425 phosphorylation in indicated prostate cancer cells. (B) Quantitation of band intensity from immunoblotting.
- 73 -
Talin1 S425 phosphorylation promotes β1 integrin activation
To determine if talin1 S425 phosphorylation were required for β1 integrin
activation, I silenced endogenous talin1 and stably expressed either talin1 wild-type
(GFP-talin1 WT ), a non-phosphorylatable mutant (GFP-talin1 S425A ), or a phosphorylation-
mimicking mutant (GFP-talin1 S425D ) in PC3-MM2 and C4-2B4 cells as described in
Materials and Methods. Levels of expression of each form of talin1 were similar (Figure
25). Flow cytometric analysis demonstrated that talin1 WT expressed in talin1-silenced
PC3-MM2 cells restored β1 integrin activation (Figure 26). In contrast, expression of
talin1 S425A inhibited β1 integrin activation by 60%, whereas talin1 S425D promoted β1
integrin activation by 76% relative to talin1 WT . Similar results were observed when
talin1 WT and mutants were expressed in C4-2B4 cells in which endogenous talin1 was
silenced (Figure 27). I further assessed the effects of talin1 phosphorylation on β1
integrin activation by immunofluorescence staining. In agreement with the flow
cytometric analysis, fewer activated β1 integrins were expressed in talin1 S425A cells relative to talin1 WT cells, while talin1 S425D cells showed increased clustering of active β1
integrins (Figure 28). Next, I examined whether talin1 phosphorylation affects
downstream integrin signaling. The PC3-MM2 talin1 S425A cells were decreased in
expression of pFAK Y397, pp130 Cas Y165 and pAkt S473 but not total FAK, p130 Cas
or Akt (Figure 29), consistent with decreased signaling through activated β1 integrins.
Similarly, in talin1-silenced cells, pFAK Y397, pp130 Cas Y165 and pAkt S473 were
decreased with no decrease in expression of these proteins; whereas in cells re-transfected
with talin1 WT , activation of these downstream intermediates was restored. Together, these
results demonstrate that talin1 S425 phosphorylation promotes β1 integrin activation and
downstream signaling in metastatic prostate cancer cells.
- 74 -
A B
Figure 25. Expression of talin1 mutants in prostate cancer cells. (A) Expression of GFP (empty vector), GFP-talin1 WT and specified GFP-tagged talin1 mutants in talin1- silenced PC3-MM2 and (B) in talin1-silenced C4-2B4 cells.
- 75 -
Figure 26. Flow cytometric analysis of activated and total β1 integrins of PC3-MM2 talin1 mutants . PC3-MM2 cells expressing talin1 WT and mutants were subjected to flow cytometric analysis using antibodies for activated β1 integrins (9EG7) and total β1 integrins (MAR4; top panels). Quantitation of fluorescence intensity is shown in the bottom panels. The sh-talin1 knockdown cells were served as a negative control. * P < 0.005.
- 76 -
Figure 27. Flow cytometric analysis of activated and total β1 integrins of C4-2B4 talin1 mutants . C4-2B4 cells expressing talin1 WT and mutants were subjected to flow cytometric analysis using antibodies for activated β1 integrins (9EG7) and total β1 integrins (MAR4; top panels). Quantitation of fluorescence intensity is shown in the bottom panels. The sh-talin1 knockdown cells served as a negative control. * P < 0.005.
- 77 -
Figure 28. Immunofluorescence staining of GFP and activated β1 integrins. Immunofluorescence staining of GFP and activated β1 integrins (using mAb 12G10) in PC3-MM2 cells expressing talin1 WT and mutants. Nuclei were counterstained by Hoechst 33342. Scale bar represents 25 µm.
- 78 -
Figure 29. Effect of talin1 phosphorylation on activation of downstream β1 integrin signaling. Immunoblotting of pFAK Y397, total FAK, pp130 Cas Y165, total p130 Cas, pAkt S473 and total Akt in PC3-MM2 cells expressing talin1 WT and talin1 mutants. The sh-talin1 knockdown cells served as a negative control.
- 79 -
Chapter 5 Effects of talin1 phosphorylation in prostate cancer cells
- 80 -
This chapter is based in partly upon “ Jin JK , Tien PC, Cheng CJ, Song JH, Huang C,
Lin SH, Gallick GE (2014) Talin1 phosphorylation activates β1 integrins: a novel mechanism to promote prostate cancer bone metastasis. Oncogene (in press)” with permission.
Effects of talin1 S425 phosphorylation on β1 integrin-mediated proliferation and
anoikis resistance
To determine the effect of talin1 S425 phosphorylation on biologic properties of
prostate cancer cells, I used the PC3-MM2 and C4-2B4 cells described above expressing
talin1 WT and mutants. Expression of talin1 WT , integrin-activating and -inhibiting talin1
mutant proteins had no affect on proliferation rates of PC3-MM2 cells or C4-2B4 cells
(Figure 30). However, when cultured in anoikis conditions, 30% of the non-
phosphorylatable talin1 S425A -expressing cells died after 24 hr and 40% after 48 hr (Figure
31). In contrast, no cell death was observed in both talin1 WT and talin1 S425D cells after 24 hr. After 48 h, 35% talin1 WT cells died, similar to talin1 S425A , but only 16% talin1 S425D
died (Figure 31). To determine if effects on viability were due to changes in apoptosis,
propidium iodide staining was performed. A two-fold increase in the sub-G0/G1
population was observed in talin1 S425A cells compared to talin1 WT cells after 24 hr (Figure
32). After 48 hr, the sub-G0/G1 population in talin1 WT cells and talin1 S425A cells was similar, while talin1 S425D cells were still resistant to anoikis (Figure 32). As a second measure of apoptosis, PARP cleavage was examined. PARP cleavage occurred in talin1 S425A cells by 24 hr, but no PARP cleavage was observed in talin1 S425D cells even after 48 hr (Figure 33). Thus, increased anoikis resistance correlated with talin1 S425 phosphorylation in prostate cancer cells.
- 81 -
A B
Figure 30. Effects of talin1 S425 phosphorylation on cell proliferation. (A) PC3- MM2 and (B) C4-2B4 cells expressing talin1 WT and mutants were plated (5 × 10 4 cells) and cultured for indicated times, and then the trypan blue negative cells were enumerated.
- 82 -
Figure 31. Cell viability of PC3-MM2 cells expressing talin1 mutants in anoikis conditions. PC3-MM2 talin1 WT and mutant-expressing cells were cultured in anoikis conditions as described in Materials and Methods. Surviving cells were counted at indicated times. *Talin1 WT compared to talin1 S425D , P < 0.05.
- 83 -
Figure 32. Flow cytometric analysis of propidium iodide-labeled cells in sub-G0/G1. PC3-MM2 talin1 WT and mutant-expressing cells maintained in anoikis conditions were harvested at indicated times and stained with propidium iodide, then were subjected to FACS analysis. The percentage of cells in sub-G0/G1 is plotted. * P < 0.005.
- 84 -
Figure 33. Immunoblotting of total and cleaved PARP of talin1 mutants in anoikis conditions. Immunoblotting of total and cleaved PARP using lysates of PC3-MM2 talin1 WT and mutant-expressing cells maintained in anoikis conditions for indicated times.
- 85 -
Effects of talin1 S425 phosphorylation on β1 integrin-mediated adhesion and
motility
Next, I determined whether talin1 S425 phosphorylation promoted attachment of
metastatic prostate cancer cells to ECM. For these analyses, talin1 WT and mutant-
expressing cells were subjected to adhesion to fibronectin and collagen I-coated culture
plates. Binding of PC3-MM2 cells expressing talin1 S425A to fibronectin was decreased by
74% and to collagen I by 81% relative to talin1 WT cells (Figure 34). Binding of PC3-
MM2 cells expressing talin1 S425D to fibronectin was increased by 66% and to collagen I
by 53% relative to talin1 WT cells (Figure 34). Very similar results were observed in
adhesion assays when these mutants were expressed in C4-2B4 cells (Figure 35). Next, I
determined whether talin1 phosphorylation promotes motility of prostate cancer cells on
ECM. Migration assays were performed using collagen I-coated modified Boyden
chambers, as described in Materials and methods. The ability of PC3-MM2 cells
expressing talin1 S425A to migrate on collagen I was reduced 52% (62% in C4-2B4 cells
expressing talin1 S425A ) as compared to talin1 WT cells, whereas the migratory ability of
talin1 S425D -expressing PC3-MM2 cells was increased by 30% (55% in C4-2B4 cells
expressing talin1 S425D ) relative to respective wild-type transfected cells (Figure 36), again
correlating with the level of β1 integrin activation. Similar results were observed in
invasion assays, in which cells invaded through Matrigel-coated modified Boyden
chambers. The invasive ability of PC3-MM2 cells expressing talin1 S425A was reduced
95% (90% in C4-2B4 cells expressing talin1 S425A ) as compared to talin1 WT cells, whereas
the invasive ability of talin1 S425D -expressing PC3-MM2 cells was increased by 40% (43%
in C4-2B4 cells expressing talin1 S425D ) relative to respective wild-type transfected cells
- 86 -
(Figure 37), demonstrating that talin1 S425 phosphorylation promotes cell migratory and invasive abilities.
- 87 -
PC3 -MM2
Figure 34. Talin1 S425 phosphorylation promotes cell adhesion in PC3-MM2 cells. Adhesion of PC3-MM2 talin1 WT and mutant-expressing cells on fibronectin and collagen I-coated plates. Adhesion to BSA served as a negative control. *Talin1 WT compared to talin1 S425A , P < 0.005. **Talin1 WT compared to talin1 S425D , P < 0.0005.
- 88 -
Figure 35. Talin1 S425 phosphorylation promotes cell adhesion in C4-2B4 cells. Adhesion of C4-2B4 talin1 WT and mutant-expressing cells on fibronectin and collagen I- coated plates. Adhesion to BSA served as a negative control. * P < 0.0005.
- 89 -
A B
Figure 36. Effect of talin1 S425 phosphorylation on cell migration. (A) PC3-MM2 and (B) C4-2B4 talin1 WT and mutant-expressing cells were cultured on collagen I-coated membranes in modified Boyden chambers. Cells were allowed to migrate through the membranes for 8 h. *P < 0.0001
- 90 -
A B
Figure 37. Effect of talin1 S425 phosphorylation on cell invasion. (A) PC3-MM2 and (B) C4-2B4 talin1 WT and mutant-expressing cells were allowed to invade through Matrigel in modified Boyden chambers for 24 h. * P < 0.0001.
- 91 -
Chapter 6
Cdk5 regulates talin1 S425 phosphorylation
- 92 -
This chapter is based in partly upon “ Jin JK , Tien PC, Cheng CJ, Song JH, Huang C,
Lin SH, Gallick GE (2014) Talin1 phosphorylation activates β1 integrins: a novel mechanism to promote prostate cancer bone metastasis. Oncogene (in press)” with permission.
Talin S425 phosphorylation is mediated by Cdk5 which is activated by p35
Previous works in neuronal cells demonstrated that talin phosphorylation on S425 is catalyzed by Cdk5 [143]. To determine the mechanism by which talin1 S425 phosphorylation is increased in metastatic prostate cancer cells, first I examined whether
Cdk5 expression or activity correlated with talin1 phosphorylation in prostate cancer cells.
For these studies, both Cdk5 and p35 expression were determined. Expression of Cdk5 by immunoblotting was similar in LNCaP, C4-2B4, PC3 and PC-3MM2 cells (Figure 38).
However, levels of p35 expression were increased in PC3 and PC3-MM2 cells compared to LNCaP and C4-2B4 cells (Figure 38). As p35 is known to activate the enzymatic activity of Cdk5, Cdk5 activity was assessed by ADP production through ADP-Glo
Kinase Assay kit as described in Materials and Methods. Cdk5 activity was increased in
PC3 (2-fold relative to LNCaP) and PC3-MM2 (2.5-fold relative to LNCaP; Figure 39), which correlated with the increased talin1 phosphorylation and β1 integrin activation in these cells. To determine whether Cdk5 was responsible for talin1 S425 phosphorylation in prostate cancer cells, Cdk5 was inhibited in PC3-MM2 cells. Inhibition of Cdk5 by the non-specific Cdk inhibitor, roscovitine, reduced talin1 phosphorylation in PC3-MM2 cells in a time-dependent manner (Figure 40), suggesting that Cdk5 might be responsible for talin1 phosphorylation. To examine directly whether Cdk5-mediated talin1 phosphorylation, Cdk5 was silenced in PC3-MM2 and C4-2B4 cells. The results
- 93 -
Figure 38. Expressions of Cdk5 and p35 in prostate cancer cells. Immunoblotting of Cdk5 and p35 using cell lysates from different prostate cancer cell lines.
- 94 -
Figure 39. Cdk5 kinase activity in prostate cancer cells. Cdk5 kinase activity in prostate cancer cells was measured by ADP production as described in Materials and Methods. The sh-Cdk5 knockdown cells were used as a negative control. *PC3 compared to LNCaP cells, P < 0.0005. **PC3-MM2 compared to LNCaP cells, P < 0.0001.
- 95 -
Figure 40. Talin1 phosphorylation was inhibited by roscovitine. The Cdk inhibitor Roscoitine (20 µM) was added to PC3-MM2 cells. Cells were incubated and lysed at indicated times and immunoblotted for talin1 S425 phosphorylation and total talin1.
- 96 -
demonstrated talin1 phosphorylation was decreased by ~90% (Figure 41). To examine
whether Cdk5 kinase activity was required for talin1 phosphorylation and not functioning
as an adaptor protein, prostate cancer cells were transiently transfected with a plasmid
directing the expression of a dominant-negative Cdk5 [143]. Expression of this dominant-
negative mutant inhibited talin1 phosphorylation in both PC3-MM2 and C4-2B4 cells
(Figure 42). These results demonstrated that Cdk5 activity, but not expression, promotes
talin1 S425 phosphorylation in prostate cancer cells. Next I determined whether Cdk5
regulates β1 integrin activation. Silencing Cdk5 resulted in reduced β1 integrin activation in PC3-MM2 cells (Figure 43), suggesting that Cdk5 is required for β1 integrin activation.
Next, to demonstrate that talin1 phosphorylation was mediated in Cdk5-induced β1 integrin activation, I silenced Cdk5 in PC3-MM2 cells in which talin1 was silenced and talin1 WT or talin1 S425D mutants were re-expressed (Figure 44A). As expected, silencing
Cdk5 inhibited β1 integrin activation in talin1 WT cells, but did not affect β1 integrin activation in phospho-mimicking talin1 S425D cells (Figure 44B). These observations demonstrate that Cdk5 phosphorylates talin1 on S425, and its activity promotes β1
integrin activation.
- 97 -
Figure 41. Immunoblotting of Cdk5, ptalin S425 and total talin1 in Cdk5 knockdown cells. Silencing of Cdk5 in PC3-MM2 or C4-2B4 cells by shRNA expression was described in Materials and Methods. Cells were infected with lentivirus and lysed after 48 hr.
- 98 -
Figure 42. Immunoblotting of ptalin S425, talin1 and Myc-tag in cells expressing dominant-negative Cdk5. Prostate cancer cells were transfected with Myc-Cdk5 wild- type and dominant-negative fusion construct as described in Materials and Methods, and talin1 phosphorylation was evaluated by immunoblotting.
- 99 -
Figure 43. Flow cytometric analysis of Cdk5 knockdown cells. FACS analysis of activated (9EG7) and total β1 integrins (MAR4) in Cdk5-silenced PC3-MM2 cells (top panels). Quantitation of fluorescence intensity is shown in the bottom panels. *sh-Cdk5 compared to sh-control, P < 0.0005.
- 100 -
A
B
Figure 44. Talin1 phosphorylation was mediated in Cdk5-induced β1 integrin activation. (A) Immunoblotting of Cdk5. PC3-MM2 talin1 WT and mutant-expressing cells were transducted with a sh-control vector or a sh-Cdk5 vector to silence Cdk5 expression. (B) Activated (9EG7) and total β1 integrins (MAR4) were measured by FACS analysis. * P < 0.005.
- 101 -
Chapter 7 Talin1 phosphorylation promotes prostate cancer bone metastasis in vivo
- 102 -
This chapter is based in partly upon “ Jin JK , Tien PC, Cheng CJ, Song JH, Huang C,
Lin SH, Gallick GE (2014) Talin1 phosphorylation activates β1 integrins: a novel mechanism to promote prostate cancer bone metastasis. Oncogene (in press)” with permission.
Talin1 S425 phosphorylation is required for prostate cancer bone metastasis
To determine whether talin S425 phosphorylation promoted metastasis in vivo , I
used two nude mouse models, one of which examined experimental metastasis, and the
other, spontaneous metastasis. For these experiments, the sh-control, talin1-silenced,
talin1 wild-type and mutated talin1-expressing PC3-MM2 cells were transduced with a
vector directing luciferase expression. To determine bone metastasis of disseminated
prostate cancer cells, intracardiac injections were performed (experimental metastasis).
Following intracardiac injection of cells, bioluminescence imaging of mice was
performed weekly. The presence of tumor in bone was examined by co-localization of X-
ray and bioluminescence imaging. A representative image of mice inoculated with cells
expressing each construct is shown in Figure 45. No tumor growth observed in any
animal in the bone of talin1-silenced and talin1 S425A groups. In contrast, 3 of 4 talin1 WT mice and 4 of 5 talin1 S425D mice demonstrated tumor growth. Tumors were noted in both legs of mice as expected in this model as well as in the heads of mice as previously observed [112, 173] (Figure 46). Thus, blocking talin1 S425 phosphorylation completely inhibited bone metastasis of disseminated PC3-MM2 cells in this model. For tumors that grew, tumor size was estimated by bioluminescence imaging 7, 14 and 21 days post- intracardiac injection. Exponential growth was observed in sh-control, talin1 WT and
talin1 S425D groups, with no difference in talin1 WT and talin1 S425D observed (Figure 47).
- 103 -
Figure 45. Talin1 S425 phosphorylation promotes bone metastasis in vivo . Luciferase-labeled PC3-MM2 sh-control, talin1-silenced, talin1 WT and mutant-expressing cells (1 × 10 6) were injected into nude mice intracardially. After 21 days injection, bioluminescence and X-ray imaging of mice were performed. Images are superimposed to localize tumor growth. Arrows indicate tumor growth in femur/tibia junction. *Talin1 WT compared with sh-talin1 or talin WT , P < 0.05.
- 104 -
Figure 46. Bioluminescence imaging of luciferase-labeled talin1 mutants in mice after intracardiac injection. Luciferase-labeled PC3-MM2 sh-control, talin1-silenced, talin1 WT and mutant-expressing cells (1 × 10 6) were injected into nude mice intracardially. Shown in the figure is bioluminescence imaging of mice 21 days post-injection.
- 105 -
Figure 47. Tumor burden in the femur/tibia of mice following intracardiac injection. Tumor growth in the femur/tibia was estimated by luciferase activity of cells (presented as photons/sec).
- 106 -
Next, I examined whether talin1 phosphorylation affects lymph node metastasis
(spontaneous metastasis) of prostate cancer cells injected orthotopically into prostate.
Mice were sacrificed when primary tumors reached similar sizes (Figure 48), and lymph node metastases were detected and counted by bioluminescence imaging (Figure 49).
Lymph node metastases developed in all groups (PC3-MM2 cells expressing talin1 WT , talin1 S425A and talin1 S425D mutants; Figure 49); however, as shown in Table 1, significantly fewer lymph node metastases were observed in talin1 S425A mice compared to talin1 WT mice. Together, our results are consistent with talin1 S425 phosphorylation promoting metastasis.
- 107 -
Figure 48. Representative primary tumors when mice were sacrificed and examined for lymph node metastases. Luciferase-labeled PC3-MM2 talin1 WT and mutant- expressing cells (5 × 10 5) were orthotopically injected into the prostate. Mice were sacrificed when primary tumors reached similar sizes.
- 108 -
Figure 49. Representative bioluminescence imaging of lymph node metastases. Luciferase-labeled PC3-MM2 talin1 WT and mutant-expressing cells (5 × 10 5) were orthotopically injected into the prostate. Bioluminescence imaging of lymph node metastases of PC3-MM2 talin1 WT and mutant-expressing cells in mice after removing the primary tumor.
- 109 -
Table 1. Effects of talin1 S425 phosphorylation on development of lymph node metastases of talin1-expressing PC3-MM2 cells injected intraprostatically LN metastases Average # of LN Tumor incidence Tumor cells incidence metastases (range) Talin1 WT 6/6 6/6 3 (2-4) Talin1 S425A 5/5 5/5 1.8 (1-2)* Talin1 S425D 5/5 5/5 2.8 (2-3) *ANOVA and Tukey’s test, talin1 S425A compared to talin1 WT , P < 0.01 Abbreviation: LN, lymph node.
- 110 -
Chapter 8 Talin1 phosphorylation in human prostate cancer
- 111 -
This chapter is based in partly upon “ Jin JK , Tien PC, Cheng CJ, Song JH,
Huang C, Lin SH, Gallick GE (2014) Talin1 phosphorylation activates β1 integrins: a novel mechanism to promote prostate cancer bone metastasis. Oncogene (in press)” with permission.
Talin S425 phosphorylation in human prostate cancer specimens
To determine clinical relevance of talin S425 phosphorylation in prostate cancer, I collaborated with Dr. Sue-Hwa Lin and Dr. Chien-Jui Cheng to perform immunohistochemical analysis on formalin-fixed human prostate tumor specimens. We examined talin S425 phosphorylation in human primary tumors, lymph node metastases and bone metastases. The talin S425 phospho-specific antibody used in the immunohistochemical analysis was validated using a blocking peptide (Figure 50).
Representative images of normal glands, primary tumors, lymph node metastases and bone metastases are shown in Figure 51. Talin phosphorylation was not detected in normal or atrophied glands (Figure 51A), while 8 of 20 (40%) of primary tumors and 6 of
13 (46%) lymph node metastases stained positive (Figure 51B). Phospho-talin S425 was observed in 16 of 20 (80%) bone metastases, a significant increased compared to either primary prostate tumors ( P = 0.009), or to lymph node metastases ( P = 0.043; Figure
51B). There was no correlation between talin phosphorylation and Gleason score. These data demonstrate increased talin S425 phosphorylation is associated with prostate cancer bone metastasis.
- 112 -
Figure 50. Validation of specificity of ptalin S425 antibody. PC3-MM2 cells were pelleted to fixed in 10% formalin as described in Materials and Methods. Sections of cell blocks were incubated with ptalin S425 antibody alone or simultaneously with corresponding blocking peptide.
- 113 -
A
B
Figure 51. Talin S425 phosphorylation in stages of human prostate cancer. ( A) Immunohistochemical staining of talin S425 phosphorylation in primary tumor, lymph node metastases and bone metastases. Arrows indicate negative staining in atrophied glands, and an arrow head indicates negative staining normal glands within the primary tumor. Scale bar represents 100 µm. ( B) Percentage of human specimens expressing talin S425 phosphorylation. *Primary tumor compared to bone metastases, P < 0.005. **Lymph node metastases compared to bone metastases, P < 0.05.
- 114 -
Chapter 9 Discussion
- 115 -
Cancer metastasis is a complex process involving genetic and epigenetic
alterations of cancer cells. While many oncogenes and tumor suppressor genes are
associated with cancer metastasis, epigenetic alterations, such as constitutive activation of
receptors on the plasma membrane, often deregulate signaling cascades that increase
metastatic potential of cancer cells. Integrins are cell surface receptors for various
extracellular matrix (ECM) proteins and can be activated through inside-out signaling
[174]. When aberrantly activated in cancer cells, integrin signaling promotes multiple
steps in the metastatic cascade, including increasing migration, invasion, adhesion and
survival. In prostate cancer, activation of several integrins, including α5β1, α2β1 and
αvβ3 integrins have functional consequences for prostate cancer metastasis [79, 80, 108,
111, 175-177]. By using a neutralizing anti-β1 integrin antibody (mAb 33B6), Dr. Sue-
Hwa Lin’s group demonstrated that inhibiting β1 integrins decreases cell adhesion, migration, cell survival and downstream integrin signaling in vitro [112]. Furthermore, treatment of the anti-β1 integrin antibody, mAb 33B6, suppressed spontaneous metastasis of PC3-MM2 cells from the prostate to lymph nodes in SCID mice. Further, in a mouse model of experimental metastasis, delivery of mAb 33B6 suppressed bone metastasis of
PC3-MM2 cells following intracardiac injection [112]. These data suggest that β1 integrin activation is critical for prostate cancer metastasis.
As described in the introduction, integrin activation occurs through an inside-out mechanism or an outside-in mechanism [91, 178]. As inside-out activation rapidly increases integrin affinity for ECM ligands, which in turn facilitates outside-in activation; thus, the two mechanisms of integrin activation are not mutually exclusive [91]. However,
- 116 -
the precise mechanism by which intracellular signaling induces inside-out integrin
activation is still unknown. Although several intracellular proteins such as talin, kindlin
and integrin-linked-kinase (ILK) are known to facilitate integrin activation, only talin can
directly bind β integrins and induce activation [179]. Cellular talin in quiescent cells exists in a closed conformation that requires several molecular steps before assuming an open, integrin binding conformation. However, the regulatory mechanism for talin activation is unknown, and may occur through several different mechanisms including binding PIP2 [135, 136], and calpain cleavage [137]. A potential mechanism not previously studied is talin phosphorylation. Talin is heavily phosphorylated on 30 residues (serine, threonine and tyrosine). One potential important site of phosphorylation to prostate cancer is S425 [139, 143]. Talin S425 is phosphorylated by Cdk5 whose activity is controlled by the activator protein p35. Both Cdk5 and p35 are highly expressed in prostate cancer and associated with metastasis [155, 156]. The talin1 linker domain containing S425 binds the central portion of the rod domain [121], which masks the integrin-binding domain. Thus, phosphorylation of talin1 on S425 is predicted to promote an “open” conformation, thereby exposing the integrin-binding domain [138,
139]. However, the role of talin1 S425 phosphorylation in integrin activation was not determined prior to studies present in this dissertation.
Therefore, I proposed a hypothesis that talin1 S425 phosphorylation promotes β1
integrin activation. Because β1 integrins are receptors for collagens, the major component
of bone, I focused on β1 integrin activation and its effect on bone metastasis. Furthermore,
I also proposed that talin is phosphorylated by Cdk5 whose activity is increased due to
- 117 -
overexpression of p35 in metastatic prostate cancer cells. Next, I predicted that the
increased β1 integrin activation through talin phosphorylation can promote anoikis resistance, adhesion and motility of cancer cells. Using various functional assays, I tested these effects of talin phosphorylation in vitro . Collectively, gaining of these metastatic
properties through talin phosphorylation may increase metastatic potential of cancer cells.
To test this possibility, I examined metastasis of talin mutants in experimental and
spontaneous metastasis models in vivo . Finally, I determined the clinical relevance of ptalin S425 by immunohistochemistry in human prostate cancer samples.
Activation of integrins in prostate cancer metastasis
In Chapter 3, I addressed the question whether β1 integrin activation is increased through inside-out activation in metastatic prostate cancer cells. This question was based on the hypothesis that β1 integrins are activated in the metastatic prostate cancer cells, but not in low metastatic cells. To test this hypothesis, the levels of β1 integrin activation were examined in low metastatic (LNCaP, C4-2B4) and high metastatic (PC3, PC3-MM2) prostate cancer cells. The results from works in Dr. Sue-Hwa Lin’s labortary to which I contributed, demonstrated that the constitutive activation of β1 integrins correlates with metastatic potential of established prostate cancer cell lines [112].
Next, to determine whether β1 integrins were activated through inside-out signaling in metastatic prostate cancer cells, cells were cultured in suspension without
ECM ligands to prevent integrin activation by ligand binding or cell aggregation. In this condition, normal cells will undergo anoikis leading to cell death, but metastatic cancer
- 118 -
cells often develop resistance to anoikis by increasing integrin signaling [66]. Indeed, as
shown in Chapter 3, β1 integrin activation correlated with anoikis resistance in prostate cancer cells (Figure 12, 13 and 14). Furthermore, knockdown of β1 integrins in PC3-
MM2 cells increased sensitivity of cells to anoikis, which suggests that inside-out activation of β1 integrins induces signaling that increases anoikis resistance in metastatic
prostate cancer cells. Therefore, I demonstrated in Chapter 3 demonstrated that β1
integrins are constitutively activated through inside-out activation in metastatic prostate
cancer cells.
As described in the introduction, β1 integrins have been shown to promote cell
properties critical to metastasis. My studies in Chapter 3 provide a molecular mechanism
suggesting that β1 integrins are constitutively activated through inside-out signaling.
Activation of β1 integrins in prostate cancer was also supported by immunohistochemical
staining of downstream effector, FAK. Studies from Dr. Sue-Hwa Lin’s laboratory
showed that FAK Y397 phosphorylation is increased in primary tumor and lymph node
metastases compared to normal human tissues [112]. Because phosphorylation of FAK
Y397 directly results from integrin activation, the results indicate that β1 integrin
activation occurs during prostate cancer progression. However immunohistochemical
staining of activated β1 integrins cannot be assessed in formalin-fixed clinical specimens
as antibodies that recognize activated β1 integrins in these specimens do not exist. In fact,
there are only several integrin antibodies that can specifically recognize activated
conformation of β1 integrins in cells, such as mAb 9EG7 and 12G10. There are no
commercial available antibodies for other activated integrin subunits, such as for β3.
- 119 -
Accordingly, the activation of other integrins associated with prostate cancer progression
can only be assessed through activation of downstream signaling. Therefore, whether
other β integrins are also activated in prostate cancer cells remains unknown.
Currently, whether β integrins have overlapping functions or distinct functions in promoting prostate cancer metastasis is unclear. As I demonstrated the effects of β1 integrin activation in this dissertation, β3 integrins have also been shown to increase adhesion, migration and invasion in prostate cancer cells [180]. In fact, for β integrins other than β1, many effects of β3 integrins, such as the ability to increase migration, appear to be overlap with β1 integrins. Thus, the functions of β3 integrin in promoting metastatic potential of cells may be similar to β1 integrins during prostate cancer metastasis. Despite integrins’ functions may be similar in metastasis, integrins may be activated in different compartments of tumor microenvironments.
In this dissertation, I only focused on the β1 subunit of integrins in prostate cancer metastasis. Nevertheless, the α subunits of integrins are also involved in prostate cancer metastasis. Prostate cancer cells with high expression of α6 integrins are more invasive in
a mouse model system [181]. For αv subunit, overexpression of αv integrins increases
cell adhesion and invasion in prostate cancer cells [177, 182]. In this dissertation, β1
integrins were activated to increase migration of cancer cells on collagen and promote
bone metastasis, but which α subunits pairing with activated β1 integrins is unknown.
Integrin α subunit functions to determine the binding specificity to ECM proteins. β1
integrins dimerizing with several α subunits, including α1, α2, α10 and α11, are able to
- 120 - bind collagen (Figure 3). Among those α integrins, only the α2 subunit is overexpressed in prostate cancer and was shown to increase tumor growth in bone [79]. Therefore, α2β1 integrins could be one of the candidates to bind phosphorylated talin and become activated in this study.
Talin1 phosphorylation regulates β1 integrin activation
The inside-out activation of β1 integrins has received less attention in cancer research, as most studies focus on ECM-induced integrin signaling. The studies in
Chapter 3 demonstrate that inside-out activation of β1 integrins promotes anoikis resistance, but the mechanism was unknown. Therefore, I determined the mechanism of inside-out activation of β1 integrins in metastatic prostate cancer cells. Previous studies demonstrate that β integrins are activated by talin binding [183]. In vertebrates, talin has two genes, Tln1 and Tln2 , that share 74% amino acid sequence similarity [184]. However, which talin is critical to activate β1 integrins in metastatic prostate cancer was not known.
In Chapter 4, I demonstrated that talin1 is abundantly expressed in PC3-MM2 cells compared to talin2 (Figure 18). Knockdown of talin1 reduced β1 integrin activation and inhibited cell spreading, but this phenomenon was not observed in talin2 knockdown cells (Figure 19, 21 and 22). In adult mice, talin1 deficiency causes abnormal embryonic development and is embryonically lethal [185]. In contrast, talin2 knockout mice are viable and fertile [185]. Studies using specific antibodies targeting to talin1 and talin2 reveal different subcellular localization. Only talin1 is localized in the podosomes of adhesion structure, suggesting that talin1 has a direct function in cell-ECM interactions
[184]. A study also showed that overexpression of talin1 increases integrin signaling in
- 121 - prostate cancer cells [114]. Therefore, the results in Chapter 4 are consistent with other studies, suggesting that talin1 is critical for β1 integrin activation and cannot be compensated by talin2 in metastatic prostate cancer cells.
However, when I examined the expression of talin1 in prostate cancer cells, the immunoblotting of talin1 confirmed the result from Dr. Sue-Hwa Lin’s laboratory and indicated that the levels of talin1 in prostate cancer cell lines did not change or correlate with metastatic potential of these cells (Figure 23). This result was unexpected because talin1 was shown to be overexpressed in metastases compared to primary tumor tissues in prostate and other cancers [114-116]. While we cannot explain why talin1 expression did not increase in metastatic prostate cancer cells, studies from other laboratories also showed inconsistent results with respect to talin1 expression. In those studies, most metastatic cancer cell lines did not show higher expression of talin1 compared with low metastatic cancer cell lines, even though talin1 is overexpressed in human metastases specimens [114, 115].
The similar levels of talin1 expression in prostate cancer cell lines indicated that a mechanism other than talin protein level may be responsible for activating β1 integrins.
Because talin1 phosphorylation on S425 controls cell migration associated with β1 integrin signaling [143], I tested whether talin1 phosphorylation on S425 activates β1 integrins. For this reason, I examined the phosphorylated talin1 by immunoblotting and immunoprecipitation of talin1 in prostate cancer cell lines. I again confirmed the data from Dr. Sue-Hwa Lin’s laboratory and demonstrated that talin1 phosphorylation is
- 122 -
correlated with metastatic potential of these cells (Figure 23 and 24). In addition, talin1
phosphorylation also correlated with β1 integrin activation in prostate cancer cells, which
implies a possible role of talin phosphorylation in activating β1 integrin activation.
To directly test whether talin1 phosphorylation activate β1 integrins, I generated three plasmids encoding full-length human talin1 wild type, a non-phosphorylatable mutant, talin1 S425A , and a phosphorylation-mimicking mutant, talin1 S425D . To avoid effects from endogenous talin1, I transfected these plasmids into talin1-silenced PC3-
MM2 and C4-2B4 cells and selected stable transfected cells (Figure 25). By using these cells in flow cytometric analysis and immunofluorescence staining, I demonstrated that talin1 phosphorylation activates β1 integrins in two prostate cancer cell lines (Figure 26,
27 and 28). Furthermore, talin1 phosphorylation initiated β1 integrin signaling required to increase cell adhesion, migration, invasion and survival in anoikis in prostate cancer cells, but did not affect cell proliferation (Chapter 5). To my knowledge, this is the first evidence that demonstrates talin phosphorylation is important in activation of β1 integrins.
In a previous study, Ratnikov et. al. revealed 30 phosphorylation sites on talin using mass spectrometry [139]. Although the function of talin phosphorylation was unknown,
Ratnikov et. al. first proposed that talin phosphorylation may regulate integrin activation, because many residues in talin head where the integrin binding site located are heavily phosphorylated [139]. Later, the same group found that talin S425 phosphorylation functions to prevent ubiquitylation and degradation of the talin head [143]. Up to now, no other study has reported any function of talin phosphorylation on S425 or any other sites.
The reason may due to lack of phospho-specific antibody to other talin phosphorylation
- 123 - sites. Therefore, when new antibodies are generated, researchers may able to study the functions of other phosphorylation sites on talin.
β1 integrins contain several alternatively spliced variants as described in the introduction. While the β1A variant was shown to act as a stimulator of cell proliferation, the β1C variant acted as an inhibitor for integrin signaling. Previous studies have demonstrated that talin binds to only the β1A and β1D isoforms, but not to β1C integrins
[186]. Therefore, talin phosphorylation is likely to activate β1A or β1D integrins in prostate cancer cells, but this possibility remains to be determined in future studies.
In this dissertation, I used full-length human talin1, because studies have shown that only full-length talin is capable of forming focal adhesions and initiating proper adhesion-dependent signaling [187]. Talin can be cleaved by calpain to yield a 50-kDa N- terminal head domain and a 220-kDa C-terminal rod domain. In fact, most studies only used the talin head because it can directly bind to the β subunit and is sufficient to activate integrins. Previously, Huang et. al. showed that the talin head phosphorylation on
S425 prevents ubiquitylation and protein degradation of the talin head [143]. However, in my dissertation, non-phosphorylatable talin1 S425A mutant was not degraded as the full- length protein level was similar compared to that of talin1 wild type or talin1 S425D mutants (Figure 25). Perhaps, ubiquitylation of non-phosphorylated talin only occurs after cleavage of the talin head, which remains to be determined.
- 124 -
As described in the Introduction, talin has to attain an open conformation to bind
the cytoplasmic tails of β integrins [130, 188]. Based on previous structural analyses,
full-length talin1 exists in a compact, auto-inhibited conformation with its integrin-
binding domains masked [121]. Phosphorylation of talin has been proposed to relieve the
inhibitory conformation [138, 139]. In this dissertation, talin1 phosphorylation was
required to activate β integrins as shown in Chapter 4. Furthermore, in Chapter 5, talin1 phosphorylation induced β1 integrin signaling leading to changes of cell properties related to the functions of β1 integrins. Therefore, phosphorylated talin1 may present as an active and open conformation in order to activate integrins. However, whether phosphorylation induces a conformational change of talin was not studied in this discussion and is still unknown. Besides phosphorylation, several integrin-associated proteins, including kindlin and RIAM [189, 190] also have been implicated in promoting an open conformation of talin. Since talin also functions as an adaptor protein, phosphorylation of talin1 may recruit those integrin-associated proteins to facilitate integrin activation. Therefore, future studies of protein association with phosphorylated talin1 are warranted to provide an understanding of integrin activation, and whether these proteins or lipids binding to talin are required for its “open” conformation.
Talin1 phosphorylation by Cdk5/p35
Previous studies from Huang et. al. showed that talin1 is phosphorylated by Cdk5 in neural cells [143]. In fact, Cdk5 has been found to regulate cell adhesion and migration in non-neuronal cells [158, 159]. A study using Cdk inhibitor, roscovitine, was able to inhibit Cdk5 activity and β1 integrin activation in keratinocytes, which suggests that
- 125 -
Cdk5 activity is associated with β1 integrin activation [159]. However, whether talin1 is
phosphorylated by Cdk5 in metastatic prostate cancer cells was unknown. Therefore, in
Chapter 6, I hypothesized that Cdk5 activity is increased in metastatic prostate cancer
cells leading to talin1 phosphorylation. First, I demonstrated that expression of p35 is
increased in PC3 and PC3-MM2 cells and correlated with increased Cdk5 kinase activity
in prostate cancer cells (Figure 38 and 39). This result is in agreement with
immunohistochemical analyses of Cdk5 and p35 from other groups. Studies showed that
when compared with human normal tissues, Cdk5 and p35 are overexpressed in primary
prostate tumors compared with normal tissues [155]. Furthermore, Strock et. al.
demonstrated that overexpression of dominant-negative Cdk5 in rat prostate cancer cells
inhibits lung metastasis in subcutaneous xenograft mice [156], which suggests that Cdk5
activity is required to promote metastatic potential of prostate cancer cells. A recent study
demonstrated that Cdk5 and p35 are clustered with talin and β1 integrins into
lamellipodia during cell spreading [160]. In agreement with this result, I demonstrated
that Cdk5 activity is required for talin1 phosphorylation, and for β1 integrin activation
(Figure 40-43). Moreover, knockdown of Cdk5 in phosphorylation-mimicking talin1 S425D cells does not significantly decrease β1 integrin activation, compared to talin1 WT , which suggests that talin1 phosphorylation is mediated in Cdk5-induced β1 integrin activation
(Figure 44). Therefore, increased p35 expression promotes Cdk5 activity in metastatic prostate cancer cells, which further phosphorylates talin1 leading to β1 integrin activation.
Although the mechanism by which p35 is upregulated in metastatic prostate
cancer cells in this studies is unknown, defining this mechanism will provide further
- 126 - insights into how the p35/Cdk5/talin/integrin activation axis contributes to metastasis. In rat neuroblastoma cells, TGF-β signaling has been shown to increase Cdk5 kinase activity by upregulating p35 protein expression through induction of the transcription factor Egr-1 [191]. In prostate cancer, TGF-β serves as a tumor promoter [192], and that
Egr-1 is also overexpressed in aggressive prostate cancer cells [193]. TGF-β also enhances EMT, which increases the migratory capability of prostate cancer cells. One logical possibility for p35 overexpression in metastatic prostate cancer cells is through increased TGF-β and/or Egr-1 signaling. However, future studies are required to determine this potential mechanism of increased p35 expression.
Talin1-phosphorylation in bone metastasis
Studies in Chapter 7 assessed the effects of talin1 phosphorylation in prostate cancer metastasis in vivo . Using these PC3-MM2 talin1 mutants with the luciferase expressed, I tested whether talin1 phosphorylation is required for bone metastasis
(experimental metastasis model) and lymph node metastasis (spontaneous metastasis model). In the bone metastasis model, imaging analysis revealed no tumor growth in legs of mice injected with talin1 S425A cells (Figure 45-47). Although tumors also appeared in the mouse heads, this phenomenon is common in this model and seems not relate to bone metastasis [173]. These results suggest that talin1 phosphorylation is required for bone metastasis, possibly by increasing the interaction of β1 integrins on cells with bone stroma. During prostate cancer bone metastasis, integrin heterodimerization usage is altered to increase interaction with ECM in the bone matrix [194]. Several â1 integrin family proteins on prostate cancer cells have been shown to interact with both the bone
- 127 -
matrix and stromal cells. For example, expression of α5β1 integrins facilitates adhesion and spreading of PC3 cells on fibronectin [107]. Blocking α5β1 integrins by monoclonal antibodies inhibits adhesion of DU-145 prostate cancer cell to bone marrow stromal cells
[107, 110]. Another β1 integrin family protein, α2β1, has been shown to increase migration and adhesion of LNCaP cells on collagen I, and promotes bone metastasis in vivo [79, 80]. Similar to α5β1, α2β1 was found to mediate adhesion of malignant tumor- derived prostate epithelial cells to human bone marrow stroma, which can also be inhibited by antibodies targeting α2β1 [111]. These results suggest that interactions between tumor cells and bone matrix/stroma through β1 integrins are critical for tumor cell colonization in the bone. Since talin1 phosphorylation leads to constitutive activation of β1 integrins in metastatic prostate cancer cells, my work suggests that talin1 phosphorylation promotes bone metastasis through increasing β1 integrin activation on cancer cells thus leading to increased interaction with bone stroma.
To understand whether talin1 phosphorylation is specific to bone metastasis, I also examined roles of talin1 S425 phosphorylation in spontaneous lymph node metastasis following orthotopic implantation of talin1 mutant cells. In contrast to the effects of talin1 mutants on bone colonization, lymph node metastases were observed in mice injected with cells expressing wild-type and talin1 S425A that is unable to activate β1
integrins (Figure 48 and 49). Although the number of lymph node metastases in
talin1 S425A was decreased, incidence of lymph node metastasis was not changed (Table 1).
Our results were consistent with a recent study of Barthel et al. who found that β1
integrins were highly activated in prostate cancer cells derived from bone metastasis, but
- 128 - not in LNCaP variants selected form lymph node metastasis [175]. Therefore, these results imply that β1 integrins are less important to lymph node metastasis than to bone metastasis [175]. However, my results do support that β1 integrin activation does, in general, promote prostate cancer metastasis.
The results in Chapter 7 demonstrated that inside-out β1 integrin activation is required for prostate cancer bone metastasis. As described in the introduction, integrin signaling through inside-out and outside-in direction are not separate events in cells, because the two mechanisms of integrin activation interact with one another. Therefore, outside-in β1 integrin signaling through binding ECM proteins may also contribute to bone metastasis in vivo . Previous studies from Dr. Sue-Hwa Lin’s laboratory demonstrated that blocking of β1 integrin binding with ligands using an anti-β1 integrin antibody (mAb 33B6) decreased cell adhesion on ECM matrix. Treatment of mAb 33B6 reduced metastatic tumor growth in bone in vivo [112]. In addition, from my studies in
Chapter 5, β1 integrin activation through talin phosphorylation increased ECM binding as cells strongly adhered on collagen-coated matrix. These data suggest that integrin outside-in signaling through binding ECM proteins is equally important for bone metastasis. Prostate cancer cells with activated β1 integrins through talin phosphorylation are likely binding bone ECM proteins, which facilities colonization of cancer cell in the bone.
Finally, to support the finding of talin1 phosphorylation in prostate cancer bone metastasis, I collaborated with Dr. Sue-Hwa Lin and Dr. Chien-Jui Cheng to examine
- 129 -
talin phosphorylation in human tissues. Using an antibody specific to phospho-talin S425,
we demonstrated that talin phosphorylation is more highly expressed in bone metastases
than in lymph node metastases or primary tumors, with no talin phosphorylation observed
in normal or atrophied (non-tumorigenic) glands (Figure 51). Therefore, these data are
consistent with our in vivo studies and provide a clinical evidence that talin S425 phosphorylation is critical for prostate cancer bone metastasis.
Integrins, talin1 and Cdk5 as therapeutic targets
Integrins
Targeting integrins using inhibitory antibodies is a logical approach to inhibit aberrant integrin signaling in cancer cells. In studies from Dr. Sue-Hwa Lin’s laboratory, using neutralizing antibody mAb 33B6 successfully inhibited metastasis of prostate cancer cells in mice [112]. In fact, other functional blocking β1 integrin antibodies such as mAb AIIB2 and JB1a have been shown to inhibit tumor growth and metastasis in breast cancer [195, 196]. Therefore, targeting β1 integrins by antibodies has great potential to affect tumor growth and/or metastasis in prostate cancer. Currently, many integrin antibodies are being developed for several diseases including solid tumors [197].
For example, the M200 Volociximab, an anti-α5β1 integrin antibody, was used in a
clinical trial (phase II) to assess the effect to patients with various solid tumors [198]. A
panel of integrin antibodies targeting αvβ3, including MEDI-522 (phase II), CNTO95
(phase II) and Cilengitide (phase II) was evaluated for the effects of integrin-mediated angiogenesis in patients with metastatic CRPC [199]. Results from these studies will hopefully lead to better treatment strategies for prostate cancer. A concern of integrin-
- 130 - targeting therapy is the potential overlapping in integrin functions; therefore biomarkers that identify which integrins are activated to target would be important to optimal anti- integrin therapy.
Talin
Although talin1 may not be a druggable target for prostate cancer, talin1 phosphorylation may be used as a biomarker for integrin activation in prostate cancer bone metastases. From the results in chapter 8, talin is highly phosphorylated in prostate cancer bone metastases compared with lymph node metastases or prostate tumors. Thus, talin phosphorylation may be a useful biomarker for bone metastasis. Recently, a study found that talin1 is presented in the serum samples from patients with hepatocellular carcinoma, and the serum level of talin1 is significantly higher compared to the healthy group [200]. Phosphorylated talin1 may also present in the serum from prostate cancer patients with bone metastasis. Another possible approach to detect phosphorylated talin1 is to isolate circulating tumor cells (CTCs) from prostate cancer patients. Although whether talin is phosphorylated in CTCs is unknown, the talin1 S425D mutant cells were resistant to anoikis as shown in chapter 5, which suggests that talin1 phosphorylation may be required for CTCs to survive in the circulation. Therefore, talin1 phosphorylation in prostate CTCs may be a potential biomarker for prognosis in patients.
Cdk5
As increased Cdk5 activity was showed responsible for talin1 phosphorylation in this study, targeting talin phosphorylation through inhibiting Cdk5 activity will be a
- 131 -
reasonable strategy to develop prostate cancer therapy. In chapter 6, talin1
phosphorylation was inhibited by Cdk inhibitor, roscovitine (Figure 40). Therefore,
treatment of a selective Cdk5 inhibitor should inhibit β1 integrin activation in prostate cancer cells as well as cancer metastasis. However, no selective Cdk5 inhibitor has been developed to date. The (R)-roscovitine or Seliciclib/CYC202 is current being evaluated in clinical trials for antitumor activity in advanced solid tumors [201]. Although roscovitine has an inhibitory effect on Cdk5 activity, it can also inhibit other Cdks, including Cdk1 and Cdk2. Therefore, developing a more selective Cdk5 inhibitors would be necessary to explore the effect of Cdk5 in prostate cancer metastasis.
Future perspectives
This dissertation clarified the role of many proteins implicated in prostate cancer metastasis. While p35, Cdk5, talin and integrins have all been associated separately in increasing metastatic potential, my work is the first to put them together in a single pathway. This dissertation further demonstrated the role of talin phosphorylation as a regulator for β1 integrin activation (Figure 52). However, many questions remain to be determined in the future. Bone microenvironment is known to facilitate cancer cell colonization and tumor growth. This dissertation demonstrated that β1 integrin activation on cancer cells facilitates metastasis of prostate cancer cells in the bone. Therefore, future studies should focus on determining the interaction between cancer cells and the bone microenvironment. Generally, studies are needed to determine what is the role of β1 integrin activation in the bone microenvironment during prostate cancer metastasis. Do
β1 integrins on cancer cells affect bone cells or bone remodeling? On the other hand, do
- 132 - bone cells affect β1 integrin activation on cancer cells? While α and β subunits of integrins control ligand specificity, it may be necessary to identical which α subunit is pairing with β1 integrins. In addition, whether β1 integrins heterodimerize with particular
α subunits in different stages of prostate cancer progression? The answers to these questions will provide important information for understanding prostate cancer bone metastasis.
In this dissertation, talin phosphorylation promoted integrin activation leading to metastasis. However, cancer metastasis involves multiple mechanisms that are required to change cell properties, and integrin activation could be just one of them. Another mechanism that is possibly involved in integrin activation is epithelial plasticity. As mentioned in the introduction, EMT is required for increasing cancer cell motility. In our results, talin1 phosphorylation increased migration and invasion in C4-2B4 cells, which implies that EMT may also occur during integrin activation. In fact, studies have shown that expression of β1 integrins enhances EMT in non-small cell lung cancer cells [202].
In breast cancer cells, αvβ1 and αvβ6 integrins also induce EMT after treated with an
ECM protein, tenascin. Therefore, whether talin1 phosphorylation can induce ECM should be determined in the future studies.
A difficult question regarding epithelial plasticity is the role of integrin activation in MET. If β1 integrin activation can induce EMT in the primary tumors, cancer cells in bone metastases should have MET and inactive β1 integrins. However, according to our clinical date, talin was mostly phosphorylated in the bone metastases, suggesting that β1
- 133 -
integrins are still activated in these tissues. Therefore, further studies should determine
whether β1 integrins on cancer cells are not required for MET to occur. Furthermore,
MET can explain why cancer cells in the metastatic sites show similar epithelial phenotypes as epithelial tumor at the primary site. Therefore, other integrins which are highly expressed in the primary site may also show higher expression in the bone metastases.
Because talin1 has been shown to activate β3 integrins [124], whether talin1
phosphorylation can activate β3 integrins in prostate cancer cells also remains to be
determined. In addition to the roles of β1 integrins, β3 integrins may also have roles in
tumor growth in the bone. β3 integrins specifically bind to bone ECM proteins such as
osteopontin and bone sialoprotein. In my studies, talin1 phosphorylation did not affect
cell proliferation, suggesting that β1 integrins may be not responsible for prostate cancer
cell proliferation (Figure 30). Thus, inside-out activation of β3 integrins may increase the
binding of these bone ECM proteins and promote tumor growth in the bone.
For talin phosphorylation, a difficult question to answer is how phosphorylation
of talin structurally induces β1 integrin activation? Because talin1 has to be activated
prior to activate β1 integrins, it is plausible that phosphorylation may induce a
conformational change in talin1 leading to talin1 activation. To test this hypothesis,
protein structure modeling analyses may be useful to predict the conformational change
of phosphorylated talin1. However, the interaction between phosphorylated talin1 and β1
- 134 -
integrins may be more complex than we thought, and these analyses are likely to be
difficult due to the other 30 phosphorylation sites also present in talin.
Although this dissertation focused on motility and survival of cancer cells,
integrins affect other properties of cancer cells. One of the major problems in cancer
therapy is developing drug resistance in cancer cells. Treatments of kinase inhibitors for
prostate cancer usually develop drug-resistance, which has been shown due to increased
β1 integrin signaling [84]. Indeed, studies have shown that β1 integrin signaling is increased to activate PI3K/Akt survival pathway for developing resistance to cytotoxic chemotherapies [86]. In addition, β1 integrin expression is increased upon exposure to ionizing radiation, which has been suggested to be a mechanism for therapy resistance
[87]. From this dissertation, β1 integrin signaling was shown constitutively activated in metastatic prostate cancer cells. Therefore, β1 integrins may play an important role in therapy resistance and may control recurrence of metastasis. Thus, targeting β1 integrins together with kinase inhibitor may be a better strategy to treat prostate cancer.
Furthermore, cancer cells metastasized into the distant organs usually enter into a period of dormancy or senescence and form micrometastases. Studies have shown that β1 integrin signaling is required to break the dormancy in cancer cells [84]. Therefore, talin1 phosphorylation and β1 integrin activation may play roles in escaping senescence and resuming proliferation of cancer cells leading to tumor growth in the bone.
- 135 -
Conclusions
In this dissertation, I demonstrated the importance of talin1 S425 phosphorylation for inside-out activation of β1 integrins and promotion of prostate cancer bone metastasis.
In metastatic prostate cancer cells, β1 integrins are constructively activated through inside-out integrin activation, which correlated with metastatic potential of cells. The levels of talin1 S425 phosphorylation, but not total talin1, also correlate with metastatic potential of prostate cancer cell lines. Besides, talin phosphorylation is significantly increased in human bone metastases compared to primary tumors or lymph node metastases. Using phosphorylation-mimicking and non-phosphorylatable talin1 mutants,
I demonstrated that talin1 phosphorylation is required for β1 integrin activation in metastatic prostate cancer cells. Talin1 phosphorylation on S425 plays an important role in cell adhesion, migration, invasion, and anoikis in vitro and metastasis of prostate cancer cells to bone in vivo . Mechanistically, I demonstrated that Cdk5 activity is increased in highly metastatic prostate cancer cells as compared to low metastatic prostate cancer cells. In addition, increased Cdk5 activity in metastatic prostate cancer cells is due to overexpression of p35. Furthermore, talin1 phosphorylation is required for
Cdk5-induced β1 integrin activation. In summary, I identified a novel mechanism for β1 integrin activation through Cdk5-mediated talin1 S425 phosphorylation in metastatic prostate cancer cells (summarized in Figure 52). Therefore, I conclude that integrins, talin1, Cdk5 and p35 could be potential targets for development of novel therapies for prostate cancer bone metastasis.
- 136 -
Figure 52. Model of β1 integrin activation by talin1 S425 phosphorylation in metastatic prostate cancer cells. (1) Expression of p35 is increased in tumor cells of high metastatic potential, which increases Cdk5 activity leading to talin1 phosphorylation. Phosphorylation of talin1 on S425 may induce a conformational change leading to talin1 activation. Binding of additional proteins may facilitate this conformational change. (2) Phosphorylated talin1 binds to the cytoplasmic tail of β1 integrin and (3) increases β1 integrin activation and (4) promotes integrin signaling, leading to increased survival, adhesion, motility and metastatic potential in prostate cancer cells.
- 137 -
Appendix
- 138 -
Propidium iodide staining for FACS Analysis
1. Trypsinize cells and centrifuge cell suspension. 2. Add 5 ml of PBS and centrifuge cells at 500 ×g for 5 min. 3. Add 5 ml of 70% ethanol (cold). Make sure that cells are dispersed in the ethanol and not clumpy. If clumpy, gently disperse cells using a pipetman. 4. Leave cells in ethanol at 4 ℃ overnight for fixing. 5. Spin cells at 500 ×g for 5 min and resuspend cells in 5 ml PBS. 6. Resuspend cells in 50 µl PBS, plus 3.3 µL RNAse (30 mg/mL) and incubate at 4°C for 5 min. 7. Add 450 µl PBS and 25 µl PI (1 mg/ml). Incubate at 4 ℃ for 30 min. 8. Analysize immediately after incubation at 4 ℃, in order to prevent clumping of the cells.
- 139 -
Subcloning talin1 from pEZ-M29 to pWPXL-GFP plasmid
1. PCR amplify talin1 DNA fragment using pEZ-M29-talin1 plasmid as a temple, primer set 5’GCTGTACAAGTCCGGCATGGTTGCACTTTCACTGAAGA3’ (primer #1) and 5’GAGATCTGAGTCCGGACAAGAAAGCTGGGTTGCG3’ (primer #2) and Phusion hot start II DNA polymerase (Thermo Scientific). 2. PCR reaction setup: Water 31µl GC buffer 10µl 10 mM dNTP 1µl 10 µM primer #1 2.5µl 10 µM primer #2 2.5µl 50 ng DNA 2 µl DNA polymerase 1µl Total volume 50 µl 3. Cycling: after initial denaturation, 98 ℃ 10 sec, 68 ℃ 10sec, 72 ℃ 1 min: 56 sec for 29 cycles then 72 ℃ 5 min. 4. Digested pWPXL-GFP using Bsp EI enzyme (Thermo Scientific) at 55 ℃ for 30 min, and then purify DNA fragments of full length pWPXL-GFP. 5. Incubate 4 µl partial-digested pWPXL-GFP and 4 µl talin1 PCR product with 2 µl of 5× In-Fusion HD enzyme premix at 50 ℃ for 15 min. 6. Continue to the transformation procedure according to manufacturer’s instructions.
- 140 -
Mutagenesis of talin1 on S425
1. PCR amplify whole pEZ-M29-talin1 plasmid using complementary mutagenic primer set 5’GACTCAGTGGCCCCCAAAAAGTCAACAGTCCTG3’ and 5’GGGCCACTGAGTCCTCCAGCATAGTAGACTCCTC3’ (underline denotes mutated site) for talin1 S425A mutation. For talin1 S425D mutation, using mutagenic primer set: 5’GACTCAGTGGA CCCCAAAAAGTCAACAGTCCTG3’ and 5’GGTC CACTGAGTCCTCCAGCATAGTAGACTCCTC3’. 2. PCR reaction setup: Water 31µl GC buffer 10µl 10 mM dNTP 1µl 10 µM primer #1 2.5µl 10 µM primer #2 2.5µl 50 ng DNA 2 µl DNA polymerase 1µl Total volume 50 µl 3. Cycling: after initial denaturation, 98 ℃ 10 sec, 59 ℃ 10sec, 72 ℃ 3 min: 30 sec for 29 cycles then 72 ℃ 10 min. 4. To recircularize plasmid, incubate 1 µl talin1 S425A/D PCR product with 2 µl of 5× In-Fusion HD enzyme premix and 7 µl water at 50 ℃ for 15 min. 5. Continue to the transformation procedure according to manufacturer’s instructions. 6. The pEZ-M29-talin1 S425A/D plasmids were used as temples to PCR amplify full length talin1 S425A/D fragments and subclone into B sp EI partial-digested pWPXL- GFP vector according to the subcloning protocol.
- 141 -
Plasmid: pEZ-M29-talin1 OmicsLink Expression Clone of EX-R0040-M29 Catalog No.: EX-R0040-M29 Accession No.: AF078828 ORF Length: 7626 bp Whole Plasmid Size: 13791 bp Description: Homo sapiens talin mRNA, complete cds. Vector: pEZ-M29 Antibiotic: Ampicillin Stable Selection Marker: Neomycin
- 142 -
Plasmid: pWPXL-GFP Addgene plasmid: 12257 Whole Plasmid Size: 10510 bp Antibiotic: Ampicillin Stable Selection Marker: GFP
- 143 -
Plasmid: pWPXL-GFP-talin1 WT Whole Plasmid Size: 18172 bp Antibiotic: Ampicillin Stable Selection Marker: GFP
Plasmid: pWPXL-GFP-talin1 S425A Mutation on 5539-5541 (TCC to GCC) in pWPXL-GFP-talin1 WT plasmid to replace serine with alanine on 425 amino acid.
Plasmid: pWPXL-GFP-talin1 S425D Mutation on 5539-5541 (TCC to GAC) in pWPXL-GFP-talin1 WT plasmid to replace serine with aspartic acid on 425 amino acid.
- 144 -
- 145 -
Fixed cell pellet and embedded in paraffin
1. Pellet cells by centrifugation 400 ×g for 10 minutes at room temperature. 2. Resuspend cells in 10 ml 10% buffered Formalin, and fix for two hours at room temperature. 3. Pellet cells by centrifugation 400 ×g for 10 minutes at room temperature. 4. Resuspend cells in 300 µl of PBS in a microtube. 5. Prepare 3% low melting point (LMP) agarose in PBS; weigh before microwaving. 6. Melt in microwave and replace lost water. 7. Place melted agarose mixture in water bath at 65 ℃. Allow agarose to equilibrate to 65 ℃ (about 30 minutes). 8. Heat microtube with cells in it to 65 ℃ for no more than 10 minutes. 9. Working in water bath, add 600 µl of agarose mixture to cells, and mix by pipetting up and down. 10. Immediately transfer microtube to a room temperature microcentrifuge, and spin at 2000 ×g for five minutes. 11. Place microtube on ice, remove gelled pellet, and trim of excess agarose. 12. Wrap pellet in lens paper, place in a paraffin processing cassette, and process to paraffin block. http://www.umassmed.edu/morphology/protocols/fixcellpellet.aspx
- 146 -
Bibliography
- 147 -
1. American Cancer Society (2014) Cancer Facts & Figures 2014. American Cancer
Society, Atlanta, Georgia, USA
2. Baena Ruiz R, Salinas Hernandez P (2014) Diet and cancer: Risk factors and
epidemiological evidence. Maturitas 77: 202-208
3. Briganti A, Suardi N, Gallina A, Abdollah F, Novara G, Ficarra V, Montorsi F
(2014) Predicting the risk of bone metastasis in prostate cancer. Cancer Treat Rev
40: 3-11
4. Bian SX, Hoffman KE (2013) Management of prostate cancer in elderly men.
Semin Radiat Oncol 23: 198-205
5. Mordukhovich I, Reiter PL, Backes DM, Family L, McCullough LE, O'Brien KM,
Razzaghi H, Olshan AF (2011) A review of African American-white differences in
risk factors for cancer: prostate cancer. Cancer Causes Control 22: 341-357
6. De Pergola G, Silvestris F (2013) Obesity as a major risk factor for cancer. J Obes
2013: 291546
7. American Cancer Society (2013) Prostate Cancer: Early Detection. American
Cancer Society, Atlanta, Georgia, USA
8. Robinson JG, Hodges EA, Davison J (2014) Prostate-specific antigen screening: A
critical review of current research and guidelines. J Am Assoc Nurse Pract (in press)
9. Schroder FH, Hugosson J, Roobol MJ, Tammela TL, Ciatto S, Nelen V,
Kwiatkowski M, Lujan M, Lilja H, Zappa M, Denis LJ, Recker F, Berenguer A,
Maattanen L, Bangma CH, Aus G, Villers A, Rebillard X, der v (2009) Screening
- 148 -
and prostate-cancer mortality in a randomized European study. N Engl J Med 360:
1320-1328
10. Roobol MJ, Kerkhof M, Schroder FH, Cuzick J, Sasieni P, Hakama M, Stenman
UH, Ciatto S, Nelen V, Kwiatkowski M, Lujan M, Lilja H, Zappa M, Denis L,
Recker F, Berenguer A, Ruutu M, Kujala P, Bangma CH, Aus (2009) Prostate
cancer mortality reduction by prostate-specific antigen-based screening adjusted for
nonattendance and contamination in the European Randomised Study of Screening
for Prostate Cancer (ERSPC). Eur Urol 56: 584-591
11. Andriole GL, Crawford ED, Grubb RL 3r, Buys SS, Chia D, Church TR, Fouad
MN, Gelmann EP, Kvale PA, Reding DJ, Weissfeld JL, Yokochi LA, O'Brien B,
Clapp JD, Rathmell JM, Riley TL, Hayes R (2009) Mortality results from a
randomized prostate-cancer screening trial. N Engl J Med 360: 1310-1319
12. Bubendorf L, Schopfer A, Wagner U, Sauter G, Moch H, Willi N, Gasser TC,
Mihatsch MJ (2000) Metastatic patterns of prostate cancer: an autopsy study of
1,589 patients. Hum Pathol 31: 578-583
13. Costa L, Major PP (2009) Effect of bisphosphonates on pain and quality of life in
patients with bone metastases. Nat Clin Pract Oncol 6: 163-174
14. Lee RJ, Saylor PJ, Smith MR (2011) Treatment and prevention of bone
complications from prostate cancer. Bone 48: 88-95
15. Dong JT (2001) Chromosomal deletions and tumor suppressor genes in prostate
cancer. Cancer Metastasis Rev 20: 173-193
- 149 -
16. Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, Arora VK,
Kaushik P, Cerami E, Reva B, Antipin Y, Mitsiades N, Landers T, Dolgalev I,
Major JE, Wilson M, Socci ND, Lash AE, Heguy A (2010) Integrative genomic
profiling of human prostate cancer. Cancer Cell 18: 11-22
17. Gurel B, Ali TZ, Montgomery EA, Begum S, Hicks J, Goggins M, Eberhart CG,
Clark DP, Bieberich CJ, Epstein JI, De Marzo AM (2010) NKX3.1 as a marker of
prostatic origin in metastatic tumors. Am J Surg Pathol 34: 1097-1105
18. Bhatia-Gaur R, Donjacour AA, Sciavolino PJ, Kim M, Desai N, Young P, Norton
CR, Gridley T, Cardiff RD, Cunha GR, Abate-Shen C, Shen MM (1999) Roles for
Nkx3.1 in prostate development and cancer. Genes Dev 13: 966-977
19. Kim MJ, Bhatia-Gaur R, Banach-Petrosky WA, Desai N, Wang Y, Hayward SW,
Cunha GR, Cardiff RD, Shen MM, Abate-Shen C (2002) Nkx3.1 mutant mice
recapitulate early stages of prostate carcinogenesis. Cancer Res 62: 2999-3004
20. Abdulkadir SA, Magee JA, Peters TJ, Kaleem Z, Naughton CK, Humphrey PA,
Milbrandt J (2002) Conditional loss of Nkx3.1 in adult mice induces prostatic
intraepithelial neoplasia. Mol Cell Biol 22: 1495-1503
21. Gelmann EP (2003) Searching for the gatekeeper oncogene of prostate cancer. Crit
Rev Oncol Hematol 46 Suppl: S11-20
22. Sato K, Qian J, Slezak JM, Lieber MM, Bostwick DG, Bergstralh EJ, Jenkins RB
(1999) Clinical significance of alterations of chromosome 8 in high-grade,
advanced, nonmetastatic prostate carcinoma. J Natl Cancer Inst 91: 1574-1580
- 150 -
23. Gurel B, Iwata T, Koh CM, Jenkins RB, Lan F, Van Dang C, Hicks JL, Morgan J,
Cornish TC, Sutcliffe S, Isaacs WB, Luo J, De Marzo AM (2008) Nuclear MYC
protein overexpression is an early alteration in human prostate carcinogenesis. Mod
Pathol 21: 1156-1167
24. Ellwood-Yen K, Graeber TG, Wongvipat J, Iruela-Arispe ML, Zhang J, Matusik R,
Thomas GV, Sawyers CL (2003) Myc-driven murine prostate cancer shares
molecular features with human prostate tumors. Cancer Cell 4: 223-238
25. Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, Ligon AH, Langford LA,
Baumgard ML, Hattier T, Davis T, Frye C, Hu R, Swedlund B, Teng DH, Tavtigian
SV (1997) Identification of a candidate tumour suppressor gene, MMAC1, at
chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 15:
356-362
26. Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C,
Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittmann M, Tycko B,
Hibshoosh H, Wigler MH, Parsons R (1997) PTEN, a putative protein tyrosine
phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275:
1943-1947
27. Salmena L, Carracedo A, Pandolfi PP (2008) Tenets of PTEN tumor suppression.
Cell 133: 403-414
28. Wang SI, Parsons R, Ittmann M (1998) Homozygous deletion of the PTEN tumor
suppressor gene in a subset of prostate adenocarcinomas. Clin Cancer Res 4: 811-
815
- 151 -
29. Verhagen PC, van Duijn PW, Hermans KG, Looijenga LH, van Gurp RJ, Stoop H,
van der KwT, Trapman J (2006) The PTEN gene in locally progressive prostate
cancer is preferentially inactivated by bi-allelic gene deletion. J Pathol 208: 699-
707
30. Cairns P, Okami K, Halachmi S, Halachmi N, Esteller M, Herman JG, Jen J, Isaacs
WB, Bova GS, Sidransky D (1997) Frequent inactivation of PTEN/MMAC1 in
primary prostate cancer. Cancer Res 57: 4997-5000
31. Wang S, Gao J, Lei Q, Rozengurt N, Pritchard C, Jiao J, Thomas GV, Li G, Roy-
Burman P, Nelson PS, Liu X, Wu H (2003) Prostate-specific deletion of the murine
Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell 4: 209-
221
32. Trotman LC, Niki M, Dotan ZA, Koutcher JA, Di Cristofano A, Xiao A, Khoo AS,
Roy-Burman P, Greenberg NM, Van Dyke T, Cordon-Cardo C, Pandolfi PP (2003)
Pten dose dictates cancer progression in the prostate. PLoS Biol 1: 385-396
33. Wu Z, Conaway M, Gioeli D, Weber MJ, Theodorescu D (2006) Conditional
expression of PTEN alters the androgen responsiveness of prostate cancer cells.
Prostate 66: 1114-1123
34. Lin HK, Hu YC, Lee DK, Chang C (2004) Regulation of androgen receptor
signaling by PTEN (phosphatase and tensin homolog deleted on chromosome 10)
tumor suppressor through distinct mechanisms in prostate cancer cells. Mol
Endocrinol 18: 2409-2423
- 152 -
35. Lorente D, De Bono JS (2014) Molecular alterations and emerging targets in
castration resistant prostate cancer. Eur J Cancer 50: 753-764
36. Culig Z, Santer FR (2014) Androgen receptor signaling in prostate cancer. Cancer
Metastasis Rev (in press)
37. Huggins C, Hodges CV (1972) Studies on prostatic cancer. I. The effect of
castration, of estrogen and androgen injection on serum phosphatases in metastatic
carcinoma of the prostate. CA Cancer J Clin 22: 232-240
38. Agus DB, Cordon-Cardo C, Fox W, Drobnjak M, Koff A, Golde DW, Scher HI
(1999) Prostate cancer cell cycle regulators: response to androgen withdrawal and
development of androgen independence. J Natl Cancer Inst 91: 1869-1876
39. Catalona WJ (1994) Management of cancer of the prostate. N Engl J Med 331: 996-
1004
40. Hobisch A, Culig Z, Radmayr C, Bartsch G, Klocker H, Hittmair A (1995) Distant
metastases from prostatic carcinoma express androgen receptor protein. Cancer Res
55: 3068-3072
41. Visakorpi T, Hyytinen E, Koivisto P, Tanner M, Keinanen R, Palmberg C, Palotie
A, Tammela T, Isola J, Kallioniemi OP (1995) In vivo amplification of the
androgen receptor gene and progression of human prostate cancer. Nat Genet 9:
401-406
42. Feldman BJ, Feldman D (2001) The development of androgen-independent prostate
cancer. Nat Rev Cancer 1: 34-45
- 153 -
43. Knudsen KE, Penning TM (2010) Partners in crime: deregulation of AR activity
and androgen synthesis in prostate cancer. Trends Endocrinol Metab 21: 315-324
44. Dutt SS, Gao AC (2009) Molecular mechanisms of castration-resistant prostate
cancer progression. Future Oncol 5: 1403-1413
45. Desai SJ, Ma AH, Tepper CG, Chen HW, Kung HJ (2006) Inappropriate activation
of the androgen receptor by nonsteroids: involvement of the Src kinase pathway and
its therapeutic implications. Cancer Res 66: 10449-10459
46. Dehm SM, Tindall DJ (2005) Regulation of androgen receptor signaling in prostate
cancer. Expert Rev Anticancer Ther 5: 63-74
47. Scher HI, Beer TM, Higano CS, Anand A, Taplin ME, Efstathiou E, Rathkopf D,
Shelkey J, Yu EY, Alumkal J, Hung D, Hirmand M, Seely L, Morris MJ, Danila
DC, Humm J, Larson S, Fleisher M, Sawyers CL (2010) Antitumour activity of
MDV3100 in castration-resistant prostate cancer: a phase 1-2 study. Lancet 375:
1437-1446
48. Harland S, Staffurth J, Molina A, Hao Y, Gagnon DD, Sternberg CN, Cella D,
Fizazi K, Logothetis CJ, Kheoh T, Haqq CM, de Bono JS, Scher HI (2013) Effect
of abiraterone acetate treatment on the quality of life of patients with metastatic
castration-resistant prostate cancer after failure of docetaxel chemotherapy. Eur J
Cancer 49: 3648-3657
49. Paget S (1889) The distribution of secondary growth in cancer of the breast. Lancet
1: 571-573
- 154 -
50. Joyce JA (2005) Therapeutic targeting of the tumor microenvironment. Cancer Cell
7: 513-520
51. Tuxhorn JA, Ayala GE, Rowley DR (2001) Reactive stroma in prostate cancer
progression. J Urol 166: 2472-2483
52. Casimiro S, Guise TA, Chirgwin J (2009) The critical role of the bone
microenvironment in cancer metastases. Mol Cell Endocrinol 310: 71-81
53. Corn PG (2012) The tumor microenvironment in prostate cancer: elucidating
molecular pathways for therapy development. Cancer Manag Res 4: 183-193
54. Mol AJ, Geldof AA, Meijer GA, van der PoH, van Moorselaar RJ (2007) New
experimental markers for early detection of high-risk prostate cancer: role of cell-
cell adhesion and cell migration. J Cancer Res Clin Oncol 133: 687-695
55. Goel HL, Alam N, Johnson IN, Languino LR (2009) Integrin signaling aberrations
in prostate cancer. Am J Transl Res 1: 211-220
56. Umbas R, Isaacs WB, Bringuier PP, Schaafsma HE, Karthaus HF, Oosterhof GO,
Debruyne FM, Schalken JA (1994) Decreased E-cadherin expression is associated
with poor prognosis in patients with prostate cancer. Cancer Res 54: 3929-3933
57. Thiery JP (2002) Epithelial-mesenchymal transitions in tumour progression. Nat
Rev Cancer 2: 442-454
58. van der HoG, Bos L, van der PlG (2012) Epithelial plasticity, cancer stem cells, and
the tumor-supportive stroma in bladder carcinoma. Mol Cancer Res 10: 995-1009
- 155 -
59. Nieto MA (2013) Epithelial plasticity: a common theme in embryonic and cancer
cells. Science 342: 1234850
60. Zetter BR (1990) The cellular basis of site-specific tumor metastasis. N Engl J Med
322: 605-612
61. Fidler IJ, Lieber S (1972) Quantitative analysis of the mechanism of glucocorticoid
enhancement of experimental metastasis. Res Commun Chem Pathol Pharmacol 4:
607-613
62. Chambers AF, Groom AC, MacDonald IC (2002) Dissemination and growth of
cancer cells in metastatic sites. Nat Rev Cancer 2: 563-572
63. Frisch SM, Screaton RA (2001) Anoikis mechanisms. Curr Opin Cell Biol 13: 555-
562
64. Fidler IJ (1990) Critical factors in the biology of human cancer metastasis: twenty-
eighth G.H.A. Clowes memorial award lecture. Cancer Res 50: 6130-6138
65. Horbinski C, Mojesky C, Kyprianou N (2010) Live free or die: tales of homeless
(cells) in cancer. Am J Pathol 177: 1044-1052
66. Sakamoto S, Kyprianou N (2010) Targeting anoikis resistance in prostate cancer
metastasis. Mol Aspects Med 31: 205-214
67. Cooper CR, McLean L, Walsh M, Taylor J, Hayasaka S, Bhatia J, Pienta KJ (2000)
Preferential adhesion of prostate cancer cells to bone is mediated by binding to bone
marrow endothelial cells as compared to extracellular matrix components in vitro.
Clin Cancer Res 6: 4839-4847
- 156 -
68. Bussard KM, Gay CV, Mastro AM (2008) The bone microenvironment in
metastasis; what is special about bone? Cancer Metastasis Rev 27: 41-55
69. Romanowski R, Jundt G, Termine JD, von der MaK, Schulz A (1990)
Immunoelectron microscopy of osteonectin and type I collagen in osteoblasts and
bone matrix. Calcif Tissue Int 46: 353-360
70. Pinero GJ, Farach-Carson MC, Devoll RE, Aubin JE, Brunn JC, Butler WT (1995)
Bone matrix proteins in osteogenesis and remodelling in the neonatal rat mandible
as studied by immunolocalization of osteopontin, bone sialoprotein, alpha 2HS-
glycoprotein and alkaline phosphatase. Arch Oral Biol 40: 145-155
71. Desai B, Rogers MJ, Chellaiah MA (2007) Mechanisms of osteopontin and CD44
as metastatic principles in prostate cancer cells. Mol Cancer 6: 18
72. Kanis JA, McCloskey EV (1997) Bone turnover and biochemical markers in
malignancy. Cancer 80: 1538-1545
73. Hauschka PV, Mavrakos AE, Iafrati MD, Doleman SE, Klagsbrun M (1986)
Growth factors in bone matrix. Isolation of multiple types by affinity
chromatography on heparin-Sepharose. J Biol Chem 261: 12665-12674
74. Fili S, Karalaki M, Schaller B (2009) Mechanism of bone metastasis: the role of
osteoprotegerin and of the host-tissue microenvironment-related survival factors.
Cancer Lett 283: 10-19
75. Roato I (2013) Interaction among cells of bone, immune system, and solid tumors
leads to bone metastases. Clin Dev Immunol 2013: 315024
- 157 -
76. Huang CF, Lira C, Chu K, Bilen MA, Lee YC, Ye X, Kim SM, Ortiz A, Wu FL,
Logothetis CJ, Yu-Lee LY, Lin SH (2010) Cadherin-11 increases migration and
invasion of prostate cancer cells and enhances their interaction with osteoblasts.
Cancer Res 70: 4580-4589
77. Chu K, Cheng CJ, Ye X, Lee YC, Zurita AJ, Chen DT, Yu-Lee LY, Zhang S, Yeh
ET, Hu MC, Logothetis CJ, Lin SH (2008) Cadherin-11 promotes the metastasis of
prostate cancer cells to bone. Mol Cancer Res 6: 1259-1267
78. Lee YC, Bilen MA, Yu G, Lin SC, Huang CF, Ortiz A, Cho H, Song JH, Satcher
RL, Kuang J, Gallick GE, Yu-Lee LY, Huang W, Lin SH (2013) Inhibition of cell
adhesion by a cadherin-11 antibody thwarts bone metastasis. Mol Cancer Res 11:
1401-1411
79. Sottnik JL, Daignault-Newton S, Zhang X, Morrissey C, Hussain MH, Keller ET,
Hall CL (2013) Integrin alpha2beta1 (alpha2beta1) promotes prostate cancer
skeletal metastasis. Clin Exp Metastasis 30: 569-578
80. Hall CL, Dai J, van Golen KL, Keller ET, Long MW (2006) Type I collagen
receptor (alpha2beta1) signaling promotes the growth of human prostate cancer
cells within the bone. Cancer Res 66: 8648-8654
81. Klein CA (2011) Framework models of tumor dormancy from patient-derived
observations. Curr Opin Genet Dev 21: 42-49
82. Aguirre-Ghiso JA (2007) Models, mechanisms and clinical evidence for cancer
dormancy. Nat Rev Cancer 7: 834-846
- 158 -
83. Naumov GN, Townson JL, MacDonald IC, Wilson SM, Bramwell VH, Groom AC,
Chambers AF (2003) Ineffectiveness of doxorubicin treatment on solitary dormant
mammary carcinoma cells or late-developing metastases. Breast Cancer Res Treat
82: 199-206
84. Barkan D, Chambers AF (2011) beta1-integrin: a potential therapeutic target in the
battle against cancer recurrence. Clin Cancer Res 17: 7219-7223
85. Morozevich GE, Kozlova NI, Preobrazhenskaya ME, Ushakova NA, Eltsov IA,
Shtil AA, Berman AE (2006) The role of beta1 integrin subfamily in anchorage-
dependent apoptosis of breast carcinoma cells differing in multidrug resistance.
Biochemistry (Mosc) 71: 489-495
86. Aoudjit F, Vuori K (2001) Integrin signaling inhibits paclitaxel-induced apoptosis
in breast cancer cells. Oncogene 20: 4995-5004
87. Nam JM, Chung Y, Hsu HC, Park CC (2009) beta1 integrin targeting to enhance
radiation therapy. Int J Radiat Biol 85: 923-928
88. van der FlA, Sonnenberg A (2001) Function and interactions of integrins. Cell
Tissue Res 305: 285-298
89. Rathinam R, Alahari SK (2010) Important role of integrins in the cancer biology.
Cancer Metastasis Rev 29: 223-237
90. Xiong JP, Stehle T, Diefenbach B, Zhang R, Dunker R, Scott DL, Joachimiak A,
Goodman SL, Arnaout MA (2001) Crystal structure of the extracellular segment of
integrin alpha Vbeta3. Science 294: 339-345
- 159 -
91. Shattil SJ, Kim C, Ginsberg MH (2010) The final steps of integrin activation: the
end game. Nat Rev Mol Cell Biol 11: 288-300
92. Carman CV, Springer TA (2003) Integrin avidity regulation: are changes in affinity
and conformation underemphasized? Curr Opin Cell Biol 15: 547-556
93. Takagi J, Petre BM, Walz T, Springer TA (2002) Global conformational
rearrangements in integrin extracellular domains in outside-in and inside-out
signaling. Cell 110: 599-610
94. Schwartz MA, Schaller MD, Ginsberg MH (1995) Integrins: emerging paradigms
of signal transduction. Annu Rev Cell Dev Biol 11: 549-599
95. Humphries MJ, McEwan PA, Barton SJ, Buckley PA, Bella J, Mould AP (2003)
Integrin structure: heady advances in ligand binding, but activation still makes the
knees wobble. Trends Biochem Sci 28: 313-320
96. Margadant C, Monsuur HN, Norman JC, Sonnenberg A (2011) Mechanisms of
integrin activation and trafficking. Curr Opin Cell Biol 23: 607-614
97. DeMali KA, Wennerberg K, Burridge K (2003) Integrin signaling to the actin
cytoskeleton. Curr Opin Cell Biol 15: 572-582
98. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb
MH (2001) Mitogen-activated protein (MAP) kinase pathways: regulation and
physiological functions. Endocr Rev 22: 153-183
99. Reddig PJ, Juliano RL (2005) Clinging to life: cell to matrix adhesion and cell
survival. Cancer Metastasis Rev 24: 425-439
- 160 -
100. Zheng DQ, Woodard AS, Tallini G, Languino LR (2000) Substrate specificity of
alpha(v)beta(3) integrin-mediated cell migration and phosphatidylinositol 3-
kinase/AKT pathway activation. J Biol Chem 275: 24565-24574
101. Fornaro M, Plescia J, Chheang S, Tallini G, Zhu YM, King M, Altieri DC,
Languino LR (2003) Fibronectin protects prostate cancer cells from tumor necrosis
factor-alpha-induced apoptosis via the AKT/survivin pathway. J Biol Chem 278:
50402-50411
102. Matter ML, Ruoslahti E (2001) A signaling pathway from the alpha5beta1 and
alpha(v)beta3 integrins that elevates bcl-2 transcription. J Biol Chem 276: 27757-
27763
103. Lee BH, Ruoslahti E (2005) alpha5beta1 integrin stimulates Bcl-2 expression and
cell survival through Akt, focal adhesion kinase, and Ca2+/calmodulin-dependent
protein kinase IV. J Cell Biochem 95: 1214-1223
104. Fornaro M, Languino LR (1997) Alternatively spliced variants: a new view of the
integrin cytoplasmic domain. Matrix Biol 16: 185-193
105. Moro L, Perlino E, Marra E, Languino LR, Greco M (2004) Regulation of beta1C
and beta1A integrin expression in prostate carcinoma cells. J Biol Chem 279: 1692-
1702
106. Fornaro M, Tallini G, Zheng DQ, Flanagan WM, Manzotti M, Languino LR (1999)
p27(kip1) acts as a downstream effector of and is coexpressed with the beta1C
integrin in prostatic adenocarcinoma. J Clin Invest 103: 321-329
- 161 -
107. Stachurska A, Elbanowski J, Kowalczynska HM (2012) Role of alpha5beta1 and
alphavbeta3 integrins in relation to adhesion and spreading dynamics of prostate
cancer cells interacting with fibronectin under in vitro conditions. Cell Biol Int 36:
883-892
108. Trerotola M, Jernigan DL, Liu Q, Siddiqui J, Fatatis A, Languino LR (2013) Trop-2
promotes prostate cancer metastasis by modulating beta1 integrin functions. Cancer
Res 73: 3155-3167
109. Goel HL, Underwood JM, Nickerson JA, Hsieh CC, Languino LR (2010) Beta1
integrins mediate cell proliferation in three-dimensional cultures by regulating
expression of the sonic hedgehog effector protein, GLI1. J Cell Physiol 224: 210-
217
110. Van der VeD, Verdaasdonk MA, Rademakers LH, De Weger RA, Van den TwJ,
Joling P (1997) Fibronectin distribution in human bone marrow stroma: matrix
assembly and tumor cell adhesion via alpha5beta1 integrin. Exp Cell Res 230: 111-
120
111. Lang SH, Clarke NW, George NJ, Testa NG (1997) Primary prostatic epithelial cell
binding to human bone marrow stroma and the role of alpha2beta1 integrin. Clin
Exp Metastasis 15: 218-227
112. Lee YC, Jin JK, Cheng CJ, Huang CF, Song JH, Huang M, Brown WS, Zhang S,
Yu-Lee LY, Yeh ET, McIntyre BW, Logothetis CJ, Gallick GE, Lin SH (2013)
Targeting constitutively activated beta1 integrins inhibits prostate cancer metastasis.
Mol Cancer Res 11: 405-417
- 162 -
113. Calderwood DA, Campbell ID, Critchley DR (2013) Talins and kindlins: partners in
integrin-mediated adhesion. Nat Rev Mol Cell Biol 14: 503-517
114. Sakamoto S, McCann RO, Dhir R, Kyprianou N (2010) Talin1 promotes tumor
invasion and metastasis via focal adhesion signaling and anoikis resistance. Cancer
Res 70: 1885-1895
115. Lai MT, Hua CH, Tsai MH, Wan L, Lin YJ, Chen CM, Chiu IW, Chan C, Tsai FJ,
Jinn-Chyuan Sheu J (2011) Talin-1 overexpression defines high risk for aggressive
oral squamous cell carcinoma and promotes cancer metastasis. J Pathol 224: 367-
376
116. Tang H, Yao L, Tao X, Yu Y, Chen M, Zhang R, Xu C (2013) miR-9 functions as a
tumor suppressor in ovarian serous carcinoma by targeting TLN1. Int J Mol Med 32:
381-388
117. Monkley SJ, Pritchard CA, Critchley DR (2001) Analysis of the mammalian talin2
gene TLN2. Biochem Biophys Res Commun 286: 880-885
118. Debrand E, El Jai Y, Spence L, Bate N, Praekelt U, Pritchard CA, Monkley SJ,
Critchley DR (2009) Talin 2 is a large and complex gene encoding multiple
transcripts and protein isoforms. FEBS J 276: 1610-1628
119. Manso AM, Li R, Monkley SJ, Cruz NM, Ong S, Lao DH, Koshman YE, Gu Y,
Peterson KL, Chen J, Abel ED, Samarel AM, Critchley DR, Ross RS (2013) Talin1
has unique expression versus talin2 in the heart and modifies the hypertrophic
response to pressure overload. J Biol Chem 288: 4252-4264
- 163 -
120. Anthis NJ, Campbell ID (2011) The tail of integrin activation. Trends Biochem Sci
36: 191-198
121. Goult BT, Xu XP, Gingras AR, Swift M, Patel B, Bate N, Kopp PM, Barsukov IL,
Critchley DR, Volkmann N, Hanein D (2013) Structural studies on full-length
talin1 reveal a compact auto-inhibited dimer: implications for talin activation. J
Struct Biol 184: 21-32
122. Wegener KL, Partridge AW, Han J, Pickford AR, Liddington RC, Ginsberg MH,
Campbell ID (2007) Structural basis of integrin activation by talin. Cell 128: 171-
182
123. Anthis NJ, Wegener KL, Ye F, Kim C, Goult BT, Lowe ED, Vakonakis I, Bate N,
Critchley DR, Ginsberg MH, Campbell ID (2009) The structure of an integrin/talin
complex reveals the basis of inside-out signal transduction. EMBO J 28: 3623-3632
124. Calderwood DA, Zent R, Grant R, Rees DJ, Hynes RO, Ginsberg MH (1999) The
talin head domain binds to integrin beta subunit cytoplasmic tails and regulates
integrin activation. J Biol Chem 274: 28071-28074
125. Lee HS, Bellin RM, Walker DL, Patel B, Powers P, Liu H, Garcia-Alvarez B, de
Pereda JM, Liddington RC, Volkmann N, Hanein D, Critchley DR, Robson RM
(2004) Characterization of an actin-binding site within the talin FERM domain. J
Mol Biol 343: 771-784
126. Barsukov IL, Prescot A, Bate N, Patel B, Floyd DN, Bhanji N, Bagshaw CR,
Letinic K, Di Paolo G, De Camilli P, Roberts GC, Critchley DR (2003)
- 164 -
Phosphatidylinositol phosphate kinase type 1gamma and beta1-integrin cytoplasmic
domain bind to the same region in the talin FERM domain. J Biol Chem 278:
31202-31209
127. Niggli V, Kaufmann S, Goldmann WH, Weber T, Isenberg G (1994) Identification
of functional domains in the cytoskeletal protein talin. Eur J Biochem 224: 951-957
128. Franco SJ, Rodgers MA, Perrin BJ, Han J, Bennin DA, Critchley DR, Huttenlocher
A (2004) Calpain-mediated proteolysis of talin regulates adhesion dynamics. Nat
Cell Biol 6: 977-983
129. Critchley DR, Gingras AR (2008) Talin at a glance. J Cell Sci 121: 1345-1347
130. Tadokoro S, Shattil SJ, Eto K, Tai V, Liddington RC, de Pereda JM, Ginsberg MH,
Calderwood DA (2003) Talin binding to integrin beta tails: a final common step in
integrin activation. Science 302: 103-106
131. Calderwood DA, Yan B, de Pereda JM, Alvarez BG, Fujioka Y, Liddington RC,
Ginsberg MH (2002) The phosphotyrosine binding-like domain of talin activates
integrins. J Biol Chem 277: 21749-21758
132. Garcia-Alvarez B, de Pereda JM, Calderwood DA, Ulmer TS, Critchley D,
Campbell ID, Ginsberg MH, Liddington RC (2003) Structural determinants of
integrin recognition by talin. Mol Cell 11: 49-58
133. Gingras AR, Bate N, Goult BT, Patel B, Kopp PM, Emsley J, Barsukov IL, Roberts
GC, Critchley DR (2010) Central region of talin has a unique fold that binds
vinculin and actin. J Biol Chem 285: 29577-29587
- 165 -
134. Goksoy E, Ma YQ, Wang X, Kong X, Perera D, Plow EF, Qin J (2008) Structural
basis for the autoinhibition of talin in regulating integrin activation. Mol Cell 31:
124-133
135. Martel V, Racaud-Sultan C, Dupe S, Marie C, Paulhe F, Galmiche A, Block MR,
Albiges-Rizo C (2001) Conformation, localization, and integrin binding of talin
depend on its interaction with phosphoinositides. J Biol Chem 276: 21217-21227
136. Song X, Yang J, Hirbawi J, Ye S, Perera HD, Goksoy E, Dwivedi P, Plow EF,
Zhang R, Qin J (2012) A novel membrane-dependent on/off switch mechanism of
talin FERM domain at sites of cell adhesion. Cell Res 22: 1533-1545
137. Yan B, Calderwood DA, Yaspan B, Ginsberg MH (2001) Calpain cleavage
promotes talin binding to the beta 3 integrin cytoplasmic domain. J Biol Chem 276:
28164-28170
138. Moser M, Legate KR, Zent R, Fassler R (2009) The tail of integrins, talin, and
kindlins. Science 324: 895-899
139. Ratnikov B, Ptak C, Han J, Shabanowitz J, Hunt DF, Ginsberg MH (2005) Talin
phosphorylation sites mapped by mass spectrometry. J Cell Sci 118: 4921-4923
140. Murata K, Sakon M, Kambayashi J, Okuyama M, Hase T, Mori T (1995) Platelet
talin is phosphorylated by calyculin A. J Cell Biochem 57: 120-126
141. Litchfield DW, Ball EH (1986) Phosphorylation of the cytoskeletal protein talin by
protein kinase C. Biochem Biophys Res Commun 134: 1276-1283
- 166 -
142. Litchfield DW, Ball EH (1990) Phosphorylation of high molecular weight proteins
in platelets treated with 12-O-tetradecanoylphorbol-13-acetate. Biochem Int 20:
615-621
143. Huang C, Rajfur Z, Yousefi N, Chen Z, Jacobson K, Ginsberg MH (2009) Talin
phosphorylation by Cdk5 regulates Smurf1-mediated talin head ubiquitylation and
cell migration. Nat Cell Biol 11: 624-630
144. Johnson LN, Barford D (1993) The effects of phosphorylation on the structure and
function of proteins. Annu Rev Biophys Biomol Struct 22: 199-232
145. Meyerson M, Enders GH, Wu CL, Su LK, Gorka C, Nelson C, Harlow E, Tsai LH
(1992) A family of human cdc2-related protein kinases. EMBO J 11: 2909-2917
146. Tsai LH, Takahashi T, Caviness VS, Jr., Harlow E (1993) Activity and expression
pattern of cyclin-dependent kinase 5 in the embryonic mouse nervous system.
Development 119: 1029-1040
147. Nikolic M, Dudek H, Kwon YT, Ramos YF, Tsai LH (1996) The cdk5/p35 kinase
is essential for neurite outgrowth during neuronal differentiation. Genes Dev 10:
816-825
148. Duan X, Chang JH, Ge S, Faulkner RL, Kim JY, Kitabatake Y, Liu XB, Yang CH,
Jordan JD, Ma DK, Liu CY, Ganesan S, Cheng HJ, Ming GL, Lu B, Song H (2007)
Disrupted-In-Schizophrenia 1 regulates integration of newly generated neurons in
the adult brain. Cell 130: 1146-1158
- 167 -
149. Nikolic M, Chou MM, Lu W, Mayer BJ, Tsai LH (1998) The p35/Cdk5 kinase is a
neuron-specific Rac effector that inhibits Pak1 activity. Nature 395: 194-198
150. Xie Z, Sanada K, Samuels BA, Shih H, Tsai LH (2003) Serine 732 phosphorylation
of FAK by Cdk5 is important for microtubule organization, nuclear movement, and
neuronal migration. Cell 114: 469-482
151. Jessberger S, Gage FH, Eisch AJ, Lagace DC (2009) Making a neuron: Cdk5 in
embryonic and adult neurogenesis. Trends Neurosci 32: 575-582
152. Tsai LH, Delalle I, Caviness VS, Jr., Chae T, Harlow E (1994) p35 is a neural-
specific regulatory subunit of cyclin-dependent kinase 5. Nature 371: 419-423
153. Tang D, Yeung J, Lee KY, Matsushita M, Matsui H, Tomizawa K, Hatase O, Wang
JH (1995) An isoform of the neuronal cyclin-dependent kinase 5 (Cdk5) activator. J
Biol Chem 270: 26897-26903
154. Humbert S, Dhavan R, Tsai L (2000) p39 activates cdk5 in neurons, and is
associated with the actin cytoskeleton. J Cell Sci 113 ( Pt 6): 975-983
155. Hsu FN, Chen MC, Chiang MC, Lin E, Lee YT, Huang PH, Lee GS, Lin H (2011)
Regulation of androgen receptor and prostate cancer growth by cyclin-dependent
kinase 5. J Biol Chem 286: 33141-33149
156. Strock CJ, Park JI, Nakakura EK, Bova GS, Isaacs JT, Ball DW, Nelkin BD (2006)
Cyclin-dependent kinase 5 activity controls cell motility and metastatic potential of
prostate cancer cells. Cancer Res 66: 7509-7515
- 168 -
157. Wei FY, Nagashima K, Ohshima T, Saheki Y, Lu YF, Matsushita M, Yamada Y,
Mikoshiba K, Seino Y, Matsui H, Tomizawa K (2005) Cdk5-dependent regulation
of glucose-stimulated insulin secretion. Nat Med 11: 1104-1108
158. Gao C, Negash S, Guo HT, Ledee D, Wang HS, Zelenka P (2002) CDK5 regulates
cell adhesion and migration in corneal epithelial cells. Mol Cancer Res 1: 12-24
159. Nakano N, Nakao A, Ishidoh K, Tsuboi R, Kominami E, Okumura K, Ogawa H
(2005) CDK5 regulates cell-cell and cell-matrix adhesion in human keratinocytes.
Br J Dermatol 153: 37-45
160. Bosutti A, Qi J, Pennucci R, Bolton D, Matou S, Ali K, Tsai LH, Krupinski J, Petcu
EB, Montaner J, Al Baradie R, Caccuri F, Caruso A, Alessandri G, Kumar S,
Rodriguez C, Martinez-Gonzalez J, Slevin M (2013) Targeting p35/Cdk5 Signalling
via CIP-Peptide Promotes Angiogenesis in Hypoxia. PLoS One 8: e75538
161. Ferlay J, Steliarova-Foucher E, Lortet-Tieulent J, Rosso S, Coebergh JW, Comber
H, Forman D, Bray F (2013) Cancer incidence and mortality patterns in Europe:
estimates for 40 countries in 2012. Eur J Cancer 49: 1374-1403
162. Pettaway CA, Pathak S, Greene G, Ramirez E, Wilson MR, Killion JJ, Fidler IJ
(1996) Selection of highly metastatic variants of different human prostatic
carcinomas using orthotopic implantation in nude mice. Clin Cancer Res 2: 1627-
1636
163. Thalmann GN, Anezinis PE, Chang SM, Zhau HE, Kim EE, Hopwood VL, Pathak
S, von Eschenbach AC, Chung LW (1994) Androgen-independent cancer
- 169 -
progression and bone metastasis in the LNCaP model of human prostate cancer.
Cancer Res 54: 2577-2581
164. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J,
Yaswen P, Cooper PK, Kaufman PD (2009) A versatile viral system for expression
and depletion of proteins in mammalian cells. PLoS One 4: e6529
165. Kim SJ, Johnson M, Koterba K, Herynk MH, Uehara H, Gallick GE (2003)
Reduced c-Met expression by an adenovirus expressing a c-Met ribozyme inhibits
tumorigenic growth and lymph node metastases of PC3-LN4 prostate tumor cells in
an orthotopic nude mouse model. Clin Cancer Res 9: 5161-5170
166. Park SI, Zhang J, Phillips KA, Araujo JC, Najjar AM, Volgin AY, Gelovani JG,
Kim SJ, Wang Z, Gallick GE (2008) Targeting SRC family kinases inhibits growth
and lymph node metastases of prostate cancer in an orthotopic nude mouse model.
Cancer Res 68: 3323-3333
167. Bazzoni G, Shih DT, Buck CA, Hemler ME (1995) Monoclonal antibody 9EG7
defines a novel beta 1 integrin epitope induced by soluble ligand and manganese,
but inhibited by calcium. J Biol Chem 270: 25570-25577
168. Lenter M, Uhlig H, Hamann A, Jeno P, Imhof B, Vestweber D (1993) A
monoclonal antibody against an activation epitope on mouse integrin chain beta 1
blocks adhesion of lymphocytes to the endothelial integrin alpha 6 beta 1. Proc Natl
Acad Sci U S A 90: 9051-9055
- 170 -
169. Barthel SR, Johansson MW, McNamee DM, Mosher DF (2008) Roles of integrin
activation in eosinophil function and the eosinophilic inflammation of asthma. J
Leukoc Biol 83: 1-12
170. Mould AP, Garratt AN, Askari JA, Akiyama SK, Humphries MJ (1995)
Identification of a novel anti-integrin monoclonal antibody that recognises a ligand-
induced binding site epitope on the beta 1 subunit. FEBS Lett 363: 118-122
171. Mould AP, Askari JA, Barton S, Kline AD, McEwan PA, Craig SE, Humphries MJ
(2002) Integrin activation involves a conformational change in the alpha 1 helix of
the beta subunit A-domain. J Biol Chem 277: 19800-19805
172. Vachon PH (2011) Integrin signaling, cell survival, and anoikis: distinctions,
differences, and differentiation. J Signal Transduct 2011: 738137
173. Takeshita F, Patrawala L, Osaki M, Takahashi RU, Yamamoto Y, Kosaka N,
Kawamata M, Kelnar K, Bader AG, Brown D, Ochiya T (2010) Systemic delivery
of synthetic microRNA-16 inhibits the growth of metastatic prostate tumors via
downregulation of multiple cell-cycle genes. Mol Ther 18: 181-187
174. Jahangiri A, Aghi MK, Carbonell WS (2014) beta1 integrin: Critical path to
antiangiogenic therapy resistance and beyond. Cancer Res 74: 3-7
175. Barthel SR, Hays D, Yazawa EM, Opperman MJ, Walley KC, Nimrichter L,
Burdick MM, Gillard BM, Moser MT, Pantel K, Foster BA, Pienta KJ, Dimitroff
CJ (2013) Definition of molecular determinants of prostate cancer cell bone
extravasation. Cancer Res 73: 942-952
- 171 -
176. Lin TH, Liu HH, Tsai TH, Chen CC, Hsieh TF, Lee SS, Lee YJ, Chen WC, Tang
CH (2013) CCL2 increases alphavbeta3 integrin expression and subsequently
promotes prostate cancer migration. Biochim Biophys Acta 1830: 4917-4927
177. Zheng DQ, Woodard AS, Fornaro M, Tallini G, Languino LR (1999) Prostatic
carcinoma cell migration via alpha(v)beta3 integrin is modulated by a focal
adhesion kinase pathway. Cancer Res 59: 1655-1664
178. Calderwood DA (2004) Integrin activation. J Cell Sci 117: 657-666
179. Kim C, Ye F, Hu X, Ginsberg MH (2012) Talin activates integrins by altering the
topology of the beta transmembrane domain. J Cell Biol 197: 605-611
180. McCabe NP, De S, Vasanji A, Brainard J, Byzova TV (2007) Prostate cancer
specific integrin alphavbeta3 modulates bone metastatic growth and tissue
remodeling. Oncogene 26: 6238-6243
181. Cress AE, Rabinovitz I, Zhu W, Nagle RB (1995) The alpha 6 beta 1 and alpha 6
beta 4 integrins in human prostate cancer progression. Cancer Metastasis Rev 14:
219-228
182. Sun YX, Fang M, Wang J, Cooper CR, Pienta KJ, Taichman RS (2007) Expression
and activation of alpha v beta 3 integrins by SDF-1/CXC12 increases the
aggressiveness of prostate cancer cells. Prostate 67: 61-73
183. Calderwood DA (2004) Talin controls integrin activation. Biochem Soc Trans 32:
434-437
- 172 -
184. Praekelt U, Kopp PM, Rehm K, Linder S, Bate N, Patel B, Debrand E, Manso AM,
Ross RS, Conti F, Zhang MZ, Harris RC, Zent R, Critchley DR, Monkley SJ (2012)
New isoform-specific monoclonal antibodies reveal different sub-cellular
localisations for talin1 and talin2. Eur J Cell Biol 91: 180-191
185. Liu J, He X, Qi Y, Tian X, Monkley SJ, Critchley DR, Corbett SA, Lowry SF,
Graham AM, Li S (2011) Talin1 regulates integrin turnover to promote embryonic
epithelial morphogenesis. Mol Cell Biol 31: 3366-3377
186. Pfaff M, Liu S, Erle DJ, Ginsberg MH (1998) Integrin beta cytoplasmic domains
differentially bind to cytoskeletal proteins. J Biol Chem 273: 6104-6109
187. Zhang X, Jiang G, Cai Y, Monkley SJ, Critchley DR, Sheetz MP (2008) Talin
depletion reveals independence of initial cell spreading from integrin activation and
traction. Nat Cell Biol 10: 1062-1068
188. Ye F, Kim C, Ginsberg MH (2011) Molecular mechanism of inside-out integrin
regulation. J Thromb Haemost 9: 20-25
189. Ye F, Petrich BG, Anekal P, Lefort CT, Kasirer-Friede A, Shattil SJ, Ruppert R,
Moser M, Fassler R, Ginsberg MH (2013) The mechanism of kindlin-mediated
activation of integrin alphaIIbbeta3. Curr Biol 23: 2288-2295
190. Das M, Ithychanda S, Qin J, Plow EF (2014) Mechanisms of talin-dependent
integrin signaling and crosstalk. Biochim Biophys Acta 1838: 579-588
- 173 -
191. Utreras E, Keller J, Terse A, Prochazkova M, Iadarola MJ, Kulkarni AB (2012)
Transforming growth factor-beta1 regulates Cdk5 activity in primary sensory
neurons. J Biol Chem 287: 16917-16929
192. Jones E, Pu H, Kyprianou N (2009) Targeting TGF-beta in prostate cancer:
therapeutic possibilities during tumor progression. Expert Opin Ther Targets 13:
227-234
193. Virolle T, Krones-Herzig A, Baron V, De Gregorio G, Adamson ED, Mercola D
(2003) Egr1 promotes growth and survival of prostate cancer cells. Identification of
novel Egr1 target genes. J Biol Chem 278: 11802-11810
194. Edlund M, Miyamoto T, Sikes RA, Ogle R, Laurie GW, Farach-Carson MC, Otey
CA, Zhau HE, Chung LW (2001) Integrin expression and usage by prostate cancer
cell lines on laminin substrata. Cell Growth Differ 12: 99-107
195. Weaver VM, Petersen OW, Wang F, Larabell CA, Briand P, Damsky C, Bissell MJ
(1997) Reversion of the malignant phenotype of human breast cells in three-
dimensional culture and in vivo by integrin blocking antibodies. J Cell Biol 137:
231-245
196. Park CC, Zhang H, Pallavicini M, Gray JW, Baehner F, Park CJ, Bissell MJ (2006)
Beta1 integrin inhibitory antibody induces apoptosis of breast cancer cells, inhibits
growth, and distinguishes malignant from normal phenotype in three dimensional
cultures and in vivo. Cancer Res 66: 1526-1535
- 174 -
197. Staunton DE, Lupher ML, Liddington R, Gallatin WM (2006) Targeting integrin
structure and function in disease. Adv Immunol 91: 111-157
198. Bhaskar V, Zhang D, Fox M, Seto P, Wong MH, Wales PE, Powers D, Chao DT,
Dubridge RB, Ramakrishnan V (2007) A function blocking anti-mouse integrin
alpha5beta1 antibody inhibits angiogenesis and impedes tumor growth in vivo. J
Transl Med 5: 61
199. Karlou M, Tzelepi V, Efstathiou E (2010) Therapeutic targeting of the prostate
cancer microenvironment. Nat Rev Urol 7: 494-509
200. Youns MM, Abdel Wahab AH, Hassan ZA, Attia MS (2013) Serum Talin-1 is a
Potential Novel Biomarker for Diagnosis of Hepatocellular Carcinoma in Egyptian
Patients. Asian Pac J Cancer Prev 14: 3819-3823
201. Le Tourneau C, Faivre S, Laurence V, Delbaldo C, Vera K, Girre V, Chiao J,
Armour S, Frame S, Green SR, Gianella-Borradori A, Dieras V, Raymond E (2010)
Phase I evaluation of seliciclib (R-roscovitine), a novel oral cyclin-dependent
kinase inhibitor, in patients with advanced malignancies. Eur J Cancer 46: 3243-
3250
202. Ju L, Zhou C (2013) Integrin beta 1 enhances the epithelial-mesenchymal transition
in association with gefitinib resistance of non-small cell lung cancer. Cancer
Biomark 13: 329-336
- 175 -
Vita
Jung-Kang Jin was born in Keelung, Taiwan, the son of Tzu-Shen Jin and Shiou-
Fang Han. He graduated from Er Xin High School in Keelung, Taiwan before serving in the military for two years. He received a Bachelor of Science in botany from National
Chung-Hsing University, Taiwan in 2002. For the next two years, he worked as a
Research assistant in the Department of Botany at the National Chung-Hsing University,
Taiwan . In 2004, he entered San Diego State University, San Diego, California, and then received a Master of Science in molecular and biochemistry science in 2007. Then he worked at Roche Pharmaceuticals, Palo Alto, California as a research associate. In 2008, he entered the Graduate School of Biomedical Sciences at the University of Texas Health
Science Center at Houston, Texas.
- 176 -