Supplemental Figure 1
A AICDA APOBEC1 APOBEC2 APOBEC3A APOBEC3B 1.2
● * ● ● ● ● ● 6
● ●
1.0 ●
● 3 ● ● 1.5 ● ● 3 5 ●
● ● ● ● ●● ● ● ● ● ●
● ● ● ● ● 0.8 ● ●
● ● ● ● 4 ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 2 ● ● ● ● ● ● ● ● ●● 1.0 ● ● ● ● ● ● 2 ● ● ● ● ● ● ● ● ● ● ● ● ● 0.6 ● ●● ● ●● ● ●● ● ●● ● ● ● 3 ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ●● ●● ● ● ● ● ● Log2 (TPM+1) ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● 0.4 ●● ● 2 ●●● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● 1 ● ● ●● ● ● ● 0.5 ● ● ●● ● 1 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ●● ●●● ● ● ● ●● ● ● ● ● ● 1 ● ● ● ● ●● ● 0.2 ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ●● ● ●●● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ●● ●● ●●●● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ●● ● ● ● ● ● ● ●●●● ● ● ●● ● ● ● ● ●●● ● ● ● ● ● ●● ●●● ● ● ● ● ●● ●●● ●●● ● ● ● ● ● ●● ● ● ●● ● ●● ● ●●●●● ●● ●● ● ● ● ●●● ●●●●● ● ● ● ● ●● ● ● ● ●● ●●●● ●● ● ●●● ● ●●● ● ● ● ● ●●●●● ● ● ● ● ●● ●● ● ●● ● ● ● ● ●●● ●● ●●● ●● ●● ● ● ● ●●●●●●●● ● ● ●● ● ●●●●● ●● ● ●●●● ●●● ● ● ●● ● ● ●● ● ● ●● ●● ● ● ● ● ● ● ●● ● ●● ●●●●● ● ● ● ● ● ●● ● ● ●●●● ●● ● ● ● ● ●● ●●●● ●● ● ●● ●●●●● ● ●● ●● ● ●● ● ● ●●●● ●●●●●● ● ● ●● ● ● ● ● ● ● ●●●● ●●●●● ● ● ● ●●●● ● ●●● ● ●● ●● ● ●●●●●●● ● ● ● ●●●●●●● ●● ●●● ● ●●● ● ● ● ● ●●●●●●● ● ●● ● ● ● ● ●● ●●●●●● ●●●●●●●●●● ●●●● ● ● ●● ● ●● ● ● ● ● ● ●● ● ● ● ●● ● ●● ●●●●● ●●● ●● ● ● ●●●● ●● ● ● ●●●●●●●● ● ● ●●●● ●●●●● ●●● ● ●● ● ● ●● ● ● ● ●●●●●●●●●●●●●●●●●●●●● ●● ● ● ● ●●●●● ●●●●● ● ●● ● ● ● ●●● ● ●●● ●●● ●●● ●● ● ● ● ● ●● ●●●●●●● ●●●●●● ●●●●● ●●●●●●● ●●● ●●●● ●●●●● ● ●●● ● ● ● ● ●●●●●●●●●●●●●●● ●●●●● ● ●●● ● ●●●●●●●● ●●●●● ●●● ●● ● ●●●● ● ●●● ● ●● ● ●●●●●● ● ●●●●●● ●●●●●●●●●●●●●●● ●●●●● ●●●●● ● ●● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ● ●●●● ●●● ●●● ● ●●●● ●● ●●●●●●● ● ●● ● ●● ●●● ●●● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●● ●●●●●●●●●● ●●●●●●●●● ●●●●●●●●●●●●●●●●●● ●● ● 0.0 ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● 0.0 ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● 0 0 0 LIHC LIHC LIHC LIHC LIHC (num(T)=369; num(N)=160)(num(T)=369; num(N)=160) (num(T)=369; num(N)=160) (num(T)=369; num(N)=160)(num(T)=369; num(N)=160) APOBEC3C APOBEC3D APOBEC3F APOBEC3G APOBEC3H 4 4 3.0 ● ● ● ● ● 6 ● ● 6 ●
● ●
● ● ● ● ● 2.5 ●
5 ● ● 5 ● ● 3 ● 3 ● ● ●
● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 2.0 ● ● ● ● ● ● ● ● ● ● 4 4 ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 2 2 ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● 1.5 ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● 3 ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● 3 ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ●●● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ●●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●
Log2 (TPM+1) ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ●● ●● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ●● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● 1.0 ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● 2 ● ●●● ●● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ●● ● ●●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ●●● ● ● ● ●● ● ● ● ●● ● ● ● ●● ● ●● ● ●● ● ● ● ● ● ● ● ●● ● ● ●● ●● ● ●● ● ● 2 ●● ● ● ●● ● ●●● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ●● ●● ● ●● ● ● ● ● ● ● ● ● ● ●● ●● ● ●●● ● ● ●● ● ●● ●● ●● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ●● ●● ● ● ● ●● ● ● ● ●●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ●●● ●● ● ●● ● ● ● ● ● ● ●● ●● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● 1 ●● ● ●● ● 1 ● ● ●● ● ● ● ● ● ● ●●●●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ●● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ●●● ● ●● ●● ● ●● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ●●● ●● ● ● ● ● ● ● ● ● ●● ●●●●● ● ● ● ● ●● ● ● ●● ● ● ● ●● ● ●● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●●● ● ● ●● ● ●●● ● ● ●● ●●●●●● ● ●● ● ●●● ●● ● ● ●● ● ●●● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ●● ●● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ●●● ●●●● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ● ●●●●● ● ●● ● ● ●●● ● ● ●● ● ●● ● ● ● ● ●● ●● ● ● ● ●●●● ● ●● ●● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ●● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ●● ● ●●● ● ● ● ● ●● ● ● ● ● ●● ● ● ●●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●●●● ● ● ● ● ● ● ●● ●●● ●●● ● ● ● ● ● ●●● ● ●● ● ● ●● ● ●●● ● ● ● ●● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● 0.5 ●● ● ● ● ●● ●● ● ●● ● ●● ● ● ●● ● ● ● ● ●● ● ●●● ●● ● ●● ● ●● ● ● ●● ● ● ● ●● ●●● ●● ● ●●● ●● ● ●●●●●●● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● 1 ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●●● ● ●● ● ●● ● ● ● ● ● ●● ● ●● ● ● ●● ● ● ●● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ●● ● ● ●● ●● ● ● ● ●● ● ● ● ●● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ●● ● ● ●● ● ● ● ● ● ●●● ●●● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ●●● ● ● ● ● ● ●● ●● ● ● ● ●● ● ● ●● ● ● ●● ● ●●●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ●● ●● ● ● ● ● ●● ● ● ●●● ● ● ● ● ●● ●● ● ●●● ● ●● ● ● ● ● ●● ● ● ● ● ● ● 1 ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ●●● ● ● ● ● ● ● ●● ● ●● ●●● ● ● ● ● ● ● ● ● ● ●● ●●● ●●● ● ● ● ● ● ● ●●● ● ● ● ●● ● ● ● ● ● ●● ●● ● ● ● ● ● ●● ● ● ●● ●● ● ●● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ●● ● ● ●● ● ● ●● ●● ● ● ● ● ●●●●●●● ●● ●● ●● ● ● ●●●●●●●●●● ● ●● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ●● ●● ●● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ●●●● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ●● ● ●●● ● ● ● ● ● ● ● ● ● ● ●● ●●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ●● ● ●● ● ● ●●● ●● ● ●● ● ● ● ●● ● ● ● ● ● ●● ● ● ●● ●● ●●● ● ●●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ●● ●● ● ● ●●● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ●● ● ● ● ● ●● ● ● ● ●●● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ●●● ● ●●●● ●● ● ● ●●● ● ●● ● ● ● ●●● ● ● ●● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0 0 0 ● 0.0 ●● ●●●●●● ● ●●●● LIHC LIHC LIHC LIHC LIHC (num(T)=369; num(N)=160) (num(T)=369; num(N)=160) (num(T)=369; num(N)=160) (num(T)=369; num(N)=160) (num(T)=369; num(N)=160) B GSE45436 Normal Tumor *** Log2 expression
AICDA APOBEC1 APOBEC2 A3A A3B A3C A3D A3F A3G A3H C 40 Tumor * Normal
s to Actin 30 l eve
ion l 20 ess r p ex 10 ve i t a l e R 0 APOBEC3B APOBEC3C APOBEC3D APOBEC3F APOBEC3G APOBEC3H Supplemental Figure 2
A B Overall Survival Disease Free Survival Overall Survival Disease Free Survival Low APOBEC3A TPM Low APOBEC3A TPM Low APOBEC3B TPM 1.0 1.0 1.0 Low APOBEC3B TPM High APOBEC3A TPM High APOBEC3A TPM 1.0 High APOBEC3B TPM High APOBEC3B TPM Logrank p=0.8 al Logrank p=0.078 Logrank p=0.03 al al al
v Logrank p=0.037 v HR(high)=0.95 HR(high)=0.76 v HR(high)=1.5 v 0.8 0.8 0.8 vi HR(high)=1.4 vi
p(HR)=0.8 vi
p(HR)=0.081 p(HR)=0.031 0.8 r vi r r p(HR)=0.038 n(high)=177 n(high)=177 n(high)=181 r n(low)=175 n(low)=175 n(low)=181 n(high)=181
0.6 n(low)=181 0.6 0.6 0.6 0.4 0.4 0.4 ercent su 0.4 ercent su ercent su ercent su P P P P 0.2 0.2 0.2 0.2 0.0 0.0 0.0 0.0 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 Months Months Months Months C D Overall Survival Disease Free Survival Overall Survival Disease Free Survival Low APOBEC3C TPM Low APOBEC3D TPM 1.0 Low APOBEC3C TPM 1.0 High APOBEC3C TPM 1.0 Low APOBEC3D TPM Logrank p=0.88 High APOBEC3C TPM High APOBEC3D TPM 1.0 High APOBEC3D TPM al al Logrank p=0.37 al Logrank p=1 al Logrank p=0.22
HR(high)=1 v v v
HR(high)=0.87 HR(high)=1 v 0.8 0.8 p(HR)=0.87 0.8 HR(high)=0.83 vi vi vi 0.8
p(HR)=0.36 p(HR)=1 vi r r r n(high)=181 n(high)=181 n(high)=181 r p(HR)=0.22 n(low)=181 n(low)=181 n(low)=181 n(high)=181 0.6 0.6
0.6 n(low)=181 0.6 0.4 0.4 0.4 0.4 ercent su ercent su ercent su ercent su P P P P 0.2 0.2 0.2 0.2 0.0 0.0 0.0 0.0 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 Months Months E F Months Months Overall Survival Disease Free Survival Overall Survival Disease Free Survival Low APOBEC3F TPM Low APOBEC3F TPM Low APOBEC3G TPM Low APOBEC3G TPM 1.0 1.0 1.0 High APOBEC3F TPM 1.0 High APOBEC3F TPM High APOBEC3G TPM High APOBEC3G TPM al al Logrank p=0.27 Logrank p=0.11 al Logrank p=0.73 al Logrank p=0.45 v v v v HR(high)=1.2 HR(high)=1.3 HR(high)=1.1 HR(high)=0.89 0.8 0.8 0.8 0.8 vi vi vi vi p(HR)=0.27 p(HR)=0.11 r
r p(HR)=0.72 p(HR)=0.45 r r n(high)=182 n(high)=182 n(high)=182 n(high)=182 n(low)=182 n(low)=182 n(low)=182 n(low)=182 0.6 0.6 0.6 0.6 0.4 0.4 0.4 0.4 ercent su ercent su ercent su ercent su P P P P 0.2 0.2 0.2 0.2 0.0 0.0 0.0 0.0 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 Months Months Months Months G H Overall Survival Disease Free Survival Overall Survival Disease Free Survival
1.0 Low APOBEC3H TPM Low APOBEC3H TPM Low APOBEC2 TPM 1.0 1.0 Low APOBEC2 TPM High APOBEC3H TPM High APOBEC3H TPM High APOBEC2 TPM 1.0 High APOBEC2 TPM al al al Logrank p=0.14 al Logrank p=0.0073 Logrank p=0.17 Logrank p=0.1 v v v HR(high)=0.76 v HR(high)=0.66 0.8 HR(high)=1.3 HR(high)=1.3 0.8 vi 0.8 0.8 vi vi vi
p(HR)=0.0076 r r r p(HR)=0.14 r p(HR)=0.17 p(HR)=0.1 n(high)=177 n(high)=177 n(high)=178 n(high)=178 n(low)=179 n(low)=179 n(low)=160 n(low)=160 0.6 0.6 0.6 0.6 0.4 0.4 0.4 0.4 ercent su ercent su ercent su ercent su P P P P 0.2 0.2 0.2 0.2 0.0 0.0 0.0 0.0 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 Months Months Months Months Supplemental Figure 3
A C H
s 500 HepG2 MHCC97H 250 4 Vector-DOX A3B -DOX 2.5 Vector+DOX A3B +DOX n 10
3 ) 2.0 g ( 0 nm)
8 t 2 6 igh A3B/Acti 1.5 e w 4 OD (57 1 r 2 o 1.0 m Relative expression level 0 0 Tu 0 24 48 72 0.5
LO2 Time (h) HepG2 0.0 HCCLM3 PLC/PRF/5MHCC97LMHCC97H shCon shA3B B I shCon shA3B Tet on particle 0 2 4 DOX (μg/ml) CMV Tet3G IRES Neomycin APOBEC3B
Actin
TRE APOBEC3B expression particle Liver
TRE3G APOBEC3BHis SV40 EGFP IRES Puromycin
D E F G MHCC97L MHCC97H MHCC97H 3 MHCC97L s 1.5 3 s 1.5 **** **** **** **** 1.0 1.0 2 2
0.5 0.5 1 1 A3B/Actin OD (570 nm) A3B/Actin OD (570 nm)
0.0 Relative expression level 0.0 0
Relative expression level 0 siNC siA3B-1 siA3B-2 siNC siA3B-1 siA3B-2 siNC siA3B-1 siA3B-2 siNC siA3B-1siA3B-2 Supplemental Figure 4
A B C Tumor MDSC Hepa1-6>Primary macrophage Hepa1-6>Primary MDSC 25 pT3-EGFP pT3-A3B 8 DMEM pT3-EGFP pT3-A3B
s to Actin 5 pT3-EGFP l s to Actin s to Actin
l ** l 20 ** pT-A3B **
6 eve 4 eve eve 15 ion l
ion l * * ion l 3 ** 6 ** 4 ess r ess ess r r p 2 * * p
p 4 ** 2 ex ** ex ex
2 * * 1 ve i ve ve t i i t t a
0 l a
a 0 0 l l e e e TNF-AIL1βIL12A ARG1 IL10 Arg1 iNOS PDL1 R ARG1 iNOS CLEC7A PDL1 S100A9 R R Supplemental Figure 5
E A pT3-Vector pT3-mA3 8 * DEN (25 mg/kg) pT3-mA3-Flag Euthanized
) 6 % (
Birth 2w 2m 8m MDSC MDSC C 4 2.56% 7.32% S CD11b D B Vehicle pT3-vector pT3-mA3 M 2
0 Gr1 pT3-Vector pT3-mA3
F 30 pT3-Vector pT3-mA3 *
) 20 % (
pT3-vector pT3-mA3 M A CD11b N P T N P T TAM TAM T 10 mA3 16.1% 26.5% Flag 0 Actin F4/80 pT3-Vector pT3-mA3 G H C D 4 Vehicle * pT3-vector 40 4 <1mm pT3-Vector pT3-mA3 3
pT3-mA3 (%) 1-3mm +
) ** ** 2 g
30 PD1 r (
3 + >3mm e t b
igh 1 m F4/80 40 X CD8 e u n
w 2 r 20
o 0 ver m pT3-Vector pT3-mA3 Li u pT3-vector pT3-mA3
T J ) 1 10 8 3.0 y(×10 c n
0 e 0 i 2.5 * c I Vehicle vector mA3 i Eff
t n
CD11b+ a 2.0 pT3-mA3 DEN(100 mg/kg) image di transplantation a R g
v 1.5
30 Day 18 hour 12 hour A pT3-vector pT3-mA3 Supplemental Figure 6
A B C Peritumor Cell Type Enrichment mA3 vs Con GO biological process 30 Immune system process AdrenalCortex ● BDCA4+_DendriticCells ● 25 ● Fetallung Qvalue Innate immune response 1.00 Lung ● 0.75 20 0.50 0.25 Inflammatory response CingulateCortex ●
GeneNumber 15 10 ● CD19+_BCells(neg._sel.) ● 5 ● 10 Integrin mediated signaling pathway ● ● 15 Peritumor CD33+_Myeloid 10 5 ● 20 ● 25 WholeBlood ● -Log10 (p value)
Pyroptosis −log10(FDR) 5 Thalamus ● CD14+_Monocytes ● 0 Negative regulation of gluconeogenesis 0.02 0.03 0.04 0.05 0.06 -4 -2 0 2 4 RichFactor Log2 (Flod change) Leukocyte cell−cell adhesion 0 10 20 30 D E F mA3 vs Con Canonical pathways Tumor Cell Type Enrichment 30 Immune System intestine_large ●
25 Hemostasis mIMCD−3 ● 40 lacrimal_gland ● Adaptive Immune System GeneNumber 20 ● 40 35 macrophage_peri_LPS_thio_7hrs ● ● 60 Metabolism of lipids and lipoproteins ● 80 15 30 macrophage_peri_LPS_thio_1hrs ● Qvalue 0.75 Tumor
Pathways in cancer −log10(FDR) 10 placenta ● 0.50 0.25 intestine_small ●
-Log10 (p value) Platelet activation, signaling and aggregation 5 Focal adhesion macrophage_peri_LPS_thio_0hrs ●
0 MEF ● Integrin cell surface interactions -4 -2 0 2 4 0.120.140.160.180.20 Log2 (Flod change) 0 50 100 RichFactor G H I Peritumor mA3 vs Con Tumor mA3 vs Con Tumor mA3 vs Con
NES=1.72 NES=1.71 p-value=0 NES=3.46 p-value=0.005 FDR=0 p-value=0 FDR=0.002 FDR=0
Con mA3 Con mA3 Con mA3 K C A E F
Relative expression levels H A3B/Actin Relative expression levels Supplemental Figure7 pT3-Vector Relative expression levels to Actin Relative expression levels 10 100 150 CM APOBEC pT3-mA3 +RS 4 6 8 1 50
CCL1 2/Actin1 2 2 0 2 4 6 8 pT3-A3B pT3-EGFP 0 0 0 0 to Actin 0 0 0 1 2 3 4 5 0 5 0 5 0 5 p CCL T PB
3 Relative expression levels CCL * -
3 *** s s * S E h ARG1/Actin h 10 0 h * 2 G 2 4 6 8 L A CCL2 C 0 1 2 3 4 5 * p p 0 0 0 0 F Tβ IL34 3 0 o T T P pT3-mA3 *** B * n 3
CCL3 3 *
S100A1 TN * - - - - E A
4 BMP * GF 3 Fα * IgG S100A B p + p - * P * 0 T T 3 * 7 3
CCL 1 1 2 2
Pr IL34/Actin -v - 9 0 5 IL + - A 0 5 0 5 e i 3 * m PB pT3-Vector
CCL6 8 c B t a pT3-mA3 +RS *** o s s - - L S ry anti-BMP7 CC h h
9 r Tβ C A *** L
*
L hepa Tβ
CCL27a 3 + o
2 *** -
5 B CCL n TN
12 h C
Relative expression levels * *** X t o + - p C Fα 5 c T CCL2/Actin pT3-mA3 C L1 y 3 X 0 1 2 3 4 5 t -
C e A CXCL1L9 p 3 T B 3 CXCL1 D B
-m * + *
I 0
R CXCL1 A CM (pT3-EGFP) Log2 (Fc) S 3
* 3 CM CXCL1 pT3-A3B pT3-EGFP Relative expression levels 1 Bmp4 4 Bmp7 2 ARG1/Actin 6 100 150 200 400 500 600 700 800 Bmp8b 0 p 50 T Fold Change of Avg Ccl2 −2 3 0 0 0 0 0 0 0 0 0
- −4 0
A Radiant Efficiency Ccl25 0 0 1 1 2 2 −6 3
...... CCL2 (pg/mL) 0 5 0 5 0 5 B Ccl27a −8 - - 300 400 500 100 200
s CM (pT3-A3B) Ccl6 h 0 IgG T N + i - Ccl9 *** m Relative expression levels C p p p 0 h e T T T
p Cx3cr1
IL34/Actin + - 3 3 3 T a 0 1 2 3 4 5 - - -
3 Cxadr f t * m m V pT3-mA3 VSpT3-vector e -v * - - e A A
r Cxcl1 anti-IL34 e c
3 3 D ** ** SBTmLC model c t Cxcl10 + o + t - E o p r R N r T Cxcl12 S * 3
* i - + - n
12 h Cxcl13 * A MK0812 CM (pT3-A3B)+ j e 3 Cxcl17 c B * * t
i s o Cxcl9 **
h IL34 (pg/mL) n Pr 60 80 20 40 B Cxcr5 p 0 i M T m Il12rb1 3 P J a -m 7 CM ry Il13ra1
A pT3-A3B pT3-EGFP G hepa Il15ra Relative expression levels 3 Il17ra Relative expression levels ARG1/Actin CM 200 400 600 800 t BLZ945 pT3-A3B pT3-EGFP Il17rb Relative expression o p
BMP7/Actin c T 0 1 2 3 4
y Il17re 3
0 0 0 0 levels 0 t - e A ARG1/Actin Fold change of recruitment Il18 3 0 1 2 3 4 - - 0 2 4 6 8 EGF B Il1r1 *
BMP7 (pg/mL) IgG s 1.0 1.5 0.0 0.5 Il1rap + h - - - - *** I P * L Il1rn ** - A3 3 + + - - - Il22ra1 4 ** B Il23r - - + - - A3B+MK anti-BMP7 * Il2rg * + - - - +
** Il33 ** + + -
+ - Il34 + - + Supplemental Figure 8
A HepG2 B C HepG2 1.5 -DOX -DOX +DOX (2µg/ml) s t i
+DOX (2µg/ml) s MHCC97L
t 1.5 n γH2Ax ni U
U
e c
1.0 ce n en 1.0 sc e r esce r uo fl luo
0.5 f
0.5 e v i ve t i t a l a l e e R
0.0 R 0.0 A3B A3B-Mut 97L shCon shA3B D Breast Invasive Carcinoma Hepatocellular carcinoma Supplementary Figure Legends:
Figure S1 A3B was the only upregulated gene of the APOBEC family in HCC
(A) Expression levels of APOBEC family members in GEPIA database. The differential analysis is based on the selected datasets with TCGA tumors (n=369) vs
TCGA normal + GTEx normal (n=160). *p < 0.01 (one-way ANOVA). (B)
Expression levels of APOBEC family members in human liver cancer (n=95) and non-tumor tissues (n=35) in the GSE45436 dataset. ***p < 0.001 (one-way ANOVA).
(C) RT-qPCR analysis of APOBEC family member mRNA levels in human peripheral and central liver cancer tissues (n=18). *p < 0.05 (Student’s t test). Error bars represent mean ± SEM.
Figure S2. A3B is the only member of the APOBEC family which correlates with poor prognosis of HCC patients
(A-H) Kaplan-Meier overall survival and disease-free survival curves of patients in the GEPIA database with HCC with high and low expressions (stratified by median) of APOBEC family member mRNAs using TCGA data (Log-rank test).
Figure S3. A3B did not stimulate tumor growth in immunodeficient nude mice
(A) RT-qPCR assays of A3B mRNA levels in normal cells L02 and indicated HCC cell lines. (B) Schematic map of construction for tet-on system of induced A3B expression and immunoblot assay analysis of A3B-His protein in HepG2-Teton-A3B cells.(C) Proliferation assays of HepG2-Teton-A3B exposed to doxycycline (2 µg/ml) for the indicated times. (D and E) RT-qPCR assays of A3B mRNA in MHCC97L and
MHCC97H cells with A3B knockdown. After 24h from the transfection of SiA3B, RNA of the cells were extracted for further measurement. (F and G) Proliferation assays of MHCC97L and MHCC97H cells was performed after 72h from the transfection of SiA3B. (H) Weight of the MHCC97H orthotopic tumors in indicated groups 30 days after implantation (n=6 mice per group). (I) Representative images of the MHCC97H orthotopic tumors in the indicated groups 30 days after implantation.
Error bars represent mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 (Student’s t test).
Figure S4. Hepatoma-intrinsic A3B induce expression of immunosuppression-associated genes in TAMs and MDSCs.
(A) Graph showing expression of immunosuppressive-associated genes in BMDMs with exposure to conditioned medium. (B) Graph showing expression of immunosuppression-associated genes in primary MDSCs exposed to conditioned medium. (C) Graph showing expression of immunosuppressive-associated genes in
MDSCs isolated from Hepa1-6-A3B transplantation tumors (n=5). Error bars represent mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 (Student’s t test).
Figure S5. mA3 activates HCC initiation in DEN-induced mouse HCC model
(A) Schematic map of construction for the SBTmLC model. (B) Photomicrographs of representative liver in SBTmLC model at the end time point showed in A. (C-D)
Enumeration of liver weight (C) and total tumor burden (D) of tumors following classification according to their size in the SBTmLC model (n=9 mice per group).
(E-F) The fractions of CD11b+F4/80-Gr1+ MDSCs (E) and CD11b+Gr1-F4/80+ TAMs
(F) were determined by flow cytometry in SBTmLC model (n=3 mice per group). (G) IHC of F4/80 showing the recruitment of macrophages in SBTmLC model. (H) The fractions of CD3+CD8+PD1+ T cells were determined by flow cytometry in SBTmLC model (n=3 mice per group). (I) Schematic map of construction for chemotaxis assay in vivo. (J) Representative ex vivo images of the livers of mice given DiR-labelled
CD11b+ monocytes intravenously, showing monocytes tracking to livers of
DEN-induced acute hepatitis model in mA3 overexpression and parallel control mice
(n=5 mice per group). Error bars represent mean ± SEM. *p < 0.05, **p < 0.01, ***p
< 0.001 (Student’s t test).
Figure S6. Immune landscapes of SBTmLC model.
(A and D) A scatterplot showing the results of the RNA-seq in pT3-mA3 versus pT3-vector in peri-tumor tissues (A) and tumor tissues (D) of the SBTmLC model. (B and E) A summary of the results of the RNA-seq data analyzed by gene ontology in peri-tumor tissues (B) and tumor tissues (E) of the SBTmLC model. (C and F) A summary of the results of the RNA-seq data analyzed by cell type enrichment in peri-tumor tissues (C) and tumor tissues (F) of the SBTmLC model. (G-I) GSEA analysis of the RNA-seq data analyzed by cell type enrichment in peritumor and tumor tissues of the SBTmLC model.
Figure S7. A3B mediates TAMs and MDSCs accumulation triggered by CCL2 to promote HCC progression
(A) RT-qPCR analysis of cytokine mRNA to validation of RNA-seq data in
Hepa1-6-A3B versus Hepa1-6-EGFP. (B) A heatmap showing the cytokine mRNA of
RNA-seq data in the SBTmLC model (n=2 mice per group). (C) RT-qPCR analysis of CCL2 and IL34 mRNA levels in MHCC97H cells with A3B knockdown exposed to
TNF-α or LTα1β2 for 24 hours. (D) Transwell migration assay of iBMDM attracted by
Hepa1-6-A3B. The CCR2 antagonist MK0812 (400 nM) was added. (E) RT-qPCR and ELISA analysis of cytokine mRNA and protein of primary hepatocyte in acute
DEN liver injected model (n=5 mice per group). (F) Representative ex vivo images of the livers of mice given DiR-labelled CD11b+ monocytes intravenously. Mice were treated by i.p. injection with vehicle or RS102895 (5mg/kg). (G-H) RT-qPCR analysis of ARG1 mRNA in iBMDM cells with Hepa1-6-A3B conditioned medium.
A antagonist (G) and neutralizing antibodies (H) were added as indicated. (I-J)
RT-qPCR analysis of ARG1 mRNA in BMDMs with Hepa1-6-A3B conditioned medium. Different neutralizing antibodies were added as indicated. (K) RT-qPCR analysis of CCL2, IL34 and BMP7 mRNA levels in Hepa1-6 tumor with indicated treatment. Error bars represent mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001
(Student’s t test).
Figure S8. A3B does not exhibit C>T deaminase activity in HCC cells
(A) Nuclear DNA C-to-U activity in extracts from HepG2-Teton-A3B/A3BE68Q/E255Q cells exposed to doxycycline (2 μg/ml) for 48 hours. (B) Nuclear DNA C-to-U activity in extracts from MHCC97L cells with A3B stable knockdown. (C)
Representative fields of cells imaged for γ-H2AX in HepG2-Teton-A3B cells exposed to doxycycline (2 μg/ml) for 48 hours. (D) Fold-enrichment of APOBEC mutagenesis signature over the expected occurrence of random mutagenesis from TCGA integrated data in the FireBrowse database. Left: BRCA,1 right: HCC.2 Error bars represent mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 (Student’s t test).
Supplementary Materials and Methods
Animals
The C57BL/6J mice and Balb/C Nude mice were purchased from Shanghai SLAC
Laboratory Animal Co., Ltd. All mice used in the experiments were 6-8 week-old male mice (weighing 20-22 g), and maintained in a 12-hour light and 12-hour dark turnover environment in the Center for New Drug Safety Evaluation and Research in
China Pharmaceutical University. All animal experiments were conducted with the approval of the Center for New Drug Evaluation and Research, China Pharmaceutical
University (Nanjing, China) and in accordance with the National Institutes of Health
Guide for the Care and Use of Laboratory Animals.
Human samples
Frozen human liver tumor tissues and peritumor tissues were obtained from The
Affiliated Drum Tower Hospital. This study was approved by The Affiliated Drum
Tower Hospital Research Ethics Committee, and patients provided their informed consents.
Cell Lines
All cell lines were cultured under an atmosphere of 5% CO2 at 37℃. HepG2,
HCCLM3, Hepa1-6, 293T, iBMDM, bone marrow-derived macrophages (BMDMs) and myeloid-derived suppressor cells (MDSCs) were cultured in DMEM (BI) supplemented with 10% fetal bovine serum (FBS, BI), penicillin (100 U/ml), and streptomycin (100 mg/ml). PLC/PRF/5, MHCC97L and MHCC97H cells were cultured in RPMI 1640 (Bioind) supplemented with 10% FBS (Bioind), penicillin
(100 U/ml), and streptomycin (100 mg/ml).
Bacterial strains
DH5α and Stbl3 were grown in LB medium at 37℃ and used to propagate plasmids.
BL21 were grown in LB medium at 30℃ and used to express recombinant proteins.
Transfections and RNA Interference
Transient transfections and siRNA interference were performed using jetPRIME
(PolyPlus) according to manufacturer’s protocol.
Lentiviral infection
HepG2 cells stably expressing the tetracycline inducible A3B, A3BE68Q/E255Q, and
HCCLM3, MHCC97L and MHCC97H cells with stable knockdown of A3B were generated by lentiviral infection. 293 T packaging cells were used to generate lentivirus according to manufacturer’s protocol (Lenti-Pac HIV Expression Packaging
Kit, GeneCopoeia). lentivirus was supplemented with 5 µg/ml polybrene and used for infection. 72 hours after infection, HepG2 cells were grown in medium containing
G418 (500 µg/ml) to select for the Tet-repressor, puromycin (4 µg/ml) to select for the stably expressing A3B, A3B (E68Q/E255Q). HCCLM3, MHCC97L and
MHCC97H cells were selected with 4 µg/ml puromycin in culture medium. Hepa1-6 cells stably expressing A3B and A3BE68Q/E255Q were generated by sleeping beauty transposon. Hepa1-6 cells were transfected with SB100 and pT3-A3B-EGFP constructs, 14 days after transfection, fluorescence-activated cell sorting was used to isolate Hepa1-6-A3B and Hepa1-6-A3BE68Q/E255Q cell lines.
Protein extraction and Immunoblotting
For nuclear extract preparation: cells were lysed in buffer A (10 mM HEPES, 10 mM
KCl, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM NaF, 2 mM Na3VO4, 0.1 mM PMSF and protease inhibitor cocktail). After 15 min on ice with occasional shaking, the cell lysate was centrifuged for 10 min at 12000g. The nuclear pellet was suspended in
Buffer B (20 mM HEPES, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 2 mM NaF, 2
mM Na3VO4, 0.1 mM PMSF and protease inhibitor cocktail) and occasionally shaken for 60 min on ice. After 12000g centrifugation for 10 min, the supernatant was collected as the nuclear extract. For total protein extraction, cells were incubated in buffer containing 20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% NP-40, 2 mM EDTA,
0.1% SDS, 20 mM NaF, 1 mM Na3VO4, 0.1 mM PMSF and protease inhibitor cocktail and occasionally shaken for 60 min on ice. The cell lysate was centrifuged for 10 min at 12000g, the supernatant was collected as total protein sample.
The extracted proteins (20 µg) were electrophoresed by SDS-PAGE, transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore), and probed with primary antibodies. Primary antibodies were detected by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies and imaging on an ChemiDocTM
XRS+ imaging device (BIO-RAD).
RNA extraction and Real time-PCR RNA extraction was conducted according to the manufacture instructions of RNAiso
Plus (Takara, 9108). 1.5µg total RNA was converted to complementary DNA (cDNA) by reverse transcription according to the instructions of PrimeScript™ RT Reagent
Kit with gDNA Eraser (Takara, RR047A). Realtime-PCR was conducted using
SYBR® Premix Ex Taq™ II (Tli RNase H Plus) (Takara, RR820A) and the signal was detected using Applied Biosystems detector. All primers are listed in table S2.
DNA pull-down assay
The DNA pull-down assay was performed as described previously.3 Briefly, a biotinylated DNA probe corresponding to −456/+107 from the A3B promoter was prepared by PCR. A DNA probe with mutations was prepared with DNA oligonucleotide synthesis and annealing. The biotinylated DNA probe (1 µg) was bound to 150 µg of Dynabeads M-280 Streptavidin (Thermo Fisher) according to manufacturer’s protocol. Nuclear extracts were prepared from HepG2 cells stimulated
by LTα1β2, and 65 µg of the extracted protein was incubated with 150 µg of the
DNA-coupled magnetic beads at 4 °C for 90 min. The beads were washed three times with buffer containing 5 mM Tris-HCl pH7.5, 0.5 mM EDTA, 1 M NaCl, and the bound proteins were eluted in 20 µL of SDS sample buffer and were analyzed with immunoblotting using anti-RelA (8242, CST ) and anti-RelB antibody (10544, SCT).
Chromatin immunoprecipitation (ChIP) assay
The ChIP assay was performed using the EZ-Magna ChIP™ A/G Chromatin
Immunoprecipitation Kit (Millipore) according to manufacturer’s protocol. Anti-RelB, anti-RelA, anti-H3K27me3, anti-EZH2 antibodies and normal IgG were used to precipitate DNA. The precipitated DNA was subjected to PCR to amplify the A3B,
CCL2, IL34 and BMP7 promoter regions with the primers listed in table S2, and was quantified with real-time PCR using SYBR® Green (TAKARA).
Luciferase reporter assay
293T (1×105 cells/well) were grown in 24-well plates for 24 h and transfected with
250 ng of luciferase reporter plasmids of A3B promoter (HPRM21800-LvPG04,
GeneCopoeia), together with 250 ng of pOTENT-1-RelB plasmids or pOTENT-1-vector plasmids. Gaussia luciferase and secreted alkaline phosphatase activities were measured 24 h after transfection, using the Secrete-Pair™ Dual
Luminescence Assay Kit (GeneCopoeia) and a multimode plate reader (PerkinElmer).
The Gaussia luciferase activities were normalized to the secreted alkaline phosphatase activities.
Cell proliferation assays
Cells were plated into multiple 96-well plates (5000 cells per well) and measured after
96 hours. For the tetracycline inducible A3B, cells were induced with 2 µg/ml Dox
(Sigma). The WST-8 reagents were used as directed (Beyotime). Absorbance was measured at 450 nm (PerkinElmer).
Tumor transplantation
For the orthotopic hepatocellular carcinoma mouse model, the mice were anesthetized.
After performing a median laparotomy, 5×106 cells (MHCC97H and Hepa1-6) in 25
µl PBS/Matrigel (1:1, Corning) were injected into the anterior hepatic lobe in nude Balb/C mice and C57BL/6, respectively. The abdominal incision was closed with staples. 30 days later, mice were sacrificed and tumors weights were determined.
Alternatively, Hepa1-6 tumors were processed for isolation of tumor infiltrating immune cells and subsequent analysis by flow cytometry.
For the subcutaneous hepatocellular carcinoma mouse model, Hepa1-6 cells (5×105) were subcutaneously transplanted into back flanks of C57BL/6 mice. Tumor volume was measured with a caliper every 2-3 days, and calculated tumor volume (= width2×height×0.5). 5 days after injection, RS102895 hydrochloride (5 mg/kg) were administered twice a day by i.p. injection. 15 days after cell injection, the tumors were dissected, photographed, tumors weights were determined, and tumors were processed for isolation of tumor infiltrating immune cells and subsequent analysis by flow cytometry.
Sleeping beauty transposon-based mouse liver cancer model
Two-week old male C57BL/6 mice were treated with one single i.p injection of diethylnitrosamine (DEN, Sigma, 25 mg/kg in PBS) and hydrodynamic tail vein injection of DNA 6 weeks later . 5 µg of transposase (CMV-SB100) and 25 µg of the transposon plasmids (pT3 plasmid) were diluted in saline solution at a final volume of
10% of body weight. Mice were injected with the 0.9% NaCl solution/plasmid mix into the lateral tail vein in 5-7 s. 8 months after DEN injection, the tumors were dissected, photographed, tumors weights were determined, and tumors were processed for isolation of tumor infiltrating immune cells and subsequent analysis by flow cytometry. Isolation of primary hepatocytes and immune cells from mouse liver
Briefly, 6- to 8-week-old male C57BL/6 mice were injected with 5 µg of transposase
(CMV-SB100) and 25 µg of the transposon plasmids (pT3 plasmid) as described above. 30 days after injection, mice were given 100 mg/kg DEN by i.p. injection to induce liver damage. 18 hours after DEN injection, mice were anesthetized and the inferior vena cava was cannulated. The liver was perfused with EGTA solution and digested with 0.075% collagenase solution. After passage through nylon filter and washing, centrifuging for 5 min at 50g, 4℃, the pellet was hepatocytes and immune cells were in the supernatant. Hepatocytes were cultured in serum-free Williams’ E medium with thyroxine (1 µM), dexamethasone (0.1 µM) and penicillin (100 units/ml). Hepatocytes were cultured for 48 hours and the supernatant were collected for the further detection of CCL2, BMP7 and IL34. RNA extraction from primary hepatocytes and real time PCR were conducted as described above. The supernatant was collected and centrifuged for 5 min at 1500rpm, 4℃. The cell pellet was resuspended in 4mL 20% Percoll and overlaid on 4mL 50% Percoll, centrifuged for
20 min at 2000 rpm, 20°C. The middle layer cells, which were the mononuclear cells, were collected and used for flow cytometry analysis.
Flow cytometry
Single cell suspensions form liver-infiltrating immune cells were prepared as described above. Tumor infiltrating immune cells were prepared using mouse tumor dissociation kit (Miltenyi Biotec) and gentleMACS dissociator device (Miltenyi
Biotec), according to manufacturer instructions. Spleens from tumor bearing mice were triturated grinded with the flat end of a syringe in a 100 mm culture dish, passed through a 100-µm cell strainer and centrifuged at 300g for 5 min to get single cell suspensions. RBCs were lysed. After blocking FcγRIII/II with an anti-CD16/CD32 mAb (eBioscience, San Diego, CA), cell labelling was performed by fluorescently conjugated mAbs directed against mouse CD45, CD11b, F4/80, Gr1, Ly6C, Ly6G,
CD3, CD4, CD8, and PD1. Flow cytometry was performed on Attune NxT (Thermo
Fisher Scientific). Data were analysed using FlowJo v.10.4.2 (Treestar, Ashland, OR).
Chemotaxis Assay
For in vivo chemotaxis assay, bone marrow cells were extracted from the 6- to
8-week-old male C57BL/6 mice. CD11b+ monocytes were isolated by flow cytometry
(BD FACScantoII). Monocytes were labelled using the DiR fluorescent kit
(Keygentec), according to manufacturer instructions, then 5×106 cells were injected intravenously via the tail vein after 18 h of DEN treatment in control and mA3 overexpression mice as described above. Twelve hours after cell injection, the IVIS spectrum system was used to track monocytes migration.
For in vitro chemotaxis assay, 30% conditioned medium (CM) from Hepa1-6-EGFP and Hepa1-6-A3B cells was added to the lower wells in a transwell (Corning) using
5-µm polycarbonate membranes, iBMDM cells suspended in DMEM containing 2%
FBS (2×105 cells/100 µL) were added to the upper wells and incubated for 24 hours. iBMDM that migrated to the lower surface of the transwell membrane were fixed with 4% paraformaldehyde, followed with 0.5% crystal violet staining and then subjected to microscopy imaging. To evaluate the CCL2 induced macrophage chemotaxis, the iBMDM cells were pretreated with CCR2 selective inhibitors
MK0812 (400nM) for 1 h, then MK0812 was added to the upper and lower wells; the chemotaxis assay was performed as described above.
Primary BMDMs and MDSCs generation
Tibias and femurs from C57BL/6 mice were removed in sterile condition and bone marrow was flushed. To obtain bone marrrow-derived macrophage, 1x107 cells were plated into dishes with 100 mm diameter in 10 ml of medium supplemented with
M-CSF (10 ng/ml) for 7 days.
To obtain BM-derived MDSCs, 1x107 cells were plated into dishes with 100 mm diameter in 10 ml of medium supplemented with GM-CSF (40 ng/ml) and IL-6 (40 ng/ml) for 5 days. For both cultures medium was DMEM (Bioind) supplemented with
10 mM HEPES, 1 mM sodium pyruvate, 100 U/mL penicillin, 100 mg/mL streptomycin, and 2 mM L-glutamine plus 10% fetal calf serum (Bioind).
BMDMs and MDSCs stimulation experiments
4x106 Hepa1-6-EGFP or Hepa1-6-A3B cells were plated into dishes with 100 mm diameter in 10 ml 10% serum-free DMEM. After 24 h, conditioned medium was generated by incubating cells in 10 ml serum-free DMEM for 24 h. Collected conditioned medium (CM) was centrifuged to remove cellular debris. 30% CM was used to stimulate BMDMs and MDSCs for 24 h without further addition of M-CSF,
GM-CSF or other media. Control macrophages and MDSCs received serum-free fresh
DMEM. To evaluate the involvement of IL34 and BMP7 on the CM induced change of gene expression, the BMDMs and MDSCs were cultivated in 30% CM containing either DMSO as vehicle, 500 nM BLZ945 or 1 µg/ml of the IL34 neutralizing antibody (R&D Systems) or 4 µg/ml of the BMP7 neutralizing antibody (R&D
Systems) for 24 h before experimental analysis.
Immunoprecipitation
For nuclear extract immunoprecipitation, nuclear extracts were prepared using Buffer
A and Buffer B as described above. For total protein extract immunoprecipitation, total protein extracts were prepared using buffer C containing 25 mM Tris-HCl pH
7.4, 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, 20 mM NaF, 1 mM
Na3VO4, 0.1 mM PMSF and protease inhibitor cocktail. 1 mg of nuclear extract protein from HepG2-Tet on A3B cells was precipitated with anti-His-tag magnetic beads (MBL), or for HCCLM3 cells, with normal rabbit IgG (Millipore) and anti-EZH2/EED/SUZ12 antibody (Cell Signaling Technology) or for 293T cells with anti-flag agarose beads (Bimake). For in vitro binding assays, purified recombinant
A3B protein was incubated with recombinant Flag-tagged Ezh2, Suz12 and Eed proteins, and anti-flag agarose beads (Bimake) in Buffer C. Bound immunocomplexes were washed three times with buffer B for nuclear extracts or buffer C-400 mM NaCl for total protein extracts immunoprecipitation and in vitro binding assays. The immunocomplexes were eluted by heat in SDS sample buffer and subjected to
Western blot analysis.
DNA cytidine deaminase activity assays
The nuclear extracts were prepared using Buffer A and Buffer B as described above.
Lysates were tested with a fluorescence-based deaminase activity assay as described.4 5 This assay uses fluorescently tagged oligonucleotides in table S2. Briefly, 10 pmol of oligonucleotide and 20 µg nuclear extracts were incubated with a master mix containing 0.4 units uracil DNA glycosylase (NEB), 50 mM Tris (pH 7.4), and 10 mM EDTA. The plates were incubated at 37°C for 2 h followed by addition of 100 mM NaOH and incubation for 30 min at 37°C. 3 µL of 4 N HCl and 37 µL of 2 M
Tris–Cl (pH 7.9) was then added to neutralize reactions. The plates were cooled to
4°C and fluorescence was measured using a spectrophotoflourometer with excitation at 490 nm and emission at 520 nm.
HMT assays
For histone methyltransferase (HMT) assays, purified recombinant A3B protein was incubated with the reconstituted PRC2 complex (EZH2/EED/SUZ12/RbAp46/48,
Active Motif) in histone assay buffer using the Histone H3 (K27) Methyltransferase
Activity Quantification Assay Kit (Abcam) according to manufacturer’s protocol.
Anti-H3K27me3 (CST) antibodies were used to test histone methylation. The plates was measured using a microplate reader at 450 nm.
Immunohistochemistry and Immunofluorescence
Mouse liver tissue was fixed in neutral buffered formalin, paraffin-embedded and sectioned using standard techniques. The tissue sections were incubated with a peroxidase block and then a primary antibody: F4/80. Bound primary antibody was detected using the DAB kit. The staining was visualized using an Olympus microscope. As for cell immunofluorescence, cells were grown in plates on a cover glass. The glass was fixed with 4% paraformaldehyde, washed with PBS three times and blocked with goat serum, treated with anti-His tag (abcam), anti-EZH2 (CST), anti-EED (CST) primary antibodies, subsequently reacted with Alexa Fluor 488 or 647 secondary antibodies (Invitrogen). Naive IgGs were used as negative controls. DAPI staining was used to stain all cells in the sections. Images were taken using a confocal microscope TCS SPE (Leica).
Computational Analysis of Human Liver TCGA Data
We used the web tool GAPIA6 (http://gepia.cancer-pku.cn/) to analyze TCGA data.
For comparison gene expression in tumor and non-tumor tissues, we selected “TCGA tumors vs TCGA normal + GTEx normal” for differential analysis and plotting. The expression data were first log2(TPM+1) transformed for differential analysis. The log2FC is defined as median(Tumor) - median(Normal). Genes with
|log2FC|>1values and q value <0.01 were considered differentially expressed genes.
We performed overall survival (OS) or disease free survival (DFS) analysis based on gene expression stratified by median. Log-rank test was used for hypothesis test. The cox proportional hazard ratio and the 95% confidence interval information can also be included in the survival plot. In Figure 1E and 1F, we took the median of APOBEC3B
TPM as a control. If the APOBEC3B TPM in a patient was lower than the median, we classified him into “Low APOBEC3B TPM” group. If the APOBEC3B TPM in a patient was higher than the median, we classified him into “High APOBEC3B TPM ” group. In Figure 3M, we defined the sum of APOBEC3B TPM, CD11b TPM and CD33 TPM as “A3B/CD11b/CD33” signatures. We took the median of
“A3B/CD11b/CD33” signatures as a control. If the “A3B/CD11b/CD33” signatures in a patient was lower than the median, we classified him into “Low
A3B/CD11b/CD33” group. If the “A3B/CD11b/CD33” signatures in a patient was higher than the median, we classified him into “High A3B/CD11b/CD33” group.
RNA-sequencing
Total RNA was extracted using TRIZOL Reagent (Life technologies) following the manufacturer’s instructions and checked for a RIN number to inspect RNA integrity using an Agilent Bioanalyzer 2100 (Agilent technologies). Qualified total RNA was further purified by RNAClean XP Kit (Beckman) and RNase-Free DNase Set
(QIAGEN). 1 µg-3 µg of total RNA was subsequently used to prepare RNA-seq libraries using TruSeq RNA Sample Pre Kit v2 (Illumina), Agencourt ® AMPure XP
Beads (Beckman), SuperScript II Reverse Transcriptase (Invitrogen), Qubit™ dsDNA
HS Assay Kit (Invitrogen) and Qubit™ dsDNA HS Assay Kit (Invitrogen) following the manufacturers’ protocols. The libraries were paired-end sequenced with HiSeq
2500 (Illumina).
Gene ontology analysis
We used the web tool (http://software.broadinstitute.org/gsea/msigdb/annotate.jsp) to determine GO terms enriched with down and upregulated genes in RNA-Seq data.
Biological Process terms in Gene Ontology were analyzed, and the most significant
Gene Ontology terms were reported with their respective p values.
Gene set enrichment analysis Gene set enrichment analysis was performed using GSEA software (v 3.0). The mouse RNA-Seq data were converted to human gene identifiers using the Biomart R package. The hallmark gene sets were obtained from MSigDB in chemical and genetic perturbations and employed to evaluate the gene sets enriched in RNA-seq data.
Cell type enrichment analysis
We used the Enrichr web tool to determine cell type enriched with down and upregulated genes in mouse tumor RNA-Seq data. Most significant cell types are reported with their respective p values. In addition, GSEA was then used to identify cell type using well-established immune expression signatures and the 39 MDSC genes.
Statistical Analysis
Statistical analyses were performed using GraphPad Prism 6 software (GraphPad
Software, Inc, La Jolla, CA, USA). Statistical parameters and methods are reported in the Figures and the Figure Legends. A value of p < 0.05 was considered statistically significant. Association of gene expression with the survival of patients was evaluated using log-rank test and a value of p < 0.05 was considered statistically significant.
Supplementary References
1 Broad Institute TCGA Genome Data Analysis Center. Analysis of mutagenesis by APOBEC cytidine deaminases (P-MACD). Broad Institute of MIT and Harvard 2016. doi:10.7908/C1JS9PSZ
2 Broad Institute TCGA Genome Data Analysis Center. Analysis of mutagenesis by APOBEC cytidine deaminases (P-MACD). Broad Institute of MIT and Harvard 2016. doi:10.7908/C1ST7P80
3 Mori S, Takeuchi T, Ishii Y, et al. Identification of APOBEC3B promoter elements responsible for activation by human papillomavirus type 16 E6. Biochem Biophys Res Commun 2015;460:555–60. doi:10.1016/j.bbrc.2015.03.068
4 Burns MB, Lackey L, Carpenter MA, et al. APOBEC3B is an enzymatic source of mutation in breast cancer. Nature 2013;494:366–70. doi:10.1038/nature11881
5 Thielen BK, Klein KC, Walker LW, et al. T Cells Contain an RNase-Insensitive Inhibitor of APOBEC3G Deaminase Activity. PLoS Pathog 2007;3:e135. doi:10.1371/journal.ppat.0030135
6 Tang Z, Li C, Kang B, et al. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res 2017;45:W98–102. doi:10.1093/nar/gkx247
Supplementary Table S1. Key resources table
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies anti-RelA Cell Signaling Technology 8242 anti-RelB Cell Signaling Technology 10544 anti-APOBEC3B Abcam ab184990 anti-APOBEC3B Santa Cruz Biotechnology SC86289 anti-EZH2 Cell Signaling Technology 5246 anti-EED Abcam ab4469 anti-SUZ12 Cell Signaling Technology 3737 anti-His Tag Cell Signaling Technology 12698 anti-Flag Tag Cell Signaling Technology 2368 anti-H3K27me3 Cell Signaling Technology 9733 anti-H3 Santa Cruz Biotechnology SC8654 anti-His tag Cell Signaling Technology 12698 anti-His tag Abcam Ab18184 anti-Flag tag Cell Signaling Technology 2368
Normal mouse IgG merck 12-371
Normal rabbit merck 12-370 anti-Pol II merck 05-623B anti-CCL2 R&D Systems AF-479-NA anti-IL34 R&D Systems AF5195 anti-BMP7 R&D Systems MAB3541 anti-CD45-Apc-cy7 biolegend 103115 anti-CD11B-BV510 biolegend 101245 anti-Gr1-FITC biolegend 108405 anti-F4/80-Apc ebioscience 17-4801-80 anti-Ly6G-PEcy7 biolegend 127618 anti-Ly6C-PE biolegend 128007 anti-CD3-FITC ebioscience 11-0031-82 anti-CD4-Apc-cy7 biolegend 100414 anti-CD8-PE invitrogen 12-0081-82 anti-PD1-Apc ebioscience 17-9981-80
Anti-FLAG Affinity Gel Bimake B23101
Protein A/G Magnetic Beads for IP Bimake B23201
HisPur Ni-NTA Resin Thermo Fisher Scientific 88221
Anti-His-tag mAb-Magnetic Beads MBL D291-11
Bacterial and Virus Strains
DH5α Competent Cells Thermofisher 18265017
Stbl3 E. coli Thermofisher C737303
Biological Samples
The tumor and corresponding non-tumor Gulou Hospital in Nanjing N/A tissues
Chemicals, Peptides, and Recombinant Proteins
Lipopolysaccharide Sigma L6529
Diethylnitrosamine Sigma N0756
DiR Keygentec KGMP0026
Recombinant Human Lymphotoxin R&D systems 8884-LY/CF
α1/β2 Protein
Mouse GM-CSF Recombinant Protein peprotech cat.#315-03-20
Mouse M-CSF Recombinant Protein peprotech cat.#315-02-50
Mouse IL-6 Recombinant Protein peprotech cat.#216-16-10
Recombinant EZH2 protein complex Activemotif 31337
Recombinant PCR2 complex Activemotif 31387
Recombinant APOBEC3B protein This paper N/A
RS102895 hydrochloride MedChemExpress HY-18611
GSK126 Selleck Chemicals S7061
Doxycycline hyclate Sigma D9891
MK-0812 MedChemExpress HY-50669
Critical Commercial Assays
PrimeScript™ RT reagent Kit with TAKARA RR047 gDNA Eraser Secrete-Pair Gaussia Luciferase Assay Genecopoeia SPGA-G010
Kit
TB Green™ Premix Ex Taq™ II TAKARA RR820
Lenti-Pac™ Lentiviral Packaging Kits Genecopoeia LT001
Tumor Dissociation Kit, mous Miltenyi Biotec 130-096-730
EZ-Magna ChIP™ A/G Chromatin Millipore 17-10086
Immunoprecipitation Kit
Histone H3 (K27) Methyltransferase Abcam ab113454
Activity Quantification Assay Kit
Deposited Data
RNA-seq This paper GEO: GSE117546
Experimental Models: Cell Lines
Human cell line: HepG2 ATCC HB-8065
Human cell line: HCCLM3 National Infrastructure of 3131C0001000700094
Cell line Resource, China
Human cell line: MHCC97H Liver Cancer Institute, N/A
Zhongshan Hospital,
Shanghai, China
Human cell line: MHCC97L Liver Cancer Institute, N/A
Zhongshan Hospital,
Shanghai, China
Human cell line: PLC/PRF/5 ATCC CRL-8024
Human cell line: 293T ATCC CRL-3216
Mouse primary cell: bone This paper N/A marrow-derived macrophage cells
Mouse primary cell: myeloid-derived This paper N/A suppressor cell
Mouse cell line: Hepa1-6 ATCC CRL-1830
Experimental Models: Organisms/Strains
Mouse: C57BL/6 SLAC Laboratory Animal N/A
Co., Ltd Mouse: Balb/C Nude SLAC Laboratory Animal N.A
Co., Ltd
Oligonucleotides
Primers and Probe, see Supplementary This paper N/A
Table S2
A3B siRNA-1: ccugauggauccagacaca This paper N/A
A3B siRNA-2: gguguauuucaagccucag This paper N/A
IL34 shRNA: gcuacaaauguguacccuutt This paper N/A
BMP7 shRNA: gcugguugguguuugauautt This paper N/A
Recombinant DNA pIRES2-ZsGreen1 Clontech Cat. No. 632478 pIRES2-ZsGreen1-RELA This paper N/A pOTENT-1 This paper N/A pOTENT-1-RELB This paper N/A
HPRM21800-LvPG04 Genecopoeia HPRM2180
HPRM21800-LvPG04-M1 This paper N/A
HPRM21800-LvPG04-M2 This paper N/A pEX-TET3G Genecopoeia N/A pEX-TRE3G-A3B-his This paper N/A pEX-TET3G-A3BE68Q/E255Q-his This paper N/A psi-LVRU6GP-shcon This paper N/A psi-LVRU6GP-shA3B This paper N/A pCMV(CAT)T7-SB100 Addgene Plasmid #34879 pT3-EF1α-ployA This paper N/A pT3- EF1α-mA3-Flag-ployA This paper N/A pT3-EF1α-EGFP-ployA This paper N/A pT3-EF1α-A3B-T2A-EGFP This paper N/A pT3-EF1α-A3BE68Q/E255Q-T2A-EGFP This paper N/A pcDNA3.1-A3B-his This paper N/A pcDNA3.1-A3BCDT-his This paper N/A pcDNA3.1-A3BNDT-his This paper N/A pcDNA3.1-EZH2-3×FLAG This paper N/A pcDNA3.1-EED-3×FLAG This paper N/A
pcDNA3.1-SUZ12-3×FLAG This paper N/A
Software and Algorithms
GEPIA Tang, Z. et al. (2017) http://gepia.cancer-pku.
cn/index.html
http://software.broadins
GSEA Tamayo, et al. (2005) titute.org/gsea/index.js
p
http://thebrain.bwh.har NF-kB PBM Dataset Siggers T, et al. (2011) vard.edu/nfkb/
GraphPad Prism 6 GraphPad Software N/A
FlowJo Treestar N/A
http://amp.pharm.mssm Enrichr Kuleshov MV, et al. (2016) .edu/Enrichr/
Supplementary Table S2. Sequences of DNA oligos, primers, and probe.
Assay Gene Sequence (5’to 3’)
F CTACCTGTGCTACGAAGT APOBEC3A R TTCTTAGCCTGGTTGTGTA
F ACTTGGCTGTGCTATGAA APOBEC3B R GTGGTACTGAGGCTTGAA
F AGACACATTCTCCTACAACT APOBEC3F R CTACTGAGCACTTGAAATGG
F CCGCCTCTACTACTTCTG APOBEC3G QPCR R TACACGAACTTGCTCCAA
F CCTGGTACACATCTTGGA APOBEC3C R TGGTAACATGGATACTGGAA
F GACACATTCTACGACAACTT APOBEC3D R GCCACAGAACCAAGATAAG
F CCAAGTCACCTGTTACCT APOBEC3H R TGAGCCTTGATGAAGTCA
mAPOBEC3 F AATCACCTGCTACCTCAC R GATTGCCACAGAGAACAC
F CCTGGTATGGAAGTAAGAGA mCLEC7A R TAATACGGTGAGACGATGTT
F TGCTGCATAATCAGCTACGG mCD274 R TCCACGGAAATTCTCTGGTT
F AGGTCTCTACATCACAGAAG mARG1 R GAAGCAAGCCAAGGTTAA
F TTCTGTCTACTGAACTTC mTNF-A R CCATAGAACTGATGAGAG
F CAATGGACAGAATATCAAC mIL-1β R ACAGGACAGGTATAGATT
F ACATCTGCTGCTCCACAAG mIL12A R GGTGCTTCACACTTCAGGAA
F GGC CCA GAA ATC AAG GAG mIL10 R CCT TGT AGA CAC CTT GGT
F ATGAGATCAGAACCTACAACT mCCL2 R TCCTACAGAAGTGCTTGAG
F GATTGCTGTGCCTTATGAG mIL-34 R CTGAACCTCCTGTAGATACTT
F AACCTAGTGGAACATGACAA mBMP7 R CTGATAGACTGTGATCTGGAA
F GCTACGATGTCTGTGTATTC mCXCL15 (IL8) R GTAGGAACCTGTTAGTAATTGG
F GAGTATTTCTACACCAGCAG mCCL5 R GTATTCTTGAACCCACTTCTT
F ATAGCAGCCACCTTCATT hCCL2 R GCTTCTTTGGGACACTTG
F TATCTTGGGATCTTCCTTGG hIL-34 R CACTGATCTTGTAGTTGATGG
F CAAGATAGCCATTTCCTCAC hBMP7 R CGGATGTAGTCCTTGTAGAT mS100A10 F TGGCTGTGGACAAAATAATG R CCCTTCTGCTTCATGTTTAC
F ACACCTTCCATCAATACTCT mS100A9 R ATCAGCATCATACACTCCTC
F GCCAATTCATCGTTGACTATT mCCL3 R CAGGTCAGTGATGTATTCTTG
F CTTCCTGCTGTTTCTCTTAC mCCL4 R TTCAACTCCAAGTCACTCAT
F GTCGCTATAACCCTCCAATA mCCL6 R CTCCTGCTGATAAAGATGATG
F CTCCTTCCTCATTCTTACAAC mCCL9 R ACCTATAAATCTTGAACACTGAA
F GTGCTGTGAGATTCTACTTC mCCL25 R TGGTTTGACTTCTTCCTTTC
F GATTGAGGAGATACGAGGTG mCCL27a R CTTCTTGCTTCTGCTTAGTC
F GGATTCACCTCAAGAACATC mCXCl1 R CTTTTAGCATCTTTTGGACAATT
F ACCCTAGTGATAAGGAATGC mCXCL9 R ATCTCCGTTCTTCAGTGTAG
F CTCAAGGCTTCCTTATGTTC mCXCL11 R CTTCATAGTAACAATCACTTCAAC
F AACATCATAGATCGGATTCAAG mCXCl13 R CTCTTCTCTTACTCACTGGA
F AAATGAGAAACAGCAAGATGA mCXCL16 R CAGTGAGGAAGAAGACAATG
F GGAAAACCAGAGCCAGAG A3B promoter R ACAGCCCTCCTTAAAGTG
F TGGTCAGTCTGGGCTTAA CCL2 promoter-1 CHIP R CAGGAAGTAGGAAAGGGA
F AAACTGAAGCTCGCACTC CCL2 promoter-2 R TGGATGGTCCATGATAACT
CCL2 promoter-3 F TCCGTCTTAATGACACTT R GACCCAATGACTCAGTTT
F GGTAGTCCCTTAGAACAGTC IL-34 promoter-1 R AAGTAGGAGGGAGTCTTCAA
F CTCAGCCTCTCCAACCTG IL-34 promoter-2 R CCAAGACTCGGTCTCCTA
F AAGTATGCCTCAGAGAAGTATA IL-34 promoter-3 R TTGCTTTATGGTTATGTGGAT
F AGGTCTTGGAGGTCTCTG BMP7 promoter-1 R CTCAGTCCCTGTATCCTTT
F CAGAGGAGCGGGAAGAAG BMP7 promoter-2 R GAACGAAAAGGCGAGTGA
F GTTCATGCTGGACCTGTA BMP7 promoter-3 R GTGAGGAAATGGCTATCTTG
F ACAAAGGCAGATACCCAACG MYT-1 promoter R GCAGTTTCAAAAAGCCATCC
F TACTAGCGGTTTTACGGGCG GAPDH R TCGAACAGGAGGAGCAGAGAGCGA
F CTCGAGGCACACCTAAGCCTTC A3B promoter PCR R GTTCAGCCTCTTAGATACGCTTGTC
Biotin-Label F GGAAGGGTCCGGGGAAAACCAGAGCCAGAG DAPA-A3B-promoter ed Probe R CTCTGGCTCTGGTTTTCCCCGGACCCTTCC
F GGAAGGGTCCGCCGCCCGCCAGAGCCAGAG DAPA-A3B-Promoter-mut R CTCTGGCTCTGGCGGGCGGCGGACCCTTCC
5'-6-FAM-3' A3B fluorescence probe AAATTCTAATAGATAATGTGA -TAMRA Fluorescence
probe Positive-probe-1 5'-6-FAM AAATTC
Positive-probe-2 3'-TAMRA TAATAGATAATGTGA