Endophytes from Australian native plants as novel sources of bioactive compounds for industrial, environmental and medicinal applications

A thesis submitted in fulfilment of the requirements for the degree of

Doctor of Philosophy

By

Bita Zaferanloo

Department of Chemistry & Biotechnology, School of Science,

Faculty of Science, Engineering and Technology

Swinburne University of Technology, Australia

March 2014

Abstract

Natural products, including endophytic fungi, have received increased interest over the past decade for their therapeutic potential. Endophytes are fungi (or bacteria) which live in the intercellular spaces of plant tissues, for all or part of their lifecycle. The endophyte-plant relationship is symbiotic and it is believed that endophytic fungi live mutualistically with the host plant with no apparent symptoms. The asymptomatic nature of these fungi demonstrates enormous diversity and abundance, with nearly 30,000 land plant species in symbiosis with a multitude of species of endophytes. The ability of these microorganisms to colonize host plants in extreme, specialized environments has seen the development of complex relationships forming between endophyte and host. This subsequently increases the fitness of both plant and endophyte by the adaptive evolution of specialised survival mechanisms. It is suggested that these fungal endophytes offer a potentially enormous source of novel bioactive compounds that could be useful in medicine and other diverse applications, including industry and environment. In this work, the antibacterial, anticancer and enzyme activities of endophytic fungi from two Australian native plants Eremophila longifolia and E. maculata were investgiated. The rationale behind this search for new bioactive compounds and effective enzymes was based on the result of accumulated knowledge collected by indigenous Australians about the potentially medicinal properties of these two Australian native plants. In addition, the use of plants which are well-adapted to the harsh, dry climate of the Australian desert increased the likelihood of finding novel compounds. Following screening for bioactive compounds, investigation of the particular enzymes secreted by selected endophytic fungi was carried out to better understand how they survive in their natural habitat; furthermore, new enzymes with potential for industrial applications can be revealed. Twenty-six fungal strains were isolated from Eremophila longifolia and E. maculata. These were identified and screened for the production of antibacterial compounds against four different bacteria including Escherichia coli, Salmonella typhimurium, Staphylococcus aureus and Bacillus cereus using disk diffusion assays. EM-4 (Preussia sp.) showed the broadest range of antibacterial activity against all bacteria; however, EL-11 (Leptosphaerulina sp.) and EL-13 exhibited the highest

ii antibacterial activities against Bacillus cereus with minimum inhibitory concentrations of 1.6 and 0.01 µg/ml, respectively. Fungal extracts were also screened against two human cancer cell lines (T-cell acute lymphoblastic leukemia MOLT-4 and PreB697 cells), at concentrations ranging from 250.00–0.11 μg/mL. The endophytes that demonstrated potent cytotoxicity (>70%) were further screened against adherent lung cancer (A549) and a primary foreskin fibroblast cell lines. The prominent metabolites potentially contributing to the cytotoxicity were investigated by means of HPLC and comparing samples against toxic metabolites previously identified from related endophytes: Alternariol (AOH) and Alternariol methyl-ether (AME). The toxic endophytes EM-6, EM-7, EM-9 (all Alternaria sp.) and EL-14 (Preussia minima) showed 50% inhibition of proliferation (EC50) at concentrations < 103 μg/mL, with EM-6 demonstrating the greatest cytotoxicity. EM-6, EM-7 and EM-9 all contained AME and AOH metabolites at varying concentrations; however, EM-6 and EL-14 showed additional unidentified peaks which may represent novel cytotoxic compounds. These data emphasise the importance of endophytic fungi as novel anti-cancer agents. Moreover, these endophytes were screened for enzyme activities using agar plate assays; over two-thirds of the isolates from Eremophila longifolia secreted amylase and over one-thirds proteases, while many isolates from E. maculata produced xylanase. The enzyme activities of seven isolates were characterised using liquid cultures. Three samples with the highest activities were comprehensively characterised by liquid enzyme assays and zymography. Their activities were compared with standard amylase, protease and xylanase producers, including Aspergillus oryzae (ATCC 10124), Fusarium oxysporum (FRR 3414) and Aspergillus niger (ATCC 10577), respectively. Three isolates, EL-14 (Preussia minima), EL-17 (Alternaria alternate) and EM-4 (Preussia sp.), were high secretors of protein and displayed the broadest selected enzyme activities under different conditions. The amylase(s) from EL-14 Preussia minima sustained activity at cool temperatures and alkaline conditions. The protease(s) from EL-17 Alternaria alternata displayed optimal activities under neutral to alkaline conditions. The xylanase(s) from EM-4 Preussia sp. revealed versatility at lower temperatures under neutral to alkaline conditions. Some of the enzymes hold potential for application in the production of detergents, dairy and ethanol-based biofuels.

iii

Finally, the α-amylase produced by EL-14 was purified to homogeneity through fractional acetone precipitation and Sephadex G-200 gel filtration, followed by DEAE- Sepharose ion exchange chromatography and electroelution. The purified α-amylase showed a molecular mass of 70 kDa which was confirmed by zymography. Temperature and pH optima were 25°C and pH 9, respectively. The enzyme was activated and stabilized mainly by the metal ions manganese and calcium. Enzyme activity was also studied using different carbon and nitrogen sources. It was observed that enzyme activity was highest (138 U/mg) with starch as the carbon source and L- asparagine as the nitrogen source. Bioreactor studies proved that enzyme activity remained stable in a larger cultivation volume, which is relevant to potential scale-up of enzyme production. Following in-gel digestion of the purified protein by trypsin, a 9- mer peptide was sequenced and analysed by LC-ESI-MS/MS. The partial amino acid sequence of the purified enzyme presented similarity to α-amylase from Magnaporthe oryzae. In the secretome analysis of the endophytic fungus, a complex array of enzymes integral to plant biomass degradation was identified, including enzymes that could be of value to industry in the future. These results confirm the value of endophytes from Australian native plants as novel sources of bioactive compounds for industrial, environmental and medicinal applications. Further investigation is warranted to determine the structures and properties of these bioactive compounds.

iv

Acknowledgements

I am very thankful to Swinburne University and the funding provided by Swinburne University Postgraduate Research Award for making this research possible.

There are also many people I would like to thank for making my PhD candidature such a rewarding and fulfilling experience. First and foremost, I am extremely grateful to my supervisor Professor Enzo Palombo. The inspiration and motivation he provided was a vital driving force behind the project and it helped me to achieve the best and strive towards my goals, whatever came my way. I would also like to thank Dr Peter Mahon for co-supervising the project, for always finding time to have a chat and keeping me on track.

Ali, words seem inadequate to fully express my gratitude to you. Your support has been invaluable, your compassion and sense of humour have helped me to put things in perspective and kept me sane. Thank you.

A special thank you to Ngan, Soula, Chris, Savithri and the Swinburne Research Higher Degrees staff especially Aimii Treweek for their kind assistance, always delivered with a smile and a lot of patience! Thank you to Nick, Paul and Ching-Seng for their professional advice and support from the mass spectrometry lab, Bio21 Institute, Melbourne University, during my experimental work in their lab. Special thanks to Dr Sally Coulthard and her group, including Stephanie Pepper, from the Institute of Cellular Medicine, Newcastle University Medical School, for their valuable collaboration in an in-depth insight on the anticancer aspect of the project. Thanks to Irene Hatzinisiriou for helping with Imaging at Monash University.

Thank you too to all my friends in the laboratory who have made coming to university so enjoyable. Although I can’t thank you all individually I would like to especially thank Hayden, Abdullah, Shahanee, Elisa, Sarah, Saifone, Shanthi, Rue, Rebecca, Babu, Hamid, Dhivya, Avinash, Vanu, Jafar, Rashida, Rasika, Jun, Ha, Snehal and everyone else I met along the way! To Kaylass, thank you for the many times you have patiently taught me skills in the lab. Special thanks to Robyn Peterson and Mahmoud Ghorbani

v for kindly helping me with expert advice. Thank you Narges and Azadeh, for our great friendly conversations and cups of tea. Thank you to all my Masters students for their contribution in this project.

Finally I would like to express my deepest gratitude to my parents and my family. The support you provided me through difficult years helped me to turn my life around and to achieve “the impossible”. It goes without saying, but I’ll say it here: your love and support have shaped me into the person I am today.

vi

Declaration

I, Bita Zaferanloo, declare that this thesis is my original work and contains no material that has been accepted for the award of Doctor of Philosophy, or any other degree or diploma, except where due reference is made.

I declare that to the best of my knowledge this thesis contains no material previously published or written by any other person except where due reference is made. Wherever contributions of others were involved every effort has been made to acknowledge the contributions of the respective workers or authors.

Signature ______

vii

List of publications

The following publications resulted from the work carried out for this thesis. Each of the publications are introduced, presented and discussed in turn throughout the thesis chapters. Additional work, not included in the publications, is also described.

JOURNAL PAPERS

 B. Zaferanloo, S. Bhattacharjee, M. M. Ghorbani, P. J. Mahon and E. A. Palombo. (2014). Amylase Production by Endophytic Fungus, Preussia minima: Optimization of Fermentation Conditions and Analysis of Fungal Secretome by LC-MS. BMC Microbiology, 14(1):55.

 B. Zaferanloo, T. D. Quang, S. Daumoo, M. M. Ghorbani, P.J. Mahon and E.A. Palombo. Optimization of Protease Production by Endophytic Fungus, Alternaria alternata, Isolated from an Australian Native Plant. (Manuscript is accepted in World Journal of Microbiology and Biotechnology, Jan 2014).

 B. Zaferanloo, A. Virkar, P.J. Mahon and E.A. Palombo (2013). Endophytes from an Australian native plant are a promising source of industrially useful enzymes. World Journal of Microbiology and Biotechnology, 29(2): 335-345.

 S. Pepper, C.P.F. Redfern, E.A. Palombo, B. Zaferanloo, P. Berry, and S. A. Coulthard. Identification of anti-cancer metabolites of endophytes isolated from native Australian plants, Eremophila longifolia and Eremophila maculate. (Manuscript is in process)

viii

BOOK CHAPTER

 B. Zaferanloo, P.J. Mahon and E.A. Palombo (2012). Endophytes from medicinal plants as novel sources of bioactive compounds. In Medicinal plants: Diversity and Drugs. Edited by Mahendra Rai, Luca Rastrelli, Mariela Marinof, Jose L. Martinez, and Geoffrey Cordell. Science Publisher, USA, pp. 355-411.

CONFERENCE PAPERS

 B. Zaferanloo, S. Erskine, P. J. Mahon and E. A. Palombo, Endophytes from an Australian native plant as novel sources of bioactive compounds for environmental and medicinal applications, Annual Meeting of Australian Microbiology Society, July 1-4. 2012, Brisbane, Australia.

 B. Zaferanloo, A. Virkar, P. J. Mahon and E. A. Palombo, Endophytes from an Australian native plant are a promising source of industrially useful enzymes, Annual Meeting of Australian Microbiology Society, July 4-8. 2011, Hobart, Australia.

 B. Zaferanloo, S. Daumoo, P. J. Mahon and E. A. Palombo, Protease Production and Antimicrobial Activity of an Endophytic Fungus, Alternaria alternata, Isolated from an Australian Native Plant, Annual Meeting of Australian Microbiology Society, July 4-8. 2011, Hobart, Australia.

 B. Zaferanloo, N.K. Mahato, P.J. Mahon and E.A. Palombo, “Endophytes from an Australian native plant as a promising source of industrially useful enzymes”, 7th International Symposium on Industrial Microbiology & Biotechnology, 1-3 July. 2010, Melbourne, Australia.

ix

Abbreviations

AME Alternariol methyl-ether

ANOVA Analysis of Variance – A statistical test to compare more than one mean

AOH Alternariol

BLAST Basic Local Alignment Search Tool

CHAPS 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate

CID collision-induced dissociation

DNA Deoxyribonucleic Acid

DTT dithiothreitol

EC50 half maximal effective concentration

EDTA ethylenediaminetetraacetic acid

EL Eremophila longifolia

EM Eremophila maculata

ESI Electrospray ionization

FDA Fluorescein diacetate

HPLC High-performance liquid chromatography

IEF Isoelectric focusing

IPG immobilised pH gradient

ITS internal transcribed spacer

Kb kilobase pair kDa kilodaltons

LC liquid chromatography

MALDI matrix assisted laser desorption ionisation

MIC minimal inhibitory concentration

MS mass spectrometry

MS/MS tandem mass spectrometry x

NCBI National Center for Biotechnology Information

NCBInr National Centre for Biotechnology Information non-redundant

PAGE polyacrylamide gel electrophoresis

PCR polymerase chain reaction

PDA potato dextrose agar

PMF peptide mass fingerprinting

PNPG7 p-nitrophenyl maltoheptaoside

Q-TOF quadrupole time-of-flight

REA Relative Enzyme Activity rDNA ribosomal DNA

SDS sodium dodecyl sulphate

SEM Standard Error of Mean

SSF Solid-state fermentation

SmF Submerged Fermentation

TCA tricholoacetic acid v/v volume/volume w/v weight/volume

xi

Table of Contents

Abstract ...... ii

Acknowledgements...... v

Declaration ...... vii

List of publications ...... ivii

Abbreviations ...... x

Table of Contents ...... xii

List of figures ...... xx

List of Tabels ...... xxxii

Chapter 1 ...... 1

Introduction ...... 1

1.1 Endophytes ...... 2

1.1.1 Host-Endophyte interactions...... 4

1.2 Rationale for studying endophytes as potential sources of new medicinal compounds ...... 5

1.3 Rationale for plant selection ...... 7

1.4 Isolation of endophytes...... 10

1.5 Identification of endophytes ...... 11

1.6 Bioactivity of endophytic compounds according to chemical class ...... 11

1.6.1 Aliphatic compounds ...... 11

1.6.2 Alkaloids ...... 12

1.6.3 Flavonoids ...... 13

1.6.4 Isocoumarin derivatives ...... 14

1.6.5 Peptides ...... 14

1.6.6 Phenols and phenolic acids ...... 15

1.6.7 Phenylpropanoids and lignans ...... 16

1.6.8 Quinones ...... 17 xii

1.6.9 Steroids ...... 18

1.6.10 Terpenoids ...... 19

1.6.11 Other endophytic compounds ...... 20

1.7 Endophytic natural products as drugs and novel drug leads ...... 24

1.7.1 Endophytic products as antibiotics ...... 26

1.7.2 Volatile antiobitics ...... 28

1.7.3 Anticancer agents from endophytes ...... 29

1.7.4 Antiviral compounds from endophytes...... 32

1.7.5 Products from endophytes as antioxidants...... 33

1.7.6 Antidiabetic and neuroregenerate agents from endophytes ...... 34

1.7.7 Immunosuppressive compounds from endophytes ...... 35

1.7.8 Applications of fungal endophytes enzymes in biotechnology ...... 40

1.7.8.1 Prospecting for new enzymes...... 45

1.7.9 Biological control agents from endophytes ...... 49

1.7.10 Enzyme inhibitors from endophytes as sources of useful drugs ...... 50

1.7.11 Other exciting applications of endophytes...... 51

1.8 Aims of this study ...... 52

Chapter 2 ...... 55

Isolation and Identification of fungal endophytes from Australian native plants ...... 55

2.1 Introduction: Endophytes ...... 55

2.1.1 Endophytes from Australian native plants ...... 55

2.1.2 Types of endophytes based on ecological functions ...... 57

2.1.3 Isolation and identification of endophytic fungi ...... 58

2.1.3.1 Morphological identification of endophytic fungi belong to Ascomycota .. 58

2.1.3.2 Molecular identification techniques ...... 61

2.1.4 DNA extraction ...... 61

2.1.5 Organisation and evolution of rDNA...... 62

xiii

2.1.6 rDNA analysis as a tool for identification ...... 63

2.1.7 DNA sequence databases ...... 64

2.2 Methods and materials ...... 65

2.2.1 Isolation of endophytic fungi from Australian native plants ...... 65

2.2.2 Morphological analysis using scanning electron microscopy (SEM) for initial identification ...... 66

2.2.3 Extraction of fungal DNA...... 66

2.2.4 Amplification and direct sequencing of fungal ITS regions using PCR ...... 66

2.2.5 Molecular analysis and identification of the endophytic fungi ...... 67

2.3 Results ...... 68

2.3.1 Isolation and collection of the endophytic fungi ...... 68

2.3.2 Identification of fungi by morphology...... 70

2.3.3 Identification of fungi by ITS sequencing ...... 73

2.3.4 Comparison of the ITS regions of the fungal isolates ...... 79

2.4 Discussion ...... 82

Chapter 3 ...... 85

Screening of antibacterial, enzyme activities and anticancer activities ...... 85

3.1 Introduction: Investigating endophytes for new bioactive compounds ...... 85

3.1.1 Investigation of enzyme activity ...... 86

3.1.1.1 Screening enzyme activity by agar plate assay ...... 86

3.1.2 Investigation of antibacterial activity ...... 87

3.1.3 Exploration of endophyte for anticancer activity ...... 88

3.2 Methods and materials ...... 89

3.2.1. Screening for enzyme activity on solid media using endophytic fungi ...... 89

3.2.2 Screening for antibacterial activity ...... 90

3.2.2.1 Preparation of Samples ...... 90

3.2.2.2 Detection of Antibacterial activity ...... 90

xiv

3.2.2.3 Determination of minimal inhibitory concentration (MIC) ...... 91

3.2.3 Screening for anticancer activity ...... 91

3.3 Results ...... 92

3.3.1 Screening of fungi for enzyme activity by agar plate assay ...... 92

3.3.1.1 Detection of enzyme activity on solid media ...... 92

3.3.1.2 Relative Enzyme Activity (REA)...... 95

3.3.2 Screening of fungi for antibacterial activity by disc diffusion assay ...... 100

3.3.3 Drug sensitivity of cytotoxic endophytes ...... 103

3.3.3.1 Drug sensitivity of cytotoxic endophytes ...... 103

3.3.3.2 HPLC of cytotoxic endophyte agents ...... 104

3.3.3.3 Drug sensitivity of identified metabolite standards ...... 106

3.3.3.4 Comparison of drug sensitivity of pure metabolite against levels of the metabolites within endophyte agents ...... 108

3.3.3.5 Fibroblast drug sensitivity ...... 109

3.4 Discussion ...... 110

3.4.1 Enzyme activity ...... 111

3.4.2 Antibacterial activity...... 116

3.4.3 Anticancer activity ...... 118

Chapter 4 ...... 119

Optimization of the fermentation of three selected enzymes and scale-up production of amylase using a bioreactor system ...... 119

4.1 Introduction: Enzyme secretion by endophytic fungi ...... 119

4.1.1 Amylase ...... 120

4.1.1.1 The applications of amylase ...... 122

4.1.1.2 Optimum conditions of amylases used in industry ...... 122

4.1.2 Protease ...... 126

4.1.2.1 The applications of proteases ...... 128

xv

4.1.3 Xylanase...... 130

4.1.3.1 Classification of xylanases ...... 131

4.1.3.2 Production of xylanases ...... 132

4.1.3.3 The applications of xylanase ...... 132

4.1.4 Liquid cultures ...... 134

4.1.5 Liquid enzyme assays ...... 134

4.2 Materials and Methods ...... 136

4.2.1 Preparation of crude extracellular samples using liquid culture ...... 136

4.2.2 Determination of Protein Content ...... 138

4.2.3 Comparison of enzyme activity between selected endophyte samples and standard enzyme-producing fungi ...... 138

4.2.4 Enzyme assay ...... 138

4.2.4.1 Preparation of protein samples ...... 138

4.2.4.2 α-amylase assay using Megazyme amylase assay kit ...... 139

4.2.4.3 α-amylase assay measuring reducing sugar ...... 140

4.2.4.4 Protease assay...... 140

4.2.5 Effect of carbon and nitrogen source on enzyme activities ...... 141

4.2.6 Statistical Analyses ...... 142

4.3 Results ...... 142

4.3.1 Amylase samples ...... 142

4.3.1.1 Analysis of total protein for amylase samples ...... 143

4.3.1.2 Determination of α-amylase activity of three selected endophytes in different media ...... 143

4.3.1.3 Comparison of amylase activity between standard (Aspergillus oryzae) and selected endophyte (EL-14s) ...... 144

4.3.1.4 Optimization of process parameters and effect of additional nutrients.. 146

4.3.2 Protease samples ...... 151

4.3.2.1 Analysis of total protein for protease samples ...... 151 xvi

4.3.2.2 Screening for protease activity on solid media ...... 152

4.3.2.3 Determination of protease activity between three selected endophytes. 152

4.3.2.4 Comparison of protease activity between standard (Fusarium oxysporum) and selected endophyte (EL-17)...... 153

4.3.2.5 Quantitative Protease assay of EL-17 grown at different temperature and pH ...... 155

4.3.2.6 Effect of carbon and nitrogen source on protease activity ...... 155

4.3.3 Xylanase sample ...... 157

4.3.3.1 Analysis of total protein for xylanase samples ...... 158

4.3.3.2 Comparison of xylanase activity between different samples of EM-4 on solid media ...... 158

4.3.3.3 Comparison of xylanase activity between standard (Aspergillus niger) and EM-4 ...... 159

4.3.3.4 Effect of carbon and nitrogen source on xylanase activity ...... 160

4.3.3.5 Estimation of xylanase activity using best medium to grow EM-4(S3) affected at different temperature and pH ...... 161

4.4 Discussion ...... 162

Chapter 5 ...... 173

Purification and characterization of hydrolytic enzymes and investigation of the secretome of selected endophytes ...... 173

5.1 Introduction: Endophytes as the sources of secondary metabolites and enzymes ...... 173

5.1.1 Fungal secretomes: extracellular insights into efficient substrate utilisation 175

5.1.2 Gel electrophoresis ...... 178

5.1.3 Exploring a secretome: methods of protein analysis ...... 180

5.1.3.1 Mass spectrometry ...... 181

5.1.3.2 Protein identification from mass spectra ...... 185

5.2 Material and methods ...... 187

xvii

5.2.1 Culture conditions to prepare crude extracellular enzyme ...... 187

5.2.2 Purification of amylase from EL-14 ...... 188

5.2.3 Analysis of extracellular protein content by SDS-PAGE ...... 189

5.2.4 Analysis of enzyme production by zymography ...... 190

5.2.4.1 Amylase zymography...... 190

5.2.4.2 Protease zymography ...... 191

5.2.4.3 Xylanase zymography ...... 191

5.2.5 Bioreactor studies on amylase production ...... 192

5.2.6 Two-dimensional (2D) gel electrophoresis/Further characterization of amylase ...... 193

5.2.6.1 IPG strip rehydration ...... 193

5.2.6.2 Iso-electric Focussing ...... 194

5.2.6.3 IPG strip equilibration ...... 194

5.2.6.4 Second dimension SDS-PAGE ...... 195

5.2.6.5 Preparation and in-gel digestion of purified amylase fraction/secretome of EL-14 and EM-4 ...... 195

5.2.6.6 Peptide sequencing by mass spectrometry (LC-ESI-MS/MS) ...... 196

5.3: Results ...... 197

5.3.1: Initial characterization of α-amylse from selected samples ...... 197

5.3.1.1: Purification of α- amylase produced by EL-14s ...... 199

5.3.1.2 Production of α-amylase from EL-14s in 1.4 L Bioreactor...... 201

5.3.2: Initial characterization of protease from selected samples ...... 201

5.3.3: Initial characterization of xylanase from selected samples ...... 202

5.3.4 Further characterization of selected amylase ...... 204

5.3.4.1 Mass spectrometry and peptide sequencing of purified amylase ...... 204

5.3.4.2 Protein identification and secretome study of endophytic Preussia sp. . 206

5.4 Discussion ...... 210

xviii

5.4.1 Characterisation of extracellular enzymes of selected endophytes ...... 210

5.4.2 Analysis of secretomes of selected endophytes ...... 214

Chapter 6 ...... 218

Main finding and future prospects ...... 218

6.1 Main findings ...... 218

6.1.1 Broadening of knowledge about a community of endophytic fungi in Australian plants...... 218

6.1.2 Antibacterial and cytotoxic activity of endophytic fungi...... 219

6.1.3 Endophytic fungi secrete a diverse range of enzymes...... 220

6.1.4 Optimization and characterisation of possible novel enzymes secreted by fungi from Australian native plants...... 220

6.1.5 Secretome analysis of an endophytic fungus...... 221

6.2 Future Prospects ...... 221

6.2.1 The progress of novel enzymes for industrial and environmental applications ...... 222

6.2.1.1 Strain improvement to enhance enzyme production in the native host . 222

6.2.1.2 Gene isolation and recombinant expression in an established production host ...... 223

6.2.2 Further investigation of endophyte compounds for medical applications .... 224

6.2.3 A world of endophytic fungi anticipates attention...... 225

References ...... 227

Appendix ...... 313

xix

List of figures

Figure 1.1: (a) Life cycles of systemic grass endophytes and (b) benefits to the partners. (Was taken from Saikkonen et al. 2004)………………………………………………...3

Figure 1.2: Oocydin A…………………………………………………………………..9

Figure 1.3: Proportion of biologically active compounds with antimicrobial activity isolated from different endophytic host sources shows the importance of medicinal plants as the host…………………………………………………………………………9

Figure 1.4: Aliphatic compounds……………………………………………………...12

Figure 1.5: Alkaloids…………………………………………………………………..13

Figure 1.6: Flavonoids…………………………………………………………………14

Figure 1.7: Isocoumarin derivatives…………………………………………………...14

Figure 1.8: Peptides……………………………………………………………………15

Figure 1.9: Phenols and phenolic acids………………………………………………..16

Figure 1.10: Phenylpropanoids and lignans…………………………………………...17

Figure 1.11: Quinones…………………………………………………………………18

Figure 1.12: Steroids…………………………………………………………………..19

Figure 1.13: Terpenoids………………………………………………………………..20

Figure 1.14. Other endophytic compounds…………………………………………….21

Figure 1.15: Antagonistic relationships between host plant, endophyte and pathogen. Endophytes have established an asymptomatic colonisation and may help the host plant to fight against symptomatic (pathogenic) microbes. Adapted from Schulz and Boyle (2005)……………………………………………………………………………….…..25

Figure 1.16: Guanacastepene…………………………………………………………..26

Figure 1.17: Antimycotics isolated from endophytes………………………………….27

xx

Figure 1.18: Altenusin…………………………………………………………………28

Figure 1.19: Paclitaxel (Taxol)………………………………………………………...29

Figure 1.20: Cytochalasins…………………………………………………………….31

Figure 1.21: Podophyllotoxin………………………………………………………….32

Figure 1.22: Camptothecin…………………………………………………………….32

Figure 1.23: Hinnuliquinone…………………………………………………………..33

Figure 1.24: Pestacin A and Isopestacin B…………………………………………….34

Figure 1.25: L-783,281…………………………………………...……………………34

Figure 1.26: Subglutinol A…………………………………………………………….35

Figure 1.27: Worldwide industrial enzyme usage (McAuliffe et al. 2007)……………46

Figure 1.28: New technologies and applications often require enzymes that can perform at non-ambient conditions (Lange 2004)……………………………………………….46

Figure 1.29: Applications of microbial enzymes (Morgan et al. 2009)……………….47

Figure 1.30: Peramine…………………………………………………………………49

Figure 2.1: E. longifolia, matched to dry climates, has also been successfully cultured in warm, temperate areas. It should be grown in an open, sunny position with good drainage. The species is accepting of at least moderate cold and, once established, tolerates extended dry periods. E. maculata is widely cultivated in many areas and, although best suited to dry climates, can be successfully grown in more humid areas. The species prefers soils which are alkaline to mildly acidic and well drained. Full sun is preferred and, once established, the plant tolerates extended dry periods. It is also tolerant of at least moderate cold. (Adapted from anpsa.org.au)………………………57

Figure 2.2: Sexual spores found in asci (Was taken from Webster and Weber 2007)...59

Figure 2.3: Morphological characteristics of three kinds of ascocarps: A. perithecium. B: cleistothecium. C: apothecium (Was taken fromWebster and Weber 2007)……….59

xxi

Figure 2.4: Morphological characteristics of the conidiophores. A: Aspergillus sp.; B: Penicillium sp.; C: Trichoderma sp. (Was taken from Alexopoulos et al. 1996)……...60

Figure 2.5: An Ascomycota life cycle (Was taken from Alexopoulos et al. 1996)…...60

Figure 2.6: Organisation of ribosomal RNA genes (rDNA) of fungi. The genes present in up to several hundred copies. Each repeat unit (typically from 8-12 kb each) has coding regions for one major transcript (containing the primary rRNAs for a single ribosome), interrupted by one or two intergenic spacer (IGS) regions depending on the presence of the 5S rRNA gene. (Adopted from Martin and Rygiewicz 2005)………...62

Figure 2.7: Positions of primers commonly used for amplification of the fungal ITS1- 5.8S RNA-ITS2 region. Sequences and references for primers are given in Table 1. (Martin and Rygiewicz 2005)…………………………………………………………..63

Figure 2.8: The ITS1 and ITS4 primers amplify the ITS regions. These primers were designed by White et al. (1990) and are specific to fungal species. The ITS regions are highly variable and can be used to identify the fungal species. This diagram was modified from White et al. (1990)……………………………………………………...67

Figure 2.9a: Stereomicroscope images (x 10) of a selection of endophytic fungal (EL-1 to EL-17) species from E. longifolia……………………………………………………69

Figure 2.9b: Stereomicroscope images (x 10) of a selection of endophytic fungal (EM- 1 to EM-9) species from E. maculata………………………………………………..…69

Figure 2.10: Using scanning electron microscopy (SEM) for selected endophytic fungi including EL-14, EL-17 and EM-4 with 100X and 1K X and 10K X magnification. Stereo and light microscope images showing morphological features used for the identification of endophytic fungi in Table 3.2, for example: A: conidia of Cladsporium (EL-6), B: conidia of Stemphylium (EM-2), C: conidia of Alternaria (EL -17)………..71

Figure 2.11: Agarose gel electrophoresis of PCR products following the amplification of the ITS regions of rDNA of a selection of endophytic fungi. 5µl of DNA was loaded per lane. Lane M- Gene Ruler. The PCR products ranged from approximately 500 to 700 base pairs as expected……………………………………………………………...74

xxii

Figure 2.12: DNA sequence chromatogram of the ITS regions and adjacent rDNA of endophytic fungus EL-2 from E. longifolia with accession number of AY278318……75

Figure 2.13: Sequence alignment of the ITS sequences and adjacent rDNA regions of endophytic fungus EL-2 from E. longifolia with accession number of AY278318, shown as “Query” to that of the sequence bearing greatest similarity in the NCBI database (Leptosphaerulina species AY278318 shown as “Sbjct”). Discrepancies between the sequences are indicated in red, suggesting that the fungus was of the same genus but of a different species to that of the database entry (White et al. 1990)……...76

Figure 2.14a: The ITS regions of fungal endophytes isolated from E. longifolia were used to construct a phylogenetic tree. The Neighbour-Joining method was used to infer phylogeny using MEGA version 5; p-distance and a bootstrapping score of 1000 with values of greater than 50 % were employed parameters. (Tamura et al. 2011)………..80

Figure 2.14b: The ITS regions of fungal endophytes isolated from E. maculata were used to construct a phylogenetic tree under the same conditions as above……………80.

Figure 2.14c: The ITS regions of fungal endophytes isolated from both plants, E. logifolia and E. maculata, were used to construct a phylogenetic tree under the same conditions as above……………………………………………………………………..81

Figure 3.1: Endophyte growths in a grass plant. ). Upper left: A cross section of leaf shows hyphae (h) of the endophytic fungi between host cells. Also reveal a chloroplast (ch) and vacuoles (v). Bottom left: fungal growth in the true stem and leaf primordia. The fungal hyphae are presented darkly stained Right: the endophyte as it appears in a leaf epidermal peel, stained for hyphae, which are arranged mainly along the longitudinal axis of plant cells. (Was taken from Schardl et al. 2004)………………....85

Figure 3.2: The method used to calculate relative enzyme activity (REA) of the fungal isolates. The relative activity was calculated by dividing the area of the halo around the colony (the area of the clearing zone minus the area of the colony) by the area of the colony…………………………………………………………………………………..87

Figure 3.3: Screening of amylase activity using agar plates containing starch and visualised with iodine. Test was repeated three times under different temperature and pH conditions…………………………………………………………………………...92

xxiii

Figure 3.4: a) Endophyte EM-4 exhibiting xylanase activity on xylan agar plate (incubated at 25 °C for 5 days) after staining with Congo Red. b) Endophyte EL-15 exhibiting amylase activity on starch agar plate (incubated at 25 °C for 5 days) after staining with iodine. c) Endophyte EL-17 exhibiting protease activity on agar plate supplemented with skim milk powder (incubated at 25 °C for 7 days). d) Endophyte EM-8 exhibiting ligninase activity on agar plate added with subsequently stained with ferric chloride (FeCl3) and potassium ferricyanide (K3 [Fe (CN) 6]) (incubated at 25 °C for 7 days). Note the clear zone or brown colour around the fungal colonies………….94

Figure 3.5: a) Effect of temperature on amylase activity of endophytes. Experiments were performed at pH 5.5. Error bars were included to indicate the standard deviations above and below the mean REA. Error bars indicate one standard deviation from the mean across three replicate plate assays at each condition. The absence of a column on the graphs indicates that no enzyme activity was observed, either due to lack of halo formation or lack of growth of the fungal isolate at the indicated temperature or pH…96

Figure 3.5: c) Effect of temperature on protease activity of endophytes. Experiments were performed at pH 5.5. Error bars indicate one standard deviation from the mean across three replicate plate assays at each condition. The absence of a column on the graphs indicates that no enzyme activity was observed, either due to lack of halo formation or lack of growth of the fungal isolate at the indicated temperature or pH…97

Figure 3.5: d) Effect of pH on protease activity of endophytes. Experiments were performed at 25 °C. Error bars indicate one standard deviation from the mean across three replicate plate assays at each condition. The absence of a column on the graphs indicates that no enzyme activity was observed, either due to lack of halo formation or lack of growth of the fungal isolate at the indicated temperature or pH……………….97

Figure 3.6: a) Effect of using different substrate agar plate and their relative enzyme activity of endophytes isolated from E. maculate. Experiments were performed at 25 °C and pH 5.5……………………………………………………………………………....98

Figure 3.6: b) Isolates that displayed positive results for ligninase activity were reinvestigated to observe the effect of different pH and temperature conditions on secretion of enzyme………………………………………………………………...…..98

xxiv

Figure 3.6: c) Isolates that displayed positive results for xylanase activity were reinvestigated to observe the effect of different pH and temperature conditions on secretion of enzyme…………………………………………………………………….99

Figure 3.7: a) Disk diffusion assay of EL-17 against Bacillus cereus. b) Disk diffusion assay of EL-17 against Staphylococcus aureus (Betadine used as control)…………..100

Figure 3.8: Drug sensitivity curves of PreB 697, MOLT-4 T-lymphoblastoid and Lung cancer A549 cell lines with A) EM-7; B) EM-6; C) EM-9; D) EL-14. Error Bars represent the standard error of mean (SEM) of triplicate results from 3 separate experiments……………………………………………………………………...…….104

Figure 3.9: 4 UV-HPLC (200-600nm absorption range) analysis of endophyte samples, A) EM-6; B) EL-14 C) EM-7; D) EM-9 comparing peak formation against known metabolites Alternariol; retention time 11.2 minutes and Alternariol monomethyl ether; retention time 13.9minutes. Stars indicate peaks of interest for A) EM-6, EL-14 chromatogram…………………………………………………………………………105

Figure 3.10: Chemical structure of Alternariol monomethly ether (AME) and Alternariol (AOH), both identified via HPLC in samples EM-6, EM-7 and EM-9. Alternariol and Alternariol monomethyl ether have been shown to act as an inhibitor of the topoisomerase enzyme, preferentially affecting the 11 α isoform (Fehr et al. 2008), thus disrupting DNA replication……………………………………………………....106

Figure 3.11: Drug sensitivity curves of PreB 697, MOLT-4 T-lymphoblastoid and Lung cancer A549 cell lines with A) Alternariol, B) Alternariol methyl-ether. Error Bars represent the standard error of mean (SEM) of triplicate results from 3 separate experiments. 2-way ANOVA comparing drug effect on different cell line demonstrated statistical significance < 0.0001 in AOH and 0.0009 in AME………………………..107

Figure 3.12: Drug sensitivity curves comparing the level of sensitivity of the pure AOH metabolite with the sensitivity relative to the levels of AOH and ‘AOH equivalents (AME) (abscissa) within the impure endophyte agents: EM-6, EM-7 and EM-9 against MOLT-4 cells…………………………………………...…………………………….109

xxv

Figure 3.13: Drug sensitivity curves of Primary Foreskin Fibroblast normal cell line with A) EM-6, EM-7, EM-9; B) EL-15; C) AME; D) AOH. Error Bars represent the standard error of mean (SEM) of Duplicate results from 2 separate experiments…....110

Figure 4.1: Three main types of amylase (Adopted from Singh et al. 2011)………...121

Figure 4.2: Five main types of protease (Was taken from Turk 2006)………………127

Figure 4.3: Structure of xylan and the sites of its attack by xylanolytic enzymes. The backbone of the substrate is composed of 1, 4- β-linked xylose residues. Ac., Acetyl group; α-araf., α-arabinofuranose; α-4-O- Me-GlcUA, α-4-O-methylglucuronic acid; pcou., p-coumaric acid; fer., ferulic acid. (b) Hydrolysis of xylo-oligosaccharide by β- xylosidase (Adopted from Goldman 2009)……...……………………………………130

Figure 4.4: Examples of the rate of reaction from different enzyme profiles showing the influence of environmental conditions on enzyme activity: a) temperature profiles; (b) pH profiles (Campbell 1996). The activity of a typical human enzyme (shown in black), the activity of enzymes isolated from some thermophilic bacteria (shown in green)...135

Figure 4.5: Principle of the Megazyme α-Amylase Assay (manufacturer's specifications)………………………………………………………………...……….139

Figure 4.6: Principle of the Quanticleave™ Protease Assay (manufacturer's specifications)…………………………………………………………………………141

Figure 4.7: Total protein and α-amylase activity of three selected endophytic fung...143

Figure 4.8: Amylase activity of crude extracellular extracts on solid media containing starch at 25 °C and pH 5.5…………………………………………………………….144

Figure 4.9: Comparison of amylase activity between crude extracellular enzyme from endophytic fungus (EL-14s) and standard (A. oryzae) at different temperatures at pH 3 (a), pH 5.(b), pH 7 (c) and pH 9 (d)…………………………………………………...145

Figure 4.10: A EL-14s (P. minima) was grown at different pH and crude enzymes were investigated to assess the effect of different pH on secretion of amylase and finding the best pH for amylase production. B EL-14s was grown at different temperatures and crude enzymes were to assess the best temperature for amylase production. C standards (A. oryzae and A. niger) were grown at the same conditions to compare their activity xxvi with P. minima. Means followed by the same letter within a column are not significantly different at P<0.01 according to the Duncan multiple range test. (Samples (EL-14s) growing in different temperature and different pH were analysis using Duncan test separately)………………………………………………………………………...148

Figure 4.11: Effects of different carbon and nitrogen sources at optimum conditions (25 °C and pH 9). P. minima was grown in different media based on hydrolase-inducing medium as control media (Nyugen et al. 2002) by replacing different carbon and nitrogen sources. The highest specific activity was achieved by using starch and L- asparagine in the original media. Means followed by the same letter within a column are not significantly different at p <0.01 according to the Duncan multiple range test.

Figure 4.12: The effect of metal ions on fungal amylase activity. The relative activities were measured at optimum of pH and temperature and enzyme activity without metal ions was taken as 100%...... 151

Figure 4.13: The proteolytic activities of the three endophytes on a skim-milk agar plate at 25 °C and pH 5.5……………………………………………………………...152

Figure 4.14: Comparison of total extracellular protein production and protease activity by the different fungal endophytes…………………………………………………...153

Figure 4.15: Protease activities of endophytic fungus (EL-17) and standard (F. oxysporum) at different temperature and pH conditions……………………………...154

Figure 4.16: Comparison of specific protease activities between standards and endophytic fungus, EL-17, grown at different temperature and pH. Means followed by the same letter within a column are not significantly different at P<0.01 according to the Duncan multiple range test. Variable pH experiments were performed at 25 °C, while variable temperature experiments were performed at pH 5.5………………………...155

Figure 4.17: Effects of different carbon and nitrogen sources at optimum conditions (37 °C and pH 7). Means followed by the same letter within a column are not significantly different at P<0.01 according to the Duncan multiple range test…………………..…156

Figure 4.18: Xylanase activity of crude extracellular extracts from EM-4 on solid media containing xylane at 25 °C and pH 5.5………………………………………...157

xxvii

Figure 4.19: Comparison of enzyme activities and total protein concentrations in different samples of EM-4 (S1-S8) using different sources of carbon and nitrogen at 25 °C and pH 5…………………………………………………………………………...158

Figure 4.20: Xylanase activities of EM-4 and Aspergillus niger (standard) under different pH and temperature conditions……………………………………………...159

Figure 4.21: Comparison of enzyme activities of different samples of EM-4 (S1-S8) grown under optimum conditions of 37 °C and pH 5…………………………………160

Figure 4.22: Comparison of specific xylanase activities between Aspergillus niger and EM-4 (S3) grown at different temperatures and pH. Means followed by the same letter within a column are not significantly different at P<0.01 according to the Duncan multiple range test. Variable pH experiments were performed at 25 °C, while variable temperature experiments were performed at pH 5.5. A. niger was grown under its optimum conditions (50ºC and pH 7) with respect to xylanase production…………..162

Figure 5.1: Schematic demonstrating protein separation by a) 1D electrophoresis in which proteins are separated into bands according to their molecular weight (MW); and b) 2D electrophoresis in which proteins are further resolved across two dimensions, molecular weight (MW) and isoelectric point (pI)…………………………………....179

Figure 5.2: Schematic of the 1D zymography technique. a) Proteins in a sample are separated by their molecular weight (MW) by electrophoresis on a gel containing the substrate of the target enzyme; b) The protein gel is placed in a renaturation buffer to restore enzyme activity; c) The gel is incubated in a suitable buffer; d) The gel is stained and washed; e) Proteins with enzyme activity against the substrate are revealed as bands on the zymogram………………………………………………………..…………….180

Figure 5.3: The mass-spectrometry/proteomic experiment. A mixture of proteins is prepared from a biological source such as cell culture and the last step in protein purification is often SDS–PAGE. The gel bands/spots that are achieved are excised into several slices, which are then in-gel digested. Many different enzymes and/or chemicals are available for this step. The generated peptide mixture is separated on- or off-line using single or multiple dimensions of peptide separation. Peptides are then ionized by electrospray ionization (depicted) or matrix-assisted laser desorption/ionization (MALDI) and can be analysed by various different mass spectrometers. Finally, the xxviii peptide-sequencing data that are obtained from the mass spectra are searched against protein databases using one of a number of database-searching programmes. Examples of the reagents or techniques that can be used at each step of this type of experiment are shown beneath each arrow. 2D: two-dimensional; FTICR: Fourier-transform ion cyclotron resonance; HPLC; high-performance liquid chromatography (Was taken from Steen and Mann 2004)………………………………………………………………...181

Figure 5.4: Ionisation methods used for protein analysis by mass spectrometry: a) Matrix Assisted Laser Desorption/Ionisation (MALDI); b) Electrospray Ionisation (ESI) (Was taken from Steen and Mann 2004)……………………………………………...182

Figure 5.5: a) The total ion intensity from all the mass spectra that were recorded during the liquid chromatography mass spectrometry (LC-MS) run is shown as a function of elution time. The black trace shows the total ion chromatogram. Shown in bold is the trace for the intensity of one particular ion, which elutes within a 40 second window approximately 42.5 minutes into the gradient. The bold trace shows an extracted ion chromatogram. The area under this curve represents the total signal of this peptide. b) The mass spectrum of the peptides that were eluted 42.4 minutes into the gradient is shown. The insert shows the mass-to-charge values around the peptide ion of interest, which are indicative of the resolution and allow the charge state to be derived. c) The MS/MS spectrum of the peptide ion of interest (highlighted by a dashed box in part b). The mass differences between this y-ion series indicate the amino-acid series. As this is a y-ion series, the sequence is written in the carboxy-to-amino-terminus direction going from left to right. m/z, mass-to-charge ratio (Was taken from Steen and Mann 2004).

Figure 5.6: a) The figure shows the chemical structure of a peptide, together with the designation for fragment ions. b) Cleavage of the amide bonds lead to b-ions when the charge is retained by the amino-terminal fragment or y-ions when it is retained by the carboxyl-terminal fragment (Was taken from Steen and Mann 2004).

Figure 5.7: The peptide sequences from the MS/MS spectra were identified by the MASCOT searching tool (Matrix Science Ltd., London, UK) against the NCBI nr (National Centre for Biotechnology Information non-redundant) sequence database. The

xxix criteria for protein and peptide sequence identification were based on the manufacturer’s definitions (Matrix Science Ltd)…………...... 186

Figure 5.8: Purification protocol of extracellular amylolytic enzyme…………….....189

Figure 5.9: Nanoflow LC/MS/MS system……………………………………………197

Figure 5.10: a) SDS-PAGE analysis of concentrated crude extracellular extracts of endophytes EL-13, EL-14 and EL-15. EL-14s indicates EL-14 grown in an alternative hydrolase-inducing media. M = broad range protein mix (Bio-Rad). b) Zymographic analysis of the fungal extracellular extracts of endophytes EL-13, EL-14 and EL-15. EL-14s indicates EL-14 grown in an alternative hydrolase-inducing media. Starch (0.2%) co-polymerised with polyacrylamide gel was used as a substrate for detection of amylase. M = broad range protein mix (Bio-Rad)………………………………….....198

Figure 5.11: Zymography was performed using EL-14s with highest α-amylase activity to confirm the activity at pH 9 and temperature 25 °C was optimal (Chapter 4), in comparison with standards (A. oryzae and A. niger). Markers “the precision plus protein kaleidoscope standard” was used. Common sharp band was detected around 70KD...199

Figure 5.12: Electrophoresis analysis of the crude and purified samples (EL-14). Lane M: Precision Plus Protein™ Kaleidoscope™ standards (250-10 kDa); Lane 1: 12% SDS-PAGE of the crude sample; Lane 2: 12% SDS-PAGE of the sample after TCA concentration; Lane 3: 12% SDS-PAGE of the sample after gel filtration; Lane 4: 12% SDS-PAGE of the purified α-amylase after anion exchange; Lane 5: 12% amylotic zymogram of purified α-amylase developed from protein staining with Lugol’s solution. Zymography was performed to confirm that the purified sample comprised a single band of 70kDa………………………………………………..……………………….200

Figure 5.13: SDS-PAGE analysis of concentrated crude extracellular extracts of endophytes EL-7, EL-8 and EL-17. Marker broad range protein mix (Bio-Rad)…….202

Figure 5.14: Zymography gel of endophytic fungal samples (EL-17) grown at different pH and temperature compared with F. oxysporum (grown at 25 °C and pH 5.5). All the clear bands indicate active protease and it confirmed the optimum conditions of protease activity at 37 °C and pH 7………………………………………………….…………202

xxx

Figure 5.15: a) SDS PAGE of the standard and selected endophyte (EM-4) for xylanase activity. The sharp band of 45 KDa in standard contrasts to the sharp band of 33 KDa in sample. b) Different samples of EM-4 grown in diverse sources of carbon and nitrogen in the media showing the effect on the protein profiles……………………………....203

Figure 5.16: a) Zymography gel image for xylanase activity confirmed a 45 KDa enzyme in the standard and enzymes of approximately 33 KDa and 250 KDa in EM-4. b) The use of different carbon and nitrogen sources indicated a positive effect on xylanase production in samples S1-S4 (carbon sources) but not in samples S5-S8 (nitrogen sources)……………………………………………………………………..204

Figure 5.17: a) Tryptic digest peptide spectrum of purified 70 kDa protein from P. minima. b) MS/MS spectrum of precursor peak (543.4). The data are representative of three independent experiments (Appendix 5.2)……………………………………….205

Figure 5.18: Crude extracellular proteins (approx. 200 µg) from the supernatant of (a) P. minima (EL-14) and (b) Preussia sp. (EM-4) following growth in the first hydrolase- inducing medium for 7 days were separated by 2D gel electrophoresis. .Proteins were visualized with Coomassie Blue. Gels were scanned with a Typhoon FLA 9000 laser scanner (GE Healthcare) using no emissions filter, PMT 600, Laser Red (633) and normal sensitivity. Thirty-three spots were separated that mostly had pI lower than 6 in (a) while 53 spots were mostly with pI higher than 6 in (b). (c) Amylase zymogram of 2D gel of P. minoma crude protein sample. Proteins in spots 26 and 7 could be assigned as α-amylase following an NCBI nr database search after LC-MS/MS analysis (Table 5.5). The two spots adjacent to spot 26 could be isomers with different pI (Peterson et al. 2011b)……………………………………...………………………………………207

xxxi

List of Tabels

Table 1.1 Bioactive compounds produced by endophytic fungi……………...………..22

Table 1.2 New Natural Products from Endophytic Fungi………………………….….36

Table 1.3 Some of the industrial uses of fungal enzymes (modified from Rao et al. 1998; Kashyap et al. 2001; Kirk et al. 2002; Prema 2006; Rodríguez Couto and Toca Herrera 2006; Satynanarayana et al. 2006; Aguilar et al. 2007; Dhawan and Kaur 2007, Pogori et al. 2007)…………………………………………………………….………..41

Table 1.4 Enzymes Produced by Endophytic Fungi……………………..…………….43

Table 1.5 Enzyme screening projects for fungi from environmental sources (2000 to 2010)………………………………………………………………………..…………..48

Table 2.1 PCR primers for the amplification of the ITS1-5.8S RNA-ITS2 region in fungi……………………………………………………………………….……………63

Table 2.2.1 Morphological identification of endophytic fungi isolated from E. longifolia ...... 72

Table 2.2.2 Morphological identification of endophytic fungi isolated from E. maculate………………………………………………………………..……………….73

Table 2.3 Identification of endophytic fungi based on the closest match of ITS sequences in the NCBI database¹…………………………………………………..…..77

Table 2.4 Classification of endophytic fungi based on their identification using ITS sequences……………………………………………………………………………….78

Table 3.1 Number of fungal isolates from E. longifolia and maculate that produced halos on agar plates test containing substrate for each target enzyme. Incubation was 5-7 days depending on substrate, temperature and pH……………………………………..95

Table 3.2 summary of highest enzyme activities among endophytic fungi isolated from E. longifolia and E. maculate…………………………………………………………..99

Table 3.3 Summary of screening the antibacterial activity of endophytic fungi isolated from E. longifolia and E. maculata. Fungal extracts were tested at 100 mg /mLagainst four different bacteria…………………………………………………..……………..101

Table 3.4 Summary of positive results with screening antibacterial properties…….102

Table 4.1 Uses of Amylase in various sectors of industry (modified from Kirk et al. 2002, Satynanarayana et al. 2006, Sivaramakrishnan et al. 2006)……………………122

Table 4.2a Properties of bacterial α-amylases (Souza and Magalhães 2010)……….124

xxxii

Table 4.2b Properties of fungal α-amylases (Souza and Magalhães 2010)………....125

Table 4.3 Uses of fungal proteases in various sectors of industry (Barata et al. 2002, Dayanandan et al. 2003, Nouani et al. 2011)………………………………………….128

Table 4.4 Properties of fungal xylanases and their industrial applications……...…..133

Table 4.5 Chemical compound used to identify the activity of xylanase enzyme……137

Table 4.6 Test of significant effect of three factors (standard/selected endophyte (EL- 14s, Temp and pH) on amylase activity………………………………………………146

Table 4.7 Test of significant effect of three factors (EL-14s growing in different conditions, Temp and pH) on amylase activity……………………………………….150

Table 4.8 Test of significant effect of three factors (standard/selected endophyte (EL- 17), Temp and pH) on protease activity……………………………………..………..154

Table 4.9 Test of significant effect of three factors (pH, Temp and media) on protease activity produced by EL-17……………………………………………………...……157

Table 4.10 Test of significant effect of three factors (pH, Temp and standard/selected endophyte (EM-4)) on xylanase activity……………………………………………...160

Table 4.11 Test of significant effect of three factors (pH, Temp and media) on xylanase activity produced by EM-4……………………………………………...…………….161

Table 5.1 Secretome studies of filamentous fungi (expanded from Bouws et al. 2008)…………………………………………………………………………………..176

Table 5.2 Preparation of resolving gel (12%) and stacking gel (5%) for SDS- PAGE………………………………………………………………………………….190

Table 5.3 Preparation of resolving gel (12%) and of stacking gel (5%) for zymography……………………………………………………………………….…..192

Table 5.4 Purification summary for extracellular α-amylase produced by Preussia minima……………………………………………………………………………...…200

Table 5.5 Successful protein spot identification (MS/MS/BLAST) in the secretome of Preussia minima (EL-14) by LC MS/MS by comparison to proteins in the NCBI databasea and with BLAST searching…………………………………….…………..208

xxxiii

This PhD is lovingly dedicated to my mother, Mansooreh Daneshdoost. Her support, encouregment, and constant love have sustained me throughout my life…

xxxiv

Chapter 1

Introduction

The threat posed by diseases such as cancers and infections is ever-increasing. Challenges to public health and well-being include the development of drug-resistant microbes and life threatening viruses. The problems caused by loss of biodiversity and the degradation of natural resources as a result of toxic organic insecticides and industrial effluent. Therefore, there is a general need for new and useful bioactive compounds, which are highly effective, possess low toxicity and have minor environmental impact. Traditionally, such compounds (commonly referred to as ‘natural products’) have come from the natural environment, such as microorganisms, plants and invertebrates. However, a recent trend has been to screen libraries of synthetic chemicals for bioactivity. Although this approach has brought some success, the general consensus is that outcomes have been generally disappointing. Therefore, interest is once again turning to natural products for the discovery of new drugs and chemical compounds. Without doubt, natural products have been the single most productive source for the development of new drugs, particularly anti-cancer and anti-infective agents. While plants have been a great source of valuable bioactive compounds, attention has recently turned to endophytes which are microorganisms (fungi and bacteria) living in the intercellular spaces of plant tissues without causing any obvious harm. They are recognised as potential sources of novel secondary metabolites with potential application in medicine, agriculture and industry (Bacon and White 2000, Molina et al. 2012, Zaferanloo et al. 2012). It is noteworthy that each of the approximately 300,000 plant species which exist on our planet is host to one or more endophytes (Strobel and Daisy 2003). In addition, it is estimated that there may be as

1 many as 1 million different fungal species, of which only a handful have been studied in detail (Ganley et al. 2004). Endophytes synthesise an enormous range of bioactive compounds (Owen and Hundley 2004, Higginbotham et al. 2013), thus there is a great opportunity to find new natural products from interesting endophytic microorganisms among the myriad of plants in different niches and ecosystems. This chapter will describe the rationale and methods used to discover bioactive natural products from endophytic microorganisms. In addition, these bioactive compounds will be described according to their various biological applications, in particular their medicinal and industrial potentials.

1.1 Endophytes

The term “endophyte” (Gr. Endon, within; phyte, plant) was first described by De Bary (De Bary 1866) and the first reports describing these microbes date back to the nineteenth and early twentieth centuries (Freeman 1904). One inclusive definition of endophytes is: “microbes that colonize living, internal tissues of plants, without causing any immediate negative effect” (Bacon and White 2000). Endophytes have been associated with plants for more than 400 million years (Krings et al. 2007) and play an important role in natural ecosystems by promoting plant growth (Lyons et al. 1990, Lu et al. 2000, Wu et al. 2010). It seems that plants infected by endophytes are often healthier than endophyte-free ones (Waller et al. 2005). This effect is perhaps partly due to the endophytic production of phytohormones (e.g. indole-3-acetic acid (IAA)), cytokines and other substances, such as vitamins, and partly to the fact that endophytes can increase the plant’s absorption of nutritional elements such as nitrogen (Lyons et al. 1990, Reis et al. 2000, Loiret at al. 2004, Sandhiya et al. 2005) and phosphorus (Gasoni and Stegman de Gurfinkel 1997, Malinowski et al. 1999, Guo et al. 2000b) as well as regulate nutritional qualities such as the carbon-nitrogen ratio (Raps and Vidal 1998). Endophytes are also able to enhance the ability of their host plant to resist disease (Clay et al. 1989) and microbial infections (Bacilio-Jimenez et al. 2001, Reiter et al. 2002, Waller et al. 2005), increase the ecophysiology of host plants and enable the plant to counter biotic and abiotic stresses, such as drought (Arechavaleta et al. 1989, Latch 1993, Bonnet et al. 2000). They can protect their host plants against pathogens (Danielsen and Jensen 1999, Narisawa et al. 2002, Campanile et al. 2007), fungal

2 parasitism (Samuels et al. 2000), affect the production of antimicrobial secondary metabolites, such as alkaloidal mycotoxins and antibiotics (Schulz et al. 1999, Stinson et al. 2003, Corrado and Rodrigues 2004, Kim et al. 2004, Kunkel et al. 2004, Atmosukarto et al. 2005, Li et al. 2005), and induce systematic resistance (Song et al. 2005, Vu et al. 2006). Other beneficial features have also been seen in infected plants, including resistance to insect pests (Breen 1994) and herbivores (Siegel and Bush 1997, Schardl and Phillips 1997, Mandyam and Jumpponen 2005), increased competitiveness (Hill et al. 1991) and enhanced tolerance to stressful factors such as metal contamination (Malinowski and Belesky 2000, Monnet et al. 2001, Lodewyckx et al. 2002), low pH (Lewis 2004) and high salinity (Waller et al. 2005). The length of the symptomless endophytic phase is characterised by some key characters, with importance employed upon the endophyte’s reproduction cycle and mode transmission of the symbiont (Saikkonen et al. 2004). Endophytic fungi can spread by two ways of transmission (Fig. 1.1); horizontally, by sexual or asexual spores or vertically, where systemic fungus spreads from plant to offspring by the production of host seeds (Schardl et al. 2004). These two separate reproductive pathways affect the co-habitation of endophytes and dictate the endophyte’s selection for the host plant species (Tenguria et al. 2011).

(a)

(b)

Figure 1.1: (a) Life cycles of systemic grass endophytes and (b) benefits to the partners. (Was taken from Saikkonen et al. 2004)

3

The development of complex relationships between endophyte and host has been affected by the ability of these microorganisms to colonize host plants in extreme and particular environments (Santiago et al. 2012). This consequently increases the fitness of both plant and endophyte by the adaptive evolutions of specialised survival mechanisms (Tejesvi et al. 2007a). The complex interaction between endophyte and host as a result of these protective mechanisms (Tejesvi et al. 2007a), influences chemical changes by improving the production of endophytic secondary metabolites in response to a pathogenic invasion, such as the secretion of anti-vertebrate alkaloids lolitrem B and ergovaline (Schardl et al. 2004). It is this collaboration between fungus and plant that contributes to the diverse genetic nature of the microorganisms and the production of complex bioactive metabolites (Santiago et al. 2012).

1.1.1 Host-Endophyte interactions

The horizontally transmitted endophytic fungi have complex interactions with their host plant (Santiago et al. 2012), revealing a tight variety of symbiont expression ranging between pathogenic and mutualistic associations with the host (Aly et al. 2011). This expression is directed by a range of factors including environmental pressures as well as variable genetic expression of the host plant (Suryanarayanan et al. 2009) accordingly causing alterations in metabolic profiles of both endophyte and host (Suryanarayanan et al. 2009). This complicated communication system, relying on genetic cross-talk, delivers advantageous growth conditions for both the plant host and symbiont (Aly et al. 2011). Incrased expression of particular genes in the fungal endophyte may control protection mechanisms of the plant in response to abiotic or biotic stress (Bailey et al. 2006), leading to increase production of secondary metabolites, and therefore provide increased evolutionary fitness to both plant and endophyte (Suryanarayanan et al. 2009). This increased fitness resulting from the endophyte’s ability to adapt to environmental pressures may be induced by the endophyte’s ability to combine plant DNA into its own genome (Aly et al. 2011). It is believed that this adaptability and genetic flexibility demonstrated by endophytic fungi (Strobel et al. 2004) facilitates secondary metabolite production and thus introduces vast chemical diversity, which is of particular relevance

4 to industrial, environmental and pharmaceutical applications of endophyte-derived compounds.

1.2 Rationale for studying endophytes as potential sources of new medicinal compounds

The discovery of novel and potentially useful compounds from natural products has been a main focus of research over the past century. Improvements in drug discovery have modernized healthcare in developed countries, however with huge costs attributed to high-throughput screening and combinational chemistry, developing countries still depend on the natural products for medicinal treatments (Wachtel-Galor and Benzie 2011). The importance is evidenced by the global distribution of natural products within current drug production, with 30% of all drugs sold worldwide containing at least one active ingredient isolated from natural products. Moreover, of particularly increasing importance, 61% of all drugs under current development originate from natural sources (Ramasamy et al. 2010). This clearly represents their pharmacological importance and demonstrates the ability of natural products to provide a rich wealth of biological and chemical diversity, with such properties first utilised over 200 years ago (Wachtel-Galor and Benzie 2011). With the current drop in the discovery rate of active novel chemical entities (Cragg and Newman 2005), the need to bioprospect previously un-explored regions, which offer a rich biodiversity of plant species growing in challenging conditions, is becoming essential. This subsequently presents a greater opportunity to maximise the discovery of novel biotopes. Microorganisms have been a productive source of novel, essentially diverse biotopes, demonstrating huge chemical sources (Santiago et al. 2012) for not only deriving some of the most essential pharmaceutical products currently available (Schwartsmann et al. 2002), but also in discovering new compounds with anti-cancer, antibiotic and anti-fungal properties (Hazalin et al. 2012). Endophytes are a vast source of biodiversity with largely undiscovered bioactive compounds that are a readily renewable, reproducible and inexhaustible supply of novel structures having pharmaceutical potential (Staniek et al. 2008). In the past century, only about 100,000 fungal species, including endophytic fungi, have been studied (Hawksworth and Rossman 1987); however, it is estimated that there may be at least 1

5 million species of endophytic fungi alone (Dreyfuss and Chapela 1994). Endophytes are detected in a wide variety of plant tissue types, such as seeds and ovules (Siegel et al. 1987), fruits (Schena et al. 2003), stems (Gutierrez-Zamora and Martinez-Romero. 2001), roots (Germida et al. 1998), leaves (Smith et al. 1996), tubers (Sturz et al. 1998), buds (Ragazzi et al. 1999), xylem (Hoff et al. 2004), rachis (Rodriguez and Samuels 1999) and bark (Raviraja 2005). It is widely accepted that there are few plants without endophytes, including some shrubs and trees (Gennaro et al. 2003). Several studies have shown the presence of endophytes in host species belonging to all plants, from mosses and ferns to monocotyledons. These data show that bacteria and fungi are the most common endophytic microorganisms (Petrini 1986, 1991). Evidence of plant-associated microorganisms detected in the fossilized tissues of stems and leaves indicated that endophyte-host associations may have evolved from the time that higher plants first appeared on the earth (Taylor and Taylor 2000, Andrzej 2002). Research about the origin and evolution of endophytes has suggested that some phytopathogens are related to endophytes and have an endophytic origin (Carroll 1988). In certain environments, some microbes appear to actively enter plant tissues through invading openings or wounds, as well as proactively using hydrolytic enzymes. Some bacterial endophytes are believed to originate from the rhizosphere microbiot (Misko and Germida 2002), through penetrating and colonising root tissue as an access point to the xylem (Sturz and Nowak 2000). Results showed that the endophytes enhanced the diversity and size of the rhizospheric microbial populations (Yang et al. 2013) and they confirmed the symbiotic relations between the endophytic microbial and their host plant (Dai et al. 2003). During the long co-evaluation of endophytes and their plants, endophytic microorganisms have adapted themselves to their special microenvironments by genetic variation through the uptake of some plant DNA into their own genomes (Germaine et al. 2004). As a direct result, this could have led to the ability of certain endophytes to synthesise some phytochemicals originally associated with the host plant (Stierle et al. 1993). Just as plant secondary metabolites have been developed into medicinces, the same secondary metabolites isolated from endophytes may ultimately have medical applications (Strobel 2003). The scope for the discovery of novel compounds is great with a comprehensive study showing that 51% of biologically active substances isolated from endophytic

6 fungi were previously unknown (Schutz 2001). In a coevolutionary context, endophytic microbes improve the resistance of the host plants by producing bioactive secondary metabolites (Strobel 2003). The evolved relationships between endophytes and their host plants involve multi-species interactions which are affected by stochastic events, such as abiotic and biotic challenges (Saikkonen et al. 2004). The results of some research suggested endophytic colonisation involved an activation process governed by genetic determinants from both partners (Dong et al. 2003). Results indicated that the host-endophyte relationship and the possibility of transferring genetic systems could have led to the evolution of biochemical pathways which resulted in the production of plant growth hormones, including auxins, abscisins, ethylene, gibberellins and kinetinsis (Goodman et al. 1986). Furthermore, independent evolution of the endophytes may have allowed them to better adapt to a particular host as well as protect the host plant from pathogens, insects and grazing animals and enhance their resistance to unfavourable challenges. Eventually, different types of relationships may have formed, resulting in symbiosis or mutualism and ultimately to host specificity (Fisher and Petriniet 1993, Gao et al. 2005). Overall, the rationale for investigating endophytic microbes as potential sources of new medicinals is related to the fact that they are a relatively unexplored area of biochemical diversity. In particular, the protection provided by endophytes to the host plant by diverse antimicrobial compounds increases the attractiveness of such compounds in medical applications. In addition, because toxicity to higher organisms is a concern of any prospective drug, natural products isolated from endophytes may be an appealing alternative, since these compounds are produced within a eukaryotic system with no apparent harm. Therefore, the host plant itself has naturally served as a selection system for microbes producing bioactive compounds with reduced toxicity toward higher organisms.

1.3 Rationale for plant selection

Particular microbial metabolites are characteristic of certain biotopes, both at the environmental and organismal levels. Consequently, it appears that the study of novel secondary metabolites should be based on organisms that inhabit unique biotopes. Thus, it is important to understand the methods and rationale that provide the best

7 opportunities to isolate novel bioactive compounds from an enormous selection of available plant species. Plants growing in areas of great biodiversity, e.g. tropical rainforests with the greatest levels of biodiversity globally, have the greatest prospect for endophytes with novel metabolites. Similarly, plants growing in unique habitats, especially those with an unusual biology and possessing novel strategies for survival (e.g. the mangrove forest ecosystem in the tidal shallows of the sea border), are considered especially important for the investigation of unusual endophytic species (Kumaresan and Suryanarayanan 2001). A specific example is the aquatic plant, Rhyncholacis penicillata, which exists beside a river sytem in Southwest Venezuela in which the harsh aquatic environment is one surrounded by debris, tumbling rocks and pebbles. Such circumstances should provide opportunity for pathogenic oomycetes to attack the plant. Investigation of the endophytes of R. penicillata led to the isolation of a potent antifungal bacterium, identified as Serratia marcescens, able to produce oocydin A (Fig. 1.2), a novel anti-oomycetous compound that obviously protects the host plant from the water moulds (Strobel et al. 1999a). Plants asymptomatically infected with phytopathogens have a greater likelihood of having resident endophytes which produce antimicrobial natural products, as exemplified by an endophyte reported to have antimicrobial activity against the plant pathogen Colletotrichum musae (Tuntiwachwuttikul et al. 2008). Plants that have an ethnobotanical history and have been used by indigenous people as traditional medicines are also good candidates for finding novel bioactive endophytes. The antibacterial endophytic fungus from traditional Chinese medicine, Celastrus angulatus (Ji et al. 2005), and the novel endophytic Streptomyces isolated from an Australian medicinal plant, snakevine (Kennadia nigriscans), which produces a wide-spectrum novel peptide antibiotic called munumbicins (Castillo et al. 2002), are two relevant examples. Finally, endemic plants which have an unusual longevity or occupied a certain ancient land mass such as Gondwanaland (Strobel and Daisy 2003) are also considered good options for the discovery of novel endophytes. An example is the isolation of the antituberculosis compound, chaetoglobosin B, from the leaves of Maytenus hookeri which is only distributed in areas of Yunnan, China (Ni et al. 2008).

8

Figure 1.2: Oocydin A.

Since the recognition that medicinal plants are a repository of endophytes with novel compounds of pharmaceutical importance (Strobel et al. 2004, Wiyakrutta et al. 2004, Kumar and Hyde 2004, Tejesvi et al. 2007a, Selvanathan et al. 2011, Tenguria and Khan 2011, Tong et al. 2011), many studies have focused on such plant species (Raviraja et al. 2006, Huang et al. 2008b, Tejesvi et al. 2008, Lin et al. 2010, Huang et al. 2007a, Lv et al. 2010). Indeed, a recent comparison of the origins of endophytes in screening studies of antimicrobial activity confirmed that medicinal plants were frequently used as the source hosts (Fig. 1.3) (Yu et al. 2010b, Ellsworth et al. 2013).

Figure 1.3: Proportion of biologically active compounds with antimicrobial activity isolated from different endophytic host sources shows the importance of medicinal plants as the host.

In some cases, endophytes produce the same rare and important bioactive compounds as their host plants. However, using endophytes as the sources of such compounds reduces the need to harvest slow-growing and rare plants, thus preserving 9 the world’s ever-diminishing biodiversity. In addition, a microbial source of a valued natural product may be easier and more economical to produce, effectively reducing its market price.

1.4 Isolation of endophytes

It is important to introduce a specific protocol for the isolation of endophytes from a given plant, especially as 90-99% of microorganisms are not readily cultivated (Amann et al. 1995). The method frequently utilized to detect and quantify endophytes involves isolation from surface-sterilised host plant tissue (Zhang et al. 2006). Surface sterilisation of plant material is usually performed by treatment with a strong oxidant or general disinfectant for a period, followed by a sterile rinse. Effective oxidants are 3% H₂O₂ and 2% KMnO₄ (Bills et al. 2004), while household bleach (NaOCl), usually diluted in water to concentrations of 2-10%, is the most commonly used surface sterilant. In addition, the efficacy of surface sterilisation can be increased by combining the sterilant with a wetting agent. Ethanol (70-95%) is the most commonly used wetting agent (Schulz et al. 1993), although surfactants such as Tween 80 are also used as wetting agents to increase surface sterilisation of the host plant (Bills et al. 2004). In order to isolate endophytes from plant seeds, rubbing the seeds vigorously between the hands is needed to remove contaminants associated with the dry glumes and then rinsing the seeds for 15-20 minutes with a bleach solution (Bills et al. 2004). Endophytes are generally isolated after cutting plant material into segments (3-5 mm long) followed immediately by treatment with bleach. Alternatively, the plant organ is surface-treated with 70% ethanol and then dried under a laminar flow flood (Reis et al. 2000, Strobel 2003). Then, a sterile knife blade is used to remove the outer tissues from the samples and the inner tissues are carefully placed on water agar plates. After several days of incubation, hyphal tips of fungi are removed and transferred to Potato Dextrose Agar (PDA) plates. Endophytic bacteria are less common and one of the reasons may be the difficulty in their isolation. They live in intercellular spaces instead of intracellular spaces and this may be the reason for their low recovery rate (Zhang et al. 2006). The isolation of endophytic bacteria is often accomplished by placing plant tissue on Luria- Bertani agar plates (Hallmann et al. 1997).

10

1.5 Identification of endophytes

Morphological examination of endophytic fungi is performed by scrutinising the culture, the mechanism of spore production and the characteristics of the spores. Each of isolated fungal strains is separately incubated on PDA, Cornmeal Agar (CMA), Carrot Agar (CA) and Potato Carrot Agar (PCA) to achieve a pure culture and optimum conditions for sporulation (Reis et al. 2000). Furthermore, endophytic fungi that neither grow nor sporulate in culture can only be identified by molecular methods. Thus, endophytes are often detected using a combination of morphological and molecular methods (Raps and Vidal 1998, Malinowski and Belesky 1999). The molecular detection is based on comparison of ribosomal DNA (rDNA) of individual endophytes with the GenBank sequence database using the NCBI BLAST program. For newly discovered endophytic fungi, morphology-based detection is confirmed by 18S rDNA sequence comparison or internal transcribed spacer regions (ITS1 and ITS4) and 5.8 rDNA sequence examination (White et al. 1990). Bacterial endophytes are detected by 16S rRNA-based techniques, however, several molecular methods are combined to detect novel endophytic isolates (Scott 2001, Loiret et al. 2004, Bhore et al. 2013).

1.6 Bioactivity of endophytic compounds according to chemical class

Numerous bioactive natural products isolated from endophytes have been reported in recent years and these compounds can be classified into diverse chemical classes, including aliphatic compounds, alkaloids, flavonoids, isocoumarin derivatives, peptides, phenols, phenylpropanoids and lignans, quinines, steroids and terpenoids (Zhang et al. 2006, Yu et al. 2010b). Specific examples are described below and are summarised in Table 1.1.

1.6.1 Aliphatic compounds

Antimicrobial aliphatic compounds (Fig. 1.4) are frequently detected in cultures of endophytes. Chaetomugilin A (1) and D (2) are two aliphatic compounds with antifungal activities which were isolated from an endophytic fungus Chaetomium globosum collected from Ginkgo biloba (Qin et al. 2009). Other examples of these types

11 of compounds with antifungal activities, cytosporone B (3) and C (4), were isolated from a mangrove fungal endophyte, Phomopsis sp. (Huang et al. 2008a). Wang and colleagues have found brefeldin A (5) synthesized by an endophytic Cladosporium sp. residing in Quercus variabilis with antimicrobial potential (Wang et al. 2007).

Figure 1.4: Aliphatic compounds

1.6.2 Alkaloids

Alkaloids (Fig. 1.5) are one of the common secondary metabolites in endophytes and many are pharmacologically active (Iwassa et al. 2001, Rackova et al. 2004). Two antibacterial alkaloid compounds, Chaetoglobosins A (6) and C (7), were isolated from an endophytic C. globosum originating from the leaves of G. biloba (Qin et al. 2009). Pyrrocidines A (8) and B (9), two newly reported antibiotics, were isolated from the endophyte Acremonium zeae in maize and show significant antifungal activities (Wicklow et al. 2005). A recently described antibacterial alkaloid, phomoenamide (10), is synthesized by an endophytic fungus Phomopsis sp. in Garcinia dulcis and exhibits a minimum inhibitory concentration (MIC) of 6.25 µg/ml against Mycobacterium tuberculosis (Rukachaisirikul et al. 2008). Two endophytic bacteria, Pseudomonas sp. and Enterobacter sp., which were isolated from a suspension culture of Pinellia ternate protocorm-like bodies (PLBs) produced alkaloid compounds. One of the highest natural

12 sources of alkaloids, including purines and pyridines, is Pinellia ternate (Liu et al. 2010b). Purine alkaloids, like guanosin and inosine, have been shown to exhibit anti- tumour and anti-viral activities (Kinahan et al. 1981). Pyridine alkaloids, such as trigonelline, are also used in the treatment of diabetes mellitus and liver injury (Sur et al. 2001, Zia et al. 2002).

Figure 1.5: Alkaloids

1.6.3 Flavonoids

Antimicrobial flavonoids (Fig. 1.6) were isolated from the endophytic fungus Nodulisporium sp. from Juniperus cedre (Dai et al. 2006a). These compounds can be used as lead molecules whose activities can be increased by manipulation through synthetic chemistry.

13

Figure 1.6: Flavonoids

1.6.4 Isocoumarin derivatives

Three metabolites (Fig. 1.7) of this type have been isolated from endophytic sources. These compounds were separated from endophytic Geotrichum sp. which exists in Crassocephalum crepidiodes and biological assays showed their antimalarial, antituberculous and antifungal activities (Kongsaeree et al. 2003).

Figure 1.7: Isocoumarin derivatives

1.6.5 Peptides

Antimicrobial activities are displayed by many endophytic peptides (Fig. 1.8). Leuesnostatin A (17), synthetised by Acremonium sp. in Taxus baccata, exhibited antimicrobial activities against Pythium ultimum (Strobel et al. 1997). A novel lipopeptide, cryptocandin (18), isolated from the endophyte Cryptosporiopsis quercine from Tripterigium wiflordii, a medicinal plant native to Eurasia, showed excellent 14 antifungal activities against some important human fungal pathogens including Candida albicans and Trichophyton spp. (Strobel et al. 1999b). Cryptocandin and its related compounds are considered useful against a number of fungi causing diseases of skin and nails. A group of endophytic peptides, echinocandins (A, B, C and D) (19-22), isolated from Cryptosporiopsis sp. and Pezicula sp. in Pinus sylvestris and Fagus sylvatica, respectively, were shown to be antimicrobial (Noble et al. 1991). Two antibacterial peptides, cyclo (Pro-Thr) (23) and cyclo (Pro-Tyr) (24), were produced by the endophytic fungus Penicillium sp.0935030 isolated from the mangrove plant Acrostichum aureurm (Cui et al. 2008).

Figure 1.8: Peptides

1.6.6 Phenols and phenolic acids

Phenol and phenolic acids (Fig. 1.9) are often synthetised from endophytic secondary metabolites in a variety of host plants. Many novel phenol and phenolic acids with antibacterial activities have been identified in recent studies, showing that these 15 groups of endophytic compounds will be a great potential to find new and effective antibiotics. Pestalachloride A (25) and B (26) are two new antibiotics isolated from the endophyte Pestalotiopsis adusta which exhibited significant antifungal activity against plant pathogens (Li et al. 2008a). A group of antibacterial phenolic acids (27-29) were isolated from the culture broth of an endophytic Phoma sp. from the Guinea plant, Saurauia scaberrinae (Hoffman et al. 2008). Orsellinic acid and three novel esersglobosumone were synthetised by an endophytic Chaetomium globosum in Ephedra fasciulat, of which globosumone A (30) showed moderate inhibitory activity of cell proliferation of lung cancer, breast cancer, CNS glioma and pancreatic carcinoma (Bashyal et al. 2005).

Figure 1.9: Phenols and phenolic acids

1.6.7 Phenylpropanoids and lignans

Guignardic acid (Fig. 1.0), isolated from Guignardia sp., an endophyte of Spondias mombin with antibacterial activities, produced the oxidative deamination 16 compounds dimethylpyruvic acid and phenylpyruvic acid (Rodrigues-Heerklotz et al. 2001).

Figure 1.10: Phenylpropanoids and lignans

1.6.8 Quinones

Quinones (Fig. 1.11) are another group of secondary metabolites isolated from endophytes with antimicrobial activities. 3-O-methylalaternin (32) and altersolanol A (33) were isolated from the endophyte Ampelomyces sp. from the medicinal plant Urospermum picroides. These compounds showed antimicrobial activity against the Gram-positive bacteria, Staphylococcus aureus, S. epidermidis and Enterococcus faecalis. The antibacterial activity of altersolanol A is not due to its cytotoxic activity, but rather that the compound acts as an electron acceptor in the bacterial membrane and inhibits bacterial growth (Haraguchi et al. 1992, Aly et al. 2008). Three new spiroketals (34-36) were isolated from the endophytic fungus Edenia gomezpompae which displayed significant inhibition against phytopathogens (Macías-Rubalcava et al. 2008).

17

Figure 1.11: Quinones

1.6.9 Steroids

Steroid compounds (Fig. 1.12) are another class of endophytic chemical compounds. Ergosterol (37) and 5α, 8α-epidioxyergosterol (38) were isolated from the culture extract of the endophytic fungus Nodulisporium sp. isolated from Juniperus cedre on Gomera Island (Dai et al. 2006a). Four antibacterial steroid compounds (39- 42) were produced from Colletotrichum sp. isolated from Artemisia annua and these compounds elicited fungistatic activities towards plant pathogens (Lu et al. 2000). However, most steroid compounds isolated from endophytes have showed moderate antimicrobial activities, so it is unlikely that effective drugs or pesticides will be found from this group of endophytic compounds.

18

Figure 1.12: Steroids

1.6.10 Terpenoids

Sesquiterpenes, diterpenoids and triterpenoids are the major terpenoids (Fig. 1.13) isolated from endophyes (Yu et al. 2010b). Guanancastepene A (43), guanacastepene (44), periconicin A (45) and periconicin B (46) were four novel diterpenoid antibacterials isolated from endophytes (Brady et al. 2000, 2001, Kim et al. 2004). Five sesquiterpenes (47-51) were produced by fractionation from the endophyte

19

Phomopis cassiae found in Cassia spectabilis and found to be active against Cladosporium cladosporioides and C. sphaerospermum (Silva et al. 2006).

Figure 1.13: Terpenoids

1.6.11 Other endophytic compounds

Two new cyclohexanone derivaties (52, 53), separated from the endophytic fungus, Pestalotiopsis fici, showed significant antifungal activities against Aspergillus fumigatus (Liu et al. 2009). Sordaricin (54), produced by the endophytic fungus Xylaria sp. isolated from the leaves of Garcinia dulcis, showed moderate activity against a board range of fungal pathogens (Pongcharoen et al. 2008). The antifungal trichodermin (55), characterized from Trichoderma harzianum isolated from Llex cornuta Lindl, showed a significantly protective effect against early blight on tomato and damping-off

20 on cucumber (Chen et al. 2007). Four lactones, sequoiamonascins A-D (56-59) (which contain a novel carbon skeleton), were produced by the fungal endophyte Aspergillus parasiticus and have been shown to have moderate activities against cancer cell lines, including MCF7 (breast), NCI-H460 (lung) and SF-268 (CNS) (Stierle et al. 2003) (Fig. 1.14).

Figure 1.14. Other endophytic compounds

21

Table 2.1 Bioactive compounds produced by endophytic fungi

Types of Entophyte Host plant Bioactivity Ref. endophytic compounds

Aliphatic Chaetomium Ginkgo biloba Antifungal Qin et al. 2009 compounds globosum

Cladosporium sp. Quercus Antifungal Wang et al. 2007 variabilis

Fungal endophytes Chinese herbs Antimicrobial Mousa and Raizada 2013

Phomopsis sp. Excoecaria Antifungal Huang et al. agallocha 2008a

Alkaloids Acremonium zeae Maize Antifungal Wicklow et al. 2005

Acremonium zeae Maize Antibacterial Wicklow and poling 2009

Penicillium citrinum Ceratonia cytotoxicity El-Neketi et al. siliqua 2013

Phomopsis sp. Garcinia dulcis Antibacterial Rukachaisirikul et al. 2008

Flavonoids Nodulisporium sp. Juniperus cedre Antifungal, Dai et al. 2006a Antibacterial

Peptides Cryptosporiopsis Pinus sylvestris Antifungal , Noble et al. 1991 sp., Pezicula sp. and Fagus antibacterial sylvatica

22

Table 1.1 Bioactive compounds produced by endophytic fungi Types of Entophyte Host plant Bioactivity Ref. endophytic compounds

Cryptosporiopsis Tripterigium Antifungal Strobel et al. quercine wiflordii 1999b

Fusarium Rhododendron Antimicrobial Tejesvi et al. tricinctum tomentosum 2013

Penicillium sp. Acrostichum Antifungal, Cui et al. 2008 aureurm Antibacterial

Culophyllum sp. Pullularia sp. Antiprotozoal, Isaka et al. Antiviral 2007

Phenols Alternaria sp. Sonneratia alba Antibacterial Kjer et al. 2009

Neotyphodium Lolium Antifungal Pańka et al. coenophialum arundinaceum 2013

Penicillium sp. Cerbera Antibacterial Han et al. manghas 2008

Quinones Ampelomyces sp. Urospermum Antibacterial Aly et al. picroides 2008

Dendryphion Ficus religiosa Antidiabetic, Anti Mishra et al. nanum inflammatory 2013

Edenia Callicarpa Antifungal Macías- gomezpompae acuminata Rubalcava et al. 2008

Penicillum Unidentified Antiviral Singh et al. chrysogenum 2003

23

Table 1.1 Bioactive compounds produced by endophytic fungi Types of endophytic Entophyte Host plant Bioactivity Ref. compounds

Steroids Colletotrichum Artemisia annua Antifungal Lu et al. 2000 sp.

Phomopsis sp Aconitum Antifungal Wu et al. carmichaeli 2013

Terpenoids Phomopiscassiae Cassia Antifungal Silva et al. spectabilis 2006

Periconia sp. Taxus cuspidate Antibacterial Kim et al. 2004

Fungal Not mention Antimicrobial de Souza et endophytes al. 2011

1.7 Endophytic natural products as drugs and novel drug leads

More than 20 drugs derived from natural products were approved onto the worldwide market in 2002-2005 and around 140 have undergone different stages of clinical development in all major therapeutic areas (Butler 2005, Lam 2007). It seems impossible to estimate the impact of endophytic natural products on the drug discovery process, although functional metabolites of endophytic origin have considerable potential to impact in the pharmaceutical arena (Tan and Zou 2001, Strobel 2003, Strobel and Daisy 2003, Strobel et al. 2004, Gunatilaka 2006, Higginbotham et al. 2013). The biological activities of the endophytic fungus depend on the natural compounds that they produce in the host plant. The secondary metabolites are usually alkaloids, steroids, terpenoids, isocoumarin derivatives, quinones, phenylpropanoids and lignans, phenols and phenolics, aliphatic compounds, lactones and others (Zhang et al. 2006). Endophyte research has yielded potential drug lead compounds with antibacterial, antiviral, antioxidant, insulin mimetic, anti-neurodegenerative and immunosuppressant properties. Microbial endophytes possessing natural substances 24 were observed to kill a broad array of pathogenic microbes ranging from bacteria to protozoans (Strobel and Daisy 2003). Moreover, while being implicated in livestock neurotoxicosis, some endophyte- produced bioactive compounds show insecticidal activity. A very elegant hypothesis has been suggested that the endophyte-host relationship is postulated to be a “balanced antagonism” (Fig. 1.15).

Figure 1.15: Antagonistic relationships between host plant, endophyte and pathogen. Endophytes have established an asymptomatic colonisation and may help the host plant to fight against symptomatic (pathogenic) microbes. Adapted from Schulz and Boyle (2005).

It is clear that the future success of the pharmaceutical industry depends on the combination of complementary technologies such as natural product discovery (Demain and Zhang 2005), metabolic engineering (Tyo et al. 2007), combinatorial biosynthesis and combinatorial chemistry (Floss 2006). Examples of metabolites identified from endophytes as biological factories of functional metabolites are described below and summerised in Tbale 1.2.

25

1.7.1 Endophytic products as antibiotics

Antibiotics, recognised as low-molecular-wight organic natural compounds produced by microorganisms that are active at low concentrations against other microorganisms (Demain 1981), are the most common bioactive secondary metabolites isolated from endophytes. Natural products from endophytic microbes have been shown to inhibit a board variety of harmful disease-causing agents including, but not limited to, bacteria, fungi, viruses and protozoans that are pathogens of humans, animals and plants. The search for new and alternative antibacterial compounds, particularly those with novel modes of action, is especially important given the extent of resistance to many of the presently available drugs. Natural products, including those produced by endophytes, are considered a good source of alternative antibiotics (Christina et al. 2013). Guanacastepene (Fig. 1.16), a novel diterpenoid isolated from an endophytic fungus living in Daphnopsis americana (found growing in the Guanacaste province of Costa Rica), proved to be a potential new class of antibacterial agents. It showed activity against methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecium (Singh et al. 2000). Fungal endophytes isolated from members of the family Euphorbiaceae (which includes some medicinal plants) have been found to produce antibacterial compounds which were active against a variety of tested bacteria, such as S. aureus and Bacillus subtilis (Dai et al. 2006b).

O

H CH O OAc

Figure 1.16: Guanacastepene

Finding new antimycotics is becoming more urgent given the rise in fungal infections amongst immunocompromised people. Phomol (Fig. 1.17.A), a novel antibiotic, was synthetised from fermentations of an endophytic Phomopsis species

26 isolated from the Argentinian medicinal plant Erythrina crista-galli. This compound also exhibited antiinflammatory, neuroleptic, antibacterial and weak cytotoxic activities (Weber at al. 2004). A highly functionalised cyclohexenone epoxide, Jesterone (Fig. 1.17.B), was separated from an endophytic Pestalotiopsis jesteri found in Fragraea bodenii (Li and Strobel 2001). Ambuic acid (Fig. 1.17.C), a quinone epoxide compound, was extracted from Pestalotiopsis spp. and Monochaetia sp. living in Torreya taxifolia. Both these compounds displayed potent antifungal activity (Li and Strobel 2001).

Figure 1.17: Antimycotics isolated from endophytes

Parasitic protozoan species belonging to the genera Trypanosoma and Leishmania are the causes of several diseases in tropical areas of the world, so there is an urgent need for effective and affordable new drugs against these pathogens. Altenusin (Fig. 1.18), a biphenyl isolated from an endophytic Alternaria sp. (UFMGCB55) living in the plant Trixis vauthieri DC, was shown to procduce trypanocidal compounds which inhibit trypanothione reductase (TR). This enzyme is involved in the protection of parasitic protozoan species against oxidative stress and is considered to be a validated drug target. Altenusin is the first compound in its class to have TR inhibitory activity, opening new perspectives for the design of more effective derivatives that could serve as drug leads for new chemotherapeutic agents to treat trypanosomiasis and leishmaniasis (Cota et al. 2008).

27

O OH HO O

HO

CH3 O CH3

Figure 1.18: Altenusin

It was demonstrated by Hazalin et al. (2009) that about 8% of the isolated endophytic fungi isolated from Malaysian plant samples possessed antibacterial properties. Additionally, a study performed by Lv et al. (2010) into the antibacterial activities of fungal endophytes isolated from an Alpine Plant demonstrated that 24.5% of fungal strains exhibited antibacterial action against at least one bacterial strain. Discovering novel antibacterial compounds may be important in the development of new agents to combat the rise of bacterial resistance to some commonly used drugs (Strobel et al. 2004, Yu et al. 2010). Novel antibacterial and antifungal compounds may also have an important role to play in the fight against many human diseases that are caused as a result of a compromised immune system (Strobel and Daisy 2003). Furthermore, there may be significant applications in agriculture, where such remedies could be utilised in conjunction with or in place of conventional bactericides, insecticides and fungicides, thus limiting the need to use environmentally harmful agrochemicals (Strobel et al. 2004).

1.7.2 Volatile antiobitics

Muscodor is a novel fungus which produces extremely bioactive volatile organic compounds (VOC’s). The original endophytic fungus, Muscodor albus, originated from the host plant Cinnamomum zeylanicum and produced a mixture of VOC’s that were lethal to a broad range of plant and human pathogenic fungi and bacteria as well as nematodes and certain insects. Analysis of the mixture of VOC’s showed that it consisted of various alcohols, acids, esters, ketones and lipids. Muscodor species have

28 been sugessted to be a prospective agent for mycofumigation, agriculture, medicine and industry (Strobel et al. 2001, Strobel 2011, Ting et al. 2010).

1.7.3 Anticancer agents from endophytes

Cancer is the second major cause of death around the world after cardiovascular diseases (Firáková et al. 2007, Miller et al. 2012, Chandra et al. 2012). It was estimated by Strobel et al. (2004) that over 50% of current anti-cancer drugs approved by the FDA have been obtained or derived from natural products. The importance of bioprospecting is further highlighted by the success of the anti-cancer drug, Paclitaxel, which occurs in a natural form in the endophytic fungi of yew plants (Strobel and Daisy 2003). Paclitaxcel (Taxol) (Fig. 1.19) is the most striking example because of its potent anticancer activity. After the discovery of this compound in the 1960s and the elucidation of its structure, it was approved by the FDA in 1992. This diterpenoid natural product has become a blockbuster drug with commercial sales of over US$3 billion in 2004 (Croteau 2005). Initially it was obtained from the inner bark of Taxus brevifolia, a rare and slow-growing tree. The ecological problem resulting from the endangerment of this plant and the increase demand for the drug prompted the search for alternative paclitaxel-producing microorganisms among the endophytic fungi of Taxus species. Endophytic Taxomyces andreanae was the answer to this search and during the 1990s several reports of different Taxol-producing endopytes were released (Stierle et al. 1993, Strobel at al. 1996, Noh et al. 1999, Zhou and Ping 2001). A recent example is the endophytic fungus isolated from Taxus chinensis var. mairei which proved to have strong toxicity to liver cancer cells 7402 and lung cancer cells A549 (Guo et al. 2008a).

O

O O O OH

NH O

O H O HO O O OH

Figure 1.19: Paclitaxel (Taxol)

29

Taxol and its synthetic derivatives (paclitaxel) represent one of the first anti- cancer agents from fungal endophytes to reach and subsequently demonstrate efficacy in clinical trials (Strobel et al. 2004) The diterpenoid taxol was primarily isolated from endophytic fungi residing in the bark, roots and branches of western yew, Taxus brevifolia (Zhou et al. 2010), with continued research further identifying more than 20 different genera of taxol-producing endophytic fungi, including Taxomyces sp. and a range of Alternaria species (Zhou et al. 2010). Preliminary screening of the tetracyclic diterpeniod, Taxol, confirmed broad spectrum in vivo cytotoxicity against p-388,p-1534 and 1-1210 murine leukemia, the Walker 256 carcinosarcoma and sarcoma 180 (Tejesvi et al. 2007a). Although Taxol demonstrated its potent ability as an anti-cancer agent, formulation difficulties and low availability attributed to a long development period. Taxol entered phase 1 clinical trials in 1983, 23 years after discovery, earning FDA approval for the treatment of ovarian cancer in 1992. Taxol acts an anti-miotic drug, promoting polymerization of tubulin causing assemblage of stable microtubules and protects it from disassembly (Kingston 1993). This leaves the chromosomes unable to form metaphase spindle arrangements and subsequently blocks the progression of mitosis (Bharadwaj and Yu 2004), subsequently triggering apoptosis and preventing proliferation. The alkaloids, a group of naturally occurring chemical compounds, are also readily found within endophytic fungi, including such genera as Chalara, Phoma and Hpoxylon, which are examples of the synthesisers responsible for producing a specific type of alkaloid, the cytochalasins (Tenguria et al. 2011). These fungal metabolites have demonstrated anti-tumour activity, by the ability to interact and successively attach to actin filaments within a cell. This interaction blocks the functionality of actin and therefore inhibits a range of cellular processes (Haidle and Myers 2004), regaining control over cellular dysfunctions driven by tumourogenisis, inducing apoptotic pathways for cellular death (Tobias and Hochhauser 2010). These cytochalasins are an abundant source of potential anti-cancer therapeutics with new compounds continually being identified, including cytochalasin H, J and epoxycytochalsins, all reportedly isolated from Tripterygium wilfordii (Tenguria et al. 2011). The diversity and abundance of alkaloids has continually provided novel mechanisms for the treatment of a range of different cancers, with another clinically

30 important drug, camptothecin, stemming from endophytic origin. This cytotoxic heterocyclic aromatic alkaloid, derived from the inner bark of Camptotheca acuminata (Tenguria et al. 2011), act as a DNA topoisomerase poison. Similarily to Taxol, the unmodified camptothecin suffered formulation issues within the clinic however chemical modifications to the structure, forming modified drug Exatecan, increased drug solubility, facilitating progression to clinical trials (Tenguria et al. 2011). The endophyte Stemphylium botryosum from Chenopodium album produced curvularin and dehydrocurvularin as well as altersolanol A which are a cytotoxic. All compounds were further tested for protein kinase inhibitory activity. Compound 3 (altersolanol A) was the most potent inhibitor (Aly et al. 2010). Reports showed alkaloids isolated from endophytic fungi to be novel anticancer agents. Three novel cytochalasins (Fig. 1.20), produced from an endophyte Rhinocladiella sp. living in a medicinal plant, Tripterygium wilfordii which is in traditional medicine used as a treatment for arthritis and other autoimmune, exhibited antitumor activity (Wagenaar et al. 2000).

Figure 1.20: Cytochalasins

31

An aryltetralin lignan, podophyllotoxin (Fig. 1.21), produced by the fungal endophyte Phialocephala fortinii from rhizomes of the plant Podophyllum peltatum, showed potent antioxidant, anticancer and radioprotective activities (Puri et al. 2006).

OH

O O O

O

H3CO OCH3

OCH 3

Figure 1.21: Podophyllotoxin

Camptothecin (Fig. 1.22) and its derivatives exhibited strong antineoplastic activity and are used in China for the treatment of skin diseases. An endophytic fungus, which belongs to the family Phycomycetes and exists in host plant Nothapodytes foetida, has been shown to produce camptothecin. The biological activity of this compound was tested in cytotoxicity assays using human cell cancer cell lines and high activities were observed (Puri et al. 2005).

N O N

O H3C HO O

Figure 1.22: Camptothecin

1.7.4 Antiviral compounds from endophytes

Another appealing use of endophytic products is the inhibition of viruses (Kaul et al. 2012). Two novel tridepside human cytomegalovirus (hCMV) protease inhibitors,

32 cytonic acids A and B, isolated from the endophyte Cytonaema sp. (which inhabits the internal tissues of Querus sp.) showed antiviral activity (Guo et al. 2000a). Further studies of the microbiota characteristic of oak trees resulted in the isolation of a potentially valuable endophytic fungal compound from the leaves of Quercus coccifera, hinnuliquinone (Fig. 1.23), which was shown to be a potent inhibitor of HIV-1 protease (Singh et al. 2004).

NH O HO

OH

HN O

Figure 1.23: Hinnuliquinone.

1.7.5 Products from endophytes as antioxidants

Reactive oxygen species such as free radicals play an important role in the pathogenesis of many diseases, including cancer and several neurodegenerative diseases such as Alzheimer’s Disease and Parkinson’s Disease (Bertrman 2000, Rottkamp et al. 2000), so there is much research to find new antioxidant compounds as natural antioxidants are preferred to synthetic ones (Abdalla and Roozen 1999, Sadrati et al. 2013). Two isobenzofuranone compounds, pestacin and isopestacin (Fig. 1.24), with structural similarity to the flavonoids (an established group of free-radical-scavengers), exceed the antioxidant capacity of trolox (a vitamin E derivative) by at least one order of magnitude, as measured by the total oxyradical scavenging capacity (TOSC) assay. These new potent antioxidants were isolated from culture fluids of the endophyte Pestalotiopsis microspora from the combretaceaous plant, Terminalia morobensis, inhabiting the Sepik River drainage of Papua New Guinea (Strobel et al. 2002, Strobel 2002, Harper et al. 2003).

33

HO OH O OH H O H C 3 OH O HO HO H3C

A B

Figure 1.24: Pestacin A and Isopestacin B.

1.7.6 Antidiabetic and neuroregenerate agents from endophytes

A nonpeptide metabolite was isolated from an endophytic fungus, Pseudomassaria sp. (collected from an African rainforest near to Kinshasa in the Democratic Republic of the Congo), and was shown to be a “biofactory” of an insulin mimetic which, unlike insulin, was not destroyed in the digestive tract. This endophytic compound, L-783,281 (Fig. 1.25), prompted quite a revolutionary notion in the therapy of diabetes, namely an orally administered activator of the human insulin receptor (Zhang et al. 1999). Moreover, this intriguing endophytic compound was reportedly able to stimulate the Trk family of tyrosine kinase receptors, culminating in neuroregenerative effects, including neuronal survival and neurite outgrowth by the activation of multiple signalling cascades (Wilkie et al. 2001). Although the cytotoxicity of the compound seems to prohibit its direct therapeutic application, it is a prototype for small molecule insulin and neurotrophin mimetics and may help in the development of pharmaceutically significant compounds for the treatment of diabetes and neurodegenerative disorders (Mishra et al. 2013).

O NH

HO

OH

HN O

Figure 1.25: L-783,281.

34

1.7.7 Immunosuppressive compounds from endophytes

Immunosuppressive drugs are used today to prevent allograft rejection in transplant patients and in the future they could be used to treat autoimmune diseases such as rheumatoid arthritis and insulin-dependent diabetes (Stobel and Daisy 2003, Tenguria et al. 2011). Subglutinol A (Fig. 1.26) and B were isolated from the endophytic fungus Fusarium subglutinans, found in Tripterygium wilfordii, and showed substantial immunosuppressive activity while causing none of the detrimental cytotoxic effects characteristic of cyclosporine A, which was isolated from Tolypocladium inflatum (Borel and Kis 1991, Lee et al. 1995). Novel endophytic compounds with biological activity as well as novel structures without specific biological activities are listed in Table 1.2 (Zaferanloo et al. 2012).

H CH3

H CH3 H O

CH3 H

CH3 H O OH

O CH3

CH3

Figure 1.26: Subglutinol A.

35

Table 1.2 New Natural Products from Endophytic Fungi Biological Fungus Plant Host Natural Product Ref. Activity (Country)

Antialgal Ascochyta sp. Meliotus (4S)-(+)-ascochin Krohn et al. dentatus 2007 (Germany)

Blennoria sp. Carpobrotus blennolides A and B Zhang et al. edulis (Spain) blennolides C-G 2008

Microsphaeropsis Larix decidua palmarumycin M1 Dai et al. sp. (Denmark) microsphaerospsin A 2007

Antialgacidal Phoma species Salsola Epoxydines A and B Qin et al. (Strain no. 8889) oppostifolia 2010

Antibacterial Pullularia sp. Culophyllum pullularin A Isaka et al. sp. 2007 Streptomyces sp. Datura Hyoscyamine and Nimal et al. stramonium L. scopolamine 2012

Chalara sp. Artemisia isofusidienol A-D Losgen et vulgaris al. 2008 (Germany)

Phoma species Salsola Epoxydines A and B Qin et al. oppostifolia 2010

Sordariomycete sp. Eucommia Chlorogenic acids Chen et al. ulmoides 2010 Oliver (China)

Xylaria sp. Torreya jackii xylarenones A and B , Hu et al. (China) xylarenic acid 2008

Fusarium sp. PSU- Thalassia Not identified Supaphon ES73 hemprichii et al. 2013

36

Table 1.2 New Natural Products from Endophytic Fungi Biological Fungus Plant Host Natural Product Ref. Activity (Country) Antibiotic Ampelomyces sp. Urospermum 3-O-Methylalaternin, Aly et al. 2008 picroides altersolanol A Verticillium sp. Rehmannia Massariphenone, You et al. glutinosa ergosterol peroxide 2009 Anticancer Alternaria sp. Sonneratia alba Polyketides, Proksch et al. alternariol 2010 Sordariomycete Eucommia Chlorogenic acids Chen et al. sp. ulmoides Oliver 2010 (China) Colletotrichum Justicia Taxol Gangadevi and gloeosporioïdes gendarussa Muthumary 2008 Antifungal Blennoria sp. Carpobrotus blennolides A and B Zhang et al. edulis (Spain) blennolides C-G 2008 Colletotrichum Pteromischum colutellin A Ren et al. 2008 dematium sp. (Costa Rica) Cylindrocarpon Trewia nudiflora Brefeldin A and its Yu et al. 2010a obtusisporum analogues Pestalotiopsis Not identified pestalachlorides A and Li et al. 2008a adusta (China) B Pestalotiopsis Not identified pestafolide A , Ding et al. foedans (China) pestaphthalides A and 2008 B Phomopsis sp. Azadirachta 8α- Wu et al. 2008 indica (China) acetoxymultiplolide A

Phoma species Salsola epoxydines A and B Qin et al. 2010 (Strain no. 8889) oppostifolia

Sordariomycete Eucommia chlorogenic acids Chen et al. sp. ulmoides 2010

37

Table 1.2 New Natural Products from Endophytic Fungi Biological Fungus Plant Host Natural Product Ref. Activity (Country)

Antifungal Phomopsis sp. Azadirachta 8α-acetoxymultiplolide A Wu et al. indica (China) 2008

Phoma species Salsola epoxydines A and B Qin et al. (Strain no. 8889) oppostifolia 2010

Sordariomycete Eucommia chlorogenic acids Chen et al. sp. ulmoides Oliver 2010 (China)

Antimalarial Pullularia sp. Culophyllum sp. pullularin A Isaka et al. 2007

Exserohilum Stemona sp. 11-hydroxymonocerin Sappapan et rostratum (Thailand) al. 2008

Xylaria sp. Sandoricum 2-chloro-5-methoxy-3- Tansuwan et koetjape methylcyclohexa-2,5- al. 2008 (Thailand) diene-1,4-dione (42), xylariaquinone

Antioxidant Aspergillus niger Colpomenia nigerasperone A and B Zhang et al. sinuosa (brown nigerasperone C 2007 alga) (China)

Chaetomium sp. Nerium oleander phenolic compounds Huang et al. (China) 2007b

Streptomyces Datura phenolic contents Nimal et al. sp. Loyola UGC stramonium L. 2013

38

Table 1.2 New Natural Products from Endophytic Fungi Biological Fungus Plant Host Natural Product Ref. Activity (Country)

Antiviral Paraconiothyrium Acer truncatum brasilamides A-D Liu et al. brasiliense (China) 2010a

Pestalotiopsis fici Not identified chloropupukeananin Liu et al. (China) 2008 Pullularia sp. pullularin A Culophyllum sp. Isaka et (Thailand) al. 2007

Pestalotiopsis theae Not identified pestalotheol C Li et al. (China) 2008b

Cytotoxic Eupenicillium sp. Glochidian trichodermamide C Davis et ferdinandi al. 2008 (Australia)

Fusarium sp. Not identified fusaristatins A and B Shiono et al. 2007

Guignardia sp. Kandelia kandel methoxyvermistatin Xia et al. (China) 2007

Hypoxylon Artemisia annua daldinone C and D Gu et al. truncatum (China) 2007

Phomopsis sp. Not identified phomopsin A Tao et al. (China) 2008

Phomopsis sp. Not identified phomopsin A Tao et al. (China) 2008

Penicillium sp. Aegiceras penicillenols A1 and Lin et al. corniculatum B1 2008 (China)

39

Table 1.2 New Natural Products from Endophytic Fungi Biological Activity Fungus Plant Host Natural Product Ref. (Country)

Cytotoxic Phomopsis sp. Not identified phomopsin A Tao et al. (China) 2008

Penicillium sp. Aegiceras penicillenols A1 Lin et al. corniculatum and B1 2008 (China)

Stemphylium Mentha pulegium alterporriol G & H Debbab et globuliferum (Morocca) al. 2009

Xylaria sp. Torreya jackii xylarenones A Hu et al. (China) and B, xylarenic 2008 acid

Not identified Kandelia kandel 1962A Huang et (China) al. 2007c

Penicillium sp. Quercus variabilis penicidones A-C Ge et al. 2008

Immunosuppressive Colletotrichum Pteromischum sp. colutellin A Ren et al. dematium (Costa Rica) 2008

1.7.8 Applications of fungal endophytes enzymes in biotechnology

As fungi are heterotrophic and are not able to create their own food as plants do, producing enzymes is necessary to their survival. Secretion of enzymes enables the breakdown of complex substances in the environment to simple molecoules that can be used by the cell to obtain nutritional needs. Fungi are able to produce broad ranges of enzymes in response to the available substrates and different fungal strains produce different enzymes which are suited to the environmental conditions (Webster and Weber 2007). Enzymes are biological catalysts which are very essential in an industrial 40 setting. Many industrial products such as detergents, washing liquids and foods have enzymes incorporated into their formulations. Microbes are the preferred source of enzymes in industrial applications because of their rapid growth and low production cost, compared to enzymes from plants and animals and fungi exhibit a wider variety of enzymes than bacteria (Laxman et al. 2005). Furthermore, fungi are normally GRAS (generally regarded as safe) strains and they produce extracellular enzymes, which are easier to be recovered from fermentation broths (Wu et al. 2006). Many industries such as dairy, leather, beer, wine, food and paper industries need enzymes in their end-product and manufacturing steps. The majority of enzymes are used in industry are hydrolyses and are listed in Table 1.3.

Table 1.3 Some of the industrial uses of fungal enzymes (modified from Rao et al. 1998; Kashyap et al. 2001; Kirk et al. 2002; Prema 2006; Rodríguez Couto and Toca Herrera 2006; Satynanarayana et al. 2006; Aguilar et al. 2007; Dhawan and Kaur 2007, Pogori et al. 2007). Enzyme Industry Application Fungal sources Amylase Baking Bread softness and volume Aspergillus niger Beverage Starch removal from pectin Humicola grisea Detergent Starch stain removal Starch-coating, Mucor rouxianus Pulp and deinking Penicillium oxalicum paper Thermomyces Textile lanuginosus Catalase Dairy Sterilisation, cheese Aspergillus niger Textile Bleach termination Penicillium β- Beverage Debittering of citrus juices Aspergillus niger glucosidase Biofuels Cellulose/ cellobiose hydrolysis Trichoderma atroviride Confectionary Natural food colours and flavours Talaromyces emersonii Cellulase Biofuels Cellulose hydrolysis Aspergillus niger Detergent Cleaning, colour clarification Humicola insolens Pulp and De-inking, fibre modification Penicillium Paper Denim finishing, softening funiculosum Textile Trichoderma reesei

41

Table 1.3 Some of the industrial uses of fungal enzymes (modified from Rao et al. 1998; Kashyap et al. 2001; Kirk et al. 2002; Prema 2006; Rodríguez Couto and Toca Herrera 2006; Satynanarayana et al. 2006; Aguilar et al. 2007; Dhawan and Kaur 2007, Pogori et al. 2007). Enzyme Industry Application Fungal sources Laccase Beverage Juice clarification Coriolus versicolor Pulp and paper Enzymatic bleaching Phlebia radiate Textile Denim bleaching Trametes Waste Degradation of xenobiotics Pleurotus ostreatus Lipase Baking Dough stability, conditioning Aspergillus Dairy Cheese flavour Geotrichum Detergent Lipid stain removal Mucor Fats and Oils Transesterification Penicillium Leather Depickling Rhizopus Pulp and paper Pitch and contaminant control Mannanase Animal feed Nutritional improvement Aspergillus Beverage Hydrolysis of coffee extract Agaricus Detergent Mannan gum stain removal Trichoderma Pulp and paper Enzymatic bleaching Sclerotium Protease Baking Biscuits, cookies Aspergillus Dairy Milk clotting, infant formulas Mucor Detergents Protein stain removal Penicillium Leather Unhairing, bating Rhizopus Pulp and paper Biofilm removal Tritirachium Tannase Animal feed Nutritional improvement Aspergillus niger Beverage Instant tea Fusarium. solani Chemical Fruit juice clarification, debittering Penicillium chrysogenum Waste Production of gallic acid Rhizopus oryzae Tannery effluent treatment Trichoderma viride Xylanase Animal feed Improvement of digestibility Aspergillus niger Beverage Fruit juice clarification Fusarium oxysporum Pulp and paper Enzymatic bleaching Schizophyllum commune Talaromyces emersonii Trichoderma reesei

42

Endophytes produce many enzymes to metabolise nutrients from the environment in order to grow and colonize host plant tissues and to survive in the plant- endophyte relationship. They are viewed as a good source of enzymes to address the numerous uses and rising demands of industry. Microbial endophytes naturally produce a number of hydrolytic enzymes in order to degrade the cell wall (Firakova et al. 2007, Bischoff et al. 2009) such as the endophytic fungus Acremonium typhinum of the grass Poa ampla produces a novel endoprotease during symbiotic infection (Lindstrom et al. 1993). Thus, these microorganisms have also been investigated for their enzymatic properties, in particular those that may have useful industrial applications (Borges et al. 2009, Souza and Magalhaes 2010). Table 1.4 lists the enzyme activities described in endophytes thus far.

Table 1.4 Enzymes Produced by Endophytic Fungi Enzyme Endophyte Plant Reference

Amylase Cladosporium Adhatoda vasica Amirita et al. 2012 cladosporioides Melanconium Alnus viridis Guo et al. 2008b apiocarpum

Acetylesteras Colletotrichum sp Abelmoschus esculentus Grünig et al. 2008 β-galactosidase Colletotrichum sp Abelmoschus esculentus Grünig et al. 2008 β-1,6-glucanase Epichloe festucae Poa ampla Wang et al. 2006 Neotyphodium lolii Poa ampla Cellulase Pestalotiopsis sp. Manglietia garrettii Moy et al. 2002 Phoma sp. Garcinia cowa Xylaria sp. Trichilla connaroides Colletotrichum sp. Cinnamomum iners Camellia sinensis

Mycelia sterilia Trichilla connaroides Melanconium Alnus viridis Guo et al. 2008b apapiocarpum Penicillium sp. - Syed et al. 2013

43

Table 1.4 Enzymes Produced by Endophytic Fungi Enzyme Endophyte Plant Reference

Chitinase Neotyphodium sp Poa ampla Saranpuetti et al. 2006 Laccases Melanconium apiocarpum Alnus viridis Guo et al. 2008b Monotospora sp Cynodon dactylon Weihua and Hongzhang 2008 Mycelia sterilia YY-5 Rhus chinensis Mill. Lumyong et al. 2002 Curvularia brachyspora Adhatoda vasica Amirita et al. 2012 Lipase Cercospora kikuchii Tithonia diversifolia Nogueira et al. 2008 Mannanase Colletotrichum sp. Cinnamomum iners Moy et al. 2002 Camellia sinensis Mycelia sterilia YY-5 Trichilla connaroides Leptosphaeria sp. Magnolia liliifera Promputtha et al. 2010 Pestalotiopsis sp. Manglietia garrettii Moy et al. 2002 Phoma sp. Garcinia cowa Xylaria sp. Trichilla connaroides

Proteinase Colletotrichum sp. Cinnamomum iners Moy et al. 2002 Camellia sinensis Phoma sp. Garcinia cowa Xylaria sp. Trichilla connaroides Aspergillus sp. Alpinia calcarata Sunitha et al. 2013 Roscoe Xylanase Colletotrichum sp. Cinnamomum iners Moy et al. 2002 Camellia sinensis Phomopsis sp. Garcinia cowa Trichilla connaroides Cinnamomum iners Mycelia sterilia YY-5 Trichilla connaroides Xylaria sp. Trichilla connaroides Aspergillus niger spoiled books in Brazil Robl et al. 2013

44

1.7.8.1 Prospecting for new enzymes

The ever growing demand for new and more productive sources of industrial enzymes is ongoing. Industrial enzymes are commonly sourced from microorganisms have been used by humans since ancient times for the production of cheese, bread, beer and alcohol. Improvements of large-scale fermentation processes have facilitate the production and purification of enzymes at an industrial level. Through hundreds of millions of years of natural selection, fungi in a range of different environments have evolved enzymes to suit their surroundings, from hot, humid compost piles of rotting plant material in the tropics (Maheshwaki et al. 2000) to the cold stark Antarctic soil (Ruisi et al. 2007). Therefore, fungi display a great metabolic flexibility which enables their natural survival in their ecological niche could be considered as attractive organisms for production of particular enzymes of interest that could be valuable to industry. Indeed, it is estimated that fungal endophytes may actually be metabolically more active than fungi from other sources. Though the quest to find novel products from endophytes may have begun to identify their use in medicine, their potential is not limited to the medicinal field. The industrial use of endophytes for enzyme production and the role of their secondary metabolites in plant defence systems have been researched (Schulz et al. 2002, Suryanarayanan et al. 2009). Microbial enzymes are an attractive alternative to chemical catalysts due to their ability to function over a broad range of temperature and pH conditions, making them useful in different applications, with low environmental impact and high substrate specificity. Microbial enzymes presently account for approximately 90% of all enzymes used in industry. In addition, at least 75% of all industrial enzymes have hydrolytic activity, being used for the degradation of different natural substances (Godfrey and west 1996, Souza and Magalhaes 2010). Worldwide industrial enzymes sales (Fig. 1.27) amount to over $US 2 billion per year (McAuliffe et al. 2007, Morgan et al. 2009).

45

Figure 1.27: Worldwide industrial enzyme usage (McAuliffe et al. 2007)

Industrial enzymes often need to perform at temperatures higher or lower than ambient, depending on the requirements of the particular process in which they are involved (Peterson et al. 2009a), so there is a demand for microbial enzymes which work in a board range of temperature and pH conditions. For example, the manufacture of detergents for washing in cold water utilizes enzymes that are active at a low temperature and high pH; enzymes for pulp and paper and textiles requires enzymes that are active at a high temperature and high pH; dairy and other food production processes often require enzymes to function at a low temperature and low pH (Lange 2004). Optimum temperature and pH used in different industrial applications are summarised in Fig. 1.28.

Figure 1.28: New technologies and applications often require enzymes that can perform at non- ambient conditions (Lange 2004)

46

Among the vast industrial applications, detergents have the greatest proportion with 34% with the second being dairy-related uses (Fig. 1.29). The search for new enzymes with natural characteristics that suit industrial processes is an ongoing area of research, motivated by the desire to increase productivity and supply for emerging technologies. Universities and small companies with leads based on environmental screening projects could support large biotechnology companies to discover new productive sources of enzymes useful in high-demand industrial applications, such as detergent and dairy (Laird et al. 2006). Moreover, fungi do not naturally produce enzymes at sufficiently high levels for commercial purposes. Therefore, strain improvement programs are undertaken.

Figure 1.29: Applications of microbial enzymes (Morgan et al. 2009)

Accordingly, environmental screening programs are used to seek enzymes from various environments to increase the secretion of target enzymes to levels that are economically maintainable and express these enzymes in highly secreting production hosts (Teter and Cherry 2005). Some examples of fungal screening projects and the enzymes discovered are listed in Table 1.5.

47

Table 1.5 Enzyme screening projects for fungi from environmental sources (2000 to 2010). Screening site Enzyme Fungal species found Reference with high enzyme activity Agricultural and Xylanase Aspergillus, Fusarium, Penicillium Abdel-Sater and El- industrial waste and Trichoderma sp. Said 2001 Rotting wood Pectinase Gloeophyllum striatum Xavier-Santos et al. Pycnoporus sanguineus 2004 Schizophyllum commune Forest Ligninases Trametes trogii, Stereum annosum Dhouib et al. 2005 (Tunisia) Phlebia sp., Polyporus sp. Oxyporus latemarginatus

Mixed forests Ligninases Ganoderma applanatum Matos et al. 2007 (Portugal) Trametes versicolor Bjerkandera adusta

Tannery effluent Tannase Aspergillus niger, A. flavus Murugan et al. Trichoderma sp., Penicillium sp., 2007 Fusarium sp.

Marine corals and Protease Beauveria brongniartii Kamat et al. 2008 sponges Acremonium fusidioides

Wooden hut Cellulase Cladosporium oxysporum Duncan et al. 2008 (Antarctica) Geomyces sp.

Fruit and wood Lipase Botryosphaeria sp. Messias et al. 2009 (Brazil)

Root knot nematodes Chitinase Paecilomyces lilacinus Wei et al. 2009 Protease Pochonia chlamydosporia

Lake water and Amylase Aspergillus flavus Sasi et al. 2010 sediments (India)

48

1.7.9 Biological control agents from endophytes

Bioactive compounds produced by endophytes are seen as attractive and environmentally-friendly alternatives to toxic organic insecticides and poisonous gases currently used in biological control (Guo et al. 2008a). Endophytes have been widely reported to produce antibiotics which can be used instead as alternatives to toxic organic compounds. Moreover, endophytes have also been shown to have other bioactivities that may be useful in biological control and environmental applications. A novel application of endophytic microbes has been explored in the field of phytoremediation to metabolise compounds associated with chemical waste. Certain endophytes act as phytoremediators by degrading compounds which are environmental hazards (Lodewychx et al. 2001, Firáková et al. 2007). A endophytic bacterium, Methylobacterium populum, was shown to degrade 2,4,6-trinitrotoluene (TNT), hexahydro-1,3,5-trinitro-1,3,5-triazine (HMX) and hexahydro-1,3,5-trinitro-1,3,5- trizaine (RDX) (Siciliano et al. 2001, Van Aken et al. 2004). An engineered endophyte, VM1330, had been shown to increase plant tolerance to toluene and to decrease the transpiration of toluene to the atmosphere (Newman and Reynolds 2005). A novel endophyte Ceratobasidum stevensii from host plant Bischofia polycarpa which was able to degrade phenanthrene is another promising use of endophytes in bioremediation (Dai et al. 2010). In addition, endophytic compounds have been shown to be useful as bioinsecticides. Some endophytic Neotyphodium produced four groups of alkaloids. Of these, the ergot alkaloids and tremorgenic lolitrems, such as Peramine (Fig. 1.30), cause neurotoxic effect on grazing or granivorous vertebrates (Bacon et al. 1986). Other anti- insect endophytic compounds of this group protect perennial ryegrass from Listronotus bonariensis, which is a highly destructive insect pest in New Zealand (Tanaka et al. 2005) while lolines are potent insecticidal and anti-aphid agents which do not show any mammalian toxicoses (Wilkinson et al. 2000).

O

NH2 N N H3C

HN HN Figure 1.30: Peramine 49

Thus, these endophytic alkaloids are the most promising candidates with application in the agricultural arena. Nodulisporic acids (novel indole diterpenes) were isolated for the first time from endophytic Nodulisporium sp. living in the plant Bontia daphnides and these exhibited potent insecticidal activities against the larvae of the blowfly (Demain 2000). Benzofuran is another insect toxin found in an unidentified endophytic fungus from Gaultheria procumbens which shows toxicity to the larvae of spruce budworm (Findlay et al. 1997). Naphthalene has been isolated from the endophytic Muscodor vitigenus, which inhabits Paullina paullinioides, and showed promising results as an insect deterrent (Daisy et al. 2002a,b). The basidiomycete fungus Crinipellis perniciosa is a disease of cacao and has proven difficult to control. In order to evaluate the potential of endophytes as biological control agents of this phytopathogen, the endophytic fungal community of cacao was studied and found to contain a group of endophytes which were able to control C. perniciosa (Rubini et al. 2005).

1.7.10 Enzyme inhibitors from endophytes as sources of useful drugs

The use of enzymes as drugs has some advantages based on features that separate enzymes from all other types of drugs. First, they tend to bind and act on their targets with great affinity and specificity. Second, their catalytic property enables the conversion of multiple target molecules to the desired products (Vellard 2003). Poly endopeptidases (PEPs) are proline-specific proteases which are actively involved in neurological disorders such as Alzheimer’s disease, amnesia, depression and schizophrenia. Thus, inhibitors of PEP could play an important role in the treatment of these diseases. An endophytic fungus, F0274 (classified as a Fusarium sp.), with potential PEP inhibitory activity was isolated from yam flower in the Padawan area, Kuching, Sarawak (Ng et al. 2010). Asparaginase produced by the endophyte Colletotrichum sp., from medicinal plants in Thailand, showed cancer-inhibitory and cytoxicity properties which were devoid of glutaminase activity (Theantana et al. 2009). Twenty percent of the world’s population suffer from cardiovascular diseases and stress-related condtions like hypertension or high blood pressure are known to be high risk factors for this disease (Yeolekar and Shete 2002). Antihypertensive or angiotensin I-converting enzyme (ACE) inhibition is considered an effective treatment 50 for hypertension (Ghiadoni et al. 2003). Synthetic ACE inhibitors, including captopril, cause some side effects, such as coughing, allergic reactions, taste disturbances and skin rashes. Thus, research to find safer and innovative ACE inhibitors is important to control hypertension. Since cardiovascular disease is a major concern for public health, the synthesis of new antihypertensive compounds derived from endophytes could be effective alternative drugs for treatment. In this context, Pestalotiopsis microspora isolated from some medicinal Indian plants has been shown to exhibit ACE inhibitory activity (Tejesvi et al. 2008). While the compounds described below were not isolated from endophytes, these microorganisms are also known to exist as endophytes. Therefore, it is possible that further research may reveal true endophytes that produce similar enzymes. Clavulanic acid, a potent β-lactamase inhibiotor with low antibiotic activity, was isolated from Streptomyces clavuligerus, and is used with various β-lactam antibiotics, such as penicillins and cephalosporins, in combination therapy against penicillin- resistant bacterial infections (Brown 1986, Sousa et al. 2009). Desferal with a high level of metal-binding activity produced by Streptomyces proved to be a solution for iron- overload diseases (hemochromatosis) and aluminium overload in kidney dialysis patients (Winkelmann 1986, Marinelli 2009). Acarbose produced by Actinoplanes sp. is a pseudotetrasaccharide used as an inhibitor of intestinal α-glucosidase in type I and type II diabetes and hyperlipoproteinemia (Truscheit et al. 1981, Marinelli 2009). Lipstatin, which is produced by Streptomyces toxytricini, is used as a treatment for obesity and diabetes by interfering with gastrointestinal absorption of fat (Weibel et al. 1987, Singh and Pelaez 2008).

1.7.11 Other exciting applications of endophytes

Apart from their use in medical, agricultural and industrial settings, other promising uses of endophytes and their metabolites have been suggested. The volatile hydrocarbons which are major constituents of diesel fuel were found to be produced by some endophytes and thus generated interest in the application of endophytes as a source of biofuels. Thus, the production of ‘Mycodiesel’ by endophytes is an exciting potential application (Stadler and Schulz 2009). An endophytic fungus, Gliocladium roseum (NRRL 50072), was isolated from Eucryphia cordifolia (ulmo) and produced a 51 series of volatile hydrocarbons and mycodiesel hydrocarbon derivatives (Strobel et al. 2008). There is a philosophy in Traditinal Chinese Medicine (TCM) of “using poison against poison”. The mycotoxins (toxins produced by moulds) are often fatal for human and animals (ergotism). Ergot alkaloids, which are produced by non-endophyte Claviceps species (Demain and Zhang 2005), have been biosynthetised by an endophyte of perennial ryegrass (Wang et al. 2004). It is amazing that these poisonous ergot alkaloids can now used for angina pectoris, hypertonia, migraine headache, cerebral circulatory disorder, uterine contraction, hypertension, serotonin-related disturbances, inhibition of prolactin release in agaloactorrhea, reduction in bleeding after childbirth, and for prevention of implantation in early pregnancy (Bentley 1997). Recently, endophytes have been recognized as useful for studying biomimetic systems. The capacity for endophytes to produce the same componds as humans and other mammals (in addition to unique endophytic metabolites) shows that endophytes can be potentially useful in biotransformation applications. Thus, large quantities of the major and minor metabolites can be produced with lower cost, greater efficiency and in less time than those produced by experimental animals, mammalian enzyme systems, or in cell culture (Pupo et al. 2008, Pimentel et al. 2010).

1.8 Aims of this study

Endophytes produce a broad range of valuable secondary metabolites. Some of these metabolites have novel biological activities. Thus, endophytes are demonstrated to be a rich and reliable source of biologically active compounds with potential benefits in medicinal, industrial and agricultural applications. Often, bioactive natural products that are thought to be produced by plants are actually generated by endophytes which have colonized the plant. In these cases, the cultivation of the endophytes is preferred over cultivation of the plants, as the former exhibit lower generation times and, thus, higher growth rates. On the other hand, the development of techniques such as combinatorial chemistry and equipment such as peptide synthesizers gives rise to exciting opportunities and expectations for the synthesis of biological active compounds (Strobel et al. 2004). However, the desired breakthroughs from unfocused combinatorial chemistry and the production of novel medical drugs has not yet been achieved (Li and 52

Vederas 2009) and while screening libraries of synthetic chemicals for bioactivity has brought some success, the general consensus is that outcomes have been generally disappointing. Currently, only a handful of plant species colonised by endophytes have been studied. This means that only a small fraction of endophytes has been explored for production of bioactive compounds. Additionally, as most endophyte research has been conducted on cultivated species, the diversity of studied endophytes has been further restricted by limitations in the ability to cultivate endophytes in the laboratory. This means that a vast, largly untapped, resource for bioactive compounds exists among endophytes, which will be exploited as more and more plant species are studied, and new cultivation techniques are developed. Therefore, a broad aim of this work is to further understand a little-explored new endophytic fungi community and search for bioactive compounds. Specifically, the work will seek new enzymes that could be of interest for development for industrial applications. In order to achieve these goals, the specific aims of each part of the work are as follows:

1- Isolation and Identification of fungal endophytes from the Australian native plants, Eremophilia longifolia and Eremophila maculate, by morphological and molecular analysis (Chapter 2). 2- Screening of antibacterial and selected enzyme acitivies by agar plate assays in order to determine the antibacterial properties and the types of enzymes secreted by the fungi and to identify isolates that secrete enzymes of potential interest for industrial applications. Investigation of anticancer acitivites of this collection of endophytic fungi in collaboration with Newcastle University (UK) (Chapter 3). 3- Optimization of selected endophytic fungi with the greatest enzyme activities with respect to temperature, pH and different sources of carbon and nitrogen. Statistical analysis was used to determine the significant factors affecting between optimal enzyme production of the selected endophytic fungi and comparisons to standard fungi (Chapter 4). 4- Detailed characterisation of the enzymes secreted by a selected fungal isolate from Eremophilia longifolia using liquid cultures, protein purification, scale-up bioreactor studies, enzyme assays and zymogramy. These studies aimed to reveal enzymes with temperature or pH profiles that may have potential for

53 utilisation under specific industrial conditions. Identification of selected enzymes and proteins in the secretome of the fungal isolate was undertaken using 1D and 2D gel electrophoresis, zymography and mass spectrometry to achieve a greater understanding of the collection of enzymes secreted by endophytic fungi (Chapter 5).

54

Chapter 2

Isolation and Identification of fungal endophytes from Australian native plants

2.1 Introduction: Endophytes

Endophytes are becoming increasingly recognised as sources of novel secondary metabolites with potential application in medicine, agriculture and industry. However, their vast numbers alone makes screening all of them impossible. Equally, there is limited information about endophytes from Australian native plants or the bioactive metabolites produced by these microorganisms. For these reasons, a focused approach for host plant selection is preferred and the enthanomedicial approach is a suitable starting point.

2.1.1 Endophytes from Australian native plants

Indigenous Australians have accumulated knowledge about the potentially medicinal properties of Australian native plants for centuries. Although much of this knowledge was lost during European colonisation, an increasing number of studies are proving that many of the plants used by the Aboriginal people do, in fact, produce potentially useful bioactive compounds (Pennachio et al. 2004). The potential association of endophytes which show the medicinal effects of the host plant is an interesting field of study. Plants that have been exploited by humans as traditional medicines are useful targets for research, such as the traditional Chinese medicinal plants (Yu et al. 2010c). Similar successful research has been done and a novel wide

55 spectrum antibiotic designated Munumbicin has been discovered from the endophytes of Kennedia nigriscans which is used as a medicinal plant by the Australian aborigines (Castillo et al. 2002). Plants belonging to the genus Eremophila grow throughout Australia and, as such, are well known to indigenous Australians. Furthermore, there is evidence that this plant species was medically and culturally important, with particular Eremophila species serving specific roles for the Aboriginal people (Richmond and Ghisalberti 1994). E. longifolia (snakevine) has been used in the form of a medicinal paste to treat cold and bruises by Australian aboriginal communities (Clarke 1988). E. longifolia is widely distributed across Australia as it is a desert-loving shrub and is also called Native Plum Tree or Weeping Emu Bush (Cribb and Cribb 1981). E. maculata was classified as a poison by early European settlers; however, some Aborigines used this plant for treating colds and headaches. Pennacchio et al. (2004) demonstrated that E. maculata possesses antibacterial properties against Staphylococcus aureus, Streptococcus pyogenes and Bacillus cereus. However, notably, this study did not investigate specific active ingredients of the plant. Additionally, E. maculata is endemic to Australia and is well adapted for the harsh, dry climate of the Australian desert. Conversely, the plant may also survive in mild frost conditions (ANPSA 2011). Together with this unusual adapted physiology and its strong ethnobotanical use by native Australians, E. longifolia and E. maculata will be prime candidates for isolating and examining endophytic fungi in this study (Fig 2.1).

56

Figure 2.1: E. longifolia, matched to dry climates, has also been successfully cultured in warm, temperate areas. It should be grown in an open, sunny position with good drainage. The species is accepting of at least moderate cold and, once established, tolerates extended dry periods. E. maculata is widely cultivated in many areas and, although best suited to dry climates, can be successfully grown in more humid areas. The species prefers soils which are alkaline to mildly acidic and well drained. Full sun is preferred and, once established, the plant tolerates extended dry periods. It is also tolerant of at least moderate cold. (Adapted from anpsa.org.au)

2.1.2 Types of endophytes based on ecological functions

There are several classes of fungal endophytes based upon phylogenetic history, taxonomy, plant hosts and ecological functions (Rodriguez et al. 2008). The clavicipitaceous (C-endophytes) and nonclaviciptaceous (NC-endophytes) belong to Class 1 and Class 2, respectively, which are harboured by nonvascular plants. Class 1 has received more attention since this class encompasses some grasses that are of agricultural interest. These endophytes are generally vertically transmitted via seed infections, and notably the host plant will possess one dominant endophytic fungus (Rodriguez et al. 2009, Higgins et al. 2011). The Class 2 endophytes have been much less studied and their ecological roles are poorly understood. Nevertheless, some commonalities between endophytes of this group include: ability to grow in tissues located below and above the ground, low diversity within host plant, passed on via vertical transmission and often found in plants occupying a high-stress environment

57

(Rodriguez et al. 2009). Class 3 endophytes are located in tissues of the plant above the ground only and appear as localised infections within the tissue. However, these endophytes have exhibited benefits or costs on the host plant that are environment- specific. Furthermore, a high number of endophyte populations seem to be capable of sharing the same host, which the plant passes on via horizontal transfer (Higgins et al. 2011). Finally, Class 4 endophytic fungi include those endophytes restricted to the roots. These are the least studied group of fungal endophytes and their role within the host plant is still unknown. However, they do occupy hosts that inhabit diverse environments, so it is reasonable to assume that their biological and ecological roles are important to their host (Rodriguez et al. 2009).

2.1.3 Isolation and identification of endophytic fungi

The isolation of fungi from an environmental source can be processed in different ways, which can be chosen by the environment concerned and the aim of the study. Fungi can be isolated from different parts of plant as endophytes (Section 1.4) or collected as microscopic spores in soil and other materials for growth in the laboratory. Identification can be achieved by morphology (Section 2.3.1) and molecular means (Section 2.3.2).

2.1.3.1 Morphological identification of endophytic fungi belong to Ascomycota

The phylum Ascomycota, with over 32,000 described species, is the largest, most biologically and morphologically diverse group in the kingdom of fungi (Webster and Weber 2007). The significant morphological character of the phylum Ascomycota is the production of four to eight sexual spores in a microscopic sac-like cell named an ascus (Fig 2.2).

58

Figure 2.2: Sexual spores found in asci (Was taken from Webster and Weber, 2007)

Therefore, they are described as “sac fungi”. Most ascomycetes have their asci in macroscopic fruiting bodies called “ ascocarps”. Hyphae have many septa and sexually produced spores (ascospores) are contained in a characteristic sac, the ascus, which differs in structural appearance between species (Fig. 2.3).

Figure 2.3: Morphological characteristics of three kinds of ascocarps: A. perithecium. B: cleistothecium. C: apothecium (Was taken from Webster and Weber 2007).

Many of the Ascomycota species, such as Penicillium, Aspergillus and Trichoderma, are mostly in an asexual state as “anamorphs” and hardly produce ascospores or asci. The morphological identification of these species is dependent on the placement and structure of their asexual fruiting bodies, the conidiophores (Gupta 2004, Fig. 2.4).

59

Figure 2.4: Morphological characteristics of the conidiophores. A: Aspergillus sp.; B: Penicillium sp.; C: Trichoderma sp. (Was taken from Alexopoulos et al. 1996).

The asexual spores called conidia are usually formed on the tips of modified hyphae in simple chains or clusters. Before sexual reproduction, compatible haploid mating-type hyphae (+ and -) fuse to form a dikaryotic hypha. Ascomycetes have a more limited dikaryotic stage that eventually provides growth to an ascocarp and sexual ascospores (sexually produced spores). The Ascomycota life cycle is summarized in Fig 2.5.

Figure 2.5: An Ascomycota life cycle (Was taken from Alexopoulos et al. 1996)

Classification and identification of fungi by morphological techniques is not always a confirmatory process. A single fungal species can be different in morphology, depending on the growth medium, temperature, pH and moisture availability. Different

60 species can also reveal very similar characteristics under certain conditions. Morphological features play an important role for making initial identifications that are then supported by molecular methods which provide more reliable identification of fungi (Rodriguez et al. 2004).

2.1.3.2 Molecular identification techniques

PCR and direct sequencing can be used to great advantage in phylogenetic studies. There are several benefits to this method: i) crude preparations of DNA can be used; ii) small amounts of DNA are sufficient; iii) double-stranded DNA can be sequenced; iv) automated DNA sequencing instruments can be employed (White et al. 1990).

2.1.4 DNA extraction

In order to carry out molecular genetic analysis of endophytic fungi, their DNA has to be prepared, i.e. the DNA needs to be extracted and purified from the fungal cells. Different protocols have been developed for isolating DNA from pure cultures for many fungal species that optimise yield, time, cost or purity. Polysaccharides and glycoprotein compounds in the cell wall of many species present the most problems during DNA extraction from filamentous fungi. These problems have been overcome by the use of the cationic detergent cetyltrimethyl ammonium bromide (CTAB) and β- mercaptoethanol (Talbot 2001). Genomic DNA can be subjected to a number of identification techniques, including Restriction Fragment Length Polymorphism, Random Amplified Polymorphic DNA, 18S sequencing and Internal Transcribed Spacer (ITS) sequencing (Section 2.3.2.3).

61

2.1.5 Organisation and evolution of rDNA

Ribosomes are assemblies within cells that direct protein production by translating messenger RNA. They contain of a small (SSU) and a large (LSU) subunit. The small subunit contains the 18S rRNA and approximately 33 proteins. The large subunit contains three types of rRNA (5S, 5.8S, and 25-28S) and approximately 49 proteins. The rRNAs of eukaryotes are encoded by highly conserved genes which are typically present in the nuclear genome in several hundred, tandemly repeated copies (Wool et al. 1995). Each gene is separated from the next by a nontranscribed region known as the intergenic spacer (IGS) region. The SSU, LSU and 5.8S rRNAs are transcribed as a single primary transcript which is then cut during processing in the nucleus into the three final molecules. The three genes are separated by two internal transcribed spacers (ITS 1 and ITS 2) which contain signals for processing the primary transcript (Hillis and Dixon 1991; Nilsson et al. 2008). Transcription of the 5S rRNA gene is separate from the three other genes. (Schmidt 2006, Ciardo et al. 2010). Notably, the nuclear small-subunit ribosomal DNA has evolved relatively slowly and can be utilised to study distantly-related organisms. The ITS regions of the nuclear rRNA repeat units evolve faster and these sequences can be used to compare species of the same genus and for identification purposes (Martin and Rygiewicz, 2005).

Figure 2.6: Organisation of ribosomal RNA genes (rDNA) of fungi. The genes present in up to several hundred copies. Each repeat unit (typically from 8-12 kb each) has coding regions for one major transcript (containing the primary rRNAs for a single ribosome), interrupted by one or two intergenic spacer (IGS) regions depending on the presence of the 5S rRNA gene. (Adopted from Martin and Rygiewicz 2005) 62

2.1.6 rDNA analysis as a tool for identification

As explained above, the ITS regions of rDNA have been particularly useful for the molecular identification of fungi due to its evolutionary rate. The high sequence conservation of the bordering SSU and LSU rRNA genes make them ideal targets for DNA primer sites to amplify the complete ITS region (including the 5.8S rRNA) by PCR. Due to the high conservation, such primers will amplify the target DNA from many species, thus making them "universal". White et al. (1990) designed such universal PCR primers (ITS1 to ITS4) for the fungal ITS region (Fig. 2.7, Table 2.1).

Figure 2.7: Positions of primers commonly used for amplification of the fungal ITS1-5.8S RNA- ITS2 region. Sequences and references for primers are given in Table 1. (Martin and Rygiewicz 2005)

Table 2.1 PCR primers for the amplification of the ITS1-5.8S RNA-ITS2 region in fungi. Primer Sequence(5' to 3') Remark Reference¹ ITS1 TCCGTAGGTGAACCTGCGG Broad range specificity (fungi, plants, 1 protists, animals) ITS2 GCTGCGTTCTTCATCGATGC Broad range specificity (fungi, plants, 1 protists, animals) ITS3 GCATCGATGAAGAACGCAGC Broad range specificity (fungi, plants, 1 protists, animals)

63

Table 2.1 PCR primers for the amplification of the ITS1-5.8S RNA-ITS2 region in fungi. Primer Sequence(5' to 3') Remark Reference¹ ITS4 TCCTCCGCTTATTGATATGC Broad range specificity (fungi, 1 plants, protists, animals) ITS1-F CTTGGTCATTTAGAGGAAGTAA Specific to fungi 2 ITS4-B CAGGAGACTTGTACACGGTCCAG Specific to basidiomycetes 2 NSA3 AAACTCTGTCGTGCTGGGGATA Specific to Dikaryomycota (primary 3 forward primer) NLC2 GAGCTGCATTCCCAAACAACTC Specific to Dikaryomycota (primary 3 reverse primer) NSI1 GATTGAATGGCTTAGTGAGG Specific to Dikaryomycota 3 (secondary forward primer) NLB4 GGATTCTCACCCTCTATGAC Specific to Dikaryomycota 3 (secondary reverse primer) ¹1: White et al. 1990, 2: Gardes and Bruns 1993, 3: Martin and Rygiewicz 2005

Martin and Rygiewicz (2005) developed another primer set which specifically amplifies all Dikaryomycota sequences (ascomycetes and basidiomycetes). They introduced this set for use in a two-step PCR (nested PCR) of Dikaryomycota ITS sequences; primers NSA3/NLC2 serve as outer primers and NSI1/NLB4 as inner nested primers (Fig. 2.7, Table 2.1).

2.1.7 DNA sequence databases

After amplification and confirming the presence of DNA in an agarose gel, the PCR products need to be analysed. The most detailed and specific information is found by sequencing. The ITS region (400 to 900 bp) can be compared to other available sequences to identify the sample in question. The NCBI GenBank (http://www.ncbi.nlm.nih.gov/) or the EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) are public databases for all kinds of nucleotide (and protein) sequences and provide the highest number of entries for comparison. To find the closet matching sequences, the Basic Local Alignment Search Tool (BLAST) (Altschul et al. 1990) is normally used.

64

This chapter describes the isolation and identification of endophytic fungi from the Australian native plants E. longifolia and E. maculata. Seventeen fungal strains were isolated from the leaves of E. longifolia and nine strains from E. maculata were identified by morphological analysis and sequencing of the ITS regions of the ribosomal DNA. Most isolates were found to belong to the Ascomycota.

2.2 Methods and materials

2.2.1 Isolation of endophytic fungi from Australian native plants

Frozen leaves of E. longifolia and fresh plant material of E. maculata were obtained from Canopus Corporation (Byrock, NSW, Australia) and a native plant nursery in Horsham (Victoria, Australia), respectively. These materials were used for isolation of endophytes, as described by Strobel and Daisy (2003). Leaves of E. longifolia were screened for their endophytic populations by carrying out surface sterilisation with 70 % ethanol in a laminar flow hood to prevent interference of non- target organisms. Using a sterile scalpel blade, outer tissues were removed from the samples and the inner tissue fragments were carefully excised and placed on water agar plates. The plates were incubated for several days at 25 °C until fungal mycelia were observed, followed by removal of hyphal tips, transfer to potato dextrose agar (PDA containing antibiotics) and incubation at 25 °C. Surface sterilised and un-dissected tissues were also placed onto water agar plates to ensure that sterilisation procedures had been effective. Colonial growth of endophytes was observed after 5–7 days and subculturing was performed several times to produce pure fungal cultures. Identification was carried out by standard morphological techniques (fungal slide culture and microscopy and scanning electron microscopy (SEM)) (Castillo et al. 2005) and confirmed by direct sequencing of fungal ITS regions (Peterson et al. 2009).

65

2.2.2 Morphological analysis using scanning electron microscopy (SEM) for initial identification

Fungal mycelia structures on agar plates (PDA) were examined by stereo and light microscopy, followed by more detailed analysis by SEM. The samples were then processed based on modified procedures described by Castillo et al. (2005). The surface morphologies of the mycelium was observed using a field emission scanning electron microscope (FeSEM - SUPRA 40VP, Carl Zeiss GmbH, Jena, Germany) at fixed voltage of 3kV. The samples were then critical-point dried and attached to metallic substrata using conductive double-sided adhesive tape. Samples were sputter coated with gold using a JEOL NeoCoater (model MP-19020NCTR) prior to imaging at 100X, 1,000 X and 10,000 X magnifications.

2.2.3 Extraction of fungal DNA

Fresh mycelia were removed from PDA plates after 5 days of growth at 25 °C. For each isolate, two small squares of fungal mycelia was placed into a microcentrifuge tube and mixed gently with 750 μl Lysis Solution. Genomic DNA of the mycelium was isolated using the ZR Fungal/Bacterial DNA kit (Zymo Research Corp, USA.) in accordance with manufacturer’s protocol (Appendix 2.1). The quantity and quality of the DNA extracted was confirmed by electrophoresis in 1 % (w/v) agarose gels (Appendix 2.2) and an estimate of the relative size and quality of DNA was made according to the clarity of bands.

2.2.4 Amplification and direct sequencing of fungal ITS regions using PCR

The ITS1, 5.8S and ITS2 regions of the fungal DNA were amplified by PCR using the BioMix Red PCR kit (Bioline, Alexandria, Australia). The sequences of the primers used for PCR amplification of the ITS regions are shown in Fig. 2.8, along with the location of the primers on nuclear ribosomal DNA. The reaction mixture consisted of 10 µmol of each primer ITS1 (5´-TCC GAT GGT GAA CCT GCG G-3´) and ITS4 (5´-TCC TCC GCT TAT TGA TAT GC-3´) (Peterson et al. 2009), 25 µl of Biomix

66

Red, approximately 100 ng of genomic DNA and ddH2O to make up the volume to 50 µl. PCR was carried out in a MyCycler thermal cycler (Bio-Rad, Hercules, USA) with 1 cycle (94 °C for 5 min) for initial denaturation, 35 cycles (94 °C for 45 s; 54 °C for 45 s; 72 °C for 1 min) for extension and annealing, and 1 cycle (72 °C for 10 min) for final extension of the amplified DNA.

Figure 2.8: The ITS1 and ITS4 primers amplify the ITS regions. These primers were designed by White et al. (1990) and are specific to fungal species. The ITS regions are highly variable and can be used to identify the fungal species. This diagram was modified from White et al. (1990).

2.2.5 Molecular analysis and identification of the endophytic fungi

The PCR products were analysed in 1 % (w/v) agarose gels, and purified using the Wizard SV Gel and PCR Clean-Up System kit (Promega, Madison, USA) in accordance with manufacturer’s protocol (Appendix 2.3). The DNA samples were prepared according to the sequencing guidelines (Appendix 2.4) and sequenced by the Australian Genome Research Facility (http://www.agrf.org.au). The sequence data were analyzed using the BLASTN software available at the National Center of Biotechnology Information (NCBI) web site (http://www.ncbi.nlm.nih.gov/ blast/Blast.cgi) to determine the identity of the endophytes (Table 1). All 26 sequences have been submitted to the GeneBank database and they assigned accession numbers. The DNA sequences were subsequently aligned using CLUSTALW (http://www.ebi.ac.uk/clustalw/), using the blosum matrix. The CLUSTALW output could then be converted for use in MEGA version 5 (Tamura et al. 2011). A

67 phylogenetic tree was inferred from the imported sequences using the Neighbor-Joining method with a p-distance substitution matrix; bootstrapping was performed 1000 times. The phylogenetic tree was used to determine the genetic relatedness of fungal isolates.

2.3 Results

2.3.1 Isolation and collection of the endophytic fungi

Most of the fungi that become visible on agar plate from plant samples during the incubation time were transferred to the PDA plates containing antibiotics for continued growth and examination. Sub-culturing onto new PDA plates was performed until pure cultures were obtained. It was observed that some fungi originally isolated as mixed cultures did not persist following sub-culture. This could have been due to a symbiotic relationship between the original mixed isolates. It was also observed that some isolates did not survive during prolonged incubation (several weeks) on PDA agar, suggesting an inability of the fungal strain to survive on nutrients provided in the PDA medium. Finally, seventeen isolates of endophytic fungi were obtained from the leaves of E. longifolia and nine from E. maculata (Fig 2.9).

68

Figure 2.9a: Stereomicroscope images (x 10) of a selection of endophytic fungal (EL-1 to EL-17) species from E. longifolia.

Figure 2.9b: Stereomicroscope images (x 10) of a selection of endophytic fungal (EM-1 to EM-9) species from E. maculata.

69

It is recognised that the techniques employed in this study to isolate endophytic fungi would not have recovered all the fungal species and some could be considered “unculturable” under laboratory conditions. However, the use of a different cultivation medium (such as malt extract agar) may have led to the recovery of different fungi. In parallel, complete identification of the endophytic species may have been achieved by ITS sequencing of DNA extracted directly from the plant but this was not attempted in this work as the aim was to study culturable endophytic fungi and characterise their bioactive properties and enzyme activities.

2.3.2 Identification of fungi by morphology

Initial Identification was performed based on the shape, structure and colour of colonies, conidiophores, conidia and/or sexual fruiting bodies and spores. Some examples of identifying morphological features of the fungi seen under scanning electron microscopy (SEM) are shown in Fig. 2.10.

70

A B

C

Figure 2.10: Using scanning electron microscopy (SEM) for selected endophytic fungi including EL-14, EL -17 and EM-4 with 100X and 1K X and 10K X magnification. Stereo and light microscope images showing morphological features used for the identification of endophytic fungi in Table 3.2, for example: A: conidia of Cladsporium (EL-6), B: conidia of Stemphylium (EM-2), C: conidia of Alternaria (EL-17).

Tables 2.2 contain a summary of the morphological features and corresponding identifications of fungi isolated from E. longifolia and E. maculata (Bell 2005).

71

Table 2.2.1 Morphological identification of endophytic fungi isolated from E. longifolia Sample Genus Diagnostic morphological features EL-1 Phoma black aerial mycelia, flask shaped ostiolate pycnidia containing one-celled colourless conidia EL-2 Leptosphaerulina thick black mycelia, turning white below with age olivaceous-greyish, darkly pigmented, terminal, EL-3 Stemphylium multicellular conidia (dictyoconidia) are formed on a distinctive conidiophore with a darker terminal swelling EL-4 Nigrospora initially white then grey mycelia/ conidia are black, unicellular, flattened horizontally EL-5 Leptosphaerulina thick black/grey mycelia, turning white below with age EL-6 Cladosporium olivaceous-brown mycelia, often becoming powdery due to the production of abundant conidia EL-7 Fungal sp. no fruiting bodies, black mycelia embedded agar EL-8 Phoma as above EL-9 Phoma as above EL-10 Fusarium white cottony aerial mycelia, white on top, becomes pink beneath, lunate multi-septate hyaline macroconidia, ellipsoid microconidia EL-11 Leptosphaerulina thick grey mycelia, turning white with age EL-12 Alternaria greyish white colony, blastocatenate of multicelled conidia EL-13 Fungal grey granular colony, ellipsoid conidia, one septum endophyte EL-14 Preussia ascospores, with three or more septa, non-ostiolate perithecia EL-15 Alternaria olivaceous white colony, blastocatenate of multicelled conidia EL-16 Fungal greyish white colony, single ovoid conidia, spherical dark endophyte grey cleistothecia EL-17 Alternaria greyish white colony, branched acropetal chains and multicelled, obclavate to obpyriform conidia with short conical beaks

72

Table 2.2.2 Morphological identification of endophytic fungi isolated from E. maculate. Sample Genus Diagnostic morphological features EM-1 Phoma black aerial mycelia, flask shaped ostiolate pycnidia containing one-celled colourless conidia EM-2 Stemphylium olivaceous-greyish, darkly pigmented, terminal, multicellular conidia (dictyoconidia) are formed on a distinctive conidiophore with a darker terminal swelling

EM-3 Stemphylium as above

EM-4 Preussia ascospores, with three or more septa, non-ostiolate (Sporomiella) perithecia EM-5 chaetomium thick white tufty mycelia, turning yellow below with age EM-6 Alternaria olivaceous white colony, blastocatenate of multicelled conidia

EM-7 Alternaria greyish white colony, blastocatenate of multicelled conidia

EM-8 Alternaria greyish white colony, blastocatenate of multicelled conidia

EM-9 Alternaria greyish white colony, blastocatenate of multicelled conidia

2.3.3 Identification of fungi by ITS sequencing

High DNA yields were achieved from relatively soft hyphae and fruiting bodies of endophytic fungi grown on PDA plates. The size of the PCR products resulting amplification of the ITS regions (ITS 1 and ITS 4) of the fungi varied between the fungal isolates, ranging from approximately 500 to 700 base pairs. Some of the PCR products visualised by gel electrophoresis (Fig. 2.11) were obtained from isolates that were later identified as different genera belonging to the Ascomycota.

73

Figure 2.11: Agarose gel electrophoresis of PCR products following the amplification of the ITS regions of rDNA of a selection of endophytic fungi. 5µl of DNA was loaded per lane. Lane M- Gene Ruler. The PCR products ranged from approximately 500 to 700 base pairs as expected.

Sequencing of the PCR products from the ITS regions resulted in the determination of DNA sequences that covered 5.8S rDNA, ITS regions 1 and 2. The chromatograms displaying the sequencing data were examined in BioEdit (Fig 2.12, Hall 1999) for the consensus sequences. Alignment of the forward and reverse sequences was performed to obtain a consensus sequence. The DNA sequences were edited at those sections where sequences were judged to be unreliable. These new truncated sequences were used for all subsequent analyses (Fig 2.13).

74

18S ITS

5.8S

5.8S ITS

28S

Figure 2.12: DNA sequence chromatogram of the ITS regions and adjacent rDNA of endophytic fungus EL-2 from E. longifolia with accession number of AY278318.

75

Figure 2.13: Sequence alignment of the ITS sequences and adjacent rDNA regions of endophytic fungus EL-2 from E. longifolia with accession number of AY278318, shown as “Query” to that of the sequence bearing greatest similarity in the NCBI database (Leptosphaerulina species AY278318 shown as “Sbjct”). Discrepancies between the sequences are indicated in red, suggesting that the fungus was of the same genus but of a different species to that of the database entry (White et al. 1990).

The BLASTN sequences were considered to match the fungal isolates against the NCBI database. The identifications obtain from the sequence similarity in the database (Zaferanloo et al. 2013, Table 2.3) were supported with those made by morphological analyses (Table 2.2.1 and Table 2.2.2). All the fungal isolates obtained

76 from E. longifolia and E. maculata had matches in the NCBI database with at least 95% identity (E = 0). The species of endophytes that could not be identified by morphology were recognized for most of the isolates. The ITS sequences were placed in GenBank (www.ncbi.nlm.nih.gov/ genbank/) and accession numbers were assigned for EL samples (JQ316434-JQ316450; Table 1, Publication 1) and for EM samples (JX262252- JX262260). The majority of the fungi isolated from these two Australian native plants were identified as species from the phylum Ascomycota (Table 2.1, Publication 1). The exceptions were three isolates (EL-7, EL-13 and EL-16) which identified as “unclassified fungi” (Table 2.1).

Table 2.3: Identification of endophytic fungi based on the closest match of ITS sequences in the NCBI database¹ BLAST result Sample Size of Genus GenBank Percent sequence Accession Identity (bp) number EL-1 545 Phoma GQ352491 98 EL-2 537 Leptosphaerulina AY278318 99 EL-3 456 Stemphylium EF104168 100 EL-4 483 Nigrospora FJ785429 99 EL-5 538 Leptosphaerulina AY831558 99 EL-6 648 Cladosporium GU214631 100 EL-7 540 Unclassified fungus EU816402 96 EL-8 542 Phoma AB470824 99 EL-9 493 Phoma AY210335 98 EL-10 514 Fusarium DQ993637 100 EL-11 618 Leptosphaerulina EF694653 99 EL-12 570 Alternaria GQ302684 99 EL-13 574 Unclassified fungus EF419981 97 EL-14 474 Preussia DQ468035 95 EL-15 607 Alternaria GU187964 100 EL-16 544 Unclassified fungus EF420002 97 EL-17 506 Alternaria FJ375168 100 EM-1 545 Phoma GQ352491 98

77

Table 2.3: Identification of endophytic fungi based on the closest match of ITS sequences in the NCBI database¹ BLAST result Sample Size of Genus GenBank Percent sequence Accession Identity (bp) number EM-2 554 Stemphylium EF104156 100 EM-3 500 Stemphylium EF076750 100 EM-4 482 Preussia HQ130664 99 EM-5 519 Chaetomium GU934507 99 EM-6 524 Alternaria HQ914864 99 EM-7 522 Alternaria HQ914865 100 EM-8 522 Alternaria HQ914850 99 EM-9 519 Alternaria HQ914865 99

¹Sequences have been submitted to the GenBank database and assigned the accession numbers JQ316434– JQ316450 for EL samples and JX262252-JX262260 for EM samples.

The results revealed the abundance of ascomycetous species in the collection of endophytic fungi isolated from E. longifolia and E. maculate. This is consistent with previous research on Ascomycota, in which many ascomycetes grow as endophytes in symptomless associations with plants (Webster and Weber 2007, Table 2.4).

Table 2.4 Classification of endophytic fungi based on their identification using ITS sequences Sample Genus Family Class Division

EL-1 Phoma Pleosporaceae Dothideomycetes Ascomycota EL-2 Leptosphaerulina Didymellaceae Dothideomycetes Ascomycota EL-3 Stemphylium Pleosporaceae Dothideomycetes Ascomycota EL-4 Nigrospora Trichosphaeriaceae Sordariomycetes Ascomycota EL-5 Leptosphaerulina Pleosporaceae Dothideomycetes Ascomycota EL-6 Cladosporium Davidiellaceae Dothideomycetes Ascomycota EL-7 NA Unclassified fungi Unclassified fungi Unclassified EL-8 Phoma Pleosporaceae Dothideomycetes Ascomycota EL-9 Phoma Pleosporaceae Dothideomycetes Ascomycota EL-10 Fusarium Nectriaceae Sordariomycetes Ascomycota

78

Table 2.4 Classification of endophytic fungi based on their identification using ITS sequences Sample Genus Family Class Division

EL-11 Leptosphaerulina Didymellaceae Dothideomycetes Ascomycota EL-12 Alternaria Pleosporaceae Dothideomycetes Ascomycota EL-13 NA Unclassified fungi Unclassified fungi Unclassified EL-14 Preussia Sporormiaceae Dothideomycetes Ascomycota EL-15 Alternaria Pleosporaceae Dothideomycetes Ascomycota EL-16 NA Unclassified fungi Unclassified fungi Unclassified EL-17 Alternaria Pleosporaceae Dothideomycetes Ascomycota EM-1 Phoma Pleosporaceae Dothideomycetes Ascomycota EM-2 Stemphylium Pleosporaceae Dothideomycetes Ascomycota EM-3 Stemphylium Pleosporaceae Dothideomycetes Ascomycota EM-4 Preussia Sporormiaceae Dothideomycetes Ascomycota EM-5 Chaetomium Chaetomiaceae Sordariomycetes Ascomycota EM-6 Alternaria Pleosporaceae Dothideomycetes Ascomycota EM-7 Alternaria Pleosporaceae Dothideomycetes Ascomycota EM-8 Alternaria Pleosporaceae Dothideomycetes Ascomycota EM-9 Alternaria Pleosporaceae Dothideomycetes Ascomycota

2.3.4 Comparison of the ITS regions of the fungal isolates

To reveal evolutionary relationships between isolates, DNA sequences were aligned using CLUSTALW (http:// www.ebi.ac.uk/clustalw/). The phylogenetic relationships of the isolates were evaluated using neighbour-joining analysis in MEGA version 5 (Tamura et al. 2011) with a bootstrap value obtained from 1000 replicates. Evolutionary distances were computed using the Kimura 2-parameter method (Kimura 1980). Phylogenetic trees can be observed in Fig 2.14. A bootstrap score of 1000 with values of greater than 50% indicated that the sequences shared significant homology. Since the DNA sequences displayed significant similarities, it was suspected that the fungal isolates were evolutionarily close relatives and so phylogenetic analysis was performed using DNA rather than deduced protein sequences. The sequences varied

79 mainly in the ITS1 and ITS2 regions and a high degree of sequence similarity was apparent in the more highly conserved contiguous regions of 18S, 5.8S and 28S rDNA.

EL-2 Leptosphaerulina americana EL-5 Leptosphaerulina trifolii

EL-1 Phoma moricola EL-8 Phoma herbarum EL-13 Unclassified fungus EL-16 Unclassified fungus

EL-9 Phoma sp. EL-3 Stemphylium sp. EL-12 Alternaria sp. EL-15 Alternaria sp.

EL-17 Alternaria alternata EL-11 Leptosphaerulina sp. EL-14 Preussia minima EL-6 Cladosporium sp.

EL-7 Unclassified fungus EL-10 Fusarium sp. EL-4 Nigrospora sp.

Figure 2.14a: The ITS regions of fungal endophytes isolated from E. longifolia were used to construct a phylogenetic tree. The Neighbour-Joining method was used to infer phylogeny using MEGA version 5; p-distance and a bootstrapping score of 1000 with values of greater than 50 % were employed parameters. (Tamura et al. 2011)

EM-7 Alternaria sp. EM-9 Alternaria sp. EM-6 Alternaria sp. EM-8 Alternaria sp. EM-2 Stemphylium sp.

EM-3 Stemphylium sp.

EM-1 Phoma sp. EM-4 Preussia sp. EM-5 Chaetomium sp.

Figure 2.14b: The ITS regions of fungal endophytes isolated from E. maculata were used to construct a phylogenetic tree under the same conditions as above.

80

EL-15 Alternaria sp. EL-12 Alternaria sp. EL-17 Alternaria alternata EM-6 Alternaria sp. EM-9 Alternaria sp. EM-7 Alternaria sp. EM-8 Alternaria sp. EM-3 Stemphylium sp. EM-2 Stemphylium sp. EL-3 Stemphylium sp. EL-16 Unclassified fungus EL-13 Unclassified fungus EL-5 Leptosphaerulina trifolii EL-2 Leptosphaerulina americana EL-9 Phoma sp. EL-8 Phoma herbarum EM-1 Phoma sp. EL-1 Phoma moricola EL-11 Leptosphaerulina sp. EM-4 Preussia sp. EL-14 Preussia minima EL-6 Cladosporium sp. EM-5 Chaetomium sp. EL-7 Unclassified fungus EL-4 Nigrospora sp. EL-10 Fusarium sp.

Figure 2.14c: The ITS regions of fungal endophytes isolated from both plants, E. logifolia and E. maculata, were used to construct a phylogenetic tree under the same conditions as above.

81

2.4 Discussion

Evolution is a basic biological process of all living species. Evolutionary changes result in successful adaptation to changing habitats through the generation and inheritance of natural mutations at the gene or chromosome level. With respect to fungi, these changes may lead to the rapid appearance of a wide range of new species that might require new nomenclature in fungal taxonomy. In addition, inadequate taxonomy might be due to the mistakes in identification of isolates such as too few characters and an inadequate number of isolates (Samson 1991, Guarro et al. 1999). Hence, fungal taxonomy should be dynamic and progressive discipline. There are many methods used to classify the fungi based on morphological (Samson 1991, Guarro et al. 1999, Taralova et al. 2011), molecular (Bridge 1985, Samson 1991), or metabolite characteristics (Frisvad et al. 2008) or combinations of morphological, physiological and molecular markers (Lopez and Jensen 2002, Grimm et al. 2005, Moore et al. 2005). The most common are morphological methods based on fungal appearance using two different concepts of fungal species. The phenotypic concept is based on the morphological characteristics while the polythetic concept is an approach that combines several characters (Guarro et al. 1999). However, these methods have problems, such as those seen with pathogenic fungi where they appear as vegetative cells during an infection; thus only the shape and pigmentation of hyphal elements or other nonspecific structures such as the presence or absence of septa are observed. Another problem is the variability of shapes and sizes of different fungal organs that lead to errors in classification of fungi based on the observation of growing colonies (e.g. colour and physical appearance) as well as microscopic morphological structures (Lopez and Jensen 2002, Grimm et al. 2005, Moore et al. 2005). Hence, there are many biochemical and physiological methods have been used as the alternative approaches to identify fungi. These methods have some problems in that they are labourious, time-consuming, sensitive to growth conditions and gene expression. These problems can lead to the inadequate taxonomy and require the use of new techniques like DNA-based methods for confirmation (Bridge 1985; Samson 1991). The use of bio- molecular technologies (e.g. MALDI-TOF mass spectrometry and RAPD PCR) in fungal identification may obviate the problems of biochemical and physiological methods. These methods are based on the differences in DNA (e.g. nucleotide sequence and % G+C) among species and strains (Samson 1991). The advantage of these 82 methods is the insensitivity of DNA sequences to short-term environmental change which play important role in strain identification. It is clear that each method has advantages and disadvantages hence there is no general method used for every fungus. In this chapter, the identities of several fungal endophyte isolates were obtained by sequencing of the ITS regions. All the samples obtained from E. logifolia and E. maculata were identified by a database search in GenBank with a match of at least 95% (E=0) (Table 3.3). Fourteen isolates from E. longifolia were identified as belonging to eight different genera, including Alternaria, Cladosporium, Fusarium, Leptosphaerulina, Nigrospora, Phoma, Preussia and Stemphylium. Nine isolates from E. maculata were identified as Alternaria, Chaetomium, Phoma, Preussia (Sporormiella) and Stemphylium. These species have previously been identified as being endophytic to several plants (Ma´rquez et al. 2011). However, only endophytic Phoma isolates have previously been investigated for their extracellular enzyme production (Borges et al. 2009). Twenty two of the isolates had matches with a percentage identity of at least 98 % with fungal species listed in the GenBank. Three isolates belonged to unclassified fungi which, with the exception of EL-7, were annotated as endophytes. EL-7 was most closely related to a fungal species, STRK1, which is known as a soil inhabitant rather than an endophyte. Given that endophytes are known to colonise their host plant through uptake from the soil through the roots (Hurek and Hurek 1998), it is likely that STRK1-like fungi are indeed endophytic in E. longifolia. For the EM samples, isolate EM-1 was identified as a coelomycete, Phoma sp., which have previously been isolated and reported as fungal endophytes, with a high abundance in the roots and surrounding soil (Huang et al. 2009; Rodriguez et al. 2009). The isolates EM-3 and EM-4 are both suspected to belong to Stemphylium sp. Although this endophyte is not commonly cited in literature, a recent study has demonstrated its ability to produce exopolysaccharide (Banerjee et al. 2009). EM-5 and EL-15 were identified as Sporormiella and Preussia sp., respectively. Both these fungi are reported as known fungal endophytes (Kruys and Wedin 2009). It has been noted that identification based on searching for matches in GenBank relies on previous sequencing results deposited in the database to be accurate and taxonomic groups identified correctly (Bellemain et al. 2010). Furthermore, the non-coding ITS regions are subject to rapid evolutionary mutations, which create

83 additional difficulties in obtaining sequence matches and performing accurate sequence alignments (Huang et al. 2009). It is recommended that molecular identification should be supported using traditional morphological identification techniques (Huang et al. 2009). Moreover, utilising a range of different primers to amplify the ITS regions and analysing these alongside each other to generate a consensus would allow for more accurate reporting (Bellemain et al. 2010). Nevertheless, the high percentage of identity observed in this study provides confidence that the reported identifications, at least at the genus level, are correct. However, it was noticed that isolates EM-3 and EM-4 shared significant similarity (Figure 2), even though they appeared distinct by morphological inspection; these should be investigated further to determine if the fungi are the same species, and possibly the same isolate, or if they are two subtly different species occupying the same niche. An additional recommendation would include employing a variety of culture methods in the initial isolation of endophytes to determine if other fungal isolates can be obtained. It is possible that some slow growing endophytes were not cultured and consequently did not undergo identification (Huang et al. 2009). It is also noted that some fungi, such as the Class 2 endophytes, may not be cultivable on culture media at all since it is likely that vertical transmission requires an obligate host-symbiont relationship; the use of environmental PCR is recommended for the identification of these fungi (Aly et al. 2011).

84

Chapter 3

Screening of antibacterial, enzyme activities and anticancer activities

3.1 Introduction: Investigating endophytes for new bioactive compounds

Endophytic fungi that reside within intercellular epidermal layers of plant tissue (Fig. 3.1) are being ever more recognized as an ecological collection of microorganisms that may provide sources for new secondary metabolites with useful biological activities. It is therefore surprising that they have not been subjected to intensive screening programs, thus the majority of species largely remain undiscovered, as described in Section 1.1 and 1.2 (Tejesvi et al. 2007b, Lu et al. 2012).

Figure 3.1: Endophyte growths in a grass plant. ). Upper left: A cross section of leaf shows hyphae (h) of the endophytic fungi between host cells. Also reveal a chloroplast (ch) and vacuoles (v). Bottom left: fungal growth in the true stem and leaf primordia. The fungal hyphae are presented darkly stained Right: the endophyte as it appears in a leaf epidermal peel, stained for hyphae, which are arranged mainly along the longitudinal axis of plant cells. (Was taken from Schardl et al. 2004)

85

3.1.1 Investigation of enzyme activity

Fungal strains isolated from an ecological source are screened (Section 1.7.8) for their enzyme activities and rapid selection of potential candidates can be achieved by means of agar plate assays. Once a smaller group of the most promising fungal strains is established, more extensive enzyme purification, optimization and characterisation can be carried out using liquid cultures, enzyme assays and zymograms, as detailed in the following chapters.

3.1.1.1 Screening enzyme activity by agar plate assay

This technique involves inoculating a fungal strain onto an agar plate which contains the substrate for the target enzyme of interest (Hankin and Anagnostakis 1975). The fungus must secrete the target enzyme to break down the substrate into small molecules that it can absorb and use for nutrition and growth. Detecting enzyme excretion and activity is typically accomplished by observing a halo around the fungal colony, representing the degradation of the substrate. Direct visualisation of substrate may not be possible for some enzymes and additional procedures, such as Congo Red staining to reveal xylanase and endoglucanase activities (Teather and Wood 1982), are required. The diameter of the halo is representative of the amount of enzyme activity and, in combination with the colony size, can be used to select for the best candidates (Bradner et al. 1999) by calculating the index of “relative enzyme activity” (REA) (Bradner 2003, Fig. 3.2). This was simplified by the equation (D² – d²)/ d², in which D and d were the diameter of the halo and colony respectively Eq. (3.1).

D2−d2 Relative Enzyme Activity = ( d2 3.1)

86

D Area of enzyme activity

d

Fungal colony

D2−d2 Relative Enzyme Activity = d2

Figure 3.2: The method used to calculate relative enzyme activity (REA) of the fungal isolates. The relative activity was calculated by dividing the area of the halo around the colony (the area of the clearing zone minus the area of the colony) by the area of the colony.

Modifying the incubation temperature or the pH of the agar medium can readily determine the range of conditions under which the enzymes are active. When the aim of a research project is to seek particular enzyme properties, such as those desirable for a defined industrial application, agar plate selection can be carried out at, or close to, the temperature and pH conditions in which the enzyme would be required to perform. For large-scale projects, computer-based imaging softwares are being used increasingly to improve efficiency and throughput of the agar plate screening process (Hughes et al. 2006).

3.1.2 Investigation of antibacterial activity

When isolating fungi from an environmental source, it is common to obtain a vast number of different species and strains that could be potential candidates of antibacterial activity. Rapid screening of the isolates can be achieved by means of a disc diffusion assay. Once a smaller group of the most promising fungal strains is established then further experiments can be carried out to establish the minimum

87 inhibitory concentration (MIC), i.e. the lowest concentration of an antimicrobial agent that will inhibit the visible growth of the target microorganism.

3.1.3 Exploration of endophyte for anticancer activity

The chemical and biological diversity associated with endophytic fungi has potential applications to a wide range of clinical therapeutics, producing an array of secondary metabolites, with diverse structural (Schulz et al. 2002). Endophytic fungi provide a wealth of diversity, which provides opportunities to utilise these abundant sources of bioactive metabolites, in the quest to produce a greater range of therapeutic drugs for applications to not only cancer, but also to other diseases. The communication and genetic cross talk mechanisms illustrated between the host plant and endophyte, particularly in plants inhabiting extreme or specialised environments, are crucial to the production of novel secondary metabolites. This information can provide a leaded- directed approach, in which successful identification of novel biotopes from specific habitats can provide greater knowledge to further screen, in an efficacious manner, these relatively unknown micro-organisms, in the hope to further enrich and improve the availability of therapeutic treatments (Tenguria et al. 2011). However the uses of novel secondary metabolite producing endophytes for therapeutic treatments are not without their draw backs, with supply issues needing to be addressed in order to exhaustively screen the entophyte’s clinical capabilities and subsequently supply the large volumes of the agents required to formulate clinical trials. Both taxol and camptothecin are produced in small quantities within the host plant in their natural environment, and both consequently endured delays before, during and after clinical trials due to the inability to naturally synthesis the quantities of endophyte required, coupled with the fact that the extraction methods used were relatively inefficient (Zhou et al. 2010). Endophytes have demonstrated their ability to produce a multitude of chemically and biologically diverse secondary metabolites, subsequently gaining increased scientific attention regarding the endophytes therapeutic abilities. By prioritising the screening of endophytes over the use of synthetic chemistry and other artificial screening processes, will in turn provide greater information on endophytic behaviours, and thus provide a greater understanding in to the mechanisms which trigger the production of valuable metabolites. This allows for the utilisation of 88 these mechanistic processes to increase the production of novel compounds and provide an increase in therapeutic treatment production. The potential of endophytic fungi to produce powerful bioactive compounds is great, as signified by their growth on such an unusual substrate and environment, and warranted further investigation through this work. In this study, the foliar fungal endophyte population of the Australian native medicinal plants, Eremophila longifolia and E. maculata, were examined and assessed for their potential as a source of enzymes of industrial interest and screened for major plant macromolecule degrading enzymes as well as their antibacterial and anticancer activities. The concept of a relationship between the medicinal properties of E. longifolia and E. maculata and the metabolic products of their endophytes provides the rationale for selection of these plants in medicinal, environmental and industrial applications.

3.2 Methods and materials

3.2.1. Screening for enzyme activity on solid media using endophytic fungi

All fungal isolates were individually inoculated on 2 % (w/v) agar (Difco Bacto) plates containing one of the following substrates (supplied by Sigma-Aldrich): soluble starch (1% w/v) for amylases, lignin (0.25% w/v) to detect ligninases activity (ligninolytic phenol-oxidases), Avicel cellulose (0.5% w/v, Fluka) for cellobiohydrolases, commercial skim milk powder (1% w/v) for proteases and brich xylan (0.5 %w/v) for xylanases. All plates also contained minimal medium salts:

KH2PO4 (1.5% w/v), (NH4)2SO4 (0.5% w/v), MgSO4.7H2O (0.06% w/v) and

CaCl2.2H2O (0.06% w/v). Lignin plates were also supplemented with 0.5% (w/v) of ammonium tartrate. To prevent excessive colony growth, 0.01% (w/v) of Triton X-100 was added (Peterson et al. 2009a). Each fungal isolate was transferred to test plates containing the substrates for the detection of the target enzyme class. This process was replicated three times for each isolate at each incubation temperature (9oC, 25oC, 37oC and 50oC) and pH (3.5, 5.5, 7 and 9). Enzyme activity was detected by the presence of the clearing zone around the fungal colony, indicating the degradation of the substrate as the result of the production of enzyme (Peterson et al. 2009a). Halo zones in starch plates were detected by staining with iodine. Lignin plates were visualized by flooding the plates with equal parts of 1% 89

(w/v) aqueous solutions of FeCl3 and K3[Fe/(CN)6], mixed immediately before use. If required, protease plates were flooded with 10 % (w/v) tannic acid but zones were generally very clear and needed no additional stains for assessment. Xylanase and cellulase activities were visualised by staining the plates with Congo Red 1% (w/v) for 5 min followed by distaining with 1M NaCl for 15 min. The activity was assessed on day 5-7 depending on the temperature, pH and enzyme. The relative enzyme activity was determined (Brander 2003, Peterson et al. 2009a).

3.2.2 Screening for antibacterial activity

3.2.2.1 Preparation of Samples

All fungal isolates were grown in Potato Dextrose Broth (PDB) and then filtered by membrane filtration through a 0.22 µm filter (Millipore) under vacuum to separate mycelium from broth (Xu et al. 2008a). Each sterilized broth was frozen in autoclaved round-bottom flask for freeze-drying. The weight of the lyophilized extract was measured by first weighing the empty round-bottom flask before adding the filtrate and again after freeze-drying. The weight of the freeze-dried compound was calculated by the difference between the two weights and recorded. After freeze-drying, the lyophilized powder was mixed in sterile water to the same concentration for all samples, kept at 4 °C and used to determine antibacterial activity.

3.2.2.2 Detection of Antibacterial activity

An overnight bacterial broth of Escherichia coli (150 µL almost with concentration of 7.5 × 108 cells/mL bacteria) was added to molten nutrient agar using the pour-plate method. This was repeated for Salmonella enterica Serovar Typhimurium, Staphylococcus aureus and Bacillus cereus. After the plates had set, 4 holes were bored into the agar (using an 8 mm borer), and 3 holes were filled with approximately 120 µL of the fungal extract. The fourth hole contained approximately 10 µL of 1% Betadine which acted as a positive control. These were left to incubate at 37oC for 4 days. A clear zone because there was no bacterial growth surrounding the well, indicated a positive result for antibacterial properties.

90

3.2.2.3 Determination of minimal inhibitory concentration (MIC)

Those extracts which exhibited positive results were selected to determine the minimal inhibitory concentration (MIC) for that particular bacterium. A round-bottom well microtitre plate was used and 100 µL of PDB was added to 12 wells. Undiluted fungal extract (100 µL) was added to the first well and mixed thoroughly. This was then serially diluted 1:2 by removing 100 µL of the broth and mixing it in the next well so that each subsequent well had a concentration which was half that of the preceding well. Bacterial cultures were prepared by visually comparing them to a 0.5 McFarland Standard. The diluted bacterial culture (10 µL) was used to inoculate each well. The plate was incubated at 37oC for 18 hours. A growth control well contained PDB with bacterial inoculum but no fungal extract and a sterility control well contained only PDB. This method of determining MIC was based on that reported by Wiegand et al. (2008).

3.2.3 Screening for anticancer activity

The following experiments were performed in collaboration with Dr Sally Coulthard and her team from Newcastle University (UK) whose research interests include the utilisation of micro-organisms and natural products for potential therapeutic treatments. Dr Coulthard’s laboratory was provided with twenty six endophyte samples (prepared as described in 3.2.2.1) and these were screened for anti-cancer activity. The specific aims were to: 1. Identify any endophytes that were cytotoxic against the two leukemic suspension cancer cell lines (PreB697 and MOLT-4) and an adherent lung cancer

cell line (A549), using EC50 values as a direct comparator. 2. Elucidate the metabolites which mediated cytotoxic effects

3. Further screen isolated metabolites to deduce cytotoxicity, again using EC50 values as a direct comparator. Cell culture cytotoxicity assays, preparation of endophyte samples for drug sensitivity assays, MTS cell proliferation assays, UV-HPLC and appropriate statistical analysis were undertaken by Dr Coulthard’s team..

91

3.3 Results

3.3.1 Screening of fungi for enzyme activity by agar plate assay

The 26 fungal isolates from E. longifolia and E. maculata were screened for their enzyme activity using agar plates containing substrates for specific target enzymes (amylase, cellobiohydrolase, protease, xylanase and ligninase). This process was replicated three times (Fig. 3.3) for each isolate at each incubation temperature (9ºC, 25ºC, 37ºC and 50ºC) and pH (3.5, 5.5, 7 and 9).

Figure 3.3: Screening of amylase activity using agar plates containing starch and visualised with iodine. Test was repeated three times under different temperature and pH conditions.

3.3.1.1 Detection of enzyme activity on solid media

The enzyme activities of the fungi were measured on the basis of halo development around the fungal colonies, representing degradation of the substrate that was included in the agar medium (Zaferanloo et al. 2013). Visualisation of a clear zone representing endoglucanase, such as xylanase, activity required staining with Congo Red (Fig. 3.4a). Congo Red is a secondary diazo dye derived from benzidine that forms complexes with cellulose and hemicellulose but does not bind once the polysaccharides have been hydrolysed (Teather and Wood 1982). Detection of enzymes able to degrade the glucose units joined by glycosidic bonds such as starch was carried out using agar plates containing 1 % (w/v) starch. The

92 iodine/starch complex produces an intense blue colour and clearing indicates starch degradation (Fig. 3.4b). Protease activity of the fungi was identified using skim milk powder as substrate in the agar plates. The halos representing enzyme activity around the fungal colonies were visible, but they were not clearly separate. Therefore, to increase the clarity of the zone of hydrolysis, tannic acid was used to flood the plates (Fig. 3.4c). The tannins form insoluble complexes with the unhydrolysed skim milk protein, sharply increasing the colour intensity and contrast to areas of protein hydrolysis (Saran et al. 2007). Visualisation of clear zones indicating ligninase, which is able to degrade the phenolic units of lignin, was carried out using agar plates containing 0.25 % (w/v) lignin. These were subsequently stained with ferric chloride (FeCl3) and potassium ferricyanide (K3[Fe(CN)6]) (Zaferanloo et al. 2013). The phenolic units of lignin formed complexes with the iron (III) ions and were detected by the formation of a Prussian Blue complex with the potassium ferricyanide reagent (Mole and Waterman 1994), which appeared green in the lignin-infused agar medium. Oxidation of the phenolic units prevented the formation of the Prussian Blue complex and resulted in the formation of yellow to light brown halos (Fig. 3.4d). Any enzyme able to degrade the phenolic units of lignin could be detected using this test, including lignin peroxidase, manganese peroxidase, laccase (enzymes able to degrade phenolic and non-phenolic lignin units) and mild oxidants such as GMC oxidoreductases (enzymes only capable of oxidation or modification of phenolic lignin units).

93

(a) (b)

(c) (d)

Figure 3.4: a) Endophyte EM-4 exhibiting xylanase activity on xylan agar plate (incubated at 25 °C for 5 days) after staining with Congo Red. b) Endophyte EL-15 exhibiting amylase activity on starch agar plate (incubated at 25 °C for 5 days) after staining with iodine. c) Endophyte EL-17 exhibiting protease activity on agar plate

supplemented with skim milk powder (incubated at 25 °C for 7 days). d) Endophyte EM-8 exhibiting ligninase activity on agar plate added with subsequently stained with ferric chloride (FeCl ) and potassium ferricyanide (K [Fe (CN) ]) (incubated at 25 °C 3 3 6 for 7 days). Note the clear zone or brown colour around the fungal colonies.

Screening for enzyme activity on media containing a specific substrate was observed by the clear zone around endophytic fungi and revealed amylase, protease, xylanase and ligninase activities among the total twenty six endophytic fungi isolated from E. longifolia and E. maculata (Fig. 3.4a- 3.4d). None of the isolates were able to degrade crystalline cellulose. Over two-thirds of the isolates from E. longifolia showed amylase activity at 25 °C. Around one-third exhibited protease activity. Maximum enzyme activity for amylase occurred at higher temperature and pH, however some isolates exhibited activity in lower pH and maximum protease activity was exhibited in lower temperature and higher pH. About one-third of isolates from E. maculata demonstrated xylanase and ligninase activities. Isolates including El-14 with the broadest ranges of amylase activity, El-17 with a wide range of protease activity in 94 different temperatures and highest activity in alkaline condition and EM-4 with highest xylanase activity specially at pH 7 might be a good prospects for further study and application to industry based on their optimised production. Many of isolates produced amylase and protease activity over a broad range of temperature and pH (Table 3.1).

Table 3.1 Number of fungal isolates from E. longifolia and maculate that produced halos on agar plates test containing substrate for each target enzyme. Incubation was 5-7 days depending on substrate, temperature and pH.

Number of isolates with enzyme activity

Target enzyme 9 °C 25 °C 37 °C 50 °C pH 3.5 pH 5.5 pH 7 pH 9

Amylase 5 10 8 12 6 10 7 4

Protease 3 6 5 2 0 6 11 5

Ligninase 0 2 2 2 0 2 2 2

Cellobiohydrolase 0 0 0 0 0 0 0 0

Xylanase 0 3 3 3 0 3 3 3

3.3.1.2 Relative Enzyme Activity (REA)

An index of relative activity was used to provide a broad measure of the enzyme production of the isolates as described in section 3.1.1 (Bradner et al. 1999). The effects of temperature and pH variations on the enzyme production of individual endophytes are presented in Fig. 3.5a and 3.5b. Protease production was dominant at the lower end of the temperature and higher end of the pH scale demonstrating the potential of these enzymes to be used in industrial applications (Fig. 3.5c and 3.5d).

95

30 pH 5.5 25 9⁰C 20 25⁰C

15 37⁰C 50⁰C 10

5 Relative Relative amylase activity

0

Endophytes

Figure 3.5: a) Effect of temperature on amylase activity of endophytes. Experiments were performed at pH 5.5. Error bars were included to indicate the standard deviations above and below the mean REA. Error bars indicate one standard deviation from the mean across three replicate plate assays at each condition. The absence of a column on the graphs indicates that no enzyme activity was observed, either due to lack of halo formation or lack of growth of the fungal isolate at the indicated temperature or pH.

30

Temp 25 °C 25 pH 3.5 20 pH 5.5 15 pH 7 pH 9 10

Relative Relative amylase activity 5

0

Endophytes

Figure 3.5: b) Effect of pH on amylase activity of endophytes. Experiments were performed at 25 °C. Error bars indicate one standard deviation from the mean across three replicate plate assays at each condition. The absence of a column on the graphs indicates that no enzyme activity was observed, either due to lack of halo formation or lack of growth of the fungal isolate at the indicated temperature or pH. 96

25 pH 5.5

20 9⁰C 25⁰C 15 37⁰C 50⁰C 10

5 Relative Relative proteaseactivity

0

Endophytes

Figure 3.5: c) Effect of temperature on protease activity of endophytes. Experiments were performed at pH 5.5. Error bars indicate one standard deviation from the mean across three replicate plate assays at each condition. The absence of a column on the graphs indicates that no enzyme activity was observed, either due to lack of halo formation or lack of growth of the fungal isolate at the indicated temperature or pH.

25 Temp 25 °C

20 pH 3.5 pH 5.5 15 pH 7 10 pH 9

5 Relative Relative proteaseactivity

0

Endophyes

Figure 3.5: d) Effect of pH on protease activity of endophytes. Experiments were performed at 25 °C. Error bars indicate one standard deviation from the mean across three replicate plate assays at each condition. The absence of a column on the graphs indicates that no enzyme activity was observed, either due to lack of halo formation or lack of growth of the fungal isolate at the indicated temperature or pH.

97

A broad range of enzyme activities was exhibited by most of the fungal isolates from E. longifolia, with at least 16 of the 26 isolates exhibiting amylase and protease activities. The results obtained from all 9 isolates from E. maculata are displayed in Fig. 3.6a - 3.6c. Xylanase and ligninase activity (ligninolytic phenoloxidase) was exhibited by three of the isolates. Therefore, the basic premise that endophytic fungi would be good secretors of enzymes particularly those involved in the degradation of the particular substrate that exist in the environment of the original host, was realised.

5 Lignin 4 Cellulose 3 Starch Xylan 2 Milk Mix 1 Relative Relative enzyme activity 0 EM-1 EM-2 EM-3 EM-4 EM-5 EM-6 EM-7 EM-8 EM-9 Endophytes

Figure 3.6: a) Effect of using different substrate agar plate and their relative enzyme activity of endophytes isolated from E. maculate. Experiments were performed at 25 °C and pH 5.5.

5

4

3

2 pH 5.5 pH 7.0 1 pH 9.0

Relative Relative ligninase activity 0 EM-1 EM-8 EM-1 EM-8 EM-1 EM-8 25°C 37°C 50°C Endophytics

Figure 3.6: b) Isolates that displayed positive results for ligninase activity were reinvestigated to observe the effect of different pH and temperature conditions on secretion of enzyme.

98

20

15

10 pH 5.5 pH 7.0 5 pH 9.0 Relative Relative xylanase activity

0 EM-1 EM-2 EM-4 EM-1 EM-2 EM-4 EM-1 EM-2 EM-4 25°C 37°C 50°C Endophytics

Figure 3.6: c) Isolates that displayed positive results for xylanase activity were reinvestigated to observe the effect of different pH and temperature conditions on secretion of enzyme.

The relative enzyme activities of four top-performing fungi isolated from E. longifolia and E. maculata are displayed in Table 3.2. These were selected as candidates for further study in the following chapters.

Table 3.2: summary of highest enzyme activities among endophytic fungi isolated from E. longifolia and E. maculata

Endophytes isolated from: Amylase Protease Ligninase Xylanase

++++ +++ - - E. longifolia EL-14 EL-17 + - ++ +++ E. maculata EM-2 EM-1 EM-4 + indicates halo < 5 mm around well ++ indicates halo 5-9 mm around well +++ indicates halo9-13 mm around well ++++ indicates halo>13 mm around well

99

3.3.2 Screening of fungi for antibacterial activity by disc diffusion assay

Fungal extracts (100 mg/mL) were tested against four different bacteria including Escherichia coli, Salmonella enterica serovar Typhimurium, Staphylococcus aureus and Bacillus cereus in order to determine those with antibacterial activities. Clear zones surrounding agar wells (Fig. 3.7a - 3.7b) indicated positive antibacterial activity of the respective endophytic fungi. The results of initial screening of all endophytic fungi (Table 3.3) showed that many have the ability to produce natural antibacterial compounds which may be the result of the interactions with the host plants in the context of protection against plant pathogens.

(a) (b) Control

Control

Figure 3.7: a) Disk diffusion assay of EL-17 against Bacillus cereus. b) Disk diffusion assay of EL-17 against Staphylococcus aureus (Betadine used as control)

100

Table 3.3: Summary of screening the antibacterial activity of endophytic fungi isolated from E. longifolia and E. maculata. Fungal extracts were tested at 100 mg /mLagainst four different bacteria. Extract Escherichia Bacillus Staphylococcus Salmonella Identification coli cereus aureus enterica EL-1 - - - - EL-2 - - - - EL-3 - - + - EL-4 - - ++++ - EL-5 - - - - EL-6 - - - - EL-7 - - - - EL-8 - - - - EL-9 - - - - EL-10 - - - - EL-11 - +++++ - - EL-12 - - - EL-13 - +++++ - - EL-14 - - - - EL-15 - ++++ +++ - EL-16 - ++++ +++ - EL-17 - ++++ +++ - EM-1 - - - - EM-2 - - - - EM-3 - ++ ++ - EM-4 - +++ +++ +++ EM-5 - - - - EM-6 - +++ + - EM-7 - ++ - - EM-8 - ++++ ++ - EM-9 - ++++ + - NA plates had approx. 150 µL of bacterial culture added via the pour plate method. + indicates halo < 2 mm around well ++ indicates halo 2-3 mm around well +++ indicates halo3-4 mm around well ++++ indicates halo4-5 mm around well +++++ indicates halo >4 mm around well 101

Only the isolates that returned positive results during antibacterial screening were used for determining MIC. The data obtained for MIC tests are summarised in Table 3.4.

Table 3.4: Summary of positive results with screening antibacterial properties Fungal isolate Genus Bacteria tested MIC (mg/mL)

EL-3 Stemphylium S. aureus >100 EL-4 Nigrospora S. aureus 0.49 EL-11 Leptosphaerulina B. cereus 0.0016 EL-13 Unclassified fungus B. cereus 0.00001 EL-15 Alternaria B. cereus 0.05 EL-15 Alternaria S. aureus 6.313 EL-16 Unclassified fungus B. cereus 0.14 EL-16 Unclassified fungus S. aureus 1.13 EL-17 Alternaria B. cereus 0.64 EL-17 Alternaria S. aureus 1.64 EM-3 Stemphylium B. cereus 64.3 EM-3 Stemphylium S. aureus 64.3 EM-4 Sporormiella B. cereus 4.5 EM-4 Sporormiella S. aureus 2.3 EM-4 Sporormiella S. enterica 2.3 EM-6 Alternaria B. cereus 2.4 EM-6 Alternaria S. aureus >100 EM-7 Alternaria B. cereus 46.5 EM-8 Alternaria B. cereus 0.5 EM-8 Alternaria S. aureus 32 EM-9 Alternaria B. cereus 0.44 EM-9 Alternaria S. aureus >100

The lowest concentration that inhibited bacterial growth in a well as decided by unaided visual inspection was reported as the MIC (Wiegand et al. 2008). Among all the fungal isolates, EL-13, EL-11, and EL-15 exhibited MIC values of <50 µg/ml

102 against B. cereus and can be considered for further study. Isolate EM-4 exhibited the broadest range of antibacterial action against three of the bacterial strains tested (B. cereus, S. aureus and S. enterica) and would be another interesting source to investigate further.

3.3.3 Drug sensitivity of cytotoxic endophytes

A total of 26 fungal isolates (17 isolates from E. longifolia and 9 isolates from E. maculata) were initially screened for cytotoxicity against two leukemic suspension cell lines: Precursor B 697 (PreB 697) cells and MOLT-4 T-lymphoblastoid cells (MOLT- 4). Of the 26 endophyte extracts, the samples displaying the greatest activity were selected for more detailed repeat experiments and further screening against adherent A549 lung cancer cell lines to assess cell line specificity. Samples from three Alternaria species, isolated from E. maculata (EM-6, EM-7 and EM-9) and one Preussia species from E. longifolia (EL-14) showed the most potent cytotoxic activity, as assessed by >70% cell death of cancer cells at the highest concentrations used and, therefore, were selected for further investigation. All the results related to this part of the study were generated by Dr Sally Coulthard and her team and are summarised below.

3.3.3.1 Drug sensitivity of cytotoxic endophytes

EM-6 (Fig. 3.8 A) produced growth inhibition in all three cell lines, with EC50 values of 46.0 μg/mL, 70.0 μg/mL, 162.0 μg/mL, for PreB, MOLT-4 and A549 respectively. EM-7 (Fig. 3.8 B) showed greater cytotoxicity and growth inhibition, with

EC50 values of 3.9 μg/mL PreB, 8.0 μg/mL MOLT-4, 29.7 A549 μg/mL. EM-9 (Fig. 3.8

C) displayed modest cytotoxicity with EC50 values of 44.6 μg/mL for PreB, 46.4 MOLT-4 and 156 μg/mL A549. Of the four endophyte extracts investigated in detail, EL-14 elicited the smallest cytotoxic effect but was further studied since the originating endophyte was not an Alternaria species. The EC50 values for EL-14 (Fig. 3.8 D) were as follows; 125.9 μg/mL for PreB and 575.0 μg/mL for Molt-4 however no EC50 value was reached for A549 cell line (Fig. 3.8).

103

Figure 3.8: Drug sensitivity curves of PreB 697, MOLT-4 T-lymphoblastoid and Lung cancer A549 cell lines with A) EM-7; B) EM-6; C) EM-9; D) EL-14. Error Bars represent the standard error of mean (SEM) of triplicate results from 3 separate experiments.

A 2-way analysis of variance (ANOVA), was utilized to illustrate that the cytotoxic effect of each endophyte was statistically different (p=<0.05) when acting on the same cell line, with further analysis of variance used to determine the difference in effect of a single endophyte sample on the three cell lines was again statistically significant (P=<0.05).

3.3.3.2 HPLC of cytotoxic endophyte agents

In an attempt to identify the metabolite components within the impure cytotoxic endophyte agents, high performance liquid chromatography (HPLC) with detection by UV at 254nm was utilised. The endophyte peaks were compared to the known endophytic metabolites Alternariol (AOH) and Alternariol methyl-ether (AME) used as standards with retention times of 11.2 and 13.9 minutes, respectively (Fig. 3.9). These two metabolites had already been shown to have cytotoxic potential against HT29 human colon adenocarcinoma, human vulva carcinoma A431 and human breast adenocarcinoma MCF-7 cancer cell lines (Fehr et al. 2009). 104

All Alternaria species of cytotoxic endophytes (EM-6, EM-7, EM-9) displayed peaks corresponding in retention time to both AOH and AME peaks in varying concentrations, however these peaks were not represented in the Preuissa minima species, EL-14 endophytic agent. EM-6 also contained 3 additional unidentified peaks of interest; one of these additional peaks was present in the EL-14 chromatogram but was not represented in either EM-7 or EM-9. The EM-6 unidentified peaks were represented by peak 7 (retention time 9.1 minutes), peak 8 (Retention time 10.75 minutes) and peak 11 (retention time 14.5 minutes) on the chromatogram. Peak 11 was also present in the EL-14 chromatogram with a similar retention time of 14.5 minutes.

A

B

C

D

Minutes

Figure 3.9: 4 UV-HPLC (200-600nm absorption range) analysis of endophyte samples, A) EM-6; B) EL-14 C) EM-7; D) EM-9 comparing peak formation against known metabolites Alternariol; retention time 11.2 minutes and Alternariol monomethyl ether; retention time 13.9minutes. Stars indicate peaks of interest for A) EM-6, EL-14 chromatogram.

105

To obtain evidence that the endophyte sample peaks with the same retention times as the two pure metabolites, were in fact Alternariol and Alternariol methyl-ether, the UV-visible absorbance spectra, obtained from the diode-array detector, of the AOH and AME standards (Fig. 3.10) were compared with spectra of the material eluted from the endophyte extracts at the same retention times. The UV-visible spectra of the peaks eluted from the endophyte extracts with retention times characteristic of AOH and AME, respectively, were very similar to those of the AOH and AME standards (Figures not shown). These data suggest that AOH and AME are present in the endophyte extracts EM-6, EM-7 and EM-9 due to the conservation of the both the Alternariol and Alternariol methyl-ether visible spectra within the extracts.

Figure 3.10: Chemical structure of Alternariol monomethly ether (AME) and Alternariol (AOH), both identified via HPLC in samples EM-6, EM-7 and EM-9. Alternariol and Alternariol monomethyl ether have been shown to act as an inhibitor of the topoisomerase enzyme, preferentially affecting the 11 α isoform (Fehr et al. 2008), thus disrupting DNA replication.

3.3.3.3 Drug sensitivity of identified metabolite standards

Drug sensitivity assays with the identified AOH and AME were carried out to compare the cytotoxic effects of the two identified metabolites with the cytotoxic effect of the impure endophyte extracts, using EC50 values as direct comparators. AOH and AME were tested on the same 3 cell lines used within the endophyte sensitivity assays: PreB 697, MOLT-4 and A549 cell lines (Fig. 3.11). AOH demonstrated potent cytotoxicity against all 3 cell lines, with EC50 values of 1.6 μg/mL for PreB, 0.86 μg/mL for MOLT-4 and 2.69 μg/mL for A549 cell lines. AME however, elicited a weaker

106 cytotoxic effect with EC50 values of 2.2 μg/mL, 9.8 μg/mL and 11 μg/mL for PreB, MOLT-5 and A549 cell lines respectively.

Figure 3.11: Drug sensitivity curves of PreB 697, MOLT-4 T-lymphoblastoid and Lung cancer A549 cell lines with A) Alternariol, B) Alternariol methyl-ether. Error Bars represent the standard error of mean (SEM) of triplicate results from 3 separate experiments. 2-way ANOVA comparing drug effect on different cell line demonstrated statistical significance < 0.0001 in AOH and 0.0009 in AME.

A 2-way analysis of variance was used to compare the cytotoxic effects of AME and AOH on the three cell lines. The analysis shows that AOH elicits a statistically significantly different cytotoxic effect (p=<0.05) when comparing MOLT-4 and A549 cell lines, as well as a statistically significantly different response between PreB and A549 cell lines. However the sensitivity of the MOLT-4 and PreB cell lines were not significantly different (P=>0.05.) On analysis of the cellular sensitivity in response to AME, all cell lines demonstrated a statistically significant (P= <0.05) different response to metabolite agent.

107

3.3.3.4 Comparison of drug sensitivity of pure metabolite against levels of the metabolites within endophyte agents

Since the HPLC data suggest that AOH and AME are present in the endophyte extracts EM-6, EM-7, and EM-9, the contribution of these compounds to the overall cytotoxicity of the extracts was assessed by re-plotting viability data for the MOLT4 cell line against the concentration of AOH and AME present in the EM-6, EM-7 and EM-9 extracts. For these cells, AME had approximately one-tenth of the activity of AOH, so AME concentrations were converted to ‘AOH-equivalents’ so that viability assay data could be plotted against the concentration of ‘AOH and AOH equivalents’ in the original extracts (Fig. 3.12). This analysis showed that the level of cytotoxicity of the EM-6 extract was greater than expected from the concentration of AOH and AOH- equivalents in the extract. The EC50 for the expected effect of AOH and AOH equivalents fell outside the 95% confidence range of the EM-6 extract. In contrast, the levels of cytotoxicity of the two other endophyte samples, EM-7 and EM-9 were similar to those expected from the measured concentrations of AOH and AOH-equivalents within these extracts and were within the 95% confidence interval for cytotoxicity of these extracts. These results therefore suggest that the majority of the cytotoxic effects produced in MOLT4 cells by the EM-7 and EM-9 endophyte extracts can be accounted for by the presence of AOH and AME within these extracts. For EM- 6, cytotoxicity can be only partially accounted for by the presence of AOH and AME and therefore there must be other compounds within the EM-6 extract that are cytotoxic to MOLT-4 cells.

108

Figure 3.12: Drug sensitivity curves comparing the level of sensitivity of the pure AOH metabolite with the sensitivity relative to the levels of AOH and ‘AOH equivalents (AME) (abscissa) within the impure endophyte agents: EM-6, EM-7 and EM-9 against MOLT-4 cells.

3.3.3.5 Fibroblast drug sensitivity

The sensitivity of normal primary foreskin fibroblasts to the endophyte extracts was assessed to determine whether cytotoxicity is specific to tumour cells (Fig. 3.13).

109

The endophyte concentrations used to treat the fibroblast cells were identical to that used in the drug sensitivity assays against the three cancer cell lines. EM-6 was the only endophytic agent to elicit a cytotoxic response, eliciting growth inhibition of >70% compared to the control vehicle, with an EC50 of 60.0 μg/mL. EM-7, EM-9 and EL-14 all failed to elicit significant cytotoxicity on the fibroblasts and therefore an EC50 growth inhibition value could not be estimated. To investigate further the resistance of foreskin fibroblast cells, drug sensitivity assays were carried out using the AOH and AME metabolite standards. AOH displayed a moderate level of cytotoxicity, with an EC50 value of 1.2 μg/mL. However AME failed to elicit a level of 50% viability within the fibroblast cells.

Figure 3.13: Drug sensitivity curves of Primary Foreskin Fibroblast normal cell line with A) EM-6, EM-7, EM-9; B) EL-15; C) AME; D) AOH. Error Bars represent the standard error of mean (SEM) of Duplicate results from 2 separate experiments.

3.4 Discussion

The sourcing of enzymes depends on criteria such as the availability of source, the cost of source material and the ease of recovery (Nirmal et al. 2011). Microbes are the preferred source of enzymes in industrial applications because of their rapid growth and low production cost compared to enzymes from plants and animals (Laxman et al. 2005). 110

In the current study, screening of enzyme production, antibacterial and anticancer activities from a collection of endophytic fungi isolated from the Australian native plants, E. longifolia and E. maculata, are described. These plants were selected as a source of endophytes as they have an established ethnobotanical history and are of great importance to the aboriginal people of Australia due to their medicinal properties (Richmond and Ghisalberti 1994).

3.4.1 Enzyme activity

Proteolytic enzymes used by the detergent, food and leather industries make up about 50 % of total enzyme sales, followed by carbohydrases such as amylases, cellulases and hemicellulases used in the food, pharmaceuticals, textile, detergent, pulp and paper and baking industries, for the manufacture of animal feed (McAuliffe et al. 2007) and the production of biofuels (Sivaramakrishnan et al. 2006; Yeoman et al. 2010). Furthermore, enzymes that are capable of breaking down complex carbohydrates such as xylan and lignin could have important consequences for bioremediation by aiding in the safe removal of oragnopollutants and environmental applications (Zhang et al. 2006, Peterson et al. 2009a). This information emphasizes the reason of choosing these five enzymes in this study. Enzyme activity was observed over a broad range of physical conditions which may be attributed to the host plants under investigation. The specific role of host- endophyte interactions is not well-defined and the presence of endophytes in Eremophila may well be mainly as a predatory defence mechanism of the plant (Strobel et al. 2004, Zhang et al. 2006). The name Eremophila means ‘desert loving’ and this genus is found throughout Australia, predominantly in arid conditions. Its adaptability and tolerance to climatic conditions may reflect the enzyme production of its endophytes which are able to perform at a wide range of pH and temperature conditions. Tolerance to variance in physical conditions may be seen as an adaptive measure to variable climatic conditions. The isolates showing activity over the widest physical conditions were chosen for further analysis using crude extracellular enzyme extracts (Peterson et al. 2011a). The enzyme characteristics that have been necessary for the survival of the endophytic fungi in their ecological niche can also be valuable to industry. For example, the manufacture of pulp, paper and textiles requires enzymes that

111 are active at a high temperature and high pH; dairy and other food production processes often require enzymes to function at a low temperature and low pH; enzymes for inclusion in detergents for washing in cold water need to be active at a low temperature and high pH (Lange 2004). Isolates EL-14 (P. minima), EL-15 (Alternaria sp.) and EL-13 (unclassified fungus) showed maximum amylase activity over the range of temperatures and pH (Fig. 3.5a and 3.5b). EL-14 was active across all temperatures and a broad range of pH, thus its enzymes have potential application in the confectionary industry and food or detergent industry where enzymatic breakdown of starch is required (Ghorbel et al. 2009, Asoodeh et al. 2010). EL-13 showed the highest relative amylase enzyme activity. Its preference for higher temperatures and slightly acidic pH make it useful in the baking industry (Hmidet et al. 2009). EL-15 showed amylase production at the extremes of the temperature range. This was an interesting observation and suggests that these enzymes could be exploited in the textile and detergent industries (Ghorbel et al. 2009, Hmidet et al. 2009) where enzymes are needed for catalytic action on stains at high and low temperatures, respectively. Proteases represent one of the three largest groups of industrial enzymes employed as detergents, in leather, food and pharmaceutical industries and in bioremediation processes (Najafi et al. 2005). Endophytes EL-3 (Stemphylium sp.), EL- 7 (unclassified fungus), EL- 8 (Phoma herbarum), EL-9 (Phoma sp.) and EL-17 (Alternaria alternata) demonstrated highest protease production, tolerance to temperature and pH fluctuations and were the most promising of the fungi assayed (Fig. 3.5c and 3.5d). In the production of protease from microbes, the secretory fungal proteases are favoured compared with those from bacteria as cell removal is less complicated during downstream processing (Shankar et al. 2011, Nirmal et al. 2011). In addition, they offer many advantages due to their activity over a wide range of pH and broad substrate specificity (Rani et al. 2012) and can be used in different industrial applications such as the leather industry (Dayanandan et al. 2003, Devi et al. 2008, Murthy and Naidu 2010), cheese-making (Fazouane-Naimi et al. 2010, e Silva et al. 2011) and milk-clotting (Benlounissi et al. 2012, Fazouane-Naimi et al. 2010). In addition, fungi exhibit a wider variety of proteases than bacteria. Furthermore, fungi are normally GRAS (generally regarded as safe) and they produce extracellular enzymes, which are easier to recover from fermentation broths (Wu et al. 2006). Much

112 importance is given to fungal enzymes in agriculture, industry and human health because of their stability at high temperature and extreme pH compared to the enzymes derived from plants and animals (Maria et al. 2005). However, the application of fungal proteases is not extensive compared with bacterial proteases due to their low reaction rate and heat tolerance (Rani et al. 2012, Nirmal et al. 2011). Therefore, further studies to exploit the new fungi as well as their characteristics need to be carried out. Many industries produce lignocellulosic wastes in vast quantities, including pulp and paper, agriculture and forestry. Municipal solid waste and animal waste are also contributing factors. However, much of the lignocellulosic waste can potentially be converted into useful commodities, particularly biofuels (Dashtban et al. 2009). Treatment of this waste commonly employs a combination of chemical and electrical energy, which generates toxic wastewater and other associated environmental pollutants (Singh et al. 2010, Chen et al. 2013). It is suggested that many of these problems could be abated by utilising microorganisms that are capable of degrading or partially degrading much of this lignocellulosic waste (Dashtban et al. 2009). Depending on the specific conditions employed by that industry, enzymes that are naturally active under those conditions would be favourable to those enzymes that are not. For example, in the case of degrading lignocellulosic waste in the pulping industry, enzymes that are active at higher temperatures and alkaline conditions would be preferred (Peterson et al. 2011a). Although there are already examples of fungi and their enzymes being used in the pulping industry, there is a need to identify further sources of these enzymes that may provide increased suitability to industry conditions (Singh et al. 2010). Ligninases and xylanases are particularly useful in the pretreatment of wood chips; ligninases degrade the lignin component of wood, while xylanases are useful in breaking down hemicelluloses, thus increasing the accessibility of the cellulose components of waste materials. In the pulping industry, this is termed ‘biopulping’ and has the advantages of reducing the amount of effluent toxicity produced by traditional treatment methods (Singh et al. 2010). Many fungi secrete extracellular versions of these enzymes, which make them promising candidates in the pretreatment of lignocellulosic waste. Therefore, Identifying fungi which exhibit high levels of activity for these enzymes maybe of interest to many industries; thermophilic enzymes may further be well-suited to the conditions experienced under industrial processes (Dashtban et al. 2009, Ko et al. 2011).

113

The preliminary screening for active enzymes on a range of substrate plates did not yield positive results for all isolates among the endophytic fungi samples isolated from E. maculata. However, the production of xylanases and ligninases was notable for several isolates (Fig. 3.6a). Since xylanase and ligninase have important uses in bioremediation and bioconversion of waste products in industry, it was decided to further study those isolates exhibiting activity for these enzymes under different pH and temperature conditions. Notably, EM-1 and EM-4, identified as Phoma and Sporormiella sp, displayed enzyme activity under variable conditions (Fig. 3.6b and 3.6b). Interestingly, the Phoma sp isolate (EM-1) exhibited both xylanase and ligninase activity, which was observed at higher pH and at a range of temperatures. The Preussia (Sporormiella sp) isolate exhibited only xylanase activity, but also showed some versatility, secreting active enzyme at the lower pH range and at higher temperatures. Both isolates display potential enzymatic properties for use in various industries. The stability of xylanase at higher temperatures has promising applications in bleaching pretreament in the pulp industry, termed biobleaching (Ko et al. 2011). It is further suggested that the use of thermophilic fungal species may reduce energy costs in other industries dealing with lignocellulosic waste (Dashtban et al. 2009). However, the lower temperatures favoured by EM-1 (Phoma sp) may have applications for in situ bioremediation of soil and waterways or in detergents where lower temperatures are more commonly desired or experienced (Peterson et al. 2009a). However, screening for enzyme activity performed in this chapter provided a crude analysis only. It would be advisable to further investigate all isolates on the various substrate plates under a range of pH and temperature conditions to determine the optimum conditions for each of these selected endophytic fungi with higher enzyme activity. It is possible that the enzyme activity for some isolates was not observed due to unfavourable incubation conditions. Similarly, those isolates displaying positive results could be further examined over a broader pH and temperature range with different sources of carbon and nitrogen to determine more accurately the optimised conditions favoured for each isolate to secrete active enzyme (Peterson et al. 2011a). The method used to give a numerical value of relative enzyme activity (Peterson et al. 2009a) provided an approximate estimate of activity only. For those isolates exhibiting positive results, further investigations such as using liquid cultures, enzyme

114 characterisation by enzyme assays and zymogram gels is warranted (Peterson et al. 2011a). A limitation of using substrate agar plates in order to determine enzyme activity is that it does not take into account the size of the fungal colony in relation to the amount of enzyme activity displayed. Therefore, fungal species that grow faster or more prolifically could be considered to have higher enzyme activity simply due to the higher secretion capacity that arises from the greater number of hyphae, not necessarily due to the specific activity of the enzyme itself. This is particularly an issue when comparing the enzyme activities of different species of fungi with different growth patterns, as was attempted in the work described here. Enzymes from endophytes of E. longifolia and E. maculata were active over a range of pH and temperature conditions, a property that may exploited in commercial applications. Thermostable amylase and protease have already been reported from endophytes inhabiting other plant sources (Stamford et al. 2001, Schulz et al. 2002) and Eremophila is seen as a new promising candidate for this area of study. The production of extracellular enzymes is a fundamental aspect of fungal biology as enzymes are needed to obtain nutrients, colonise plant tissues and survive in plant-microbe relationships. Several enzymes produced by soil fungi (proteases, lipases, amylases, cellulases, b-1,6glucanase rhamnogalcturonanlyase, laccase, xylanase, and mannanase) have been employed in various industries. These enzymes are also produced by endophytic fungi and have biochemical properties adapted to the fungi’s natural environment, thus distinguishing them from those produced by soil fungi (Borges et al. 2009). Therefore, research in endophytes may lead to the identification of enzymes with novel or improved biotechnological applications. In particular, efforts to establish the optimal conditions for enzyme production by endophytic fungi have gained momentum in the last decade (Borges et al. 2009). Endophytic fungi have a great metabolic flexibility that facilitates their natural survival and also makes them attractive organisms for the production of particular enzymes of interest. The search for new enzymes with natural characteristics that suit industrial processes is an ongoing area of research besides the optimization of their fermentation to increase productivity and provide for developing technologies. Large biotechnology companies often rely on universities and small companies to provide leads based on environmental screening projects (Laird et al. 2006). Since fungi do not naturally produce enzymes at levels high enough for commercial purposes, fermentation improvement programs are undertaken to increase

115 the secretion of target enzymes to levels that are economically sustainable. Consequently, environmental screening programs are used to seek enzymes from various environments, with the view to express these enzymes in highly secreting production hosts (Teter and Cherry 2005). In summary, preliminary investigation of a collection of endophytic fungi isolated from Australian native plants indicates that they are promising sources of enzymes (Table 3.2) that may have applications in a wide range of industries. However, further study including purification and optimization of enzyme production needs to be performed to assess their suitability in the industrial environment. In addition, scale-up experiments will need to be carried out to establish whether the fungi will be suitable for industrial scale production of enzymes.

3.4.2 Antibacterial activity

Although bacteria and fungi have provided chemicals and compounds important in the manufacture of drugs and medicines (Suryanarayanan et al. 2009), limited knowledge currently exists regarding the potential medicinal value of Australian endophytic fungal species (Mapperson et al. 2014). For this reason, a focused approach for host selection is preferred and the enthanomedicial approach for host selection is a great starting point. Various civilizations throughout the world have used, and continue to use, plants and their extracts to treat medical conditions (Demain and Sanchez 2009). Eremophilia has been used in the form of a medicinal paste to treat cold and bruises by the Australian aboriginal community (Clarke 1988). The potential association of its endophytes with the medicinal effects of the plants is an interesting field of study. Similar successful research has been performed and a novel wide-spectrum antibiotic, designated as Munumbicin, was discovered from the endophytes of Kennedia nigriscans which is also used as a medicinal plant by the Australian aborigines (Castillo et al. 2002). The success of Munumbicin provides encouragement for the research performed in this study. It is unsurprising, therefore, that endophytic fungi are being examined for potential novel and bioactive compounds. Indeed, it is estimated that fungal endophytes may actually be metabolically more active than their soil counterparts, precisely because the endophytes must produce a range of defences to protect themselves in planta (Suryanarayanan et al. 2009).

116

Endophytic fungi have already been identified as producing a vast array of natural bioactive compounds, including anti-oxidants, anti-inflammatory agents, insulin receptor activators, with further studies screening for antibiotics and anti-cancer chemicals (Suryanarayanan et al. 2009). Notably, the fungal isolates investigated in this study have only been evaluated for antibacterial properties on four bacterial species; the range of action should thus be extended to other clinically important bacterial species. Some of these isolates including EL-15, EL-16, EL-17, EM-4 and particularly EL-4 showed promising activities against S. aureus (Table 3.3), and it would be interesting and of clinical importance to investigate these isolates were active against various strains of drug- resistant S. aureus (Arivudainambi et al. 2011). In addition, the inhibition of B. cereus by some isolates may be of interest to the food industry (Lawrence and Palombo 2009) as these fungi may have active ingredients that can be potentially used as anti- sporulating agents (Table 3.3 and Table 3.4). Furthermore, the bioactive ingredients of these fungi which confer the antibacterial properties should be identified and characterised since these may have additional medical or pharmaceutically important features (Strobel and Daisy 2003). Interestingly, EM-4 (Preussia) seemed to exhibit a broader range of antibacterial action, inhibiting growth of both gram-negative and gram- positive bacteria, it would be a good candidate for the further study of antimicrobial activity. Determination of the MIC would help understand the minimum concentration required to show an antibacterial effect and would help in conservation of product and also avoid non-target specific toxicity (Andrews 2001). It would also give an opportunity to understand its comparative commercial potential and viability as a product as compared to standard antibacterial agents. In summary, 13 endophytic fungi revealed antibacterial activity against various bacteria. Separation and identification of the active compound demonstrating the antibacterial activity would be a future avenue of research utilising techniques such as Thin Layer Chromatography (TLC), bio- autography and column chromatography (Yu et al. 2010c). The results of this work described in this chapter and related to enzyme activity, were used to select fungal isolates for further enzyme optimization (Chapter 4) and characterisation in liquid cultures (Chapter 5). Overall, 26 endophytic fungi belonging to a range of different species were screened for enzyme and antibacterial and

117 anticancer activities. EL-14, EL-17 and EM-4 seem to be potential sources of different type of enzymes including amylase, protease and xylanase, respectively, which are in high demand in industrial and environmental applications, so more study is needed to determine the optimal conditions and suitable applications. This will be described in Chapter 4. EL-4 showed promising activities against S. aureus and it would be of clinical importance to investigate activity against various strains of drug-resistant S. aureus. EL-11 and EL-13 may be of interest to the food industry because of their highest antibacterial activities against B. cereus which is a spore-forming food poisoning species.

3.4.3 Anticancer activity

Work by collaborators showed that EM-6, EM-7, EM-9 and EL-14 demonstrated varying levels of toxicity on a range of different cancer cell lines. The development of the experimental rationale allowed progression of research and provided promising results towards the application of endophytes to anti-cancer therapies. However, a few unanswered questions are crucial to the progression and identification of compounds produced by the most cytotoxic endophyte, EM-6. The presence of unidentified peaks within the chromatogram teamed with the fact the agent contained the lowest concentration levels of the two previously identified metabolites, Alternariol and Alternariol mono-methyl ether, suggest that another metabolite is contributing to the increased cytotoxicity and therefore identification of these peaks is necessary.

118

Chapter 4

Optimization of the fermentation of three selected enzymes and scale-up production of amylase using a bioreactor system

4.1 Introduction: Enzyme secretion by endophytic fungi

Industrial enzymes are commonly sourced from microorganisms, including bacteria and fungi, and microbial enzymes which are produced by fermentation of microorganisms presently account for approximately 90% of all enzymes used in industry. In addition, at least 75% of all industrial enzymes have hydrolytic activity, being used for the degradation of different natural substances (Godfrey and west 1996, Souza and Magalhäes 2010). Hydrolytic enzymes are one of the most important groups of enzymes in an industrial setting and they are attractive in comparison to chemical catalysts due to their low environmental impact, high substrate specificity and their worldwide sales per year. In 2000, the global market for industrial enzymes was estimated at $2 billion and continues to increase by 5-10% annually (Nevalainen and Te’o 2003). In response to this demand, environmental screening is used to seek new enzymes to introduce to large-scale fermentation processes at an industrial level. One rationale for screening fungal endophytes as a potential source of these enzymes relates to the hypothesised mutualistic relationship between the endophyte and its host plant (Schulz et al. 2002, Sunitha et al. 2013). Thus, identifying plants that inhabit unique and harsh environments may give refuge to endophytes that have evolved strategies to cope with these conditions. Of importance to industry, these fungal endophytes may produce extracellular enzymes that are heat stable and retain activity under high or low pH conditions (Beg et al. 2001). Eremophila longifolia and E.

119 maculata are endemic to Australia, and are well adapted for the harsh, dry climate of the Australian desert. Conversely, the plants may also survive in mild frost conditions. Together with this unusual adapted physiology and their strong ethnobotanical use by native Australians, these plants become prime candidates for isolating endophytic fungi and screening their hydrolytic enzymes activities in this study.

4.1.1 Amylase

Amylases account for 30% of world enzyme production and are important industrial enzymes which are able to degrade starch by catalyzing the hydrolysis of glycosidic bonds between amylose and amylopectin moieties of the polysaccharide (Singh et al. 2011, Pengthamkeerati et al. 2012). Enzymatic hydrolysis offers many advantages for industrial production such as greater control and high specificity of reaction, better stability of generated products, lower energy requirements and the elimination of neutralization steps (Singh et al. 2011). These advantages, together with improved yields and favorable economics, make them available for a wide range of applications.

There are three main types of amylase including α-amylase, β-amylase and γ- amylase (Fig 4.1). The α-amylases are calcium metalloenzymes which are only active in the presence of calcium. They degrade long-chain carbohydrates at random sites along the starch chain to produce final products including maltotriose and maltose from amylose, or maltose, glucose and "limit dextrin" from amylopectin. β-amylases only degrade the second α-1,4 glycosidic bonds of starch from the non-reducing end to form two maltoses at a time. β-amylases are not present in animal tissues. γ-amylases act at α(1-6) glycosidic bond and also cut the last α(1-4) glycosidic bond at the non- reducing end of amylose and amylopectin to form glucose. It cleaves effectively in acidic environments and has an optimum pH of 3 (Singh et al. 2011). Amylase can be obtained from microorganisms by submerged fermentation (SmF) and solid state fermentation (SSF) (Singh et al. 2011, Pengthamkeerati et al. 2012). SmF has advantages, such as the ease of sterilization and process control, but SSF offers some benefits compared with SmF such as higher yields in a shorter incubation period, better oxygen circulation, resemblance to natural habitats for filamentous fungi, high volumetric productivity, relatively higher concentration of products, less effluent 120 generation, requirement for simple fermentation equipment, less effects in downstream processing and low energy consumption (Nigam and Singh 1995, Pandey et al. 2000a, Pandey et al. 2000b, Singh et al. 2011).

CH2OH CH2OH O O

O O O OH OH OH CH2OH CH2OH CH2 CH2OH

O O O O

O O O O O OH OH OH OH OH OH OH OH -Amylase n CH2OH CH2OH

O O

O O O OH OH OH CH OH 2 CH2OH CH2OH x CH2

O O O O O

O O O O OH OH OH OH OH OH OH OH OH OH OH Amyloglucosidase -Amylase n -Glucosidase

CH2OH CH2OH O O

O O O OH OH OH CH2OH x CH2 CH2OH Isoamylase O O O

OH HO O O O OH OH OH OH OH OH CH2 n Amyloglucosidase & O O -Glucosidase (terminal (1-6) residues) OH O O OH OH OH OH n

Amylopectin and Glycogen

Figure 4.1: Three main types of amylase (Was taken from Singh et al. 2011)

Amylase can be collected from plants, animals and microorganisms. However, amylase production from microorganisms has advantages such as the economical bulk

121 production capacity and the ease of manipulation to obtain enzymes of desired characteristics (Singh et al. 2011). However, the industrial application of amylase is limited because of extreme conditions, especially with respect to pH and temperature.

4.1.1.1 The applications of amylase

Amylase offer many potential applications for commercial production in the food, textiles, paper industries (Fogarty and Kelly 1979), bread making (Cheetham 1980), glucose and fructose syrups, detergents, fuel ethanol from starches (UpaDek and Kottwitz 1997), fruit juices (Wiseman 1980), alcoholic beverages (Macleod 1979), sweeteners (Peppler and Periman 1978), digestive aids and spot removers for dry cleaning (Peppler and Periman 1978). In addition, the α-amylases from bacteria can also be used in some other areas such as clinical and analytical chemistry (Pandey et al. 2000b, Arican 2008). All of these diverse applications and their suitable standard fungi are listed in Table 4.1.

Table 4.1: Uses of Amylase in various sectors of industry (modified from Kirk et al. 2002, Satynanarayana et al. 2006, Sivaramakrishnan et al. 2006). Amylase in industry Application Standard fungal sources Beverage industry Starch removal from pectin Humicola grisea

Detergent industry remove starch stain Mucor rouxianus

Paper industry Reduction of viscosity of starch/ Starch Penicillium oxalicum coating Pharmaceutical Used as a digestive aid Aspergillus oryzae industry Textile industry Warp sizing of textile fibres Thermomyces lanuginosus

4.1.1.2 Optimum conditions of amylases used in industry

In the production of enzyme from microbes, the secretory fungal enzymes are favoured compared with those from bacteria as cell removal is less complicated during downstream processing (Nirmal et al. 2011). 122

Physical and chemical parameters for each fermentation process must be optimized with regards to the feasibility of the process as well as any economic impacts (Francis et al. 2003, Souza and Magalhães 2010). Specifically for α-amylase production, the effects of various factors, including composition of the growth medium, pH, temperature, metal ions, and carbon and nitrogen sources have been explored in order to match a specific property such as thermostability, pH profile, pH stability, or Ca- independency to a particular application. For example, α-amylases used in the starch industry must both be active and stable at a low pH, whereas in the in detergent industry, high pH values are required (Sajedi et al. 2005, Couto and Sanromán 2006). The physical and chemical properties of α-amylases from bacteria and fungi shown in Table 4.2a and 4.2b (Gupta et al. 2003, Souza and Magalhães 2010) indicate unexplored, alkaline microbial amylase with optimal lower temperature that can be utilized in the detergent industry, further strengthening our research involving amylase isolated from the endophytic fungus, Preussia. minima. Preussia contains seven different species (P.mediterranea, P. australis, P. africana, P. isabellae, P. similis, P. minima and P. intermedia); they have similar morphology (Arenal et al. 2007) and so far are not reported as sources of enzymes. Recently, Mapperson et al. (2014) described that limited knowledge exists regarding species diversity and antimicrobial activity of endophytic isolates of Preussia within Australia. They reported endophytic Preussia species that were identified through molecular analysis of the internal transcribed spacer region and their antibacterial activities. The current work is of particular significance because it represents the first time, to our knowledge, that the Preussia species has been explored for their amylase (EL-14) and xylanase (EM-4) activites. These fungi were isolated from two different species, E. longifolia and E. maculata (Chapter 2). EL-14 (P. minima) was selected for the secretome study and proteomic analysis (Chapter 5) because a broad range of amylase activities were displayed by the isolate in the agar plate assays (Chapter 3), liquid assays and zymograms (this chapter and Chapter 5).

123

Table 4.2a: Properties of bacterial α-amylases (Souza and Magalhães 2010) Microorganism Fermentation pH Temperature Molecular optimal/ optimal/ weight stability stability (kDa) Bacillus amyloliquefaciens SmF 7.0 33 °C - Chromohalobacter sp. TVSP 101 SSF 7.0 - 9.0 65 °C 72 Caldimonas taiwanensis sp. nov. 7.0 55 °C - Halobacillus sp MA-2 SmF 7.5 - 8.5 50 °C - Haloarcula hispânica 6.5 50 °C 43.3 Bacillus sp. PS-7 SSF 6.5 60 °C 71 Bacillus subtilis SSF 7.0 37 °C - Bacillus subtilis DM-03 SSF 6.0–10.0 50 °C - Bacillus subtilis KCC103 SmF 6.5 37 °C - Bacillus sp. KCA102 71 57.5 °C - Bacillus sp. AS-1 SSF 6.5 50 °C - Bacillus caldolyticus DSM405 SmF 5.0-6.0 70 °C - Bacillus sp. Ferdowsicous 4.5 70 °C 53 Halomonas meridiana SmF 7.0 37 °C - Rhodothermus marinus SmF 6.5 - 7 85 °C - Bacillus sp. KR-8104 4.0 - 6.0 70-75 °C 59 Bacillus licheniformis GCBU-8 SmF 7.5 40 °C - Halobacillus sp MA-2 SmF 7.5 - 8.5 50 °C - Bacillus sp. I-3 SmF 7.0 70 °C - Bacillus sp. PN5 SmF 10 60 °C - Bacillus subtilis SSF 7.0 37 °C - Bacillus subtilis JS-2004 SmF 7.0 50 °C - Bacillus sp. IMD 435. SmF 6.0 65 °C - Bacillus subtilis SmF 7.0 135 °C - Halomonas meridiana SmF 7.0 37 °C - Bacillus dipsosauri DD1 6.1 60 °C 80

124

Table 4.2b: Properties of fungal α-amylases (Souza and Magalhães 2010) Microorganism Fermentation pH Temperature Molecular optimal/ optimal/ weight stability stability (kDa) Nocardiopsis sp. 5.0 70 °C - Geobacillus thermoleovorans 7.0 70 °C - Lactobacillus fermentum Ogi E1 5.0 30 °C Lactobacillus manihotivorans LMG SmF 5.5 55 °C 135 18010T Thermomyces lanuginosus ATCC SSF 6.0 50 °C - 58160 Thermomyces lanuginosus ATCC 6.0 50 °C - 200065 Aspergillus niger SSF 5.5 70 °C - Aspergillus sp. AS-2 SSF 6.0 50 °C - Aspergillus niger UO-1 SmF 4.95 50 °C - Aspergillus niger ATCC 16404 SmF 5.0 / 6.0 30 °C - Aspergillus oryzae 5.0 –9.0 25-35 °C - Aspergillus oryzae CBS570.64 SSF 7.0 35 °C - Aspergillus oryzae NRRL 6270 SSF 30 °C - Aspergillus oryzae CBS 125-59 SSF 6.0 30 °C - Aspergillus fumigatus SmF 6.0 30 °C - Aspergillus kawachii 3.0 30 °C 108 Cryptococcus flavus 5.5 50 °C 75 Penicillium fellutanum SmF 6.5 30 °C - Pycnoporus sanguineus SmF 7.0 37 °C - Pycnoporus sanguineus SSF 5.0 37 °C - Mucor sp. 5.0 60 °C - Saccharomyces kluyveri YKM5 5.0 30 °C -

125

4.1.2 Protease

Proteases are one the major enzymes utilised widely as detergents, in the leather, food and pharmaceutical industries and for bioremediation processes (Najafi et al. 2005). Indeed, proteases make up 60-65% of the world-wide enzyme market which signifies their importance to industry (Saran et al. 2007). They play important roles in the metabolism of organisms and can be collected from plants, e.g. papain extracted from papaya (Carica papaya, Caricaceae) (Konno et al. 2004, Rani et al. 2012), from animals, e.g. chymotrypsin extracted from pancreatic extract (Rocha et al. 2012, Rani et al. 2012) and from microbes, e.g. protease extracted from Fusarium sp. BLB (Ueda et al. 2007). Microorganisms represent an excellent source of intracellular and/or extracellular proteases (Gupta et al. 2002). Physiologically, extracellular proteases act as a catalyst in the hydrolysis of large proteins into smaller molecules for later absorption by the cell whilst intracellular proteases are important in regulating metabolism (Rao et al. 1998). Proteases can be categorized in the different ways. For example, on the basis of their capability to hydrolyze specific proteins (keratinase, elastase, collagenase, etc.), on the base of the pH range over which they are active (acid, neutral, or alkaline), or on the basis of their resemblance to well-characterized proteases such as pepsin, trypsin, chymotrypsin, or the mammalian cathepsins. The most standard classification scheme is based on the catalytic mechanism (North, 1982). Proteases are now classified into six broad groups including (Fig 4.2) serine proteases, threonine proteases, cysteine proteases, aspartate proteases glutamic proteases and metalloproteases (Rao et al. 1998, Barrett et al. 2003). According to the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology, proteases can be categorized based on the requirement of critical amino acids for the catalytic function (e.g., serine protease) or the optimal pH for their activity (acidic, neutral, or alkaline protease) or the cleavage site (e.g., aminopeptidases, which cleave at the free N terminus of the polypeptide chain, or carboxypeptidases, which cleave at the C terminus of the polypeptide chain). Generally, proteases are produced by SSF and, SmF. In SSF, different substrates are used to solidify the medium, like wheat bran (Soares et al. 2010), rice bran (Sumantha et al. 2006), soybean cake (Rajmalwar and Dabholkar 2009), or combination of substrates like sunflower meal and wheat bran (Haq and Mukhtar 2004). In SmF, microorganism grows in liquid media supplemented with protein rich sources like 126 soybean meal (Mirzaei and Mirzaei 2010) and wheat bran (Soares et al. 2010). It is clear that the media play an important role in designing the experiments for specific research. The media can be optimal for microbial growth but may not be optimal for the production of secondary metabolites of interest.

Figure 4.2: Five main types of protease (Was taken from Turk 2006)

127

4.1.2.1 The applications of proteases

Fungal proteases have a wide range of pH (pH 4 to 11) and substrate specificity (Nirmal et al. 2011); hence, they offer many potential applications for a wide range of industries. For example, fungal alkaline proteases can be used to recover silver from waste X-rays films (Prema and Vandana 2012) and potentially be applied in the leather industry (Dayanandan et al. 2003, Kalpana Devi et al. 2008, Murthy and Naidu 2010). In addition, the fungal acid proteases with narrow pH and specificity of temperature are playing important roles in cheesmaking (e Silva et al. 2011, Fazouane-Naimi et al. 2010) and in milk-clotting (Benlounissi et al. 2012, Fazouane-Naimi et al. 2010). Fungal neutral proteases with high peptidase activity have replaced other sources (plant, animal, and bacteria) and provide an important group of enzymes, widely used in food, beverage and pharmaceutical industries (e Silva et al. 2011). In addition, fungi exhibit a wider variety of proteases than bacteria, they offer many advantages due to their activity over a wide range of pH and broad substrate specificity (Rani et al. 2012). Furthermore, fungi are normally GRAS (generally regarded as safe) strains and they produce extracellular enzymes, which are easier to recover from fermentation broths (Wu et al. 2006). However, the application of fungal proteases (Table 4.3) is not great compared with bacterial proteases due to their low reaction rate (Rani et al. 2012, Nirmal et al. 2011). Therefore, further studies to characterize new fungal sources of proteases need to be carried out.

Table 4.3 Uses of fungal proteases in various sectors of industry (Barata et al. 2002, Dayanandan et al. 2003, Nouani et al. 2011). Protease in industry Application Standard fungal sources Baking industry Biscuits, cookies Aspergillus sp

Dairy industry Milk clotting, infant formulas Mucor sp

Detergent industry Protein stain removal Fusarium oxysporum

Leather industry Unhairing, bating Rhizopus sp

Paper industry Biofilm removal Tritirachium album

128

4.1.2.2 Proteases extracted from endophytic fungus, Alternaria alternata

The choice of enzyme sources depends on criteria such as the availability of source, the cost of source material and the ease of recovery (Nirmal et al. 2011). For example, producing proteases from plants requires the cultivation of substantial land, suitable climates for plant growth and additional processing time. With the production of animal proteases, policies involving the use of experimental animals must be followed (Rani et al. 2012). Thus, microbial proteases offer many advantages such as a readily available source and lower production costs. With respect to microbial proteases, the secretory fungal proteases are preferred compared with those from bacteria because of simple methods (e.g. filtration) to remove the mycelium from the culture media (Nirmal et al. 2011) and a wide range of pH and substrate specificity (Rani et al. 2012). In addition, according to Dunaevskii et al. (2006), fungal proteases play important roles in the survival of fungi because they can metabolize the macromolecules in the media into nutritional substrates which support fungal growth. The purification of proteases and the identification of their properties from the filamntous fungus, A. alternata, had been carried out previously (Patil and Shastri 1985, Dunaevsky et al. 1996, More et al. 2009). These results showed that the Alternaria alternata produced different types of proteases (e.g. alkaline protease, acid protease) when cultured on different media (e.g. solid media or submerged fermentation). Patil and Shastri (1985) isolated one neutral and two alkaline proteases from Alternaria alternata cultured on wheat bran Czapek Dox medium and Dunaevsky et al. (1996) used affinity chromatography combined with gel filtration to purify the extracellular protease Alternaria alternata and concluded that it was a serine protease. More et al. (2009) reported that Alternaria alternata in submerged culture used different substrates and produced different quantities of protease. Using soybean seed powder as the carbon source gave the highest quantity of protease. In addition, the roles of inducing agents (e.g. fructose), various metal ions and inhibitors on the stability at higher temperatures and in alkaline pH have been assessed. For example, Patil and Shastri (1985) reported that fructose has a positive effect to the production of protease from Alternaria alternata and also affected to the characteristics of neutral and alkaline protease extracted from Alternaria alternata. The specific activity of proteases significantly increased from 119.2 U/mg to 545 U/mg in the absence and presence of fructose, respectively (Patil and Shastri 1985). 129

4.1.3 Xylanase

Xylanases occupy about $200 million of the world-wide enzyme market because they are considered as important group of carbohydrolases (Katapodis et al. 2007). Enzymes that have the ability to break down complex carbohydrates such as xylan (Fig 4.3) and lignin have great potential for bioremediation by assisting in the safe disposal of organo-pollutants (Polizeli et al. 2005, Zhang et al. 2006, Peterson et al. 2009a). Furthermore, the lignocellulosic wastes derived from agricultural practices and industrial processes offer potentially biodegradable material that can be converted into valuable products such as biofuels, chemicals and cheap energy sources for fermentation (Dashtban et al. 2009, Sakthiselvan et al. 2012). Xylanases are induced by pure xylan in Aspergillus ochraceus (Biswas et al. 1990), Trichoderma viridae (Gomes et al. 1992), Rhizomucor pusillus (Hoq and Deckwer 1995) and also produced with cellulose by rotium rolfsii (Haltrich et al. 1994). Xylans are known as major components of hemicelluloses because they contribute to approximately 20-35% of the dry weight of plant cell walls. Xylans are degraded by xylanases which have great industrial potential because of their application in food processing and paper manufacture. Additionally, xylanases are employed to enhance the nutrient value of animal diets (Soliman et al. 2012) by supplementing feed to increase the effective digestibility of crude fat, crude protein, crude fibre and organic matter, and improve the adsorption of energy (Xu et al. 2008b).

Figure 4.3: Structure of xylan and the sites of its attack by xylanolytic enzymes. The backbone of the substrate is composed of 1, 4- β-linked xylose residues. Ac., Acetyl group; α-araf., α- arabinofuranose; α-4-O-Me-GlcUA, α-4-O-methylglucuronic acid; pcou., p-coumaric acid; fer., ferulic acid. (b) Hydrolysis of xylo-oligosaccharide by β-xylosidase (Adopted from Goldman 2009). 130

4.1.3.1 Classification of xylanases

Due to the heterogeneity and complexity of xylan, there is an abundance of diverse xylanases with varying specificities, primary sequences and structures. Therefore, the classification of these enzymes by substrate specificity alone is not adequate (Collins et al. 2005). On the basis of the physicochemical properties of xylanases, Wong et al. (1988) classified them into two groups. These included those enzymes with a low molecular weight (<30 kDa) and basic pI, and those with a high molecular weight (>30 kDa) and acidic pI. However, there are several exceptions when using this classification (Matte and Forsberg 1992, Sunna and Antranikian 1997). Collins et al. (2005) reported that there are about 30% of presently identified xylanases, especially fungal xylanases, which cannot be classified by this system. Henrissat and colleagues introduced a more complicated classification system based on primary structure comparisons and sequences of the catalytic domains only (Henrissat et al. 1989, Henrissat and Coutinho 2001). Based on this system, Henrissat et al. (1989) grouped xylanases into 6 families (A-F), which was updated to 77 families (1-77) in 1999 (Henrissat and Coutinho 2001). These families continued to increase when the glycosidase sequences were included (Collins et al. 2005). Later, Coutinho and Henrissat (1999) reported that there are 96 glycoside hydrolase families, in which about one-third of them are polyspecific (e.g. have enzymes with diverse substrate specificities). This classification system indicates a relationship between the molecular mechanism of an enzyme and its primary structure; therefore, it can provide both structural and mechanistic features of enzyme (Collins et al. 2005). Enzymes which belong to a specific family will have similarities in their three- dimensional structure (Henrissat and Coutinho 2001), molecular mechanism (Gebler et al. 1992), and even in the specificity of action on small, soluble, synthetic substrates (Claeyssens and Henrissat 1992). According to Bourne and Henrissat (2001), the families containing related three-dimensional structures resulting from divergent evolution should be grouped into higher hierarchical levels, known as clans. Collins et al. (2005) reported that there are 14 different clans (GH-A to GH-N), with most clans comprised of two to three families, apart from clan GH-A which includes 17 families.

131

4.1.3.2 Production of xylanases

Xylanase can be produced from microbes by SmF or SSF. However, SmF normally requires high costs that prevent the industrial application of xylanases (Haltrich et al. 1996, Beg et al. 2000, Virupakshi et al. 2005). The advantages of SSF, such as higher productivity per reactor volume as well as the lower operation and capital costs, make it a more attractive method, especially for fungi (Purkarthofer et al. 1993, Pandey et al. 1999). In addition, the substrates for SSF can be lignocellulosic materials (e.g. wheat straw, wheat bran and corncob) instead of pure xylan, which is very expensive (Haltrich et al. 1996, Beg et al. 2000, Senthilkumar et al. 2005). However, there are several difficulties involved in measuring the growth parameters in SSF, such as cellular growth analysis and substrate consumption determination, which are caused by the heterogeneous nature of the substrate, primarily an agroindustrial by-product, that is structurally and nutritionally complex (Pandey et al. 1999, Bhargav et al. 2008, Hashemi et al. 2011).

4.1.3.3 The applications of xylanase

Fungal xylanase has an important function in breaking down the β-1,4 bond between xyloses residues and decreasing the viscosity of wheat. Different species of xylanase-producing fungi are already used in industry such as Fusarium oxysporum, Schizophyllum commune and Trichoderma reesei (Prema et al. 2006, Song et al. 2013). The properties of fungal xylanases relevant to industrial uses are listed in Table 4.4.

132

Table 4.4 Properties of fungal xylanases and their industrial applications

Applications Microorganism pH Temperature References optimal optimum (oC) Animal feed Aspergillus niger 5.3 65 Polizeli et al. Trichoderma reesei 4.5 40 2005 T. koningii 5.0 55 Qinnghe et al. 2004 Pleurotus ostreatus 5.0 50 beverage industry Fusarium oxysporum 5.0 50 Prema et al. 2006 Biofuel industry Schizophyllum 5.0 50 Song et al. commune 2013 Manufacture of T. reesei 5.3-5.5 55 Polizeli et al. bread 2005 T. koningii 5.0 55 Food industry T. longibrachiatum 5.0-5.5 55-60 Polizeli et al. 2005 Neurospora crassa 5.5 50 Abirami et al. 2011 Pharmaceutical and A. niger 4.5 50 Polizeli et al. chemical industries 2005 Pulp and paper Termomonospora 5.0 45-50 Polizeli et al. industries fusca 2005 T. reesei 4.5 50 N. crassa 5.5 50 Abirami et al. 2011 Chaetomium 5-7 70 Katapodis et thermophilum al. 2007 A. niger 7.5 60 Coral et al. 2002 Thermomonospora sp. 7.0 70 George et al. 2001

133

4.1.4 Liquid cultures

Enzyme-producing isolates identified by agar plate assays are selected for liquid culture, most commonly in shake flasks. Liquid culturing allows the enzymes to be freely secreted into the aqueous medium, which can then be separated from mycelia by centrifugation following filtration with through a 0.22 µm filter (Millipore); the culture supernatant is then used for enzyme harvesting and analysis. The culture medium typically contains essential nutrients and substrates recognized to favour fungal growth and prompt the enzymes of interest in well-studied fungal species; for example, crystalline cellulose and/or lactose induce cellulolytic enzymes (Esterbauer et al. 1991). Some species do not grow well in aqueous conditions or become very viscous or clump into pellets, inhibiting enzyme secretion (Gibbs et al. 2000). Further enzyme analysis is difficult for these species and they are eliminated from further study. For those species that do grow in liquid culture, attempts can be made to modify the culture medium by manipulation of the nutrient contents, pH or aeration (eg. shaker speed) in order to increase enzyme yield.

4.1.5 Liquid enzyme assays

Enzyme activity present in the supernatant of a fungus grown in liquid culture can be assessed using liquid enzyme assays. In the assay process, the enzymes act on a substrate to induce quantitative changes in light absorbance (colorimetric assay) or fluorescence (fluorimetric assay) in the assay medium. Enzyme activity against substrates such as xylan and starch can be measured by the amount of reducing sugars released into the assay medium, represented by the colour produced upon interaction with the aromatic compound dinitrosalicyclic acid (DNS; Bailey et al. 1992). In addition, many synthetic substrates are commercially available, such as ethylidene-pNP- G7 (www.sigma-aldrich.com), or included in kits, such as the Megazyme amylase assay (Ceralpha method, catalogue no K-CERA 08/05). These substrates contain p- nitrophenyl compounds or fluorescing groups and show colour or fluorescence when cleaved (Sicard and Reymond 2006). QuantiCleaveTM Protease Assay Kit, 23263, (Thermo-Scientific, USA) with succinylated casein as substrate was used to assess protease activity. The amount of

134 new amino (NH2) groups generated in the assay detected by 2, 4, 6-trinitrobenzene sulfonic acid (TNBSA) represent proteolytic activity based on the interaction between TNBSA and NH2 groups that can be detected at 340 - 450 nm (Hatakeyama et al. 1991, Tian et al. 2004). Each individual enzyme has an optimal temperature and pH under which it maintains the conformation necessary for maximal activity (Campbell 1996). The rise and fall of enzyme activity that occurs about this point is referred to as an enzyme’s activity profile (Fig 4.4). To a certain extent, an increase in temperature results in higher enzyme activity due to increased molecular movement and collision rates between substrate and enzyme. However, at higher temperatures the non-covalent interactions that stabilise the native structure of the enzyme are disrupted and the active site is no longer able to function correctly. Similarly, an enzyme will function most efficiently at a particular pH. As the pH changes from the optimum, the charges of amino acid residues at the active site are altered, the ability of substrate and enzyme to exchange hydrogen ions is reduced and the rate of enzyme activity is decreased. Liquid enzyme assays can be undertaken across a broad temperature and pH range to establish the activity profiles of enzymes. The enzyme activity profiles can then reveal unusual levels of temperature or pH tolerance in the enzymes that could be valuable for biotechnological applications.

Figure 4.4: Examples of the rate of reaction from different enzyme profiles showing the influence of environmental conditions on enzyme activity: a) temperature profiles; (b) pH profiles (Campbell 1996). The activity of a typical human enzyme (shown in black), the activity of enzymes isolated from some thermophilic bacteria (shown in green). 135

This Chapter describes studies conducted to determine the optimum fungal enzyme production environment. Different temperatures, pH carbon sources, nitrogen sources and mineral ions were assessed for their influence on production of particular enzymes from the selected endophytes.

4.2 Materials and Methods

Fungal isolates showing maximum halo zones on screening plates containing starch (EL-13, EL-14 and EL-15), skim milk (EL-7, EL-8 and EL-17) and xylan (EM-4) were chosen for further enzyme optimization. The same procedures were used for standard fungi Aspergillus oryzae (ATCC 10124) and A. niger (ATCC 10577) as controls for amylase, and Fusarium oxysporum (FRR 3414) and A. niger (ATCC 10577) as controls for protease and xylanase, respectively. Different factors including pH, temperature, alternative sources of carbon in the media and diverse salts (CaCl₂, CoCl₂, MgCl₂, NaCl and MnCl₂) in the phosphate buffer for enzyme assays were considered to establish the best enzymes production conditions using appropriate liquid cultures. The lyophilized ferment broth was used to carry out Bradford assays. After extracellular protein was precipitated with TCA/acetone, the protein pellet was dissolved in a suitable buffer and enzyme assays of crude enzyme preparations were performed (in triplicate) to establish the optimum production conditions in the selected hydrolase-inducing media.

4.2.1 Preparation of crude extracellular samples using liquid culture

All selected isolates were inoculated into hydrolase-inducing media containing 1.5 % w/v soybean flour, 1 % w/v lactose, 2 % w/v Avicel cellulose and minimal salts

(KH2PO4 1.5 %, (NH4)2SO4 0.5 %, MgSO₄ 0.06 %, CaCl2 0.6 %, FeSO₄.7H2O 0.0005

%, MnSO ₄.H2O 0.00016 %, ZnSO₄.7H2O 0.00014 % and CoCl₂ 0.0002 %; pH 6.5 (Penttilä et al. 1987, Peterson et al. 2011a) and incubated at 25 °C for 7 days. The media was then centrifuged at 10,000 g for 15 min to separate the mycelia from the broth and the broth filtered through a 0.22 µm filter (Millipore). The sterilized broth was then concentrated by freeze drying and used for further analysis.

136

A second hydrolase-inducing medium was used only for one of the endophytic isolates, EL-14 (Preussia minima), to assess the effect of media on amylase production. The isolate grown in this medium was designated as EL-14s and was used for further analysis. Endophyte suspension (5 ml) was prepared with 0.1 % Triton X-100 added to 100 ml glucose-aspargine medium containing: glucose 2 %, L-asparagine 0.4 %,

KH2PO4 0.3 %, K2HPO ₄ 0.2 %, MgSO₄.7H2O 0.05 % and 0.1 % (v/v) of Vogel’s trace elements (Appendix 4.1) to 100 ml distilled water and pH was adjusted to 6. The culture was incubated for 4 days at 25 °C with shaking at 220 rpm (Nguyen et al. 2002). To initiate the production of enzyme, 5 ml of the culture grown in the above medium was introduced to 150 ml of inducing media containing; soluble starch 4 %, L-asparagine

0.75 %, KH2PO₄ 0.3 %, K2HPO ₄ 0.2 %, MgSO₄.7H2O 0.05 % and 0.1 % (v/v) of Vogel’s trace elements solution in 100 mM citrate buffer pH 5.0. The mixture was allowed to ferment for 5 days at 25 °C and crude extracellular extract prepared as described for the other endophytes (Nguyen et al. 2002). The first hydrolase-inducing medium with minor changes in carbon and nitrogen sources was used to prepare samples (S1-S8) from EM-4 (Preussia sp.). The detail information for chemical ingredients was present in the Table 4.5.

Table 4.5 Chemical compound used to identify the activity of xylanase enzyme S1 Samples S2 S3 S4 S5 S6 S7 S8 (control) Temp 25 (oC)

pH 5.5

1.5% w/v Soybean flour; 2% w/v Avicel cellulose Carbon 1% 1% 1% 1% NA NA NA NA lactose starch maltose glucose 1% 1% 1% 1% Nitrogen NA NA NA NA yeast ammonium peptone tryptophan extract nitrate Minimal

salts KH2PO4 1.5 %, (NH4)2SO4 0.5 %, MgSO₄ 0.06 %, CaCl2 0.6 %, FeSO₄.7H2O 0.0005 %,

MnSO₄.H2O 0.00016 %, ZnSO₄.7H2O 0.00014 % and CoCl₂ 0.0002 %

137

4.2.2 Determination of Protein Content

The total protein content in extracellular concentrated broths (crude enzyme samples) was determined by the assay described by Bradford (1976). Bovine Serum Albumin (BSA, 1mg/ml; Sigma) was used as a standard in various dilutions (0.1 to 2.0 mg/ml) in order to cover the probable range of the unknown protein samples (Appendix 4.2). The unknown protein samples and the dilution series of BSA were mixed with Coomassie Dye (0.06% coomassie blue G-250 dissolved in 2.2% HCl (0.6M) + 1:1 2% HCl) in a 1:1 ratio, incubated at room temperature for 10 minutes, and the absorbance was read at 595nm. In order to obtain readings in range of the standards, the samples were diluted 1:10, 1:20 and 1:50 with deionised water (DW). Blank samples contained media only. A standard curve was plotted using the absorbance readings of the BSA standard. Using this curve as a reference, and knowing the absorbance of the unknown samples, their concentration was determined by extrapolation from the Graph.

4.2.3 Comparison of enzyme activity between selected endophyte samples and standard enzyme-producing fungi

Crude extracellular samples of selected endophytic fungi and the standard amylase-producing fungus, Aspergillus oryzae (ATCC 10124), standard protease- producing fungus, Furasium oxysporum (FRR 3414) and xylanase-producing fungus, Aspergillus niger (ATCC 10577) were prepared under the same conditions using the hydrolase-inducing medium (Peterson et al. 2011a). Clear zone diameters (mm) on substrate plates at four different pH (3, 5, 7 and 9) at 25 °C and temperature conditions (9 °C, 25 °C, 37 °C and 50 °C) at pH 5.5 were measured (in triplicate) to compare selected enzyme activities of the endophytes with the standards (Peterson et al. 2009a).

4.2.4 Enzyme assay

4.2.4.1 Preparation of protein samples

Proteins were precipitated by incubating the supernatant with 20% (w/v) tricholoacetic acid (TCA) for 14 hours at 4°C. Following centrifugation at 9,000 x g for

138

15 min at 4°C, the pellet was resuspended in 20 ml cold acetone and incubated on ice for 30 min. Centrifugation was then repeated at 9,000 x g for 15 min at 4°C; the supernatant was removed, and the pellet was air dried prior to resuspension in solubilisation buffer.

4.2.4.2 α-amylase assay using Megazyme amylase assay kit

The Megazyme amylase assay method (Ceralpha method catalogue no K-CERA 08/05) was used to determine the activity of α-amylase in the test samples EL-13 (unclassified fungus), EL-14 (P. minima) grown in the first hydrolase-inducing media, EL-14s grow in the second hydrolase-inducing media (Nguyen et al. 2002) and EL-15 (Alternaria sp.). Extraction buffer and Megazyme Ceralpha stopping reagent were made according to the manufacturer’s protocol. A Cary UV spectrophotometer was used for sample analysis which was standardized with p-nitrophenol phosphate (10µmol/ml) standard in 1 % tri-sodium phosphate solution. The assay was standardized using the malt sample provided in the kit and endophyte samples were assayed to determine their α-amylase activity. One CU (Ceralpha Unit) is defined by the manufacturer as the amount of enzyme, in the presence of excess a- glucosidase, required to release one micromole of p-nitrophenol from BPNPG7 (blocked p-nitrophenol maltoheptaoside) in 1 min under the defined assay conditions (Fig 4.5).

Figure 4.5: Principle of the Megazyme α-Amylase Assay (manufacturer's specifications)

139

4.2.4.3 α-amylase assay measuring reducing sugar

To optimise the best conditions in the selected endophytic fungus EL-14s (P. minima) in the hydrolase-inducing medium (Nyugen et al. 2002) with respect to pH (3, 5, 7,9 and 10), temperature (9 °C, 25 °C and 37 °C), alternative sources of carbon (maltose, cellulose and glucose), nitrogen (ammonium nitrate, yeast extract, peptone and tryptophan) in the media and diverse salts (CaCl₂, CoCl₂, MgCl₂, NaCl and MnCl₂) in the enzyme assay phosphate buffer for, amylase activity was determined by calculating the production of reducing sugar from starch using 3, 5-dinitrosalicylic acid (DNS) as described by Miller (1959). The reaction included 50µl of enzyme sample, 50µl of 1.0% starch solution in 0.1 citrate-phosphate buffer, pH 5. After 20 min incubation at 37°C, the reaction was stopped by adding 100µl of DNS reagent. A blank for each sample contained all the solutions and inactivated (boiled) enzyme sample. One unit of amylase activity was defined as the amount of enzyme that produced 1 µmol of reducing sugar per minute (Appendix 4.3). The absorbance of different concentrations of maltose solution (0-500µg/ml) at 540, as the end product of amylase activity, was used to plot a standard curve.

4.2.4.4 Protease assay

Protease activity was determined using the QuantiCleaveTM Protease Assay Kit, 23263, (Thermo-Scientific, USA) with succinylated casein as substrate, 50 mM borate buffer solution (pH 8.5) and trinitrobenzenesulfonic acid (TNBSA) (Fig 4.6). Fifty μl of each protease sample approximately 0.05-0.1 mg of total protein (diluted appropriately) and standard sample were mixed with 100 μl of casein solution. A blank for each unknown and standard sample was prepared containing buffer and protease sample without the succinylated casein solution. After incubation for 20 mins at room temperature, 50μl of TNBSA was added to each well and incubated for a further 20 mins incubation at room temperature. A standard curve was constructed from a serial dilution of 0.5 mg/ml trypsin stock solution (Appendix 4.4). One unit of protease activity is defined as the amount of enzyme required to generate 1 μmol of new amino

(NH2) groups per minute at 37 °C as detected by TNBSA (Hatakeyama et al. 1991, Tian et al. 2004). For each well, the change in absorbance at 450nm (∆A450) was calculated

140 by subtracting the A450 of the blank from the corresponding casein well. This absorbance value was generated as a result of the proteolytic activity of the enzyme. The absorbance of trypsin as a standard solution was used to plot a standard curve (∆450nm against logarithmic scale of protease standard concentration).

Figure 4.6: Principle of the Quanticleave™ Protease Assay (manufacturer's specifications)

4.2.5 Effect of carbon and nitrogen source on enzyme activities

Based on concentration of proteins produced by selected endophytes, three different media were used for optimization of different sources of carbon and nitrogen and their effect on amylase, protease and xylanase production. The second hydrolase- inducing medium (Nguyen et al. 2002) was used to define the optimum sources of carbon and nitrogen and increase the production of amylase in EL-14s (P. minima). Czapek Dox medium (More et al. 2009) was used to determine the optimum sources of carbon and nitrogen and increase the production of protease in EL-17 (A. alternata).

The composition of the medium was (w/v): 0.25% NaN03, 0.1% KH2P04, 0.05%

MgS04.7H2O, 0.05% KCl and 1 % (w/v) solution of each source of carbon (starch, glucose, sucrose, maltose and soybean) or nitrogen (tryptophan, yeast extract, casein, peptone and L-asparagine) was added to the medium.

141

The first hydrolase-inducing media containing 1.5 % w/v soybean flour, 1 % w/v lactose, 2 % w/v Avicel cellulose and minimal salts (Peterson et al. 2011a) was used to conclude the optimum sources of carbon (lactose, starch, maltose and glucose) and nitrogen(peptone, tryptophan, yeast extract and ammonium nitrate) and increase the production of xylanase in EM-4 (Preussia sp.). The final media were sterilized at 115 °C for 10 minutes. To study the effects of different carbon and nitrogen sources, temperature and pH, a factorial experiment based on a randomized complete design was designed in this study in three replications. The average of activities using different sources of carbon and nitrogen were compared by the Duncan multiple ranges test to determine the best media composition at optimum temperature and pH.

4.2.6 Statistical Analyses

Statistical analyses were carried out by analysis of variance (ANOVA) using the Statistical Analysis System (SAS) program version 9.0. A factorial experiment based on a randomized complete design in three replications was considered for each experiment individually. The Duncan’s Multiple Range Test (DMRT) was used to determine means that differed significantly. The effects of temperature, pH, type of fungus (selected endophytic fungus and standard) and different sources of carbon and nitrogen on selected enzymes activities were analyzed to indicate that the optimum activity was significant (Gouda and Elbahloul 2008).

4.3 Results

4.3.1 Amylase samples

From preliminary studies of enzyme activity (Chapter 3), three fungal endophytes identified from 18S RNA sequencing as an unclassified fungus (EL-13), Preussia minima (EL-14) and Alternaria sp. (EL-15) were selected for further analysis (below) and characterization (Chapter 5).

142

4.3.1.1 Analysis of total protein for amylase samples

An estimation of the total protein content of the extracellular extracts was made using the Bradford assay (Bradford 1976). EL-14 (Preussia minima) showed the highest protein content (7.2 mg/ml) compared to the other selected endophytes, EL-13 and EL- 15 (3.7 mg/ml and 1.44 mg/ml, respectively). EL-14s, Preussia minima grown in the second hydrolase-inducing medium (Nyugen et al. 2002), had the least total protein content (0.8 mg/ml) demonstrating the effect of media composition on total protein production (Fig 4.8).

4.3.1.2 Determination of α-amylase activity of three selected endophytes in different media

The Megazyme α-amylase kit was used to determine the α-amylase content in the test samples. Sample EL-14s (45 CU/ml) demonstrated the highest α-amylase activity followed by EL-14 (36 CU/ml), EL-13 (23 CU/ml) and EL-15 (14 CU/ml). These results are in agreement with the observations made from SDS-PAGE and zymography (see Chapter 5). Again, the effect of media on enzyme production was observed with EL-14s cultivated using the medium of Nyugen et al. (2002) showing the highest enzyme activity, even though this medium produced the lowest overall protein content (Fig 4.7).

9 50 8 40 S EL-13 EL-14 EL-15 EL-14s 7 6 30 5 4 20 3 2 10 1 Protein concentration

Amylase Amylase activity (CU/ml) (mg/ml) 0 0 Protein concentration(mg/ml) EL-13 EL-14 EL-14s EL-15

Endophytic fungi

Figure 4.7: Total protein and α-amylase activity of three selected endophytic fungi

143

Amylase production was also assessed by the plate-hole diffusion method using the concentrated broth. Samples (150 µl) with the same concentration of protein (0.5 mg/ml) were added to holes in agar plates (Fig 4.8) containing screening media with starch substrate and incubated at 25 °C and pH 5.5 for 1 day. At the completion of the incubation period, the plates were observed for activity by addition of iodine and measuring the relative amylase activity confirmed by quantitative enzyme assay (Peterson et al. 2009a).

EL-15

EL-13 EL-14

Figure 4.8: Amylase activity of crude extracellular extracts on solid media containing starch at 25 °C and pH 5.5

4.3.1.3 Comparison of amylase activity between standard (Aspergillus oryzae) and selected endophyte (EL-14s)

Amylase activity of crude sample (EL-14s) and crude standard (A. oryzae) on starch plates demonstrated that the endophytic fungus exhibited much higher amylase activity (using second hydrolase-inducing medium) in alkaline conditions and low temperature in comparison with A. oryzae (Fig. 4.9). Amylase activity under these conditions is desirable for the application of this enzyme in the detergent industry. Although the amylase activity of EL-14s in acidic conditions was not high, it was greater than the standard and may thus have applications in the dairy and food industries (Fig. 4.9).

144

40 40 35 a 35 b 30 30 25 25 20 endophyte 20 endophyte

15 15 10 Aspergillus 10 Aspergillus oryzae oryzae 5 5 0 0 Amylase activity (Clear zonemm) Amylase activity (Clear zonemm) 9°C 25°C 37°C 50°C 9°C 25°C 37°C 50°C Temperature Temperature

40 40 35 c 35 d 30 30 25 25 20 endophyte 20 endophyte 15 15 10 Aspergillus 10 Aspergillus oryzae oryzae 5 5

0 0 Amylase Amylase activity (Clear zonemm) Amylase activity (Clear zonemm) 9°C 25°C 37°C 50°C 9°C 25°C 37°C 50°C

Temperature Temperature

Figure 4.9: Comparison of amylase activity between crude extracellular enzyme from endophytic fungus (EL-14s) and standard (A. oryzae) at different temperatures at pH 3 (a), pH 5.(b), pH 7 (c) and pH 9 (d).

145

Statistical analysis showed that three factors including fungus type, pH and temperature and their interactions had significant effects on amylase activity. The significance of each factor was determined by F values and P values (Table 4.6). The model P value 0.0001 implied the model was significant and all the factors and their interaction with P values less than 0.01 was significant (a = 0.01).

Table 4.6 Test of significant effect of three factors (standard/selected endophyte (EL-14s, Temp and pH) on amylase activity Source df Sum of Squares Mean Square F Value P Value Model 31 5536.766183 178.605361 327.38 <0.0001 pH 3 4496.122583 1498.707528 2747.12 <0.0001 Temp 3 188.620358 62.873453 115.25 <0.0001 Fungus 1 74.906667 74.906667 137.30 <0.0001 pH*Temp 9 198.154175 22.017131 40.36 <0.0001 pH*Fungus 3 502.074833 167.358278 306.77 <0.0001 Temp*Fungus 3 31.350625 10.450208 19.16 <0.0001 pH*Temp*Fungus 9 45.536942 5.059660 9.27 <0.0001 Error 64 34.915600 0.545556 Corrected Total 95 5571.681783 P values less than 0.01 are significant Probability P (>F) <0.0001; R-Square= 0.993

4.3.1.4 Optimization of process parameters and effect of additional nutrients

Different conditions, including pH (3, 5, 7,9 and 10), temperature (9 °C, 25 °C and 37 °C), alternative sources of carbon (maltose, cellulose and glucose) and nitrogen (ammonium nitrate, yeast extract, peptone and tryptophan) in the media and diverse salts (CaCl₂, CoCl₂, MgCl₂, NaCl and MnCl₂) in the enzyme assay phosphate buffer, were considered to establish the optimum amylase production conditions for EL-14 in the second hydrolase-inducing medium (Nyugen et al. 2002).

146

4.3.1.4.1 Effect of temperature on the specific activity of α-amylase activity isolated from EL-14s

The optimum temperature for α-amylase was evaluated by measuring the specific activity at different temperatures (9, 25 and 37 °C) at pH 5.5. The enzyme presented a temperature optimum at 25 °C. The optimum value for α-amylase production was observed at 98 U/mg (Fig 4.10). Activity of α-amylase at low temperature was notable as well. This broad range of amylase activity might be useful for different industrial applications, especially as a detergent.

4.3.1.4.2 Effect of pH on the specific activity of α-amylase isolated from EL-14s

The effect of pH was also investigated. The enzyme was pre-incubated at the optimum temperature of 25 ºC and different pH (3, 5, 7, 9 and 10). The pH optimum was 9.0 with a specific activity of 138 U/ mg (Fig 4.10). α-amylases from most fungi are known to have pH optima in the acid to neutral range. This particular enzyme showed optimum activity in alkaline condition (similar to bacteria) and high activity in lower temperature (similar to other fungi). Thus, the optimum temperature and pH make this fungal enzyme exceptional. Enzyme assay was performed by using EL-14s (P. minima) in the second hydrolase-inducing medium (Nyugen et al. 2002) at different temperatures (9 °C, 25 °C and 37 °C, at pH 5.5) and pH (3, 5, 7, 9 and 10 at temperature 25 °C). Results based on calculating the specific enzyme activity have been summarised in Figure 4.10.

147

160 C A B a 140 25° C- pH 9 25° C pH 5.5 120 b 100 a c d b 80 b c c 60 e 40

20 Specific Specific amylase activity (U/mg) 0 A. oryzaeA. niger pH 3 pH 5 pH 7 pH 9 pH 10 9°C 25°C 37°C

Figure 4.10: A EL-14s (P. minima) was grown at different pH and crude enzymes were investigated to assess the effect of different pH on secretion of amylase and finding the best pH for amylase production. B EL-14s was grown at different temperatures and crude enzymes were to assess the best temperature for amylase production. C standards (A. oryzae and A. niger) were grown at the same conditions to compare their activity with P. minima. Means followed by the same letter within a column are not significantly different at P<0.01 according to the Duncan multiple range test. (Samples (EL-14s) growing in different temperature and different pH were analysis using Duncan test separately)

4.3.1.4.3 Effect of using different sources of carbon and nitrogen on α-amylase production

The effects of different nitrogen and carbon sources were studied at optimum conditions (Nyugen et al. 2002) and it was observed that inclusion of starch and L- asparagine (control media) produced the highest specific activity (138 U/mg). Replacement with three different carbon (maltose, cellulose and glucose) and nitrogen sources (ammonium nitrate, yeast extract, peptone and tryptophan) did not increase production of amylase. Results based on measuring the specific enzyme activity have been summarised in Figure 4.11. Zymography was carried out (Chapter 5) for all of different samples including different carbon and nitrogen sources and results confirmed that highest specific activity was observed with using starch and L-asparagine as sources of carbon and nitrogen, respectively.

148

160

140

120

100

80

60

Specific Specific enzyme activity (U/mg) 40

20

0 Yeast extract Peptone Maltose Cellulose Control Nitrogen source Carbon source

Figure 4.11: Effects of different carbon and nitrogen sources at optimum conditions (25 °C and pH 9). P. minima was grown in different media based on hydrolase-inducing medium as control media (Nyugen et al. 2002) by replacing different carbon and nitrogen sources. The highest specific activity was achieved by using starch and L-asparagine in the original media. Means followed by the same letter within a column are not significantly different at p <0.01 according to the Duncan multiple range test.

Statistical analysis showed that three factors including media (different sources of carbon and nitrogen), pH and temperature and their interactions had significant effects on amylase activity (Table 4.7). The average of activities using different sources of carbon and nitrogen were compared by the Duncan multiple range test and showed that starch as the carbon source and L-asparagine as nitrogen source produced the greatest amylase activity at 25 °C and pH 9 (Fig 4.10 and Fig 4.11).

149

Table 4.7 Test of significant effect of three factors (EL-14s growing in different conditions, Temp and pH) on amylase activity Source df Sum of Squares Mean Square F Value P Value Model 127 103971.393a 818.672 3344.364 <0.0001 pH 3 28635.049 9545.016 38992.408 <0.0001 Temp 3 7229.945 2409.982 9845.032 <0.0001 Sample 7 24030.581 3432.940 14023.926 <0.0001 pH*Temp 9 8092.023 899.114 3672.975 <0.0001 pH*Fungus 21 5643.513 268.739 1097.826 <0.0001 Temp*Fungus 21 11290.784 537.656 2196.383 <0.0001 pH*Temp*Fungus 63 19049.497 302.373 1235.226 <0.0001 Error 256 62.667 .245 Corrected Total 383 104034.060 P values less than 0.01 are significant Probability P (>F) <0.0001; R-Square= 0.999

4.3.1.4.4 Effects of salts on α-enzyme activity

Enzyme assays were performed under two different conditions, the standard enzyme assay described previously (section 4.2.4.3) and assays performed with addition of different metal ions (Na+, Mg2+, Ca2+, Co2+, Mn2+) at 2.5 mM. The chloride salts of these metal ions were used (CaCl₂, CoCl₂, MgCl₂, NaCl and MnCl₂). The amylase activity was measured at optimum pH and temperature. The relative activity of the enzyme was compared with the activity obtained using 0.1 M citrate-phosphate buffer. Results demonstrated that CaCl₂ and MnCl₂ increased the total amylase activity whereas MgCl₂ and NaCl inhibited the enzyme activity in comparison to the control (Fig. 4.12), confirming previous reports which indicated that amylases are mostly metalloenymes and require calcium and manganese ions for activity, structural integrity and stability (Sivaramakrishnan et al. 2006, Varalakshmi et al. 2009, Michelin et al. 2010) Calcium enhances amylase activity by its interaction with negatively charged amino acid residues such as aspartic and glutamic acids (Sasi et al. 2010). Magnesium and sodium ions were found to inhibit amylase activity and similar observations were made by Varalakshmi et al. (2009) and Reyed et al. (2007).

150

160

140

120

100

80

60

40 Relative Relative enzyme activity % 20

0 Control CaCl₂ CoCl₂ MgCl₂ NaCl MnCl₂ (None) Salts

Figure 4.12: The effect of metal ions on fungal amylase activity. The relative activities were measured at optimum of pH and temperature and enzyme activity without metal ions was taken as 100%.

4.3.2 Protease samples

From preliminary studies (Chapter 2), three fungal endophytes identified from 18S RNA sequencing as an unclassified fungus (EL-7), Phoma herbarum (EL-8) and Alternaria alternata (EL-17) were selected for further analysis (below) and characterization (Chapter 5).

4.3.2.1 Analysis of total protein for protease samples

The total extracellular proteins secreted by the three endophytic samples are presented in Figure 4.14. EL-7 (2.19 mg/ml) produced relatively greater amounts of proteins than EL-17 (2.04 mg/ml) in the concentrated crude extracellular extracts, whilst EL-8 secreted about half the total extracellular proteins (0.93 mg/ml) of the other two isolates.

151

4.3.2.2 Screening for protease activity on solid media

Skim-milk agar plates (Fig 4.13) showed variation in the diameter of the proteolytic zones produced by EL-7, EL-8 and EL-17. EL-17 demonstrated the largest diameter (14 mm) of proteolysis compared to EL-8 and EL-7 with diameters of 10 mm and 11 mm, respectively.

4.3.2.3 Determination of protease activity between three selected endophytes

The observations of the skim-milk agar assay were confirmed by determination of the protease activity. One milligram of trypsin gives 40 N-α-benzoyl arginine ethyl ester (BAEE) units at 37 °C. Thus, the specific protease activities of EL-7, El-8 and El- 17 have been recorded as BAEE units per mg. The EL-17 supernatant (collected from endophyte grown at 30 °C and pH 6.5) contained the highest specific enzyme activity (50 BAEE units/mg with an enzyme concentration of 0.5 mg/ml) (Figure 4.14).

EL-8

EL-17

EL-7

Figure 4.13: The proteolytic activities of the three endophytes on a skim-milk agar plate at 25 °C and pH 5.5.

152

60 10 9 50 8

40 7 Protease activity 6 (BAEE Units/mg) 30 5

units/mg) 4 Protein concentration 20 3 (mg/ml) 10 2

Specific Specific protease activity (BAEE 1 0 0 Total proteinconcentration (mg/ml) EL-7 EL-8 EL-17 Endophytic fungi

Figure 4.14: Comparison of total extracellular protein production and protease activity by the different fungal endophytes.

4.3.2.4 Comparison of protease activity between standard (Fusarium oxysporum) and selected endophyte (EL-17)

The crude sample from the endophyte with the highest protease activity (EL-17) and crude supernatant derived from the standard, Fusarium oxysporum, were tested on skim-milk plates. After staining with 10% tannic acid, it was observed that the endophyte exhibited greater protease activity (in hydrolase-inducing medium) at 37 °C and pH 7 in comparison to F. oxysporum (Fig. 4.15). The protease activity of EL-17 was greatest at pH 7 at temperatures ranging from 9 °C to 50 °C. Protease activity under these conditions is desirable for the application of this enzyme in the dairy and food industries.

153

35 30 pH=3 25 pH=5 20 pH=7 15 pH=9 10 5 0 EL-17 EL-17 EL-17 EL-17 Standard Standard Standard Standard

Protease activity zone clear activity (mm) on Proteasebased 9°C 25°C 37°C 50°C

Figure 4.15: Protease activities of endophytic fungus (EL-17) and standard (F. oxysporum) at different temperature and pH conditions.

Statistical analysis showed that three factors including fungus type, pH and temperature and their interactions had significant effects on protease activity. The significance of each factor was determined by F values and P values (Table 4.8). The model P value <0.0001 implied the model was significant and all the factors and their interactions with P values less than 0.01 were significant (α=0.01).

Table 4.8 Test of significant effect of three factors (standard/selected endophyte (EL-17), Temp and pH) on protease activity Source df Sum of Squares Mean Square F Value P Value Model 31 4127.798 133.155 1181.399 <0.0001 pH 3 106.864 35.621 316.045 <0.0001 Temp 3 3800.909 1266.970 11241.031 <0.0001 Fungus 1 44.010 44.010 390.477 <0.0001 pH*Temp 9 87.382 9.709 86.143 <0.0001 pH*Fungus 3 47.685 15.895 141.025 <0.0001 Temp*Fungus 3 10.051 3.350 29.724 <0.0001 pH*Temp*Fungus 9 30.898 3.433 30.460 <0.0001 Error 64 7.213 .113 Corrected Total 95 4135.011

P values less than 0.01 are significant Probability P (>F) <0.0001; R-Square = 0.998

154

4.3.2.5 Quantitative Protease assay of EL-17 grown at different temperature and pH

Specific protease activity produced by crude sample of EL-17 grown at 37 °C was 69.86 BAEE units/mg which was significantly (α=0.01) higher than F. oxysporum (53.62 BAEE units/mg) grown under the same conditions (Fig. 4.16). These results confirmed the optimum protease activity of this endophytic fungus in this medium condition is at pH 7 and 37 °C. However, the broad range of its protease activity might be useful for different industrial and medicinal applications.

80 a 70 b b c 60 d d e e 50 f g 40

30

20

10

0 Specific Specific protease activity (BAEE units/mg)

Figure 4.16: Comparison of specific protease activities between standards and endophytic fungus, EL-17, grown at different temperature and pH. Means followed by the same letter within a column are not significantly different at P<0.01 according to the Duncan multiple range test. Variable pH experiments were performed at 25 °C, while variable temperature experiments were performed at pH 5.5.

4.3.2.6 Effect of carbon and nitrogen source on protease activity

Statistical analysis showed that three factors including media (different sources of carbon and nitrogen), pH and temperature and their interactions had significant effects on protease activity. The average activities using different sources of carbon and

155 nitrogen were compared by the Duncan multiple range test and showed that soybean as the carbon source and tryptophan and yeast extract as nitrogen sources produced the greatest protease activity at 37 °C and pH 7 (Fig. 4.17).

35 a

a a 30 b c c c 25

20 d 15 e 10 f

5

0 Protease activity based onclear zone(mm)

Figure 4.17: Effects of different carbon and nitrogen sources at optimum conditions (37 °C and pH 7). Means followed by the same letter within a column are not significantly different at P<0.01 according to the Duncan multiple range test.

The significance of each factor was determined by F values and P values (Table 4.9). The model P value <0.0001 implied the model was significant and all the factors and their interactions with P values less than 0.01 were significant (α = 0.01).

156

Table 4.9 Test of significant effect of three factors (pH, Temp and media) on protease activity produced by EL-17 Source df Sum of Squares Mean Square F Value P Value Model 119 22291.997a 187.328 159.428 <0.0001 pH 2 1261.651 630.826 536.873 <0.0001 Temp 3 8917.592 2972.531 2529.813 <0.0001 Media 9 2197.067 244.119 207.760 <0.0001 pH*Temp 6 3136.271 522.712 444.861 <0.0001 pH*Media 18 1557.529 86.529 73.642 <0.0001 Temp*Media 27 2399.617 88.875 75.638 <0.0001 pH*Temp*Media 54 2822.271 52.264 44.480 <0.0001 Error 240 282.000 1.175 Corrected Total 359 22573.997 P values less than 0.01 are significant Probability P (>F) <0.0001; R-Square = 0.988

4.3.3 Xylanase sample

From preliminary studies (Chapter 3), one fungal endophyte identified from 18S RNA sequencing as Preussia sp (EM-4), isolated from Eremophilia maculata, was selected for further analysis (below) and characterization (Chapter 5). The xylan agar plate (Fig 4.18) shows the xylanase zones produced by EM-4 with diameters of 19 mm.

Figure 4.18: Xylanase activity of crude extracellular extracts from EM-4 on solid media containing xylane at 25 °C and pH 5.5

157

4.3.3.1 Analysis of total protein for xylanase samples

The total extracellular proteins secreted by samples of EM-4 grown under different conditions (Table 4.5) are presented in Figure 4.19. EM-4 (S2) (3.13 mg/ml) produced relatively greater amounts of proteins than other seven samples, whilst EM-4 (S1) secreted about half the total extracellular proteins (1.61 mg/ml) than the other two isolates. These results confirmed earlier observations that the amount of total protein does not necessarily correlate with the highest enzyme activities.

4.3.3.2 Comparison of xylanase activity between different samples of EM-4 on solid media

Xylanase production was assessed by the plate-hole diffusion method using the concentrated broth of EM-4 grown in hydrolase-inducing liquid medium with different sources of carbon and nitrogen (Section 4.2.1). Samples (150 µl) with the same concentration of protein (0.5 mg/ml) were added to holes in agar plates (Fig 4.19) containing screening media with xylan substrate and incubated at 25 °C and pH 5.5 for 1 day. At the completion of the incubation period the plates were observed for activity by staining the plates with congo red 1% (w/v) for 5 min followed by distaining with 1M NaCl for 15 min (Peterson et al. 2009a). Confirmation of xylanase activity by zymography will be described in Chapter 5.

3.5 35.00

3 30.00

2.5 25.00

2 20.00 Protein concentration 1.5 15.00 (mg/ml)

1 10.00 Xylanase activity (clear zone mm) 0.5 5.00 Protein concentration(mg/ml) 0 0.00 Xylanase activity( clear zonemm) S1 S2 S3 S4 S5 S6 S7 S8 Endophytic fungus (EM-4)

Figure 4.19: Comparison of enzyme activities and total protein concentrations in different samples of EM-4 (S1-S8) using different sources of carbon and nitrogen at 25 °C and pH 5.

158

4.3.3.3 Comparison of xylanase activity between standard (Aspergillus niger) and

EM-4

Xylanase activity of crude samples from EM-4 and A. niger on xylan subtrate plates demonstrated that the endophytic fungus exhibited much higher xylanase activity in alkaline conditions and higher temperature in comparison with A. niger (Fig. 4.20). Xylanase activity of EM-4 was only observed at pH 5 and pH 7 over a broad temperature range (9 to 50 °C). In contrast, A. niger displayed a more restricted range of activity. The optimal conditions for xylanase activity were 37 °C and pH 5 for EM-4 and 50 °C and pH 7 for A. niger. At pH 7, both A.niger and EM-4 displayed xylanase activity from 25 °C to 50 °C.

45 pH3 40 pH5 35 pH7 30 pH9

25

20

15

10

5

Xylanase Xylanase activity based onclear zone(mm) 0 A. niger EM-4 A. niger EM-4 A. niger EM-4 A. niger EM-4 9°C 25°C 37°C 50°C Fungus/Temperature

Figure 4.20: Xylanase activities of EM-4 and Aspergillus niger (standard) under different pH and temperature conditions

Statistical analysis confirmed that three factors including fungus type (standard and EM-4), pH and temperature and their interactions had significant effects on xylanase activity. The significance of each factor was determined by F values and P values (Table 4.10). The model P value <0.0001 implied the model was significant and all the factors and their interactions with P values less than 0.01 were significant (α=0.01).

159

Table 4.10 Test of significant effect of three factors (pH, Temp and standard/selected endophyte (EM-4)) on xylanase activity Source df Sum of Squares Mean Square F Value P Value Model 31 19545.141 630.488 916.102 <0.0001 pH 3 9955.763 3318.588 4821.922 <0.0001 Temp 3 219.796 73.265 106.455 <0.0001 Fungus 1 341.638 341.638 496.401 <0.0001 pH*Temp 9 5371.313 596.813 867.171 <0.0001 pH*Fungus 3 2278.388 759.463 1103.502 <0.0001 Temp*Fungus 3 288.821 96.274 139.886 <0.0001 pH*Temp*Fungus 9 1089.422 121.047 175.882 <0.0001 Error 64 44.047 .688 Corrected Total 95 19589.187

P values less than 0.01 are significant Probability P (>F) <0.0001; R-Square = 0.997

4.3.3.4 Effect of carbon and nitrogen source on xylanase activity

Statistical analysis showed that three factors including media (different sources of carbon and nitrogen), pH and temperature and their interactions had significant effects on xylanase activity. The average activities using different sources of carbon and nitrogen were compared by the Duncan multiple range test and showed that maltose and glucose as the carbon sources and tryptophan as nitrogen source produced the greatest xylanase activity at 37 °C and pH 5 (Fig. 4.21).

50 a a a b 40 c

d e d 30

mm) 20

10

Xylanase Xylanase activity (clear zone 0 S1 S2 S3 S4 S5 S6 S7 S8 EM-4 growth conditions

Figure 4.21: Comparison of enzyme activities of different samples of EM-4 (S1-S8) grown under optimum conditions of 37 °C and pH 5.

160

These results also were confirmed by statistical analysis which used three factors including fungus type (standard and EM-4), pH and temperature and their interactions. The significance of each factor was determined by F values and P values (Table 4.11).

Table 4.11 Test of significant effect of three factors (pH, Temp and media) on xylanase activity produced by EM-4 Source df Sum of Squares Mean Square F Value P Value Model 127 79280.372 624.255 1858.247 <0.0001 Temp 3 636.758 212.253 631.822 <0.0001 pH 3 70924.299 23641.433 70374.499 <0.0001 Media 7 809.477 115.640 344.229 <0.0001 pH*Temp 9 1280.190 142.243 423.422 <0.0001 pH*Media 21 1648.013 78.477 233.605 <0.0001 Temp*Media 21 1000.555 47.645 141.828 <0.0001 pH*Temp*Media 63 2981.081 47.319 140.856 <0.0001 Error 256 86.000 .336 Corrected Total 383 79366.372 P values less than 0.01 are significant Probability P (>F) <0.0001; R-Square = 0.998

4.3.3.5 Estimation of xylanase activity using best medium to grow EM-4(S3) affected at different temperature and pH

The clear zone produced by xylanase activity formed by crude sample of EM-4 (S3) grown at 37 °C was significantly higher than A. niger (α=0.01) grown under the optimum conditions (Fig 4.22). These results confirmed the optimum conditions for xylanase production by this endophytic fungus in this medium as pH 5.5 and 37 °C. However, the broad range of its xylanase activity might be useful for different industrial and medicinal applications.

161

50

a a 45 b b 40 c d 35 e 30 25 20 15 10

Xylanase Xylanase activity (clear zonemm) 5 0 A. niger pH3 pH5 pH7 pH9 9°C 25°C 37°C 50°C

Endophytic fungus EM-4(S3)

Figure 4.22: Comparison of specific xylanase activities between Aspergillus niger and EM-4 (S3) grown at different temperatures and pH. Means followed by the same letter within a column are not significantly different at P<0.01 according to the Duncan multiple range test. Variable pH experiments were performed at 25 °C, while variable temperature experiments were performed at pH 5.5. A. niger was grown under its optimum conditions (50ºC and pH 7) with respect to xylanase production.

4.4 Discussion

The natural ability of fungi to secrete enzymes and their metabolic flexibility make them perfect for industrial applications. Fungi can be grown in simple, inexpensive liquid media and are suitable for genetic manipulation to improve enzyme production and stability. Furthermore, the enzymes that they secrete can be easily collected as the supernatant from the fungal mycelia and studied using biochemical and protein analysis techniques, without the need for cell lysis (Kavanagh 2005). Whereas small scale laboratory cultures provide an effective tool for characterising the enzyme activities of new fungal species or strains, large fermenter cultures of industrially established fungi have been used widely for the production of commercial enzymes. A considerable amount of time and labour is involved when enzyme characterisation is carried out by manual enzyme assays. Automation by robotics is becoming increasingly common for large-scale projects and greatly improves throughput. Furthermore, protein microarrays can now facilitate kinetic measurements of enzyme activity in real time using continuous fluorescence measurements, and enable the rapid determination of the 162 properties, substrate preference, inhibitors, activators and metabolic cofactors of the enzymes tested (Lue et al. 2005). The fungal species most widely used for industrial enzyme production are from the genera Trichoderma, Aspergillus and Penicillium (Aehle 2007). In the work described in Chapter 3, seven fungal isolates from E. longifolia and E. maculata were selected for further optimisation and characterization of their enzyme activities (Section 3.3.2). Most of the hydrolase activities of the fungal isolates that were presented in the agar plate assays were also displayed in liquid assays carried out the supernatants of the endophytic fungi grown in the hydrolase-inducing liquid media. But not all the time these results are expected. For example, Peterson and colleagues (Peterson et al. 2011a) reported the differences between plate assay results and liquid assay results for just one or two individual enzyme activities of fungal isolates from koala faces. They found mannanase activity was not displayed by Gelasinospora cratophora in the agar plate assay; however the isolate was ranked third in comparison to the other fungal isolates for mannanase activity in the liquid assays. They suggested that the mannanase activity of G. cratophora could not be induced by locust bean gum in the agar plate medium (Peterson et al. 2009a) but was induced by cellulose or other substrates (lactose, soybean flour) provided in the liquid hydrolase- inducing medium (Peterson et al. 2011a). It is also possible that the mannanase activity displayed by G. cratophora could be produced by an endoglucanase, induced by cellulose but with mannan degrading abilities, as has been previously reported for endoglucanase II of T. reesei (Macarrón et al. 1996). In contrast, Doratomyces stemonitis revealed the highest amylase activity of all the koala fungal isolates using plate assays, but amylase activity was very low in most of the liquid amylase assays following growth in the hydrolase-inducing medium. This indicated that the D. stemonitis amylase was principally an inducible enzyme secreted in the presence of starch, a substrate that was included in the agar plate medium (Peterson et al. 2009a) but not in the hydrolase-inducing liquid medium (Peterson et al. 2011a). Peterson also suggested the inability of most of the fungi to grow in oxidase- inducing liquid media in comparison with lignin agar plates was due to their oxidase activities alone being insufficient to access sufficient nutrition to sustain growth under liquid cultivation conditions. This is not unusual amongst ascomycetous fungi, as hydrolases naturally form the major part of their enzyme systems (Griffin 1994). All of

163 the selected fungi had secreted oxidases on solid media as revealed by the degradation of the phenolic units of lignin in the agar plate assays. It is possible that the ability to secrete oxidases simply may not have transferred well to cultivation in liquid media. Similar observations have been previously reported for numerous fungal strains (Rodríguez Couto and Sanromán 2005, Téllez-Jurado et al. 2006). Furthermore, many of the isolates presenting activity in the agar plate assay may have only secreted mild oxidants such as GMC (glucose/methanol/choline) oxidoreductases that can only oxidise the phenolic units of lignin but not fully degrade the lignin polymer. The mild oxidants may not have supported the fungi to access sufficient nutrition to continue growth in the oxidase-inducing liquid media. Still, it could play an important role in the survival of the fungi by increasing the access of secreted hydrolases to polysaccharides in the lignocellulosic biomass (Lopez et al. 2007). The secretion of amylases is substrate-induced in many fungi and low level amylase activity is reported in most species (Radford 2004). Consequently, in our work, during the preparation of extracellular enzyme extracts, endophyte EL-14 was grown on two different media (Nguyen et al. 2002, Peterson et al. 2011a) and the result of amylase activity confirmed the effect of different inducing media on endophytic enzyme production. A noticeable difference was seen in the protein production with the medium of Peterson et al. (2011a) being more favourable in terms of quantity of extracellular enzymes which is ideal for investigation of the fungal secretome (Chapter 5). However, the medium of Nguyen et al. (2002) was customised (having starch as the substrate in the medium) for production of amylase and this effect was observed in the amylase enzyme assay (Section 4.3.1.2) and electrophoretic analysis (Chapter 5). Based on the hydrolase activities observed for fungi in the agar plate assays and liquid enzyme assays, it could be concluded that the agar plate assay had generally provided a good screening tool for measuring hydrolase activities of the fungi grown in liquid media. The enzyme features that are essential for the survival of fungi in their ecological niche can be valuable to industry. Enzymes for inclusion in detergents for washing in cold water need to be active at a low temperature and high pH. In contrast, the manufacture of pulp, paper and textiles requires enzymes that are active at a high temperature, while dairy and other food production processes often require enzymes to function at a low temperature and low pH (Lange 2004). Isolating endophytic fungi from plants that inhabit unique and harsh environments increases the chances of finding

164 those species that produce extracellular enzymes which are heat stable and retain activity under high or low pH conditions (Beg et al. 2001). Of the endophytes investigated in this study, EL-14s was active across all temperatures under acidic pH, thus its enzymes have potential application in the detergent, confectionary industry and food industry. In contrast, EL-15 showed amylase production at the extremes of the temperature range and is suitable in the textile industry (Asoodeh et al. 2010). The comparison of amylase activities between endophyte EL-14s and standard (A. oryzae) (Fig 4.9) confirmed the potential for using endophyte enzymes in different industrial applications which need lower pH, high pH and low temperature, such as confectionary and food industries or detergent industries, respectively. Since 34 % of the applications of microbial enzymes are as detergents and the second-most important application (14 %) is in the dairy industry (Morgan et al. 2009), EL-14s could be a new candidate for use in these industrial applications. To optimise enzyme production, assays were performed of P. minima (EL-14s) culture supernatants following incubation in the second hydrolase-inducing medium (Nyugen et al. 2002) at different temperatures and pH. The optimum temperature and pH based on specific enzyme activity were 25 °C and 9 (Fig 4.10), respectively; however, activity at low temperature was also notable.The optimum temperature and pH conditions of amylase production are likely to reflect the climatic conditions found in environments inhabited by the original host plant. Specific activity (138 U/mg) at pH 9 was significantly remarkable (Table 4.6) in comparison with activities previously reported (Varalakshmi et al. 2009, Gupta et al. 2010, Sasi et al. 2010, Nwagu et al. 2011, Pengthamkeerati et al. 2012). α-amylases from most fungi exhibits pH optima in the acid to neutral range; however, the enzyme from EM-14s appears to be exceptional with a pH optimum of 9. Amylase activity under these conditions of low optimum temperature and alkaline pH optimum would be desirable for the application of this enzyme in the detergent industry as an additive to remove starch-based stains (Lange 2004). The effect of metal ions on total amylase activity was studied with CaCl₂ and MnCl₂ increasing the total amylase activity in comparison to the control (Fig 4.12), confirming to previous reports which indicated that amylases are mostly metalloenymes and require calcium and manganese ions for activity, structural integrity and stability (Sivaramakrishnan et al. 2006, Varalashmi et al. 2009, Michelin et al. 2010). Calcium enhances amylase activity by its

165 interaction with negatively charged amino acid residues such as aspartic and glutamic acids (Sahnoun et al. 2012). Magnesium and sodium ions were found to inhibit amylase activity and similar observations were made by Varalakshmi et al. (2009) and Reyed (2007). The results obtained with MnCl₂ suggest that this salt may be a useful culture additive to increase enzyme production. The effects of different nitrogen and carbon sources suggested that inclusion of starch and L-asparagine (in the standard medium) produced significantly higher specific activity of 138 U/mg (Fig 4.11 and Table 4.7). Replacement with three different carbon (maltose, cellulose and glucose) and nitrogen (ammonium nitrate, yeast extract, peptone and tryptophan) sources did not increase production of amylase. This suggests that enzyme activity is linked to biomass production and starch has an important role in inducing amylase production. Many previous reports showed the same effect on enzyme activity by changing the conditions of fermentation (Varalakshmi et al. 2009, Gupta et al. 2010, Pengthamkeerati et al. 2012). Since fungi do not naturally produce enzymes at levels high enough for commercial purposes, fermentation is undertaken to increase the secretion of target enzymes to levels that are economically sustainable. Consequently, environmental screening programs are used to seek enzymes from various environments, with the view to express these enzymes in highly secreting production hosts (Teter and Cherry 2005). In this study, the protease activities of three fungal endophytes originally isolated from the leaves of E. longifolia were determined by enzyme assays (Section 4.3.2.3). These endophytes were cultivated in a specific medium (Peterson et al. 2011a) designed to induce expression of hydrolysing enzymes, including proteases. The use of skim-milk agar plates was found to be an easy and rapid technique to screen for proteases. This supports the work of Saran and co-workers (2007) who concluded that this method is of great benefit due to its simplicity, although it cannot be applied to quantitative studies. The highest protease activity was produced by an endophytic fungus identified as Alternaria alternata. A. alternata is a plant pathogen commonly affecting many crops, such as grapevine, watermelon, and blueberries, in the field and during post-harvest storage. It also plays a role in biodeterioration, although not this is not as fast as Aspergillus niger (Musetti et al. 2007, Maheswari and Sankaralingam. 2010, Greco et al. 2012) . The fungus can be isolated from many sources such as wood

166 logs (Xiao et al. 2012), and different plants (Guo et al. 2004, Musetti et al. 2007, Maheswari and Sankaralingam 2010, de Siqueira et al. 2011). A. alternata can produce many secondary metabolites such as diketopiperazines (Musetti et al. 2007), extracellular enzymes (Xiao et al. 2012), and tenuazonic acid (Zhou and Qiang 2008, Logrieco et al. 2009). However, their characteristics depend on living conditions (e.g. pH and temperature), host-relationships (e.g. specific or non- specific) or pathogenicity (Logrieco et al. 2009, Maheswari and Sankaralingam 2010). These features make A. alternata a potential source of industrial enzymes (Xiao et al. 2012) or substrates for medicine (de Siqueira et al. 2011). Using the QuantiCleaveTM Protease Assay, A. alternata (EL-17) was found to be a good secretor of protease with its crude extracellular supernatant expressing 69.86 BAEE units per mg at optimal conditions (Fig 4.16) which is comparable with trypsin (specific activity of 40.0 BAEE units per mg). Nonetheless, there is a limitation of the QuantiCleave Protease Assay in that only trypsin is used as a control protease and thus the protease activity is quantified in terms of trypsin (as a subclass of serine protease). However, catalytic proteases are classified as aspartic, cysteine, threonine, serine and metalloproteases (López-Otín and Bond 2008) and there is a possibility that different proteases belonging to each catalytic class are produced by A. alternata. One intriguing observation is that the protease activity of A. alternata EL-17 was greater than the other endophytes despite its lower overall protein content. A similar observation was made by Peterson and co-workers (2011a) in relation to the protease activity of Doratomyces stemonitis C8. Of the three endophytic fungi, A. alternata EL-17 was selected for further optimisation of enzyme production since it was found to be a very good secretor of protease. The results presented in Fig 4.16 indicated that this endophyte can produce protease in a wide range of pH (3.0 to 9.0) and temperatures (9 °C to 50 °C). The pH range is wider than that of an A. alternata isolate described by More et al. (2009) which reported the proteases activity in range pH 4 -7.5. In addition, protease production by A. alternata EL-17 at 50 °C showed that this enzyme can tolerate higher temperatures than the isolates described previously by More et al. (2009) and Dunaevsky et al. (1996). These results indicated that the optimum conditions for protease production of A. alternata EL-17 were 37 °C and pH 7 with soybean as substrate compared with the optimum conditions of 48 °C, pH 9.1 and casein as substrate described by Dunaevsky et

167 al. (1996) and 45 °C, pH 5.5 with soybean seed powder as substrate reported by More et al. (2009). Negi and Banerjee (2010) found that the optimum parameters were 35 °C and pH 5.5 for protease production from Aspergillus awamori nakazawa MTCC 6652 incubated in Czapek-Dox medium for 96 hours. These variances in protease activity might be due to differences in substrates used for the fermentation as extracellular enzyme production can be influenced by the protein substrate and the composition of the medium (Vermelho et al. 1996). It is reported in other studies that Aspergillus niger I1 displayed protease activity at pH 3 (Siala et al. 2009). In contrast, the activity of A. alternata EL-17 was lowest at pH 3 (Fig 4.16). This result suggests that a variety of fermentation conditions are suitable for the production of proteases by this endophytic fungus. Figure 4.16 shows that the enzyme was very active at pH 7 while its activity decreased considerably with pH lower and higher than 7. Muthulakshmi and colleagues (2011) reported that the protease of Aspergillus flavus exhibited maximum activity at pH 7. In the present study, supplements to the basic Czapek -Dox medium were investigated for their effects on the protease production of A. alternata EL -17 (Fig 4.17). The results indicated that not all carbon and nitrogen sources had positive effects on protease production. It was observed that fungal growth was superior when the medium was supplemented with specific carbon and nitrogen sources, which reflected the reported levels of enzyme production. This also suggests that enzyme activity is linked to biomass production. In addition, it was previously seen that EL-17 is not a good secretor of amylases (Chapter 2), possibly explaining why starch was not a good carbon source. Many media have been used for protease production and media components as well as incubation conditions are different for different organisms. Sumantha et al. (2006) reported that various substrates had different effects on the protease production of Rhizopus microsporus NRRL 3671, with the nitrogen sources casein, peptone and yeast extract reducing protease activity and the carbon sources maltose and lactose increasing protease activity. Negi and Banerjee (2010) reported that various carbon and nitrogen supplements had different effects on the protease and amylase production of Aspergillus awamori nakazawa MTCC 6652. In addition, lactose and casein (Dunaevsky et al. 1996) were reported as inducers and stabilizers of protease production by A. alternata. In the present study, different sources of carbon and nitrogen showed significant effects either in protease production or enzyme activity.

168

The effects on protease activity of all variables investigated (i.e. temperature, pH, carbon source and nitrogen source) were all shown to be significant by statistical analysis as presented in Table 4.9. However, positive effects were only seen with specific factors that increased protease production such as temperature and pH, soybean as the carbon source and tryptophan or yeast extract as the nitrogen source. Thus, these factors would be important parameters to consider for scale-up protease production. Xylanases are glycanase enzymes which catalyze the endohydrolysis of the linear polysaccharide beta-1, 4-xylan into xylose (Collins et al. 2005). They play important roles in production of xylose, a primary carbon source for cell metabolism, and in plant cell infection by plant pathogens and endophytes. They are produced from many sources such as bacteria, algae, fungi, protozoa, gastropods and anthropods (Prade 1995, Rezende et al. 2002, Bakri et al. 2013), of which Aspergillus and Trichoderma are the main fungal sources (Vikarii et al. 1994). Given the large size of the primary substrate, xylanases are excreted into the extracellular environment (Collins et al. 2005). Hydrolase enzymes make up 75% of the industrial enzyme market and carbohydrolases such as cellulases, amylases and hemicellulases are the second largest group after proteases (Bhat 2000). It is believed that the activity of xylanases produce xylo-oligomers which may be transported into the cell where they are further degraded by β-xylosidases, or indeed by intracellular xylanases (Fontes et al. 2000, Teplitsky et al. 2000). Although xylanases are the major commercial hemicellulases, they represent only a small percentage of total enzyme sales, however this is expect to increase due to their potential applications (Collins et al. 2005). They offer a wide range of potential industrial uses in food (Bhat 2000 ), in feed (Mathlouthi et al. 2003), production of ethanol and xylitol (Ali et al. 2013), in recycling paper to make deinked pulp (Pala et al. 2004), in brewing (Tikhomirov et al. 2003), in coffee extraction and in the preparation of soluble coffee (Wong 1988), in detergents (Kumar et al. 2004), in the protoplastation of plant cells (Kulkarni et al. 1999), in the production of pharmacologically active polysaccharides for use as antimicrobial agents (Christakopoulos et al. 2003) or antioxidants (Katapodis et al. 2003), in the production of alkyl glycosides for use as surfactants (Matsumura et al. 1999) and in the washing of precision devices and semiconductors (Imanaka et al. 1992). They can be used alone or in conjunction with

169 other enzymes and, in particular, with other hydrolases, proteases, oxidases and isomerases (Collins et al. 2005). Currently, xylanases are mainly used in pulp and paper industries which requires high temperature (55-70 °C) and alkaline pH (Beg et al. 2001) for efficient bleaching. Thermo-alkaliphilic or even thermo-acidophilic xylanases can also be used for bioconversion processes where the enzymatic processes require many extreme treatments such as hot water, steam explosion, alkaline, solvent or acidic pretreatments (Mielenz 2001, Saha 2003). In addition, the alkaliphilic xylanases might be used for detergent applications where high pH are commonly used and thermostable xylanases are suitable for use in animal feed that required high temperatures for production of around 70-95 °C. For the latter application, the enzymes must also have high activity (approximately 40 °C and pH of about pH 4.8) in the conditions of the digestive tract (Campenhout et al. 2003). In this study, culture supernatants collected following incubation in the first hydrolase-inducing medium (Peterson et al. 2011a) of the selected endophytic Preussia sp. (EM-4) isolated from E. maculata was tested at different temperatures and pH. The experimental design involved a wide range of pH (3-9) and temperature (9 ºC-50 ºC). Consequently, the optimum conditions for xylanase activity were determined to be 37ºC and pH 5 compared with standard A. niger growing in the same conditions of 50 ºC and 7 (Fig 4.21). Similar activities were reported for xylanases from A. niger the white-rot fungus, Pleurotus ostreatus (Qinnghe 2004). Furthermore, xylanase activity produced by A. niger described by Solima et al. (2012) showed the optima of 35 °C and pH 5.5, similar conditions to EM-4. The fact that the endophytic Preussia was stable in the range of pH 5 to 7 and also active at low temperature suggested it would be suitable for applications such as a detergent or in the food industry. Most reports have confirmed xylanase activity at high temperatures for different organisms (Shi et al. 2013, Giannesi et al. 2013). Optimal temperature and pH for xylanase production by Chaetomium themophilum were 70 oC and at pH range 5-7, respectively (Katapodis et al. 2007). Similar optima (80 oC and pH 6.5) were reported by Medicuti-Castro (1997) for a thermotolerant Aspergillus strain. Statistical analysis indicated a dramatic influence on xylanase production for the four carbon sources studied (Fig 4.22). In fact, maltose was found as most suitable carbon sources for maximum xylanase production compared to other carbon sources

170

(glucose, starch and lactose) at the same processing conditions. With respect to nitrogen sources, tryptophan and peptone were found to be the best organic nitrogen sources for xylanase production. Qinnghe (2004) found that mixtures of corn cob and wheat brand as carbon sources and peptone, beef extract and yeast extract as nitrogen sources were the most effective carbon and organic nitrogen sources for the production of xylanase from white-rot fungus Pleurotus ostreatus . In general, xylanase production was far more effective using organic nitrogen than inorganic nitrogen. This result parallels the results from studies of Pleurotus eryngii in liquid fermentation (Song et al. 2001). It could be possible that organic nitrogen contains a diverse range of amino acids and that these can be absorbed directly by mycelia, resulting in greater biomass and the production of more extracellular enzymes, including xylanase. Among the various inorganic and organic nitrogen sources tested, peptone was found to be the best in stimulating xylanase production by P. ostreatus. The optimal carbon and nitrogen sources for the production of xylanase from Chaetomium themophilum were 3% wheat straw and 0.7% sodium nitrate (Katapodis et al. 2007). Moreover, Solima (2012) showed that barley bran was the most effective carbon source used to produce xyalnase by A. niger without additive nitrogen sources. In summary, endophytes which can produce many types of bioactive secondary metabolites are of great interest (Joseph and Priya 2011, Zaferanloo et al. 2012). Between three selected samples, EL-14s (P. manima) produced the highest amylase activity at 25 °C and pH 9, respectively. The enzyme was activated and stabilized mainly by the metal ions manganese and calcium. It was observed that enzyme activity was highest (138 U/mg) with starch as the carbon source and L-asparagine as the nitrogen source. The amylase from this endophyte can be applied to the detergent industry where the fermentation conditions are suitable to the activation of amylase. EL-17 (A. alternata) was a good secretor of total protein and showed good protease activity in a wide range of pH (3 to 9). The broadest protease activity was observed at pH 7 with the enzyme showing activity between 9 °C and 50 °C. However, the optimum conditions for activity were 37 °C and pH 7 with an optimum specific activity value of 70 BAEE units/mg. Enzyme activity was also studied using different carbon and nitrogen sources which confirmed that tryptophan and yeast extract as nitrogen sources and soybean as the carbon source had significant effects on protease

171 activity. From these preliminary data, it can be suggested that the protease from EL-17 can be applied to cheese making and in milk-clotting where the fermentation conditions are suitable to the activation of protease (Benlounissi et al. 2012, Fazouane-Naimi et al. 2010) EM-4 (Preussia sp.) was known to be active in a broad range of temperature (9- 50 oC). However, optimal conditions for xylanase activity were 37 °C and pH 5. The optimum fermentation medium for xylanase activity contains maltose as a source of carbon and tryptophan as a source of nitrogen. This primary data suggested that the properties of xylanases produced by this endophyte can be applied in the process of enzyme-assisted animal feed and detergent industry.

172

Chapter 5

Purification and characterization of hydrolytic enzymes and investigation of the secretome of selected endophytes

5.1 Introduction: Endophytes as the sources of secondary metabolites and enzymes

Endophytes inhabit a myriad of host plants ranging from herbaceous plants in the Artic, alpine and xeric regions to tropical and mesic forest habitats. The various species that they inhabit include ferns and mosses, hepatics, gymnosperms and angiosperms, estuarine plants and many other evergreen perennials (Tan et al. 2001). The endophytic population of a plant depends on factors such as climate, season and ecology. It also varies depending on the time of plant sample collection. The host-endophyte relationship is under evaluation though it is commonly accepted that microbes are transferred to the plants through soil, entering through open spaces in roots and becoming endophytic. It is while carrying out activities for survival such as host defence, mobility and migration that endophytes produce a range of secondary metabolites and enzymes (Zafernaloo et al. 2012). Such secondary metabolites and enzymes play important roles for many metabolic interactions between the fungi and their host plants which includes defence, cell signalling and regulation of their symbiotic relationship (Borges et al. 2009). These metabolic interactions favour the biosynthesis of many other bioactive natural products. Endophytes are considered as an outstanding source of various small molecules as the study of natural products from plants have shown that their endophytes produce a significant number of interesting novel and bioactive compounds. Some endophytes interact mutualistically with their hosts whereby they cause improved growth, induced resistance to pathogens, and biotic and abiotic stress tolerance in the host (Junker et al. 2012). The endophytes in turn

173 profit from the host plant by receiving organic nutrients, shelter and guaranteed transmission to the next host generation (Borges et al. 2009). Fungi constitute a major proportion of the endophytic population. As these endophytic fungi are unable to ingest or produce their food, they obtain their nutrition from the host plant. For this, they carry out extracellular metabolism of nutrients into an absorbable form by producing secondary metabolites and enzymes. This characteristic feature of the fungal lifestyle and their endophytic nature leads to the potential of these fungi to produce many hydrolysing enzymes to aid the digestion process (Zafernaloo et al. 2012). Endophytes have been previously proved to be novel source of various industrial enzymes such as amylase, protease, xylanase, ligninase, pectinases and cellulose. These enzymes have been studied extensively at the biochemical and genetic level due to their wide range of applications. They have been utilized as food and feed additives and also in the saccharification of plant biomass for the production of bioethanol (Oliveira and Graaff 2011). High quality enzymes are often sought after by the above-mentioned industries for cost-effective, efficient and environmentally friendly production processes which minimize the use of water, energy and raw materials. Enzymes, being biodegradable, offer a better option compared to synthetic chemicals (Laird et al. 2006). The secondary metabolites include diverse chemical compounds and hydrolytic enzymes which are produced by remarkable secretor fungi which have granted them a prominent role in biotechnology (Archer et al. 2008). Many of secondary metabolites show anti-microbial, anti-insecticidal and cytotoxic (anti-cancer) which could be used for treating and curing various human ailments. It is suggested that the hydrolytic enzymes secreted by fungi have developed to degrade the complex structure of plant cell wall (McCann et al. 2008). The most noticeable enzymes that are secreted in the process of plant cell wall decomposition are hemicellulases (e.g. xylanases), cellulases, pectinases, proteases and amylases which have wide biotechnological and industrial applications. The enzymes are being applied as food and feed additives and are used in the saccharification of plant biomass for the production of bioethanol (Shimokawa et al. 2009). These microorganisms represent a potential source of novel natural products for medicinal, agricultural and industrial uses, such as antibiotics, anticancer agents, biological control agents, metabolic properties useful for bioremediation, production of ethanol-based biofuels and other bioactive compounds. Metabolites exploited in

174 pharmaceutical and environmental industries are widespread among endophytic fungi (Petrini et al. 1992, Russel et al. 2011, Zhao et al. 2013, de Almeida et al. 2013). Endophytes have therefore become a “hot topic” in metabolite and enzyme discovery due to their high biodiversity and predicted potential to produce novel compounds. One way to discover these diverse compounds is study their secretome.

5.1.1 Fungal secretomes: extracellular insights into efficient substrate utilisation

Endophytic fungi respond to their environment by regulating the secretion of enzymes and other proteins that have been developed to derive energy from the available substrates in the most effective way possible. The secretome, which is the complete set of secreted proteins, can provide information about the way the fungus cooperates with its host-plant and can also offer insight into effective enzyme combinations for various biotechnological applications (Kuhad and Singh 2007). Although secreted enzymes are an abundant and renewable resource to the microbial enzyme industry, an individual enzyme rarely acts alone, particularly in nature. Fungi typically secrete numerous enzymes simultaneously and, through a synergistic process, the enzymes may increase the impact of each other on the available substrates. A number of secretome studies of fungi have been undertaken in the last decade for different reasons. Some of the studies have focused on the interactions that fungal species have with their environment, such as their role in plant pathogenesis (Mueller et al. 2008). Other studies have been undertaken to discover the secreted proteins of fungi involved in cellulose or lignocellulose degradation to improve efficiency of enzyme combinations for production of ethanol from lignocellulose biomass (Bouws et al. 2008) or the symbiotic relationship between mychorrhizal fungi with plant roots (Nagendran et al. 2009). Most of the proteins characterized, though not sequenced yet, are of industrial importance such as amylases, proteases and cellulases (Polaina and MacCabe 2007). Though secretome analysis of Aspergillus, Trichoderma, Fusarium, Phanerochaete chrysosporium and Coprinopsis cinerea has been reported (Bouws et al. 2008), many proteins are yet to be identified. Several proteins identified from those fungi include peptidolytic enzymes (alkaline protease, alanyl dipeptidyl peptidase), glycosidases (e.g., α-amylase, β-galactosidase) and oxidoreductases (e.g. catalase and xanthine dehydrogenase). Several other enzymes were identified from T. reesei including

175 glycosyl hydrolases, β-1, 4-endoglucanases, β-1, 4-exoglucanases, two xylanases, α-L- arabinofuranosidase, an acetyl xylan esterase and a β-mannanase (Bouws et al. 2008). Proteomic analysis via gel electrophoresis and mass spectrometry plays a major role in the majority of the secretome studies (Table 5.1). Bioinformatic analysis of secreted proteins has been used to investigate the secretomes of unknown endophytic fungi by comparison with sequenced genomes (Ouyang et al. 2005, Nagendran et al. 2009) and to compare to experimental proteomic data (Vanden Wymelenberg et al. 2005, Vanden Wymelenberg et al. 2006, Tsang et al. 2009). Transcriptome analysis by microarray and RT-PCR has been used to link gene predictions to expressed proteins (Vanden Wymelenberg et al. 2009, Vanden Wymelenberg et al. 2010). The secretomes of fungi without sequenced genomes have been investigated successfully using cross-species identification (Medina et al. 2004, Zorn et al. 2005, Marx et al. 2013).

Table 5.1 Secretome studies of filamentous fungi (expanded from Bouws et al. 2008) Fungal species Techniques Carbon source Reference Amanita Genome based - Nagendran et al. 2009 bisporigera prediction Aspergillus niger Genome based Varied (eg. glucose, Tsang et al. 2009 prediction pectin, xylan) Ferreira de Oliveira et LC MS/MS al. 2011 Aspergillus oryzae 2DE Wheat bran Oda et al. 2006 MALDI-TOF/MS Alternaria 2DE - Seok et al. 2005 brassicicola MALDI-TOF/MS Aspergillus flavus 1DE, 2DE Rutin Medina et al. 2004 LC MS/MS, Medina et al. 2005 MALDI-TOF/MS Coprinopsis cineria Genome based Glucose, yeast extract, Hoegger et al. 2007 prediction peptone 2DE, LC MS/MS Fusarium 1DE 13 different media Paper et al. 2007 graminearum LC MS/MS (eg. xylan, pectin, corn stover)

176

Table 5.1 Secretome studies of filamentous fungi (expanded from Bouws et al. 2008) Fungal species Techniques Carbon source Reference P. chrysosporium Genome based Crystalline cellulose Vanden Wymelenberg prediction et al. 2005 1DE, LC MS/MS RT-PCR P. chrysosporium Genome based Ligninolytic media (carbon Vanden Wymelenberg prediction or nitrogen limited) et al. 2006 1DE LC MS/MS P. chrysosporium 1DE, 2DE Glucose, cellulose or Sato et al. 2007 LC MS/MS woodchips

P. chrysosporium Genome based Ligninolytic media Vanden Wymelenberg prediction (carbon or nitrogen et al. 2009 1DE, LC MS/MS, limited) microarray P. chrysosporium Genome based Ball-milled aspen Vanden Wymelenberg prediction et al. 2010 1DE, LC MS/MS RT-PCR, microarray Pleurotus sapidus 2DE Peanut shells, Zorn et al. 2005 MALDI-TOF/MS rape straw LC MS/MS Postia placenta Genome based Ball-milled aspen Vanden Wymelenberg prediction et al. 2010 1DE, LC MS/MS RT-PCR, microarray Trichoderma 1DE, 2DE Chitin, fungal cell walls Suárez et al. 2005 harzianum MALDI-TOF/MS LC MS/MS

177

Table 5.1 Secretome studies of filamentous fungi (expanded from Bouws et al. 2008) Fungal species Techniques Carbon source Reference T. reesei 2DE Lactose Herpoël-Gimbert et al. RUT-C30 and CL847 MALDI-TOF 2008 LC MS/MS Jun et al. 2011 T. reesei RUT-C30 2DE Rice straw Sun et al. 2008 LC MS/MS T. reesei RUT-C30 1DE Corn stover Nagendran et al. 2009 LC MS/MS Ustilago maydis Genome based - Mueller et al. 2008 prediction Doratomyces stemonitis 2DE Lactose- Peterson et al. 2011b C8 LC MS/MS Cellulose Phanerochaete 2DE, MALDI-TOF/MS Wood chips Abbas et al. 2005 chrysosporium LC MS/MS

Information about fungal secretomes can result in understanding of how fungi survive in their natural habitats and aid in the discovery of novel enzymes and enzyme combinations that could be of interest to industry.

5.1.2 Gel electrophoresis

One-dimensional gel electrophoresis (1DE) is a well-established procedure (Laemmli 1970) and can be used to separate proteins within a fungal supernatant according to their molecular weight (Fig. 5.1a). In two-dimensional gel electrophoresis (Fig. 5.1b), proteins are firstly separated according to their isoelectric point (i.e. the point at which they carry no net charge) and then further fixed according to their molecular weight, forming a two-dimensional visual “map” of a protein mix (Walker 2005). Following electrophoresis, protein bands or spots from 1D or 2D gels can be removed and identified using mass spectrometry.

178

Figure 5.1: Schematic demonstrating protein separation by a) 1D electrophoresis in which

proteins are separated into bands according to their molecular weight (MW); and b) 2D electrophoresis in which proteins are further resolved across two dimensions, molecular weight (MW) and isoelectric point (pI).

In case of working with enzyme as protein, zymography (Fig. 5.2) used to confirm the present of related activity. It is a method of enzyme analysis in which the proteins present in a sample are separated by gel electrophoresis, typically one dimensional (1D) electrophoresis. The process can be used to analyse a fungal supernatant to determine the approximate molecular weight and number of enzymes or enzyme isoforms it contains that are active against a particular substrate. To run a zymogram gel, the substrate for the target enzyme is incorporated into a polyacrylamide gel. Samples are prepared in a style that minimises protein denaturation to avoid loss of enzyme activity. Following separation of proteins in the sample by electrophoresis, the gel is placed into a renaturing buffer, which reactivates the enzymes, and then transferred to an appropriate incubation buffer. Digestion of the substrate in the gel occurs where proteins possessing the target enzyme activity are located, and is usually visualised by staining.

179

Figure 5.2: Schematic of the 1D zymography technique. a) Proteins in a sample are separated by their molecular weight (MW) by electrophoresis on a gel containing the substrate of the target enzyme; b) The protein gel is placed in a renaturation buffer to restore enzyme activity; c) The gel is incubated in a suitable buffer; d) The gel is stained and washed; e) Proteins with enzyme activity against the substrate are revealed as bands on the zymogram.

5.1.3 Exploring a secretome: methods of protein analysis

To detect proteins presented within a fungal secretome, supernatants from liquid cultures are typically analysed by gel electrophoresis and mass spectrometry summarised in Fig. 5.3.

180

Figure 5.3: The mass-spectrometry/proteomic experiment. A mixture of proteins is prepared from a biological source such as cell culture and the last step in protein purification is often SDS– PAGE. The gel bands/spots that are achieved are excised into several slices, which are then in-gel digested. Many different enzymes and/or chemicals are available for this step. The generated peptide mixture is separated on- or off-line using single or multiple dimensions of peptide separation. Peptides are then ionized by electrospray ionization (depicted) or matrix-assisted laser desorption/ionization (MALDI) and can be analysed by various different mass spectrometers. Finally, the peptide-sequencing data that are obtained from the mass spectra are searched against protein databases using one of a number of database-searching programmes. Examples of the reagents or techniques that can be used at each step of this type of experiment are shown beneath each arrow. 2D: two-dimensional; FTICR: Fourier-transform ion cyclotron resonance; HPLC; high-performance liquid chromatography (Was taken from Steen and Mann 2004).

5.1.3.1 Mass spectrometry

Mass spectrometry is now the most broadly established and utilised method of protein identification (Ahrens et al. 2010). Following gel electrophoresis, protein samples that are contained in a gel spot or band, are fragmented into smaller peptides using trypsin or another suitable proteases. The resulting fragments are then exposed to ionisation, most commonly Matrix Assisted Laser Desorption/Ionisation (MALDI) or Electrospray Ionisation (ESI). MALDI (Fig. 5.4a) involves application of the sample into a matrix material, which absorbs at the wavelength of a laser used to bombard the material. Electrospray ionisation of a protein sample (Fig. 5.4b) is usually carried out in conjunction with reversed phase nano-high performance liquid chromatography (nano- HPLC). A solvent gradient of increasing organic content is applied and peptides are eluted in electrostatically charged precipitations according to their hydrophobicity (Steen and Mann 2004). Multiply charged ions are then sent into a vacuum chamber for mass analysis.

181

Figure 5.4: Ionisation methods used for protein analysis by mass spectrometry: a) Matrix Assisted Laser Desorption/Ionisation (MALDI); b) Electrospray Ionisation (ESI) (Was taken from Steen and Mann 2004).

Mass analysers utilise either electric or magnetic fields to separate and identify ions according to their mass-to-charge ratio. The most commonly used mass analysers for protein analysis are time of flight (TOF), quadrupole and quadrupole-ion trap analysers. In a TOF analyser, ions are accelerated along a field-free tube. The time taken for the ions to reach the detector is measured and is proportional to their mass-to- charge ratio (Graham et al. 2007). Quadrupole mass analysers process ions by passing them through a radio frequency quadrupole field containing four parallel cylindrical rods. At any one time, only the ions of one particular mass-to-charge ratio will reach the end of the analyser for detection, whilst others collide with the quadrupole rods (Aitken 2005). Similarly, an ion trap uses an electric field that holds the ions and then sorts the ions by sequentially ejecting ions of a particular mass-to-charge ratio to be detected.

182

Following ion detection and mass analysis, a mass spectrum is generated, resulting in a peptide mass fingerprint (PMF) of the protein. The most abundant peptide ions from ESI or MALDI can then be further fragmented by “collision-induced- dissociation” (CID), in a process termed tandem mass spectrometry (MS/MS; Graham et al. 2007). The resulting MS/MS spectra are then used to elucidate the peptide sequence (de novo sequencing) or compared to the predicted fragmentation of known proteins by database analysis. Hybrid mass spectrometers are becoming more common whereby several of the above-mentioned techniques are performed by the one instrument. For example, MALDI-TOF/TOF mass spectrometers combine a MALDI ion source with a TOF analyser, followed by a CID fragmentation cell, and another TOF analyser to produce MS/MS fragmentation spectra (Gogichaeva et al. 2007). Quadrupole-time-of-flight (Q- TOF) mass spectrometers combine a TOF analyser with a triple quadrupole linked to an ESI source to achieve even higher resolution and very high mass accuracies (Chernushevich et al. 2001). A LC-ESI-MS/MS using an Agilent 1100 Series HPLC coupled to an Agilent LC/MSD Trap XCT Plus Mass Spectrometer fitted with an HPLC Chip cube (Agilent, Palo Alto, CA) were used for protein analysis in this work. Examples of data relating to the entire process are given as Fig 5.5, beginning with the total ion current (TIC) chromatogram that contains all the eluting peptides that have been separated as is shown in Fig 5.5a. At each point in time, a mass spectrum is obtained, it is possible to replot the chromatogram for a particular mass-to-charge ratio ion and this is the bold line. The primary structure of the peptide is found by a two stage process where an ionised fragment (or precursor ion) is selected in the first stage as demonstrated in the insert of Fig 5.5b. This fragment is subjected to further fragmentation to produce a series of fragments (or product ions) that are detected in the second stage as displayed in Fig 5.5c. Two sequences are possible depending where the charge is located when the amide bonds are broken (see Fig 5.6). The b-ion sequence results from the formation of amino terminated fragments and the y-ion sequence is terminated with carboxyl groups. The type of instrument influences the sequences that are observed with the y-ion sequence predominately detected when a quadrupole array is used as the first stage with both sequences detected for an ion trap instrument.

183

Figure 5.5: a) The total ion intensity from all the mass spectra that were recorded during the liquid chromatography mass spectrometry (LC-MS) run is shown as a function of elution time. The black trace shows the total ion chromatogram. Shown in bold is the trace for the intensity of one particular ion, which elutes within a 40 second window approximately 42.5 minutes into the gradient. The bold trace shows an extracted ion chromatogram. The area under this curve represents the total signal of this peptide. b) The mass spectrum of the peptides that were eluted 42.4 minutes into the gradient is shown. The insert shows the mass-to-charge values around the peptide ion of interest, which are indicative of the resolution and allow the charge state to be derived. c) The MS/MS spectrum of the peptide ion of interest (highlighted by a dashed box in part b). The mass differences between this y-ion series indicate the amino-acid series. As this is a y-ion series, the sequence is written in the carboxy-to-amino-terminus direction going from left to right. m/z, mass-to-charge ratio (Was taken from Steen and Mann 2004).

For an even more in-depth characterization, the peptide fragments can be further fragmented. This is known as MS3 or, more generally, MSn, which has recently become 184 a feasible practice in proteomics with the advent of linear ion traps - a new and improved version of the traditional three-dimensional quadrupole ion traps where more precursor ions can be stored for fragmentation (Steen and Mann 2004).

Figure 5.6: a) The figure shows the chemical structure of a peptide, together with the designation for fragment ions. b) Cleavage of the amide bonds lead to b-ions when the charge is retained by the amino-terminal fragment or y-ions when it is retained by the carboxyl-terminal fragment (taken from Steen and Mann 2004).

5.1.3.2 Protein identification from mass spectra

The data produced by mass spectrometry of a protein mix is typically analysed using a search engine such as MASCOT (Perkins et al. 1999), SEQUEST (Yates et al. 1996) or X! TANDEM (Craig et al. 2004). The pattern of peptide fragments and fragment ions observed from the mass spectra is compared to theoretical fragmentation patterns calculated from proteins in databases such as NCBI nr (www.ncbi.nlm.nih.gov) or SwissProt (www.expasy.org/sprot/). Protein identifications by MASCOT are made based on probability-based Mowse scores, whereby peptides are scored on the probability that their match to the database occurred at random (Perkins et al. 1999).

185

The MASCOT search engine was used predominantly for protein identification in this work (Fig. 5.7).

Figure 5.7: The peptide sequences from the MS/MS spectra were identified by the MASCOT searching tool (Matrix Science Ltd., London, UK) against the NCBI nr (National Centre for Biotechnology Information non-redundant) sequence database. The criteria for protein and peptide sequence identification were based on the manufacturer’s definitions (Matrix Science Ltd).

Whatever the search algorithm used, when the organism source of the protein is known and the genome sequence has been made available, matches with database proteins and subsequent identification can be relatively straight forward. However, proteins from organisms without sequenced genomes must be identified on the basis of high sequence similarities to proteins of related species, in a process termed “cross- species identification” (Liska and Shevchenko 2003, Grinyer et al. 2004). Organisms that are closely phylogenetically-related exhibit similarities in genome sequence and 186 thus their proteins also exhibit a high degree of homology. Identification based on existing protein information in databases can still be achieved using lower criteria for sequence identities and numbers of peptide matches required for a confident hit (Wilkins and Williams 1997). However, as phylogenetic distance increases between species, so does the number of nucleotide substitutions, deletions and insertions in gene sequences and subsequently, amino acid changes in proteins. These results in markedly different MS and MS/MS spectra compared to that predicted from known proteins in databases and attempts at matching can be unproductive. In this case, de novo sequencing of peptides is required for protein identification (Seidler et al. 2010). In the final part of this thesis, selected endophytic enzymes (amylase, protease and xylanase) were characterised using SDS-PAGE, 2D electrophoresis and zymography. In an attempt to identify new amylases with potential application to industry, purification of an amylase obtained from Preussia minima was performed followed by further characterisation using liquid chromatography-electrospray ionisation-mass spectrometry to determine its partial peptide sequence. Mass spectrometry was employed to identify an array of proteins in the secretome of this fungal endophyte. The genus Preussia (Sporormiaceae) comprises species from soil, wood and plant debris. They are largely unexplored and proteomic analysis has not been reported, hence the secretome study of this endophytic fungus invites application, for identifying enzymes (Chapter 3). This work represents the first proteomic analysis of the secretome of an endophytic fungus from the Australian native plant, Ermepholia longifolia.

5.2 Material and methods

5.2.1 Culture conditions to prepare crude extracellular enzyme

The mycelium of fungal endophyte EL-14 (Preussia minima),grown on Potato Dextrose Agar (PDA) plates was inoculated into the first hydrolase-inducing media (which was shown to produce greater protein content) containing 1.5 % w/v soybean flour, 1 % w/v lactose, 2 % w/v Avicel cellulose and minimal salts (KH2PO4 1.5 %,

(NH4)2SO4 0.5 %, MgSO4 0.06 %, CaCl2 0.6 %, FeSO4.7H2O 0.0005 %, MnSO4.H2O

0.00016 %, ZnSO4.7H2O 0.00014 % and CoCl2 0.0002 %) at pH 6.5 (Peterson et al.

187

2011a) and incubated at 25 °C for 7 days. The media was then centrifuged at 10,000 g for 15 min to separate the mycelia from the broth and the broth filtered through a 0.22 µm filter (Millipore). The sterilized broth was then concentrated by freeze drying and used for characterization of amylase and study of the secretome. Two selected fungal endophytes, EL-17 (Alternaria alternata) and EM-4 (Preussia sp) with highest protease and xylanase activities, respectively, were also inoculated into the first hydrolase- inducing media. A second hydrolase-inducing medium (which was shown to be more conducive to amylase production) was used for growing EL-14s (P. minima) for amylase purification and bioreactor fermentation. The endophyte suspension was prepared with 0.1 % Triton X-100 added to 100 ml glucose-aspargine medium containing: glucose 2

%, L-asparagine 0.4 %, KH2PO4 0.3 %, K2HPO4 0.2 %, MgSO4.7H2O 0.05 % and 0.1 % (v/v) of Vogel’s trace elements to 100 ml distilled water and pH adjusted to 5.5. The culture was incubated for 4 days at 25 °C with shaking at 220 rpm (Nguyen et al. 2002). To initiate the production of enzyme, 5 ml of the culture grown in the above medium was introduced into 150 ml of inducing media containing: soluble starch 4 %, L- asparagine 0.75 %, KH2PO4 0.3 %, K2HPO4 0.2 %, MgSO4.7H2O 0.05 % and 0.1 % (v/v) of Vogel’s trace elements solution in 100 mM citrate buffer pH 5.5. The mixture was allowed to ferment for 5 days at 28 °C (Nguyen et al. 2002). After that, the myecelial pads were removed by filtration, and the filtrate was saved as the source of crude extracellular amylase.

5.2.2 Purification of amylase from EL-14

The culture filtrate was lyophilized and then dialyzed against 20mM Tris-HCl, pH 8. The sample was then precipitated using TCA/Acetone, applied to a previously equilibrated Sephadex G-200 gel filtration column and eluted with the same buffer. Fractions were collected and monitored for α-amylase activity. Fractions with α- amylase activity were then pooled and applied onto a DEAE- Sepharose ion exchange column, previously equilibrated with 20mM Tris-HCl buffer, pH 8, and eluted with a linear concentration gradient (0-17M) of sodium chloride in the same buffer (Fig. 5.8). The α-amylase pooled fractions were then utilized for biochemical characterization.

188

SDS-PAGE, Bradford assay, zymography and enzyme assays were carried out using the purified fraction.

Figure 5.8: Purification protocol of extracellular amylolytic enzyme

5.2.3 Analysis of extracellular protein content by SDS-PAGE

Electrophoretic analysis of the samples was performed (Table 5.2) using sodium do-decyl sulphatepolyacrylamide gel electrophoresis (Laemmli 1970) in a Miniprotean 3 apparatus (Bio-Rad, USA) with a 5 % (w/v) stacking gel and 12 % (w/v) resolving gel. Sample - mercaptoethanol, boiled for 5 min and loaded into the gels. Five μl of the Prestained Protein ladder (the precision plus protein kaleidoscope standard) broad range: 10- 250

189

KDa (New England Biolabs, UK) was loaded in the first well and 12 μl of each sample was loaded in the remaining wells. Electrophoresis was carried out in 1X running buffer (Tris base 3.03 %, glycine 14.4 % and SDS 1 %, pH 8.3) for 45 min at 200 V. After electrophoresis, the gel was stained with Coomassie Blue G-250 overnight, de-stained and an image of the gel was captured.

Table 5.2 Preparation of resolving gel (12%) and stacking gel (5%) for SDS- PAGE No. Ingredients of resolving gel Volume 1 40% acrylamide and bis-acrylamide solution (19:1) 3 ml 2 1.5 M Tris-HCl (PH 8.8) 2.5 ml 3 10% SDS 100 µl 4 Distilled Water 4.4 ml 5 10% Ammonium Persulphate 100 µl 6 TEMED 4 µl Total 10 ml

No. Ingredients of stacking gel Volume 1 40% acrylamide and bis-acrylamide solution (19:1) 630 µl 2 1 M Tris-HCl (PH 6.8) 630µl 3 10% SDS 50 µl 4 Distilled Water 3.6ml 5 10% Ammonium Persulphate 50 µl 6 TEMED 5 µl Total 5 ml

5.2.4 Analysis of enzyme production by zymography

5.2.4.1 Amylase zymography

The presence of amylases and their relative molecular weights were evaluated by protease zymography using standard fungi and samples of EL-14s growing at different temperatures and pH. Non-denaturing PAGE (12% polyacrylamide) was used to

190 determine homogeneity of the enzyme and confirm the presence and relative molecular weight of amylase produced by the endophyte (Martinez et al. 2000). SDS-PAGE (12% polyacrylamide) was used to determine the molecular mass of the crude enzyme produced in different conditions under denaturing conditions. Samples for zymograpghy were electrophoresed as described above, except that non-denaturing conditions were used, the resolving gel contained 0.2 % (w/v) starch and electrophoresis was performed in two phases: 30 min at 40 V followed by 90 min at 100 V. The lower voltage was necessary to prevent heat denaturation of enzymes. To ensure conservation of the enzyme activity, electrophoresis was carried out at 4 °C. The gels were carefully removed, washed with distilled water and incubated for 2 h at 39 °C with phosphate- citrate-NaCl buffer (0.1 M phosphate-citrate and 0.05 M NaCl buffer, pH 6). Gels were fixed in 12 % trichloroacetic acid for 10 min and amylase activity visualized by adding Lugol’s staining solution (0.67 % KI and 0.33 % I2).

5.2.4.2 Protease zymography

The presence of proteases and their relative molecular weights were evaluated by protease zymography using standard fungi and samples of EL-17 growing at different temperatures and pH. The zymogram gel was prepared similar to that described for SDS-PAGE using 12.5% (w/v) resolving gel containing 1% gelatine (substrate for target enzyme) and a 5% (w/v) stacking gel. Samples and standard were mixed with an equal amount of zymography loading buffer without boiling, as described by Peterson and colleagues (2011a), loaded into the gel and subjected to electrophoresis at 100V for 2 hours at 4 °C (Laemmli 1970). After electrophoresis, the gel was soaked in 2.5% Triton-X 100 for 1 hour, then washed thoroughly with water and incubated in 0.03 M Tris HCl, pH 7.5 for 12 hours at 25 °C. Following incubation, the zymogram gel was stained with Coomassie blue for a few hours and an image of the gel was captured.

5.2.4.3 Xylanase zymography

The presence of xylanases and their relative molecular weights were evaluated by xylanase zymography using standard fungi and samples of EM-4 growing with different sources of carbon and nitrogen (section 4.2.1). The zymogram gel was 191 prepared similar to that described for SDS-PAGE using a 12.5% (w/v) resolving gel containing 1% birdwood xylan (substrate for target enzyme; prepared by heated gently on magnetic stirrer without boiling) and a 5% (w/v) stacking gel. After electrophoresis, the gel was soaked in 2.5% Triton-X 100 for 1 hour, then washed thoroughly with water and incubated in 0.05M citrate buffer at pH 5.5 for 1 hour at room temperature. Following incubation, the zymogram gel was stained with 1% Congo red for 15 minutes then was destained in 1M NaCl for 2 hours to reveal the band indicating hydrolysis of substrate and enzyme activities. Finally, images of gel were taken to observe clear bands.

Table 5.3 Preparation of resolving gel (12%) and of stacking gel (5%) for zymography No. Ingredients of resolving gel Volume 1 40% acrylamide and bis-acrylamide solution (19:1) 2.81 ml 2 Separating buffer (1.5 M Tris-HCl, pH 8.8, 0.4%SDS) 2.25 ml 3 Substrate solution (1%) 3.89ml 4 10% Ammonium Persulphate 45 µl 5 TEMED 6.75 µl Total 10ml

No. Ingredients of stacking gel Volume 1 40% acrylamide and bis-acrylamide solution (19:1) 560 µl 2 Stacking buffer (0.75M Tris-HCl, pH 6.8 and 0.4% SDS) 1ml 3 Distilled Water 3.145 ml 4 10% Ammonium Persulphate 20 µl 5 TEMED 5µl Total 5ml

5.2.5 Bioreactor studies on amylase production

The α–amylase production by P. minima (EL-14s) was studied in a 1.4 L bioreactor (Infors AG, Schweiz) with a working volume of 1L. The bioreactor was equipped with two Rushton-type impellers and baffles and was filled with 1L of the optimized media. The medium was sterilized at 115 °C for 10 min. The final pH of the

192 medium was adjusted by the addition of sterile 1M HCl or 1M NaOH. The medium was then inoculated with 10mL of P. minima culture solution. The fermentation was carried out for 5.5 days at 25 °C and the impeller speed was set to 180 rpm. Compressed air was sparged into the medium at 1 vvm. Fermentation parameters including temperature, pH and pO2 were continuously monitored with microprocessor-controlled probes. Analytical procedures were carried out following scale-up studies. Reducing sugar was estimated by the method of Miller (1959). Protein content was determined by Bradford Assay with BSA (Bovine Serum Albumin) as the standard.

5.2.6 Two-dimensional (2D) gel electrophoresis/Further characterization of amylase

5.2.6.1 IPG strip rehydration

The mycelium of EL-14 and EM-4 were inoculated into the first hydrolase- inducing media. Extracellular proteins were precipitated by incubating the supernatant with 20% (w/v) TCA for 14 hours at 4 °C. Following centrifugation at 9,000 x g for 15 min at 4 °C, the pellet was resuspended in 20 ml cold acetone and incubated on ice for 30 min. Centrifugation was then repeated at 9,000 x g for 15 min at 4 °C, the supernatant was removed, and the pellet was air dried prior to resuspension in a solubilisation buffer consisting of 8M urea, 4% (w/v) 3-[(3-cholamidopropyl)- dimethylammonio]-1-propanesulphonate (CHAPS), and 1% (w/v) dithiothreitol (DTT). The sample was kept on ice and vortexed intermittently over a 2 hour period. Desalting of the samples was then carried out in Microcon YM-3 (3,000-nominal-molecular- weight-limit centrifugal filter devices (Millipore, Bedford, MA) using the solubilisation buffer until the conductivity was reduced (Peterson et al. 2011b). 100-200µg of protein in a final volume of 185µl (Appendix 5.1) was used for IPG strip rehydration and protein separation via IEF and SDS-PAGE. Carrier ampholytes (pH 3-10) and Bromophenol blue were added to the samples at a final concentration of 0.2% (w/v) and 0.0002% (w/v), respectively. The final volume was brought to 185µl by adding the required amount of the 2D Lysis buffer. IPG strips were of a linear pH gradient (3-10) and 11cm in length. The samples were dispensed in the respective labelled wells and the IPG strips laid on the solution carefully with the gel 193 side of the strip facing down. Any trapped air bubbles under the IPG strips were removed by carefully and gently pressing on the plastic backing of the IPG strips. The samples were left to be absorbed by the gel matrix for an hour before overlaying with a sufficient quantity of mineral oil to cover the IPG strips and prevent them from drying during the rehydration process. IPG strips were rehydrated for 12 hours at room temperature.

5.2.6.2 Iso-electric Focussing

Iso-electric focussing was carried out using the Bio-rad Protean IEF apparatus. The focussing conditions were as follows. Paper wicks were placed on both ends of the wells to be used. The paper wicks were moistened with sterile distilled water (9µl per paper wick) after first draning excess mineral oil from the IPG strips. The strips were then placed on the labelled focussing tray wells containing moistened paper wicks with the gel side down and in the correct orientation according to the electrodes. The IPG strips were then covered with mineral oil. Any trapped air bubbles were removed. The temperature of the apparatus was set to 20 °C and IEF was performed using the following parameters:

Step 1: 250V, linear ramp, 20 minutes

Step 2: 8000V, linear ramp, 150 minutes

Step 3: 8000V, rapid ramp, 66,000 VHours

After the IEF was complete, excess oil was blotted using filter papers. The IPG strips were kept on a clean labelled rehydration tray with the gel side up.

5.2.6.3 IPG strip equilibration

IPG strips were stored at -20 °C. Before use, they were allowed to thaw at room temperature prior to performing the second dimension. The IPG strips were then equilibrated to solubilise the focussed proteins and to allow SDS binding by reduction and alkylation of cysteine residues as follows:

194

Reduction was first carried out by incubating the IPG strips with gentle shaking for 10 mins in equilibration buffer containing 2% (w/v) DTT. This process required 4ml of the reduction equilibration buffer per IPG strip. After 10 minutes, the solution was drained, 4ml of alkylation equilibration buffer containing 2.5% (w/v) of iodoacetamide was added per IPG strip and the strips incubated for 10 minutes in the dark without shaking.

5.2.6.4 Second dimension SDS-PAGE

The second dimension was carried out using hand-cast 12.5% SDS-PAGE gels. Strips were briefly dipped in SDS-PAGE running buffer and laid on top of the gel. The strips were then overlayed with molten agarose and any visible air bubbles were removed. The agarose was allowed to set before electrophoresis was performed at 100 V for 2-3 h. After electrophoresis, the gels were carefully taken out of the glass-plate assembly and rinsed twice with distilled water for 5 minutes each time on a platform shaker. The gels were then fixed in 10% (v/v) methanol and 7% (v/v) acetic acid for 1 hour. The gels were then stained in 50ml of Coomassie blue G-250 overnight. Excess of stain was removed by washing the gels in distilled water several times. To obtain a clearer background, the gels were again rinsed in fixing solution for 1 hour on a platform shaker with the solution changed at least once within that period. The gels were then finally rinsed with distilled water a few times to wash away the acetic acid and methanol. The gels were then scanned using a Typhoon Imager (Bio-Rad).

5.2.6.5 Preparation and in-gel digestion of purified amylase fraction/secretome of

EL-14 and EM-4

Larger protein spots of the EL-14 and EM-4 secretomes in replicate 2-D gels and purified amylase bands in SDS-PAGE gels were excised and washed twice with 600µL of a 1:1 (v/v) de-staining solution (50% of acetonitrile in 50mM NH4HCO3) with shaking at 37 °C for 30-60 mins. The gel pieces were then dehydrated with 200 μL of 100% acetonitrile and air-dried for 10 min. Proteins in the gel pieces were reduced with

50 μl of freshly prepared 50 mM TCEP 50 mM NH4HCO3 for 1 h at 60 °C. Reduced

195 proteins were subsequently alkylated by incubation of the gel pieces with freshly prepared 100 mM iodoacetamide in 50 mM NH4HCO3 for 30 mins at room temperature in the dark. After reduction and alkylation, gel pieces from each protein band were washed twice with 200 μL of a 1:1 (v/v) 100 mM NH4HCO3/acetonitrile mixture for 15 min, dehydrated with 200 μL of 100% acetonitrile and air-dried for 5 min. Dry gel pieces were rehydrated with 40 μL of 50 mM NH4HCO3 containing 250 ng of trypsin (Sigma) and then incubated at 37 °C overnight (Ia et al. 2011).

5.2.6.6 Peptide sequencing by mass spectrometry (LC-ESI-MS/MS)

Coomassie blue-stained protein bands were excised from the gel and digested with trypsin. The peptides generated from tryptic digestion were analyzed by LC-ESI- MS/MS using an Agilent 1100 Series HPLC coupled to an Agilent LC/MSD Trap XCT Plus mass spectrometer fitted with an HPLC Chip cube (Agilent, Palo Alto, CA). Peptides were injected onto a 40 nL Zorbax 300SB-C18 trapping column at a rate of 4μL/min and then separated by switching the trap column in-line with the separation column (Zorbax 300SB-C18, 75 µm x 43mm). HPLC solvents used were aqueous 0.1% (v/v) formic acid (solvent A) and 95% (v/v) acetonitrile / 0.1% (v/v) formic acid (solvent B). Samples were equilibrated in mass spectrometry eluent using solvent A and separated using 5% solvent B (flow rate 4.00 µL min-1), an increase of solvent B from 5% to 15% over 1 min, then a 15 min linear gradient (flow rate 300 nL min-1) from 15 to 35% solvent B was performed followed by a step from 35 to 80% solvent B over 0.5 min and held for 1min, added to elute any remaining peptides from the column (Fig 5.9). Acquired MS/MS spectra were searched against the against the non-redundant sequence database of the National Centre for Biotechnology Information (NCBI nr) using the MASCOT search algorithm (v2.1.04, Matrix Science, U.K.). Searches were conducted with carbamidomethylation of cysteine as a fixed modification (+57Da) as well as oxidation of methionine (+16Da) as variable modification, with allowance for up to two missed tryptic cleavages. The criteria for positive identification were based on peptides with a Mascot ion scores exceeding the identity threshold score (p < 0.05) (http://www.matrixscience.com/index.html). The primary sequence was analysed using

196 the BLAST database (http://blast.ncbi.nlm.nih.gov/Blast.cgi) against proteins in NCBI nr and UniProt (Fungi and all entries).

Figure 5.9: Nanoflow LC/MS/MS system

5.3: Results

5.3.1: Initial characterization of α-amylse from selected samples

Endophytes EL-13, EL-14, EL-14s and EL-15 were grown in hydrolase- inducing medium (Nguyen et al. 2002, Peterson et al. 2011a) and their extracellular extracts collected by filtration. The broth was concentrated by freeze drying followed by resuspension in a minimal volume of water and the proteins visualised by SDS-PAGE (Fig. 5.10a). Zymographic analysis confirmed the presence of amylases in the assayed extracts (Matrinez et al. 2000) and indicated the presence of amylases with a common molecular weight of approximately 70–75 kDa (Fig. 5.10b). Transparent bands were seen in the gel after staining with Lugol’s solution which were the result of starch hydrolysis in that area due to the presence of amylase.

197

a b

Figure 5.10: a) SDS-PAGE analysis of concentrated crude extracellular extracts of endophytes EL-13, EL-14 and EL-15. EL-14s indicates EL-14 grown in an alternative hydrolase-inducing media. M = broad range protein mix (Bio-Rad). b) Zymographic analysis of the fungal extracellular extracts of endophytes EL-13, EL-14 and EL-15. EL-14s indicates EL-14 grown in an alternative hydrolase- inducing media. Starch (0.2%) co-polymerised with polyacrylamide gel was used

as a substrate for detection of amylase. M = broad range protein mix (Bio-Rad).

The amylase from EL-14s was previously investigated in Chapter 4 and showed optimum activity in alkaline condition (similar to bacteria) and high activity at lower temperature (similar to other fungi). These observations were confirmed by zymography (Fig. 5.11) at different temperature and pH and compared with standard amylase- producing fungi (A. oryzae and A. niger). Thus, the combination of optimum temperature and pH make this fungal α-amylase unique.

198

M A. oryzae A. niger pH 3 pH 5 pH 7 pH 9 9 °C 25 °C 37 °C

250 KD

75 KD

37 KD

Figure 5.11: Zymography was performed using EL-14s with highest α-amylase activity to confirm the activity at pH 9 and temperature 25 °C was optimal (Chapter 4), in comparison with standards (A. oryzae and A. niger). Markers “the precision plus protein kaleidoscope standard” was used. Common sharp band was detected around 70KD.

5.3.1.1: Purification of α- amylase produced by EL-14s

The purification scheme was shown in Fig. 5.8 (Section 5.2.2). The dialyzed culture filtrate was precipitated and applied to Sephadex G-200 column. After pooling the activity fractions, the concentrated sample was applied to DEAE Sepharose ion- exchange column. Data from α-amylase purification are summarized in Table 5.4. TCA/acetone saturation yielded up to 5-fold purification of α-amylase. The specific activity at this stage and was 235U/mg with a yield of 80.86%. After Sephadex G-200 filtration, the specific activity of α-amylase increased to 298 U/mg, which further increased to 350 U/mg upon DEAE Sepharose ion exchange chromatography. The enzyme was purified approximately 7- fold, with 55.11% recovery. The total protein and enzyme activity were measured after each purification step and a single band was presented in SDS-PAGE and zymography (Fig. 5.12).

199

Table 5.4 Purification summary for extracellular α-amylase produced by Preussia minima.

Purification step Total Total Specific activity Purification Yield activity protein (U/mg) (fold) (%) (U) (mg)

Crude extract 1270 27.02 47 1 100

TCA concentration 1027 4.37 235 5 80.86

Gel filtration 834.4 2.8 298 6.34 65.7

Anion exchange 700 0.9 350 7.44 55.11

M 1 2 3 4 5 250KD

75KD

37KD

25KD

Figure 5.12: Electrophoresis analysis of the crude and purified samples (EL-14). Lane M: Precision Plus Protein™ Kaleidoscope™ standards (250-10 kDa); Lane 1: 12% SDS-PAGE of the crude sample; Lane 2: 12% SDS-PAGE of the sample after TCA concentration; Lane 3: 12% SDS-PAGE of the sample after gel filtration; Lane 4: 12% SDS-PAGE of the purified α-amylase after anion exchange; Lane 5: 12% amylotic zymogram of purified α- amylase developed from protein staining with Lugol’s solution. Zymography was performed to confirm that the purified sample comprised a single band of 70kDa.

200

5.3.1.2 Production of α-amylase from EL-14s in 1.4 L Bioreactor.

Validation of the optimization results was carried out in a 1.4-L bioreactor with 1 L of medium. The α-amylase production was studied under controlled temperature and pH conditions (optimum conditions for EL-14s growth) of 25 °C and pH 5 (Nguyen et al. 2002) for 5 days. The total enzyme activity obtained using bioreactor was 212 U/ml, which was comparable to the enzyme activity in shaker flask fermentation (214 U/ml). Therefore, it can be concluded that, scale-up of P. minima in a bioreactor does not affect the amylase activity which is an important consideration for further industrial scale fermentation.

5.3.2: Initial characterization of protease from selected samples

Following growth of selected endophytes in hydrolase-inducing medium (Peterson et al. 2011), SDS-PAGE gel (Fig. 5.13) was performed. EL-17, with highest protease activity (Chapter 4), exhibited two sharp bands of approximately 25 to 50 kDa and a protein profile that was different to the other samples. Zymography of the standard (F. oxysporum) and eight different samples of EL-17 grown at different temperatures and pH were used to confirm the presence of proteases. As the resolving gel contained gelatine (substrate for protease), each clear zone indicates the presence of protease in the samples. The relative abundance of clear protease bands confirmed that the optimum growth conditions for the endophytic fungus were 37 °C and pH 7. Figure 4.14 showed clear zones in all samples and those incubated at 37 °C, pH 5.5 had the highest number of bands (250KDa, 150KDa, 70KDa, 50KDa and 18KDa). The samples at pH 7 showed three bands and other samples showed high molecular weight bands at the top of the zymography gel (Fig. 5.14).

201

Figure 5.13: SDS-PAGE analysis of concentrated crude extracellular extracts of endophytes EL-7, EL-8 and EL-17. Marker broad range protein mix (Bio-Rad).

M F. oxysporum 9 °C 25 °C 37 °C 50 °C pH 9 pH 7 pH 5 pH 3

Figure 5.14: Zymography gel of endophytic fungal samples (EL-17) grown at different pH and temperature compared with F. oxysporum (grown at 25 °C and pH 5.5). All the clear

bands indicate active protease and it confirmed the optimum conditions of protease activity at 37 °C and pH 7.

5.3.3: Initial characterization of xylanase from selected samples

Endophytes EM-4 and the standard xylanase producer, A. niger, were grown in hydrolase-inducing medium (Peterson et al. 2011a) and their extracellular extracts collected by filtration. The broth was concentrated by freeze drying followed by resuspension in a minimal volume of water and the proteins visualised by SDS-PAGE 202

(Fig. 5.15a). The standard presented a sharp band of approximately 45 KDa in comparison with a sharp band from EM-4 of approximately 37 KDa. In addition, the diverse patterns of protein profiles in different samples S1-S8 from EM-4 (see Table 4.5) are shown in Fig. 5.15b. There is a sharp band in most samples, especially those grown with different sources of carbon (S1-S4).

M A.niger EM-4 M S1 S2 S3 S4 S5 S6 S7 S8 250 250 KD KD

50 KD 50 KD 37 KD 37 KD

a b

Figure 5.15: a) SDS PAGE of the standard and selected endophyte (EM-4) for xylanase activity. The sharp band of 45 KDa in standard contrasts to the sharp band of 33 KDa in sample. b)

Different samples of EM-4 grown in diverse sources of carbon and nitrogen in the media showing the effect on the protein profiles.

Zymographic analysis confirmed the presence of xylanase in the assayed extracts (Peterson et al. 2009b) and indicated the presence of enzymes with common molecular weights of approximately 33 kDa and 250 KDa compared with an enzyme of approximately 45 KDa produced by A. niger (Fig. 5.16a). These bands correspond to the major proteins observed in SDS-PAGE. Figure 5.16b presents the effect of using different sources of carbon and nitrogen on expression of xylanase by EM-4. The two common bands (33 KDa and 250 KDa) are visible in all samples but the use of differnt carbon sources appears to have increased xylanse production/activity. Transparent bands were seen in the gels after incubation with universal buffer and staining with Congo Red solution which were the result of beechwood xylan hydrolysis in that area due to presence of xylanase (Peterson et al. 2011a).

203

M A.niger EM-4 M

a b

Figure 5.16: a) Zymography gel image for xylanase activity confirmed a 45 KDa enzyme in the standard and enzymes of approximately 33 KDa and 250 KDa in EM-4. b) The use of different carbon and nitrogen sources indicated a positive effect on xylanase production in samples S1-S4 (carbon sources) but not in samples S5-S8 (nitrogen sources).

5.3.4 Further characterization of selected amylase

5.3.4.1 Mass spectrometry and peptide sequencing of purified amylase

A peptide spectrum obtained from in-gel tryptic digestion of purified α-amylase gave 13 prominent ions (Fig. 5.17a). These peak lists generated from the spectrum were used for protein identification using the NCBI nr database and the MASCOT search engine and resulted in one hit. The signal 543.4 was chosen as the target for analysis in MS mode to identify the precursor ion formed by the ESI ion source. The fragments and fingerprint information of the MS/MS spectrum of the precursor peak were analysed and the results with scores higher than 54 identified the amino acid sequence of a 9-mer peptide as SIYFALTDR (Fig. 5.17b).

204

Intens. 250. +MS, 11.9-12.0min #594-#598 x106 1.2 2+ 543.4

1.0

0.8

0.6

3+ 0.4 721.1 1+ 644.3 a 2+ 3+ 772.9 0.2 1+ 615.0 1+ 483.3 679.8 842.3 3+ 887.3 419.3 976.3 1084.2 1179.3 0.0 x105 250. +MS2(544.1), 11.9-12.0min #595-#599 R D T L A F Y 4 1+ 885.4 SIYFALTDR

3

1+ 1+ 575.3 2 504.2 1+ 722.4 1+ 1+ 391.2 173.0 b 443.2 1 201.0 534.2 1+ 1+ 364.1 1+ 695.4 290.1 1+ 796.4 911.4 0 200 400 600 800 1000 1200 m/z

Figure 5.17: a) Tryptic digest peptide spectrum of purified 70 kDa protein from P. minima. b) MS/MS spectrum of precursor peak (543.4). The data are representative of three independent experiments (Appendix 5.2).

The peptide sequence was used to search the NCBI database which identified similarity to α-amylase [NCBI nr: gi 389646691] from Magnaporthe oryzae. Given that this sequence is a provisional RefSeq in the NBCI database and has not been subject to final review, we performed an additional search of the UniProt database using the Protein Pilot search engine which yielded the same match. However, when Protein Pilot was used as a search engine for protein identification of the peaks produced from the same sample, the results also showed a second 9-mer peptide as NALAYLLAR (Appendix 5.3). This sequence may be helpful in the design of suitable forward and reverse primers for amplification of the gene(s) of interest.

205

5.3.4.2 Protein identification and secretome study of endophytic Preussia sp.

Crude filtered extracellular samples were used to study the secretomes of EL-14 and EM-4. These endophytes were investigated as they belong to same genus (Preussia) but had been isolated from different plant species, Ermepholia longifolia and E. maculate. These two endophytes were also selected because they exhibited the highest amylase and xylanase activities, respectively (Chapter 3). From 2D gel images (Figs. 5.18a and 5.18b), it was apparent that EM-4 produced a greater abundance of proteins with higher pI than did EL-14. Separating proteins in the EL-14 supernatant by their molecular weight as well as the isoelectric point was an effective way of isolating proteins with amylase activity from other abundant proteins occurring at the same molecular weight (Fig. 5.18c). Definitive identification of purified proteins of EL-14 (i.e. spot 26 from Fig. 5.18c and purified 70 KDa band from Fig 5.13) with amylase activity was made using LC-ESI-MS/MS. The other 32 protein spots of EL-14 visible on the 2D gel (Fig. 5.18a) which were identified are listed in Table 5.5. Additionally, the common protease band (50KDa band in Fig 5.14,) as well as the common xylanase band (33KDa band in Fig 5.16a and spot 53 in Fig 5.18b) proved to be the expected enzymes by further analysis using LC-ESI-MS/MS. The peptide sequence of the 50 KDa band was used to search the database in NCBI database which identified similarity to an alkaline serine protease [NCBI nr: gi 238490642] from Aspergillus flavus NRRL3357. The peptide sequence of spot 53 was identified to be similar to an endo-xylanase [NCBI nr: gi: 16078876] from Bacillus subtilis subsp. subtilis str. 168.

206

3 pI 10 250 KD

75KD

29 26 0 0 32 24 2 0 33 0 0 37 KD 3 5 6 7 1

12 2 4 16 011 8 10 9 0 14 15 60 0 17 13 0 0 18 20 10 0 0 30 0 0 25 23 0 28 22 21 0 0 31 0 a 0

pI 3 10 250 KD

75 KD

37 KD

b

75 KD 26 29 26 0 0 32 24 2 0 33 0 0 37 KD 3 5 6 7 7 1

12 2 4 16 011 8 10 9 0 14 15 60 0 17 13 0 0 18 20 10 0 0 30 0 0 25 23 0 28 22 21 0 0 31 0 0 c

4 pI 7

Figure 5.18: Crude extracellular proteins (approx. 200 µg) from the supernatant of (a) P. minima (EL-14) and (b) Preussia sp. (EM-4) following growth in the first hydrolase- inducing medium for 7 days were separated by 2D gel electrophoresis. .Proteins were visualized with Coomassie Blue. Gels were scanned with a Typhoon FLA 9000 laser scanner (GE Healthcare) using no emissions filter, PMT 600, Laser Red (633) and normal sensitivity. Thirty-three spots were separated that mostly had pI lower than 6 in (a) while 53 spots were mostly with pI higher than 6 in (b). (c) Amylase zymogram of 2D gel of P. minoma crude protein sample. Proteins in spots 26 and 7 could be assigned as α-amylase following an NCBI nr database search after LC-MS/MS analysis (Table 5.5). The two spots adjacent to spot 26 could be isomers with different pI (Peterson et al. 2011b).

207

Table 5.5 Successful protein spot identification (MS/MS/BLAST) in the secretome of Preussia minima (EL-14) by LC MS/MS by comparison to proteins in the NCBI databasea and with BLAST searching. Spot Enzyme category, protein Target Species Accession Mascot name/functionb substrate No. score 1 Xylanse Xylan Bacillus subtilis gi 139865 65 2 Chitinase Chitin Bacillus subtilis gi 16079742 59 3 Pectate lyase Pectin Bacillus subtilis gi 16080548 72 4 Phosphoribosyl amino Legionella gi 270158584 76 imidazole lonfbeachae Carboxylase catalytic subunit 5 Natto kinase Bacillus subtilis gi 14422313 66 6 Protease Protein Xenopus gi 58332100 51 tropicalis 7 Alpha amylase Strach Bacillus subtilis gi 255767082 85 8 Cellulase Cellulose Bacillus subtilis gi 39777 67 9 Nicotinate-Nucleotide Bacillus subtilis gi 16079838 77 pyrophosphorylase 10 Endo 1,4- beta mannosidase Mannan Bacillus gi 384158076 52 amyloliquefacie ns 11 Beta- 1,4-mannase Mannan Bacillus pumilus gi 347311566 82 12 Endo-beta 1,4 mannase Mannan Bacillus subtilis gi 84688836 396 13 Mannase Mannan Bacillus gi 239634423 73 licheniformis 14 Hypothetical protein Zymoseptoria gi 398404980 54 tritici 15 Bacillo peptidase Protein Bacillus subtilis gi 62946514 125 16 Hypothetical protein Colletotrichum gi 429850915 67 17 Arginase Xylan Bacillus subtilis gi 16081084 87 18 Arabian-endo1,5-alpha-L- Xylan Bacillus subtilis gi 1770013 118 arabinase 19 Neutral protease Protein Bacillus gi 56405351 69 mesenterious

208

Spot Enzyme category, protein Target Species Accession Mascot name/functionb substrate No. score 20 Bacillo peptidase F Protein B. mesenterious gi 142609 110

21 Unnamed protein product Cyanophora gi 11416 69 paradoxa 22 Endo-1,4-beta-glucanase Xyloglucan Bacillus subtilis gi 16079934 80 23 Catalase Hydrogen Aspergillus gi 1857716 216 peroxide fumigatus 24 VBS Aspergillus gi 46370484 70 flavus 25 Aldose 1- epimerase Glucose Pyrenophora gi 189190 81 tritici 26 Alpha amylase Magnaporthe gi 389646691 56 oryzae 27 Hypothetical protein Gibberella zea gi 46126833 84 28 Extracellular neutral Protein Bacillus subtilis gi 160789534 77 metalloprotease 29 Catalase Hydrogen Glomerella gi 310791536 107 peroxide graminicola 30 Cellobiose dehydrogenase Cellulose Cochliobolus gi 451856 92 sativus 31 Hypothetical protein Aspergillus gi 115388337 78 terreus 32 Mycelial catalase Hydrogen Neosartorya gi 119474019 105 peroxide fischeri 33 hypothetical protein Sordaria gi 336269335 68 SMAC_03015 macrospora a: Assignment of proteins to all the entries in the NCBI database (www.ncbi.nlm.nih.gov/) was determined by ESI-LC-MS/MS of protein spots or bands of the 1D and 2D gel. b: Names or predicted functions of conserved domains in proteins in the NCBI nr database (www.ncbi.nlm.nih.gov/)to which significant peptide matches (P < 0.05) were made using the Mascot search engine. Individual ions scores > 56 indicate identity or extensive homology (P<0.05).

209

5.4 Discussion

5.4.1 Characterisation of extracellular enzymes of selected endophytes

Secretions of a wide range of enzymes help fungi to obtain nutrition from their environments. These enzymes have developed to work synergistically to degrade the available substrates in the most efficient way (Webster and Weber 2007). Characterizing and identifying the enzymes in a fungal secretome can describe how the fungus can survive in its own natural habitat. Furthermore, enzymes and enzyme combinations can be discovered that could be suitable for increasing the efficiency of industrial processes (Teter and Cherry 2005). Enzymes that work synergistically to degrade plant biomass have been of particular interest to industry for the production of biofuels (Herpoël-Gimbert et al. 2008, Vanden Wymelenberg et al. 2010, Horn et al. 2012) and for application in the textile, paper and detergent industries (Aehle 2007). Study of the secretome may lead to the identification of effectors secreted by endophytic microbes which modulate the host cell function and structure and promote microbial growth in plant tissue (Rafiqi et al. 2013). Enzyme activities of three fungal isolates from Ermepholia longifolia, grown in liquid culture, were characterised using activity assays (Chapter 4) and zymogram gels (this chapter). Enzyme activities in the liquid cultures were successfully represented in the zymograms, where the number and intensity of activity bands correlated well with the activity levels measured by the assays. Zymograms give an indication of the molecular weight of the enzyme isoforms secreted by selected endophytic fungi. In this study, zymography also revealed the diversity of optimum conditions of each enzyme and the effect of using different sources of carbon and nitrogen. During the preparation of extracellular enzyme extracts, endophyte EL-14 (Preussia minima) was grown in two different media (Nguyen et al. 2002, Peterson et al. 2011a) to assess the effect of different media components on endophytic enzyme production. A noticeable difference was seen in the protein production with the medium of Peterson et al. (2011a) being more favourable in terms of quantity of extracellular enzymes. However, the medium of Nguyen et al. (2002) was customised for production of amylase and this effect was observed in the electrophoretic analysis. All extracellular extracts analysed demonstrated common protein(s) of approximately 70 kDa which were inferred to be amylases due to their presence in all samples. The molecular weight

210 of this α-amylase was confirmed by zymography using starch as the substrate. Zymography allows estimation of the relative molecular weight of an enzyme, and also permits detection and molecular size estimation of multiple forms of an enzyme or of catalytically active degradation products of an enzyme (Lantz and Ciborowski 1994). These results suggested that amylases from P. minima apparently present higher molecular masses than the majority of α-amylase from the other microorganisms. In addition to the common band of about 70–75 kDa, a band at 40 kDa was observed indicating the presence of a secondary low molecular weight amylase. However, EL-14s (same endophyte grown in different hydrolase-inducing medium) showed a second band of approximately 230 kDa. Other fungal (EL-13 and EL-15) extracts assayed also demonstrated the presence of amylase with varying levels of starch hydrolysis (data not shown). The effect of media on enzyme production was evident from the zymographic assay with EL-14 producing two amylase bands of 40 and 70 kDa using the medium of Peterson et al. (2011a) and bands of 70 and 230 kDa using the medium of Nguyen et al. (2002). Recently, amylases of the same molecular weight (70 KDa) were reported in different microorganisms including Bacillus sp., Neosartorya fischeri and the archaeon Pyrococcus sp. (Mukesh Kumar et al. 2012, Xiao et al. 2013, Jung et al. 2013). However, the activities of these amylases differed from the enzyme(s) produced by EL- 14 which was active in alkaline condition and lower temperature. α-amylases are generally stable over a wide range of pH from 4 to 11 (Michelin et al. 2010), though some are only stable within a narrow pH range (Coronado et al. 2000). Most Bacillus isolates, e.g. B. subtilis, B. licheniformis and B. amyloliquefaciens, seem to require an optimum pH of more than 7 for their enzyme activity (Tanyildizi et al. 2005), similar to EL-14, but require higher temperatures. α-amylases from most fungi exhibit pH optima in the acid to neutral range; however, the EL-14 enzyme appears to be exceptional with a pH optimum of 9.0 (Chapter 4) which was confirmed by zymography. Amylase activity under these conditions (low optimum temperature and alkaline pH optimum) would be desirable for the removal of starch-based stains (Lange 2004). Detailed investigation of the α-amylase produced by EL-14 was undertaken to assess the enzyme’s potential application as an additive for the detergent industry. The purification of α-amylase from crude extracts of culture yielded approximately 7-fold greater activity than the crude enzyme, with 55.11% recovery. Specific enzyme activity

211 is affected by the different conditions used in fermentation and purification steps, (Sahnoun et al. 2012, Irshad et al. 2012). Lower purification yields of α-amylase could be attributed to higher loss of enzyme during downstream processing or, alternatively, lower initial protein concentration of the crude extract used for the purification process (Sahnoun et al. 2012). The activity of α-amylase can be increased using various activators such as CaCl2 (Irshad et al. 2012). In the bioreactor studies, enzyme yields of 212 U/ ml were comparable to the enzyme activity in the shaker flasks of 214 U/ml. Under the proposed optimized conditions. Thus, from the current bioreactor studies, it was concluded that the process for the production of α-amylase from EL-14 can be successfully optimized with no loss in enzyme activity, which has significant implication for practical applications in industry. The SDS-PAGE and zymogram results of the selected samples investigated for protease activities were remarkably consistent. The highest protease producer, EL-17 (Alternaria alternata), presented a greater number of sharp bands in SDS-PAGE, some of which were confirmed as proteases by zymography. Interestingly, the standard fungus, Fusarium oxysporum, produced minimal amounts of mycelia and secreted protein was undetectable after 7 days of incubation. In contrast, EL-17 grew more strongly and had secreted 2.1 mg/ml protein after 7 days in the liquid medium of Peterson et al. (2011a). This result was confirmed on the protease zymogram where numerous sharp bands were observed for EL-17. Alternaria alternata is a common saprophyte found mostly on decaying organic material producing a wide range of secondary metabolites such as dibenzopyrones, tetramic acids, lactones, quinones and cyclic peptides (Brzonkalik et al. 2011). The fungus has characteristic pigmentation due to the presence of melanin and has previously been isolated from wood logs (Musetti et al. 2007, Maheswari and Sankaralingam 2010). A. alternata is an excellent source of industrial enzymes (Xiao et al. 2012) and substrates for medicine (de Siqueira et al. 2011). It is known to produce different types of proteases including neutral alkaline and serine proteases (Patil and Shastri 1985, More et al. 2009). Protease zymography of EL-17 grown at different temperatures and pH (Fig. 5.14) showed bands of approximately 18-25, 37, 50, 75, 100 and 150 kDa, however, the optimum conditions were 37 °C and pH 7 (chapter 4). It was observed that a 50 kDa

212 protease was produced by both EL-17 (at pH 7 and 37 °C) and the standard. Similarly, Akel et al. (2009) discovered that a purified protease from a Bacillus strain had a molecular mass of 49 kDa, while Barata et al. (2002) characterized an extracellular trypsin-like protease of F. oxysporum var. lini with estimated molecular mass of 41 KDa. An alkaline serine protease producing Alternaria solani was reported by Chandrasekaran and Sathiyabama (2013) with an estimated molecular mass of 42 KDa, optimal activity at 50 °C and pH 9–10 and broad pH stability between pH 6–12. In the case of endophytes, the optimum temperature and pH conditions of protease production are likely to reflect the climatic conditions found in environments inhabited by the original host plant (Zaferanloo et al. 2013). The endophytic fungus EM-4, Preussia (Sporormiella sp.), exhibited xylanase activity resulting from production of a 33 KDa enzyme. An alkaline xylanase of similar molecular mass (36 KDa) was reported from an alkaliphilic Bacillus sp. strain 41M-1 with an isoelectric point of pH 5.3 and optimum temperature for activity at pH 9.0 of around 50°C (Nakamura et al. 1993). The value of using brewer’s spent grain as a substrate for xylanase production by Penicillium glabrum was reported by Knob et al. (2013). This enzyme had an estimated molecular mass of 18.36 kDa and exhibited optimum activity at 60 °C and pH 3.0. The use of this substrate was notable not only for adding value and decreasing the amount of industrial waste, but also for reducing the xylanase production costs (Knob et al. 2013). Wong et al. (1988) classified xylanases on the basis of their physicochemical properties to two groups: those with a low molecular weight of <30KDa and basic pI and those with a high molecular weight of >30KDa and acidic pI. Thus, the 33 KDa xylanase from EM-4 would be expected to display an acidic isoelectronic point and this was indeed confirmed by 2D gel electrophoresis (pI of approximately pH 5). The xylanase zymogram confirmed the presence of more than one sharp band of enzyme activity in EM-4 compared with the single xylanase band of 45 KDa from A. niger as reported by Coral et al. (2002) and seen in this study. The xylanases of EM-4 were of particular interest as they retained activity in alkaline conditions, a feature that could potentially make these enzymes suitable for industrial applications (Demain et al. 2005, Sharma et al. 2013). In summary, the profiling of enzyme activity of endophytic fungi isolated from Australian native plants has discovered a number of enzymes of biotechnological interest and highlighted variations in the enzyme constituents and characteristics in the

213 secretomes of different fungal species. Enzymes from the isolates EL-14, EL-17 and EM-4 showed special characteristics and warranty further research, potentially leading to gene isolation and expression in high secreting fungal hosts to increase enzyme production to levels suitable for biotechnological applications.

5.4.2 Analysis of secretomes of selected endophytes

EL-14 and EM-4 were selected for secretome analysis because they were both identified as Preussia sp. but were isolated from different host plants. Therefore, it was of interest to determine whether the original host plant and/or environment influenced the adaptation and subsequent production of extracellular proteins, including enzymes. These endophytes also exhibited the highest amylase and xylanase activities, respectively. The optimal enzyme activities under neutral to alkaline conditions were displayed in agar plate assays, liquid assays and zymograms, indicating the secretion of numerous enzymes that could be of particular interest to industry. The proteomic analysis of the EL-14 and EM-4 secretomes described here resulted in the identification of enzymes likely to be responsible for activities displayed in the enzyme assays and zymograms. Gel electrophoresis and mass spectrometry were the basis of the Preussia minima (EL-14) secretome study, as these techniques have been employed to achieve protein identification from the secretomes of numerous fungal species (Vinzant et al. 2001, Bouws et al. 2008, Mueller et al. 2008, Nagendran et al. 2009). The genome sequence of EL-14 was unavailable, so cross-species identification and zymography assisted the analysis. Most of the identified proteins within the P. minima (EL-14) secretome (Table 5.5) were enzymes involved in the degradation of plant cell wall polymers starch, cellulose, lignin, pectin and protease. A diverse range of other enzymes, as well as some proteins with unknown functions, were also identified in the secretome. 2D gel electrophoresis of crude extracellular proteins from the supernatants of EL-14 and EM-4 clearly showed the different patterns of proteins spots. Most of the proteins spots in EL-14 showed acidic pI; however, proteins spots in EM-4 2D gel presented alkaline pI. These two patterns suggest that these fungi, although belonging to the same genus, may have adapted to their specific host plant environment by secreting different proteins enabling survival in diverse natural conditions.

214

In many cases, the industrial production of a novel enzyme of interest in a natural fungal host is not practicable and molecular techniques must be employed to isolate the gene encoding the enzyme for recombinant expression in an established microbial host. Amplification of the gene of interest could be achieved using degenerate primers based on peptide sequences identified from the enzymes by mass spectrometry. For example, peptide sequences were used to design degenerate primers for the isolation of a laccase gene from the edible fungus, Pleurotus sapidus (Linke et al. 2005, Wang et al. 2014). Likewise, the sequences of peptides identified from enzymes in the P. minima secretome provide a good starting point for the construction of degenerate primers for gene isolation. Degenerate primers can also be based on conserved regions of known genes encoding similar enzymes, as used for the isolation of a cellobiohydrolase gene from the thermophilic ascomycete, Myriococcum thermophilum (Zámocký et al. 2008). Two of the protein spots (7 and 26) on the 2D gel of EL-14 were identified as amylases. In addition, a few spots could be seen clustered around the same molecular weight of spot 26 but with slightly different pI values which could possibly be the isoenzymes of α-amylase. Amylase activity was shown by sharp common bands on the 1D amylase zymogram (approx.70 kDa), (Fig. 5.11 and 5.12), at the approximate molecular weight of the identified amylase spot 26 on the 2D gel (Fig 5.18c). The prominent spot was identified as α-amylase based on LC-ESI-MS/MS data from a protein spot at approximately 70 kDa, pI 6 on the 2D gel. α-amylases are highly sought after in the food industries for the production of various syrups and in the detergent industry as an additive to remove starch based dirt. Amino acid analysis from the purified 70 KDa α-amylase produced of P. minima showed two 9-mer peptides, SIYFALTDR and NALAYLLAR. Database searches (NCBI and Protein pilot) indicated that the peptides showed strong homology with an α-amylase sequence from Magnaporthe oryzae. The result of LC-ESI-MS/MS confirmed the xylanase activity of spot 53 of the EM-4 secretome which had also been observed on SDS-PAGE (Fig 5. 16). The same isoelectric point was observed for a xylanase reported by Nakamura et al. (1993) which had optimum temperature and pH of 50 °C and pH 9.0, respectively. Xylan is a polymer which is abundant in the leaves of dicotyledons, such as Eremopholia species. Complete degradation of this polymer requires the action of numerous enzymes, such as endo- 1,

215

4- β-xylanases which acts by cleaving the xylose sugar backbone. Thus, it is not unexpected that this study revealed xylanse activity in an endophyte isolated from Eremophila. Xylanase activity has also been observed in the secretome of other fungi such as Podospora anserine and Doratomyces stemonitis (Peterson et al. 2011b). Cellulose forms an integral part of the plant cell wall where it is covalently linked with lignin. The presence of cellulase in the secretome of P. minima implies the need of for this fungus to break down plant material and obtain nutrition. Another enzyme identified in the P. minima secretome was pectinase which is involved in the degradation of pectin, an indigestible polysaccharide in leaves. The presence of pectin degrading enzymes in the secretome of P. minima could indicate the presence of pectin within E. longifolia leaves. In previous studies, pectinase was identified in fungi of industrial importance, such as Aspergillus sp. and D. stemonitis (Peterson et al. 2011b). Mannase was also found in the secretome of P. minima. Mannan forms a component of the cell wall matrix of dicotyledonous leaves and the mannase acts by cleaving within the mannose backbone of the mannan polymer. Two different kinds of proteases were found in the secretome of P. minima that could allow the fungus to increase the efficiency of the degradation of the plant cell wall matrix. Metalloprotease are endoproteases that cleave within amino acid chains and enable the fungus to utilize proteins during the digestion process. Proteases have been found in the secretomes of other filamentous fungi, including Aspergillus oryzae (Oda et al. 2006), Aspergillus niger (Tsang et al. 2009), Botrytis cinerea (Shah et al. 2009) and Trichoderma reesei (Herpoel-Gimbert et al. 2008). As the genome of P. minima has not been sequenced, all protein assignments in the secretome were made by cross-species identification, based on sequence similarities to proteins from other fungal and bacterial species in the NCBI database (Table 4). The greatest number of assignments (nine) was to proteins from Bacillus subtilis. Many of the other proteins were from fungi Magnaporthe oryzae and Aspergillus sp. Over twenty different types of enzymes have been identified in the secretome of P. minima as a result of this work, with α-amylases being a major component. As explained above, other proteins were mainly enzymes involved in the breakdown of macromolecules which is reflective of the fungal endophytic lifestyle. However, there were many small protein spots that were left unidentified as good quality MS/MS spectra could not be assigned confidently to any known protein in the NCBI database. These unidentified

216 proteins might be enzymes that have complementary activities to the enzymes already identified in the secretome, thereby, increasing their access to their target substrates. Enzymes identified in the EL-14 secretome may have potential for industrial applications. Some of the enzymes could be valuable complements to the enzymes secreted by industrially-established fungi (Teter and Cherry 2005). Cellobiohydrolases, endoglucanases, xylanases and mannanases present in the secretome of EL-14 (P. minima) could increase the efficiency of enzymatic lignocellulose degradation to fermentable sugars and these can be the sources of large-scale production of xylan- degrading enzymes for application in the biofuel industry (Su et al. 2013). For example, the endo-1, 4-β-mannanase identified in the P. minima EL-14 secretome has been reported in Podospora anserine GH5 where the enzyme has recently been used as a supplement to enzymes secreted by T. reesei strain CL847, thus improving the release of total sugars from lignocellulose by 28 % (Couturier et al. 2011). Furthermore, the P. minima EL-14 pectin, and pectate lyase could be added to T. reesei enzyme cocktails to increase pectin degrading ability and have an impact on the use of pectin-rich biomass residues for biofuel production (Pain and Hertz-Fowler 2008). Comparing the P. minima secretome to those of other microorganisms, including fungi that have been explored in past research, can hekp to broaden the understanding of how endophytic fungi are adapted to their specific niche and provide valuable information for future secretome studies, particularly for microorganisms without sequenced genomes. Furthermore, the identification of enzymes with potential industrial applications may help to address the global need for new enzymes able to operate in diverse conditions.

217

Chapter 6

Main finding and future prospects

A new resource of endophytic fungi in unique natural niche has been explored in this work. As part of advancing knowledge about a community of endophytic fungi, novel bioactive compounds including antibacterial and cytotoxic agents as well as enzymes with potential for industrial applications were revealed. The significance of each of the main findings is discussed in this chapter and suggestions are made for future work.

6.1 Main findings

6.1.1 Broadening of knowledge about a community of endophytic fungi in

Australian plants.

Limited knowledge currently exists regarding species diversity of endophytic isolates of within Australian plants. In the recent work described by Mapperson et al. (2014), twenty-six endophytic fungal isolates belong to Preussia species from two Australian native plants were identified using ITS sequencing. They originally were used for their medicinal benefit by indigenous people. This represents the first time that any community of endophytic fungi from Australian plants has been identified by molecular means (Section 2.3.3). Kirkby et al. (2011) reported the role of endophytic Neotyphodium occultans in the fitness of Lolium rigidu from Australia under variable conditions such as of herbicide resistance, rainfall and abiotic and biotic pressures. The results of their study

218 confirmed these traits from endophytes are to confer ecological advantages to infected plants. An endophyte Quambalaria sp. was isolated from Leptospermum junipae in Australia, produced bioactive compounds that were inhibitory to all and lethal to some pathogenic fungi also inhibited some tested bacteria (Amin et al. 2010). In the current study, three endophytic fungal isolates from the Australian plants Eremophilia longifolia and E. maculata had significantly different ITS sequences to those of any other fungi in the NCBI database, suggesting the possible identification of three strains of new species also this is the first report of enzyme activities from collection of endophytes in Australia.

6.1.2 Antibacterial and cytotoxic activity of endophytic fungi.

The disk diffusion, minimum inhibitory concentration and cytotoxicity assays (Sections 3.3.2 and 3.3.3) indicated antibacterial and cytotoxic activities of some of the endophyte isolates, thus providing a better understanding of how bioactive secondary metabolites may be involved in a mutual relationship between endophytic microorganisms and their host medicinal plants (Firáková et al. 2007). These observations deliver new insights into how endophytic fungi might advance the capability of both plant and endophyte by the adaptive evolution of specialised survival mechanisms (Tejesvi et al. 2007b). These protective mechanisms are derived from the complex interplay between endophyte and host (Tejesvi et al. 2007b), influencing chemical changes by enhancing the production of endophytic secondary metabolites in response to a pathogenic invasion, such as the secretion of anti-vertebrate alkaloids lolitrem B and ergovaline (Schardl et al. 2004). It is this synergy between fungi and plant that contributes to the diverse genetic nature of the microorganisms, and productions of complex bioactive metabolites (Santiago et al. 2012). These finding are significant as, over the past century, developments and modernisation in the drug discovery and production pipeline has revolutionized healthcare in developed countries (Wachtel-Galor and Benzie 2011). Natural products play the most important role for discovery of new and potential drug molecules and there is a general need for new and useful bioactive compounds which are effective, possess low toxicity and have minor environmental impact (Zaferanloo et al. 2012).

219

6.1.3 Endophytic fungi secrete a diverse range of enzymes.

The agar plate assays (Section 3.3.2) revealed a diversity of enzymes secreted by the fungal isolates, supporting the hypothesis that endophytic fungi secrete enzymes that break down the complex compounds in their environment into simple molecules suitable for absorption. This great metabolic flexibility facilitates their natural survival and also makes them attractive organisms for the production of particular enzymes of interest such as those involved in the degradation of plant cell wall polymers. These outcomes are significants as the world’s largest producers of industrial enzymes are looking at environmental screening programs with the view to express these enzymes in highly secreting production hosts (Teter and Cherry 2005). Preliminary investigation of this collection of endophytic fungi isolated from Australian native plants indicates that they are promising sources of enzymes that may have applications in a wide range of industries.

6.1.4 Optimization and characterisation of possible novel enzymes secreted by fungi from Australian native plants.

Liquid enzyme assays, bioreactor fermentation, purification and zymogram (Section 4.3 and part of Section 5.3) were used to establish the activity profiles of the novel enzymes and reveal aspects that could be of interest for industrial applications. Two isolates from E. longifolia (Preussia minima EL-14 and Alternaria alternata EL- 17), and one isolate from E. maculate (Preussia sp. EM-4) were particularly good secretors of protein including alkaline amylase, protease and xylanase, making the isolates possible candidates for strain development by classical mutagenesis or genetic engineering. The significance of these enzymes having optimal activities at neutral to alkaline pH is that, compared to currently available fungal enzymes, these features would suit the requirements of the detergent, dairy and biofuel manufacturing industries and thus may help address the needs of these important industrial applications.

220

6.1.5 Secretome analysis of an endophytic fungus.

The secretome of Preussia minima EL-14 from E. longifolia was analysed by mass spectrometry (Section 5.3), revealing a broad range of enzymes involved in the degradation of cellulose, hemicellulose, pectin, mannan, chitin, starch and protein. The abundance and high number of enzymes for the degradation of different substrates were significant features of the Preussia secretome that differentiate it from the secretomes of other industrially exploited fungi. In previous reports, Preussia sp. have been isolated from typical Mediterranean plant species (Arenal et al. 2007) and studied for their antibacterial activities (Mapperson et al. 2013). The significance of the current findings is the identification of diverse enzymes that could be of interest for industrial applications.

6.2 Future Prospects

This unique collection of endophytic fungal isolates described and the results presented in this thesis offer considerable material for many future investigations. As a direct result of the work, enzymes including amylase, protease and xylanase have been identified that could have potential for industrial applications. In order to strengthen the proposed applications of these enzymes, the processes involved in commercial production are outlined below in Section 6.2.1. Further to this, bioactive molecules from fungal endophytes are well-noted for their potential use as antibacterial agents and this area certainly warrants further investigation. This study highlighted that many of the tested isolates exhibited some level of antibacterial action against several bacteria, an observation which may be of interest to the medical community. Moreover, encouraging results from screening of the anticancer activities of this collection of endophytes identified their potential use in other medicinal applications and further experimentation in this context is described in Section 6.2.2. On a more fundamental level, the work provides a stimulus for further discovery of the world of endophytic fungi. This advance in knowledge will guide us to better understand about how the fungi survive in the host plant and to potentially identify more novel enzymes of interest to industry, as deliberated in Section 6.2.3.

221

6.2.1 The progress of novel enzymes for industrial and environmental applications

The identification of enzymes of interest from natural sources is an early step towards potentially utilising the enzymes in an industrial setting. To improve the efficiency, cost or environmental impact of an existing manufacturing process, there is a specific need for an enzyme with certain properties. Of prime importance, an estimation of the investment costs involved in developing a novel enzyme for the application of interest would need to be evaluated against the expected long-term profits to conclude if the project was commercially reasonable (Aehle 2007). After an appropriate enzyme is found, decisions need to be made about how the enzyme could be produced in an economically practical manner. Two general options are proposed: strain improvement to improve enzyme production in the native host (Section 6.2.1.1), or the use of de novo sequencing and isolation of the gene encoding the enzyme(s) of interest and recombinant expression in a high secreting industrially established production host (Section 6.2.1.2). The suitability of the native host for commercial utilisation will be dependent on various factors, for example whether the native host fungus could be given “GRAS” (Generally Recognised As Safe) status by regulatory authorities (Wu et all. 2006) and whether the growth habits and culturing requirements of the species suit industrial fermentation conditions (Nevalainen and Te’o 2003, Koushki et al. 2011).

6.2.1.1 Strain improvement to enhance enzyme production in the native host

Fungal strain improvement programs can be carried out using traditional mutagens, such as N’-methyl-N’-nitro-N’-nitrosoguanidine or ultra-violet radiation, followed by mass screening to select high-performing mutants. Nevalainen (2001) reviewed the use of random mutagenesis and screening programs in combination with improving cultivation techniques on increasing the secreted enzyme yields of Trichoderma, Aspergillus and Penicillium species. In addition, the protein secretion of T. reesei has been enhanced from mg/L in the wild-type QM6a (Mandels et al. 1971) to over 40 g/L in mutant T. reesei strains (Durand et al. 1988), and further to 100 g/L by improving fermentation conditions (Cherry and Fidantsef 2003). The strains Preussia minima EL-14, Alternaria alternata EL-17 and Preussia sp. EM-4 isolated in this work could be possible candidates for strain improvement

222 programs because the endophytes grew well in an economical liquid medium, their natural protein secretion was quite high and they exhibited numerous enzyme activities that could be of interest to industry.

6.2.1.2 Gene isolation and recombinant expression in an established production host

When the industrial production of a novel enzyme of interest in a natural fungal host is not achievable, molecular techniques can be employed to isolate the gene encoding the enzyme for recombinant expression in an established microbial host. As the complete genome sequence Preussia sp. was not available, the analysis of the P. minima EL-14 secretome required the development of techniques supplementary to those typically used for protein identification involving organisms with a sequenced genome. Thus, de novo sequencing will provide good support for the identifications made. Protein gel electrophoresis and mass spectrometry, which formed the basis of the current analysis, and cross-species identification was found to be an effective method of establishing the identities and predicted functions of P. minima EL-14 proteins based on significant similarities to proteins from other species in the NCBI database. Amplification of the gene(s) of interest could be achieved by designing degenerate primers based on the peptide sequences identified by mass spectrometry (Dodge et al. 2013). For example, peptide sequences identified by mass spectrometry were used to design degenerate primers for the isolation of a laccase gene from the edible fungus Pleurotus sapidus (Linke et al. 2005). Similarly, the sequences of peptides identified from enzymes of the P. minima EL-14 secretome, supported by de novo sequencing, are good starting points for the construction of appropriate primers for gene isolation. Degenerative primers can also be based on conserved regions of known genes encoding similar enzymes, as used for the isolation of a cellobiohydrolase gene from the thermophilic ascomycetous Myriococcum thermophilum (Zámocký et al. 2008). Genes encoding enzymes responsible for activities exhibited in the agar plate and enzyme assays by the collection of endophytic fungi analysed in this project could be isolated in this way, without any prior amino acid sequence information. The gene (cDNA) encoding the enzyme of interest could be expressed in Escherichia coli for primary characterisation of the enzyme product, followed by

223 expression of the gene under a strong inducible promoter in a high secreting filamentous fungal host, such as a Trichoderma or Aspergillus species (Kiiskinen et al. 2004, Rodríguez et al. 2008). Pichia pastoris can perform many posttranslational modifications and proteolytic processing and therefore serves as an expression host of heterologous fungal enzymes (Mellitzer et al. 2012). Thus, filamentous fungi are attractive hosts for heterologous protein production because of their high secretion capability and eukaryotic posttranslational modifications (Yoon et al. 2010). Further characterisation of the expressed enzyme would then need to be undertaken in laboratory shake flasks and pilot-scale fermenters to establish the industrial value of the enzyme.

6.2.2 Further investigation of endophyte compounds for medical applications

Twenty six endophytes were initially screened for cytotoxicity, four of which demonstrated varying levels of toxicity towards a range of cell lines. The development of a collaborative experimental protocol allowed progression of this part of the research and provided promising results towards the application of endophytes to anticancer therapies. However, a few important questions were left unanswered which are crucial to the progression of studies with the endophyte displaying the greatest level of cytotoxiciy, Alternaria sp. EM-6. The presence of unidentified peaks within the UV- HPLC chromatogram teamed with the fact the extract contained the lowest concentration levels of the two previously identified metabolites, AOH and AME, led to the belief that another metabolite is contributing to the increased cytotoxicity and, therefore, identification of these peaks is necessary.

The identification of novel peaks can be carried out by a two-step process:

1. EM-6 should be analysed for the presence of other known cytotoxic metabolites. These could include recently identified metabolites derived from endophytic Alternaria species (Noser et al. 2011) such as Altenuene (ALT), Altertoxin I-III (AXT-I-III), Tentoxin (TEN), Altenusin (ATS) and Tenuazonic acid (TeA). However, if the peaks represent novel metabolites, identification will require nuclear magnetic resonance spectroscopy (NMR).

224

2. From the resulting NMR structures, the next stage would be to synthesise the metabolites and screen these compounds against the cancer cells used in the initial drug sensitivity assays to verify the cytotoxic effects of the compounds.

3. Further investigation of the mechanism of cell death will deduce if the EM-6 cytotoxic effect mimics that of AOH and AME which is mediated via the p53 pathway (Bensassi et al. 2011). This can be done by measuring the levels of apoptotic cells via FACS analysis using Annexin V/propidum iodide double staining and Western blot analysis of treated cells using a primary antibody of either anti-p53 or anti-caspase 9 monoclonal antibodies (Bensassi et al. 2012). If EM-6 exerts its apoptotic effect by inducing the expression of p53 within the cells, then the role of caspase 3 is proposed, which has been shown to interact with caspase 8 and 9 and induce this pathway (Cohen 1997). Thus, the treated cells could also be analysed for the presence of this caspase via a caspase 3 activity assay (Bensassi et al. 2011).

6.2.3 A world of endophytic fungi anticipates attention

Endophytic fungal isolates that deserve further investigation have been identified from medicinal Australian native plants in this work. Isolates that displayed antibacterial, anticancer and enzyme activities but that were not studied further could be grown in a liquid medium for further investigation to discover the structure and properties of the bioactive compounds or undergo further enzyme characterisation using the various enzyme assays and zymographic techniques described. Enzyme activity profiles may reveal new enzymes with industrial potential. Mass spectrometric analysis could be used to identify the proteins in the secretomes of the fungal isolates, in a similar way that identifications were obtained from the secretome of P. minima EL-14. Moreover, a range of different liquid media could be used to assess the influence of different substrates on protein production and secretion. Other unexplored characteristics of these endophytic fungi could also be of interest, such as the secretion of antifungal substances which may have potential for biocontrol applications. Eventually, genome sequencing would expose a great deal more about this collection of endophytic fungi, a possibility that has become more viable with the development of

225 less expensive and faster sequencing technologies, such as 454 pyrosequencing (Margulies et al. 2005). Finally, this study has confirmed the value of endophytes from Australian native plants as novel sources of bioactive compounds for industrial, environmental and medicinal applications and encourages further investigation to discover additional bioactive compounds in different sources of Australian host plants and their endophytes.

226

References

Abbas, A., H. Koc, F. Liu, and M. Tien. 2005. Fungal degradation of wood: initial

proteomic analysis of extracellular proteins of Phanerochaete chrysosporium

grown on oak substrate. Curr. Genet. 47:49-56.

Abdalla, A.E. and J.P. Roozen. 1999. Effect of plant extracts on the oxidative stability

of sunflower oil and emulsion. Food Chem. 64:323-329.

Abdel-Sater, M.A. and A.H.M. El-Said. 2001. Xylan-decomposing fungi and

xylanolytic activity in agricultural and industrial wastes. Int. Biodeterior.

Biodegrad. 47:15-21.

Abirami, V., A.S. Meenakshi, K. Kanthymathy, R. Bharathidasan, R. Mahalingam, and

A. Panneerselvam. 2011. Partial purification and characterization of

anextracellular xylanase from Penicillium janthinellum and Neurospora crassa.

J. Nat. Prod. Plant Resour. 1:117-125.

Acton, Q.A. 2013. Amylases—advances in research and application. pp. 1-253.

ScholarlyEditions, Atlanta, Georgia.

Aehle, W. 2007. Enzymes in industry: production and applications. Wiley-VCH,

Verlag, Weinheim.

Aguilar, C., R. Rodríguez, G. Gutiérrez-Sánchez, C. Augur, E. Favela-Torres, L.

Prado-Barragan, A. Ramírez-Coronel, and J. Contreras-Esquivel. 2007.

Microbial tannases: advances and perspectives. Appl. Microbiol. Biotechnol.

76:47-59.

227

Ahrens, C.H., S.P. Schrimpf, E. Brunner, and R. Aebersold. 2010. Model organism

proteomics. J. Proteomics. 73:2051-2053.

Aitken, A. Mass spectrometric techniques. pp. 405-447. In: K. Wilson, and J. Walker

[Eds.] 2005. Principles and techniques of biochemistry and molecular biology.

Cambridge University Press, New York.

Akel, H., F. Al-Quadan, and T.K. Yousef. 2009. Characterization of a purified

thermostable protease from hyperthermophilic Bacillus strain HUTBS71.

Europ. J. Sci. Res. 31:280-288.

Alexopoulos, C.J., C.W. Mims, and M. Blackwell. 1996. Introductory Mycology. John

Wiley and Sons, New York, New York.

Ali, U. F., Z. M. Ibrahim and G. S. Isaac. 2013. Ethanol and xylitol production from

xylanase broth of Thermomyces lanuginosus grown on some lignocellulosic

wastes using Candida tropicalis EMCC2. Life Sci. 10: 968-978.

Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and D.J. Lipman. 1990. Basic local

alignment search tool. J. Mol. Biol. 215:403-410.

Aly, A., D. Abdessamud, and P. Proksch. 2011. Fungal enodphytes: unique plant

inhabitants with great promises. Appl. Microbiol. Biotechnol. 90:1829-1845.

Aly, A.H., A. Edrada-Ebel, V. Wray, W.E.G. Muller, S. Kozytska, U., Hentschel, P.

Proksch, and R. Ebel. 2008. Bioactive metabolites from the endophytic fungus

Ampelomyces sp. isolated from the medicinal plant Urospermum picroides.

Phytochemistry. 69:1716-1725.

228

Aly, A.H., A. Edrada-Ebel, W.E.G. Muller, M.H.G. Kubbutat, V. Wray, R. Ebel, and P.

Proksch. 2010. Protein kinase inhibitors and other cytotoxic metabolites from

the fungal endophyte Stemphylium botryosum isolated from Chenopodium

album. Mycosphere. 1:153-162.

Amann, R.I., W. Ludwig, and K.H. Scheidler. 1995. Phylogenetic identification and in

situ detection of individual microbial cells without cultivation. FEMS

Microbiol. Rev. 55:143-169.

Amin, R.M., G.A. Strobel, M. Vishnevetsky, Y. Rena, and B. Geary. 2010. Biologically

active endophytic Quambalaria sp. from Leptospermum junipae in Australia.

Mycology. 1:67-74.

Amirita, A., P. Sindhu, J. Swetha, N.S. Vasanthi, and K.P.Kannan. 2012. Enumeration

of endophytic fungi from medicinal plants and screeening of extracellular

enzymes. World J. Sci. Tech. 2:13-19.

Andrews, J.M. 2010. Determination of minimum inhibitory concentrations. J.

Antimicrob. Chemother. 48:5-16.

Andrzej, C. 2002. Coexistence and coevolution: various levels of interactions I. Internal

fungi (endophytes) and their biological significance in coevolution. Wiad. Bot.

46:35-44.

ANPSA. 2011. Eremophila maculata in Australian Native Plants Society (Australia).

viewed at: http://www.anpsa.org.au on 12 March 2011.

Archer, D.B., I.F. Connerton, and D.A. MacKenzie. 2008. Filamentous fungi for

production of food additives and processing aids. Adv. Biochem. Eng.

Biotechnol. 111:99-147. 229

Arechavaleta, M., C.W. Bacon, C.S. Hoveland, and D.E. Radcliffe. 1989. Effect of the

tall fescue endophyte on plant response to environmental stress. Agron J.

81:83-90.

Arenal, F., G. Platas, and F. Peláez. 2007. A new endophytic species of Preussia

(Sporormiaceae) inferred from morphological observations and molecular

phylogenetic analysis. Fungal Divers. 25:1-17.

Arican, B. 2008. Highly thermostable, thermophilic, alkaline, SDS and chelator

resistant amylase from a thermophilic Bacillus sp. isolate A3-15. Bioresour.

Technol. 99:3071-3076.

Arivudainambi, E., T. Anand, V. Shanmugaiah, C. Karunakaran, and A. Rajendran.

2011. Novel bioactive metabolites producing endophytic fungus

Colletotrichum gloeo sporioides against multidrug-resistant Staphylococcus

aureus. FEMS Immunol. Med. Microbiol. 61:340-345.

Asoodeh, A., J.K. Chamani, and M. Lagzian. 2010. A novel thermostableacidophilic α-

amylase from a new thermophilic ‘‘Bacillus sp. Ferdowsicous’’ isolated from

Ferdows hot mineral spring in Iran: purification and biochemical

characterization. Int. J. Biol. Macromol. 46:289-297.

Atmosukarto, I., U. Castillo, W.M. Hess, J. Sears, and G. Strobel. 2005. Isolation and

characterization of Muscodor albus I-41.3s, a volatile antibiotic producing

fungus. Plant Sci. 169:854-861.

Bacilio-Jimenez, M., S. Aguilar-Flores, M.V., del Valle, A. Perez, A. Zepeda, and E.

Zenteno. 2001. Endophytic bacteria in rice seeds inhibit early colonization of

roots by Azospirillum brasilense. Soil Biol. Biochem. 33:167-172.

230

Bacon, C.W. and J.F. White. 2000. Microbial Endophytes. Marcel-Dekker. Inc., New

York, N.Y.

Bacon, C.W., P.C. Lyons, J.K. Porter, and J.D. Robbins.1986. Ergot toxicity from

endophyte-infected grasses: a review. Agronomy J. 78:106-116.

Bailey, B.A., H. Bae, M.D. Strem, D.P. Roberts, S.E. Thomas, J. Crozier, G.J. Samuels,

I.Y. Choi, and K.A. Holmes. 2006. Fungal and plant gene expression during

the colonization of cacao seedlings by endophytic isolates of four Trichoderma

species. Planta. 224:1449-64.

Bailey, M.J., P. Biely, and K. Poutanen. 1992. Interlaboratory testing of methods for

assay of xylanase activity. J. Biotechnol. 23:257-270.

Bakri, Y., M. Jawhar, M. Imad, and E. Arabi. 2013. Xylanase production by Fusarium

solani in solid state fermentation. Res. Biotechnol. 4:31-37.

Banerjee, D., M. Jana, and S. Mahapatra. 2009. Production of exopolysaccharide by

endophytic Stemphyliumsp. Micologia. Aplicada. International. 21:57-62.

Barata, R.A., M.H. Andrade, R.D. Rodrigues, and I.M. Castro. 2002. Purification and

characterization of an extracellular trypsin-like protease of Fusarium

oxysporum var. lini. J Biosci Bioeng. 94:304-308.

Barrett, A.J., N.D. Rawlings, and J.F.Woessner. 2003. The Handbook of Proteolytic

Enzymes, 2nd Edition. Academic Press, San Diego, Calif, USA.

Bartnicki-Garcia, S.The cell wall in fungal evolution. pp. 389-403. In: A.D.M. Rayner,

C.M. Brasier, and D. Moore [Eds.] 1987. Evolutionary biology of the fungi.

Cambridge University Press, New York, N.Y.

231

Bashyal, B.P., E.M. Kithsiri Wijeratne, S.H. Faeth and A.A.L Gunatilaka. 2005.

Globosumones A−C, cytotoxic orsellinic acid esters from the Sonoran desert

endophytic fungus Chaetomium globosum. J. Nat. Prod. 68:724-728.

Beg, Q.K., B. Bhushan, M. Kapoor, and G.S. Hoondal. 2000. Enhanced production of a

thermostable xylanase from Streptomyces sp. QG-11-3 and its application in

biobleaching of eucalyptus kraft pulp. Enzyme Microb. Technol. 27:459-466.

Beg, Q.K., M. Kapoor, L. Mahajan, and G.S. Hoondal. 2001. Microbial xylanases and

their industrial applications: a review. Appl. Microbiol. Biotechnol. 56:326-

338.

Bell, A. 2005. An Illustrated Guide to the Coprophilous Ascomycetes of Australia,

CBS, Utrecht.The Netherlands.

Bellemain, E., T. Carlsen, C. Brochmann, E. Coissac, P. Taberlet, and H. Kauserud.

2010. ITS as an environmental DNA barcode for fungi: an in silico approach

reveals potential PCR bias. BMC Microbiol. 10:189-207.

Benlounissi, A., A. Mechakra-Maza, Z. Gherib, M. Mahfouz, L.J. Blum, C.A.

Marquette, and M.J. Tareen. 2012. Milk-clotting fungus enzymes production:

A sustainable development approach based on whey recycling. Afr. J.

Biotechnol. 1:1997-2005.

Bensassi, F., C. Gallerne, O.S. el Dein, M.R. Hajlaoui, H. Bacha, and C. Lemaire. 2011.

Mechanism of Alternariol monomethyl ether-induced mitochondrial apoptosis

in human colon carcinoma cells. Toxicology. 290:230-240.

Bentley, R. 1997. Microbial secondary metabolites play important roles in medicine;

prospects for discovery of new drugs. Persp Biol Med. 40:364-394. 232

Bertrman, J.S. 2000. The molecoular biology of cancer. Mol. Aspects Med. 21:167-223.

Bharadwaj, R. and H. Yu. 2004. The spindle checkpoint, aneuploidy, and cancer.

Oncogene. 23: 2016-27.

Bhargav, S., B.P. Panda, M. Ali, and S. Javed. 2008. Solid-state fermentation: an

Overview. Chem. Biochem. Eng. Q. 22:49-70.

Bhat, M.K. 2000. Cellulases and related enzymes in biotechnology. Biotech. Adv.

18:355-383.

Bhore, S.J., J. Preveena, and K.I. Kandasamy. 2013. Isolation and identification of

bacterial endophytes from pharmaceutical agarwood-producing Aquilaria

species. Pharmacognosy. Res. 5:134-137.

Bills, J.K., M. Christensen, M. Powell, and G. Thorn. Biodiversity of Fungi: endophytic

fungi. pp. 241. In. G.M. Mueller, G.F. Bills and M. Foster [Eds.] 2004.

Elsevier Academic Press, CA, USA.

Bischoff, M., D.T. Wicklow, D.B. Jordan, S.T. de Rezende, S. Liu, S.R. Hughes, and

J.O. Rich. 2009. Extracellular hemicellulolytic enzymes from the maize

endophyte Acremonium zeae. Curr. Microbiol. 58:499-503

Biswas, S.R., S.C. Jana, A.K. Mishra, and G. Nanda. 1990. Production, purification and

characterization of xylanase from a hyperxylanolytic mutant of Aspergillus

ochraceus. Biotechnol. Bioeng. 35:244-251.

Bonnet, M., O.Camares, and P. Veisseire. 2000. Effects of zinc and influence of

Acremonium lolii on growth parameters, chlorophyll a fluorescence and

233

antioxidant enzyme activities of ryegrass (Lolium perenne L. cv Apollo). J.

Exp. Bot. 51:945-953.

Borel, J.F. and Z.L. Kis. 1991. The discovery and development of cyclosporine.

Transplant. Proc. 23:1867-1874.

Borges, W.S., K.B. Borges, P.S. Bonato, S. Said, and M.T. Pupo. 2009. Endophytic

fungi: Natural products, enzymes and biotransformation reactions. Curr. Org.

Chem. 13:1137-1163.

Bourne, Y. and B. Henrissat. 2001. Glycoside hydrolases and glycosyltransferases:

families and functional modules. Curr.Opin. Struct. Biol. 11:593-600.

Bouws, H., A. Wattenberg, and H. Zorn. 2008. Fungal secretomes- nature’s toolbox for

white biotechnology. App. Microbiol. Biotechnol. 80:381-388.

Bradford, M.M. 1976. A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Anal.

Biochem. 72:248-254.

Bradner, J.R., M. Gillings, and K.M.H. Nevalainen. 1999. Qualitative assessment of

hydrolytic activities in antarcticmicro fungi grown at different temperatures on

solid media. World J. Microbiol. Biotechnol. 15:131-132.

Bradner, R. 2003. Antarctic microfungi as a potential bioresource. PhD Thesis,

Department of Biological Sciences, Macquarie University, Sydney.

Brady, S.F., M.P. Singh, J.E. Janso, and J.J. Clardy. 2000. Guanacastepene, a fungal-

derived diterpene antibiotic with a new carbon skeleton. J. Amer. Chem. Soc.

122:2116-7.

234

Brady, S.F., S.M. Bondi, and J. Clardy. 2001. The Guanacastepene: A highly diverse

family of secondary metabolites produced by an endophytic fungus. J. Amer.

Chem. Soc. 123:9900-1.

Breen, J.P. 1994. Acremonium endophyte interactions with enhanced plant resistance to

insects. Annu. Rev. Entomol. 39:401-423.

Bridge, P.D. 1985. An evaluation of some physiological and biochemical methods as an

aid to the characterization of species of Penicillium subsection Fasciculata. J.

Gen. Microbiol. 131:1887-1895.

Brown, A.G. 1986. Clavulanic acid, a novel β-lactamase inhibitor-a case study in drug

discovery and development. Drug Design Devel. 1:1-21.

Brzonkalik, K., T. Herrling, C. Syldatk, and A. Neumann. 2011. Process development

for the elucidation of mycotoxin formation in Alternaria alternata. AMB

Express. 1:27-36.

Bunyard, B.A., M.S. Nicholson, and D.J. Royse. 1996. Phylogeny of the genus

Agaricus inferred from restriction analysis of enzymatically amplified

ribosomal DNA. Fungal Gene Biol. 20:24-253.

Butler, M.S. 2005. Natural products to drugs: natural product derived compounds in

clinical trials. Nat. Prod. Rep. 22:162-195.

Campanile, G., A. Ruscelli, and N. Luisi. 2007. Antagonistic activity of endophytic

fungi towards Diplodia corticola assessed by in vitro and in planta tests. Eur. J.

Plant Pathol. 117:237-246.

235

Campbell, N.A. 1996. Biology, 4th Edition. The Benjamin/Cummings Publishing

Company, Inc., Menlo Park, California.

Campenhout, L.V., I. Somers, S. Van de Craen, and C. Adams. In vitro test to evaluate

protein degradation by feed enzymes. pp. 387-390. In: C. M. Courtin, W. S.

Veraverbeke, and J.A. Delcour [Eds.] 2003. Recent advances in enzymes in

grain processing. Kat. Univ. Leuven, Leuven.

Carroll, G. 1988. Fungal endophytes in stems and leaves: from latent pathogen to

mutualistic symbiont. Ecology. 69:2-9.

Castillo, U., S. Giles, L. Browne, G.A. Strobel, W.M. Hess, J. Hanks, and D. Reay.

2005. Scanning electron microscopy of some endophytic streptomycetes in

snakevine- Kennedia nigriscans. Scanning J. Scanning Microscop. 27:305-311.

Castillo, U.F., G.A. Strobel, E.J. Ford, W.M. Hess, H. Porter, J.B. Jensen, H. Albert, R.

Robinson, M.A.M. Condron, D.B. Teplow, D. Stevens, and D. Yaver. 2002.

Munumbicins, wide-spectrum antibiotics produced by Streptomyces NRRL

30562, endophytic on Kennedia nigriscans. Microbiology. 148:2675-2685.

Chandra, S. 2012. Endophytic fungi: novel sources of anticancer lead molecules. Appl.

Microbiol. Biotechnol. 95:47-59.

Chandrasekaran, M., and M. Sathiyabama. 2013. Production, partial purification and

characterization of protease from a phytopathogenic fungi Alternaria solani

(Ell. and Mart.) Sorauer. J. basic microbiol. doi:10.1002/jobm.201200584.

00:1-12.

Cheetham, P.S.J. 1980. Topics in enzyme and fermentation technology. Willey, New

York. 236

Chen, L.Z., J.M. Chen, X.S. Zheng, J.F. Zhang, and X.P. Yu. 2007. Identification and

antifungal activity of the metabolite of endophytic fungi isolated from Llex

cornuta. Chin. J. Pestic. Sci. 9:143-8.

Chen, X., X. Sang, S. Li, S. Zhang, and L. Bai. 2010. Studies on a chlorogenic acid-

producing endophytic fungi isolated from Eucommia ulmoides Oliver. J. Ind.

Microbiol. Biotechnol. 37:447-454.

Chen, Y., X.G. Xie, C.G. Ren and C.C. Dai. Degradation of N-heterocyclic indole by a

novel endophytic fungus Phomopsis liquidambari. Bioresour Technol.

129:568-74.

Chernushevich, I.V., A.V. Loboda, and B.A. Thomson. 2001. An introduction to

quadrupole–time-of-flight mass spectrometry. J. Mass Spectrom. 36:849-865.

Cherry, J.R. and A.L. Fidantsef. 2003. Directed evolution of industrial enzymes: an

update. Curr. Opin. Biotechnol. 14:438-443.

Christakopoulos, P., P. Katapodis, E. Kalogeris, D. Kekos, B.J. Macris, H. Stamatis,

and H. Skaltsa. 2003. Antimicrobial activity of acidic xylo-oligosaccharides

produced by family 10 and 11 endoxylanases. Int. J. Biol. Macromol. 31:171-

175.

Christina, A., V. Christapher, and S. J. Bhore. 2013. Endophytic bacteria as a source of

novel antibiotics: An overview. Pharmacogn Rev. 7:11-16.

Ciardo, D.E., K. Lucke, A. Imhof, G.V. Bloemberg, and E.C. Bottger. 2010. Systematic

internal transcribed spacer sequence analysis for identification of clinical mold

isolates in diagnostic mycology: a 5-year study. J. Clin. Microbiol. 48:2809-

2813. 237

Claeyssens, M. and B. Henrissat. 1992. Specificity mapping of cellulolytic enzymes:

classification into families of structurally related proteins confirmed by

biochemical analysis. Protein Sci. 1:1293-1297.

Clarke, P.A. 1988. Aboriginal use of subterranean plant parts in South Australia.

Records of South Australian Museum. 22:73-86.

Clarke, P.A. 1988. Aboriginal use of subterranean plant parts in South Australia.

Records of South Australian Museum. 22:73-86.

Clay, K., G.P. Cheplick, and S.M. Wray. 1989. Impact of the fungus Balansia

henningsiana on Panicum agrostoides: frequency of infection, plant growth and

reproduction, and resistance to pests.Oncologia. 80:374-380.

Cohen, G.M. 1997. Caspases: the executioners of apoptosis. Biochem. J. 326:1-16.

Collins, T., C. Gerday, and G. Feller. 2005. Xylanases, xylanase families and

extremophilic xylanases. Microbiol. Rev. 29:3-23.

Coral, G., B. Arikan, M.N. Ünaldi, and H. Korkmaz-Güvenmez. 2002. Some properties

of thermostable xylanase from an Aspergillus niger strain. Ann. Microbiol.

52:299-306.

Coral, G., B. Arikan, N.M. Unaldi, and K.H. Guvenmez. 2002. Some properties of

thermostable xylanase from an Aspergillus niger strain. Ann. Microbiol.

52:299-306.

Coronado, M., C. Vargas, J. Hofemeister, A. Ventosa, and J.J. Nieto. 2000. Production

and biochemical characterization of α-amylase from the moderate halophile

Halomonas meridiana. FEMS Microbiol. Lett. 183:67-71.

238

Corrado, M. and K.F. Rodrigues. 2004. Antimicrobial evaluation of fungal extracts

produced by endophytic strains of Phomopsis sp. J. Basic Microb. 44:157-160.

Cota, B.B., L.H. Rosa, R.B. Caligiorne, A.L.T. Rabello, T.M.A. Alves, C.A. Rosa, and

C.L. Zani. 2008. Altenusin, a biphenyl isolated from the endophytic fungus

Alternaria sp., inhibits trypanothione reductase from Trypanosoma cruzi.

FEMS Microbiol. Lett. 285:177-182.

Coutinho, P.M. and B. Henrissat. Recent advances in carbohydrate engineering. pp. 3-

12. In: H. J. Gilbert, G. J. Davies, B. Svensson and B. Henrissat [Eds.] 1999.

Royal Society of Chemistry, Cambridge, UK.

Couto, S.R. and M.A. Sanromán. 2006. Application of solid-state fermentation to food

industry- A review. J. Food Eng. 76:291-302.

Couturier, M., M. Haon, P.M. Coutinho, B. Henrissat, L. Lesage-Meessen, and J.G.

Berrin. 2011. Podospora anserina hemicellulases potentiate Trichoderma reesei

secretome for the saccharification of lignocellulosic biomass. Appl. Environ.

Microbiol. 77:237-246.

Cragg, G.M. and D.J. Newman. 2005. Plants as a source of anti-cancer agents. J.

Ethnopharmacol. 100:72-9.

Craig, R. and R.C. Beavis. 2004. Tandem: matching proteins with tandem mass spectra.

Bioinformatics. 20:1466-1467.

Cribb, A.B. and J.W. Cribb. 1981. Wild medicine in Australia. Collins Publications.

Sydney.

239

Croteau, R., R.E. Ketchum, R.M. Long, R. Kaspera, and M.R. Wildung. 2006. Taxol

biosynthesis and molecular genetics. Phytochem. Rev. 5:75-97.

Cui, H.B., W.L. Mei, C.D. Miao, H.P. Lin, K. Hong, and H.F. Dai. 2008. Antibacterial

constituents from the endophytic fungus Penicillium sp.0935030 of mangrove

plant Acrostichum aureurm. Chem. J. Chinese U. 33:407-10.

Dai, C., B. Yu, Z. Xu, and S. Yuan. 2003. Effect of environmental factors on the growth

and fatty acid composition of five endophytic fungi from Sapium sebiferum.

Chin. J. Appl. Ecol. 14:1525-1528.

Dai, C.C., B.Y. Yu, Y.T. Zhao, J.H. Jiang, and Q.Y. Yang. 2006b. The screening and

identification of endophytic fungi from four species of family Euphorbiaceae

and the strain sp. antibacterial activity. J. Nanjing Forestry University (Natural

Sciences Edition). 30:79-83.

Dai, C.C., L.S. Tian, Y.T. Zhao, Y. Chen, and H.D. Xie. 2010. Degradation of

phenanthrene by the endophytic fungus Ceratobasidum stevensii found in

Bischofia polycarpa. Biodegradation. 21:245-255.

Dai, J., K. Krohn, B. Elsasser, U. Florke, S. Draeger, B. Schulz, G. Pescitelli, P.

Salvadori, S. Antus, and T. Kurtan. 2007. Metabolic products of the endophytic

fungus Microsphaeropsis sp. from Larix decidua. Eur. J. Org. Chem.

2007:4845-4854.

Dai, J.Q., K. Krohn, U. Florke, S. Draeger, B. Schulz, and A. Kiss- Szikszai. 2006a.

Metabolites from the endophytic fungus Nodulisporium sp. from Juniperus

cedre. Eur. J. Org. Chem. 2006:3498-3506.

240

Daisy, B.H., G.A. Strobel, U. Castillo, D. Ezra, J. Sears, D. Weaver, and J.B. Runyon.

2002a. Naphthalene, an insect repellent, is produced by Muscodor vitigenus, a

novel endophytic fungus. Microbiology. 148:3737-3741.

Daisy, B., G.A. Strobel, D. Ezra, U. Castillo, G. Baird, and W.M. Hess. 2002b.

Muscodor vitigenus anam. sp. nov., an endophyte from Paullinia paullinioides.

Mycotaxon. 84:39-50.

Danielsen, S. and D.F. Jensen. 1999. Fungal endophytes from stalks of tropical maize

and grasses: isolation, identification, and screening for antagonism against

Fusarium verticillioides in maize stalks. Biocontrol. Sci. Technol. 9:545-553.

Dashtban, M., H. Schraft, and W. Qin. 2009. Fungal bioconversion of lignocellulosic

residues; opportunities and perspectives. Int. J. of Biol. Sci. 5:578-595.

Davis, R.A., J. Longden, V.M. Avery, and P.C. Healy. 2008. The isolation, structure

determination and cytotoxicity of the new fungal metabolite, trichodermamide

C. Bioorg. Med. Chem. Lett. 18:2836-2839.

Dayanandan, A., J. Kanagaraj, L. Sounderraj, R. Govindaraju, and G. SuseelaRajkumar.

2003. Application of an alkaline protease in leather processing: an ecofriendly

approach. J. Clean. Prod. 11:533-536. de Almeidaa, M.N.,V. M. Guimarãesa, D. L. Falkoskia, E. M. Vissera,G. A. Siqueirab,

A. M.F. Milagresb, and S. T. de Rezendea. 2013. Direct ethanol production

from glucose, xylose and sugarcane bagasseby the corn endophytic fungi

Fusarium verticillioides and Acremonium zeae. J. Biotech. 168:71-77.

De Bary A .1866. Morphologie und Physiologie der Pilze, Flechten, und Myxomyceten.

Vol. II. Hofmeister’s Handbook of Physiological Botany. Leipzig, Germany. 241 de Siqueira, V.M., R. Conti, J.M. de Araujo, and C.M. Souza-Motta. 2011. Endophytic

fungi from the medicinal plant Lippia sidoides Cham. and their antimicrobial

activity. Symbiosis. 53:89-95. de Siqueira, V.M., R. Conti, J.M. De Araújo, and C.M. Souza-Motta. 2011. Endophytic

fungi from the medicinal plant Lippia sidoides Cham. and their antimicrobial

activity. Symbiosis. 53:89-95. de Souza, J.J., I. J. C. Vieira, E. Rodrigues-Filho, and R. Braz-Filho. 2011. Terpenoids

from Endophytic Fungi. Molecules. 16:10604-10618.

De Souza, P.M. and P.O. Magalhães. 2010. Application of microbial -Amylase in

industry – A Review. Braz. J. Microbiol. 41:850-861.

Debbab, A., A.H. Aly, R. Edrada-Ebel, V. Wray, W.E.G. Müller, F. Totzke, U.

Zirrgiebel, C. Schächtele, M.H.G. Kubbutat, W.H. Lin, M. Mosaddak, A.

Hakiki, P. Proksch, and R. Ebel. 2009. Bioactive metabolites from the

endophytic fungus Stemphylium globuliferum isolated from Mentha pulegium,

J. Nat. Prod. 72:626-631.

Demain, A.L. 1981. Industrial microbiology. Science. 214:987-994.

Demain, A.L. and L. Zhang. Natural products: drug discovery and therapeutic medicine.

pp. 3-29. In: L. Zhang, and A.L. Demain [Eds.] 2005. Humana press, Totowa

, New Jersey.

Demain, A.L. Microbial natural products: a past with a future. pp. 3-16. In: S.K.

Wrigley, M.A. Hayes, R. Thomas, E.J.T. Chrystal, and N. Nicholson [Eds.]

2000. Biodiversity: new leads for pharmaceutical and agrochemical industries.

The Royal Society of Chemistry, Cambridge, United Kingdom. 242

Demain, A.L., J. Velasco, and J.L. Adrio. 2005. Industrial mycology: past, present and

future. pp. 1-26. In: Z. An [Eds.] Handbook of industrial mycology. CRC

Press, New York.

Demian, A.L. and S. Sanchez. 2009. Microbial drug discovery: 80 years of progress. J.

Antibiot. 62:5-16.

Devi, M.K., A.R. Banu, G.R. Gnanaprabhal, B.V. Pradeep, and M. Palaniswamy. 2008.

Purification, characterization of alkaline protease enzyme from native isolate

Aspergillus niger and its compatibility with commercial detergents. Ind. J.

Sci. Technol. 1:1-6.

Dhawan, S. and J. Kaur. 2007. Microbial mannanases: an overview of production and

applications. Crit. Rev. Biotechnol. 27:197-216.

Dhouib, A., M. Hamza, H. Zouari, T. Mechichi, R. Hmidi, M. Labat, M.J. Martinez,

and S. Sayadi. 2005. Screening for ligninolytic enzyme production by diverse

fungi from Tunisia. World J. Microbiol. Biotechnol. 21:1415-1423.

Ding, G., S. Liu, L. Guo, Y. Zhou, and Y. Che. 2008. Antifungal metabolites from the

plant endophytic fungus Pestalotiopsis foedan. J. Nat. Prod. 71:615-618.

Dodge, A.G., C.S. Preiner, and L.P. Wackett. 2013. Expanding the cyanuric Acid

hydrolase protein family to the fungal kingdom. J. Bacteriol. 195:5233-41.

Dong, Y., A.L. Iniguez, and E.W. Triplett. 2003. Quantitative assessments of the host

range and strain specificity of endophytic colonization by Klebsiella

pneumoniae 342. Plant Soil. 257:49-59.

243

Dreyfuss, M.M. and I.H. Chapela. Potential of fungi in the discovery of novel, low-

molecular weight pharmaceuticals. pp. 49-80. In: V.P. Gullo [Eds.] 1994. The

discovery of natural products with therapeutic potential. Butterworth-

Heinemann, London, United Kingdom.

Dunaevskii, Y.E., E.B. Pavlyukova, T.N. Gruban', G.A. Belyakova, and M.A.

Belozerskii. 2006. Extracellular proteinases of filamentous fungi as potential

markers of phytopathogenesis. Microbiology. 75:649-652.

Dunaevsky, Y.E., E.B. Pavlyukova, T.N. Gruban', G.A. Belyakova, and M.A.

Belozersky. 1996. Extracellular protease of micromycete Alternaria alternata.

Biochemistry. 61:1350-1354.

Duncan, S.M., R. Minasaki, Farrell, J.M. Thwaites, B.W. Held, B.E. Arenz, J.A.

Jurgens, and R.A. Blanchette. 2008. Screening fungi isolated from historic

Discovery Hut on Ross Island, Antarctica for cellulose degradation. Antarctic

Sci. 20:463-470. e Silva, T.A.S. A.Knob, C.R. Tremacoldi, M.R. Brochetto-Braga, and E.C. Carmona.

2011. Purification and some properties of an extracellular acid protease from

Aspergillus clavatus.World J. Microbiol. Biotechnol. 27:2491-2497.

Edel, V., C. Steinberg, N. Gautheron, and C. Alabouvette. 1996. Evaluation of

restriction analysis of polymerase chain reaction (PCR)-amplified ribosomal

DNA for the identification of Fusarium species. Mycol. Res. 101:179-187.

Ellsworth, K.T., T. N. Clark, C. A. Gray, and J. A. Johnsona. 2013. Isolation and

bioassay screening of medicinal plant endophytes from eastern Canada. Can. J.

of Microbiol. 59:761-765.

244

El-Neketi, M., W. Ebrahim, W. Lin, S. Gedara , F. Badria, H.E. Saad, D. Lai, and P.

Proksch. 2013. Alkaloids and polyketides from Penicillium citrinum, an

endophyte isolated from the Moroccan plant Ceratonia siliqua. J. Nat. Prod.

76:1099-104.

Esterbauer, H., W. Steiner, I. Labudova, A. Hermann, and M. Hayn. 1991. Production

of Trichoderma cellulase in laboratory and pilot scale. Bioresource

Technology. 36:51-65.

Fazouane-Naimi, F., A. Mechakra, R. Abdellaoui, A. Nouani, S.M. Daga, A.M.

Alzouma, S. Gais, and M.J. Penninckx. 2010. Characterization and cheese-

making properties of rennet-like enzyme produced by a local Algerian isolate

of Aspergillus niger. Food Biotechnol. 24:258-269.

Fehr, M., G. Pahlke, J. Fritz, M.O. Christensen, F. Boege, M. Altemoller, J. Podlech,

and D. Marko. 2008. Alternariol acts as a topoisomerase poison, preferentially

affecting the IIa isoform. Mol. Nutr. Food Res. 53:441-451.

Ferreira de Oliveira, J.M.P., M.W.J. Passel, J.P. Schaap, and L.H. Graaff. 2011.

Proteomic analysis of the secretory response of Aspergillus niger to D-Maltose

and D-Xylose. PLoS ONE. 6:e20865.

Findlay, J.A., S. Bethelezi, G. Li, and M. Sevek. 1997. Insect toxins from an endophyte

fungus from wintergreen. J. Nat. Prod. 60:1214-1215.

Firáková, S., M. Šturdíková, and M. Múčková. 2007. Bioactive secondary metabolites

produced by microorganisms associated with plants. Biologia. 62:251-257.

Fisher, P.J. and O. Petrini. 1993. Ecology, biodiversity and physiology of endophytic

fungi, Curr. Top. Bot. Res. 1:271-279. 245

Floss, H.G. 2006. Combinatorial biosynthesis-potential and problems. J Biotech.

124:242-257.

Fogarty, W. M. and C.J. Kelly. Developments in microbial extracellular enzymes. pp.

289. In: A. Wiseman [Eds.] 1979. Topics in enzyme and fermentation

biotechnology, Ellis Horwood Ltd. Publishers, England.

Fontes, C.M., H.J. Gilbert, G.P. Hazlewood, J.H. Clarke, J.A. Prates, V.A. McKie, T.

Nagy, T.H. Fernandes, and L.M. Ferreira. 2000. A novel cellvibrio mixtus

family 10 xylanase that is both intracellular and expressed under non-inducing

conditions. Microbiology. 146:1959-1967.

Francis, F., A. Sabu, K.M. Nampoothiri, S. Ramachandran, S. Ghosh, G. Szakacs, and

A. Pandey. 2003. Use of response surface methodology for optimizing process

parameters for the production of α-amylase by Aspergillus oryzae. Biochem.

Eng. 15:107-115.

Freeman, E.M. 1904. The seed fungus of Lolium temulentum L., the darnel. Phil. Trans.

R. Soc. Lond. 196:1-27.

Frisvad, J.C., B. Andersen, and U. Thrane. 2008. The use of secondary metabolite

profiling in chemotaxonomy of filamentous fungi. Mycological Research.

112:231-240.

Gangadevi, V. and J. Muthumary. 2008. Isolation of Colletotrichum gloeosporioides, a

novel endophytic taxol-producing fungus from the leaves of a medicinal plant,

Justicia gendarussa, Mycol. Balcanica. 5:1-4

246

Ganley, R. J., S.J. Brunsfeld, and G. Newcombe.2004. A community of unknown,

endophytic fungi in western white pine. Proc. Natl. Acad. Sci.USA.

101:10107-10112.

Gao, X.X., H. Zhou, D.Y. Xu, C.H. Yu, Y.Q. Chen, and L.H. Qu. 2005. High diversity

of endophytic fungi from pharmaceutical plant, Heterosmilax japonica Kunth

revealed by cultivation-independent approach. FEMS Microbiol. Lett. 249:255-

266.

Gardes, M. and T.D. Bruns. 1993. ITS primers with enhanced specificity for

basidiomycetes– applicationto the identification of mycorrhizae and rusts.

Molecular Ecology. 2:113-118.

Gasoni, L. and B. Stegman de Gurfinkel. 1997. The endophyte Cladorrhinum

forcundissimum in cotton roots: phosphorus uptake and host growth. Mycol.

Res. 101:867-870.

Ge, H.M., Y. Shen, C.H. Zhu, S.H. Tan, H. Ding, Y.C. Song, and R.X. Tan. 2008.

Penicidones A-C, three cytotoxic alkaloidal metabolites of an endophytic

Penicillium sp. Phytochemistry. 69:571-576.

Gebler, J., N.R. Gilkes, M. Claeyssens, D.B. Wilson, P. Beguin, W.W. Wakarchuk,

D.G. Kilburn, Jr.R.C. Miller, R.A. Warren, and S.G. Withers. 1992.

Stereoselective hydrolysis catalyzed by related beta-1, 4-glucanases and beta-1,

4-xylanases. J. Biol. Chem. 267:12559-12561.

Gennaro, M., P. Gonthier, and G. Nicolotti. 2003. Fungal endophytic communities in

healthy and declining Quercus robur L. and Q. cerris L. trees in northern Italy.

J. Phytopathol. 151:529-534.

247

George, P.S., A. Ahmad, and B.M. Rao. 2001. A novel thermostable xylanase from

Thermomonosspora sp.: influences of additives on thermostability. Bioresource

Technology. 78:221-224.

Germaine, K., E. Keogh, G. Garcia-Cabellos, B. Borremans, D. Lelie, T. Barac, L.

Oeyen, J. Vangronsveld, F. P. Moore, E.R.B. Moore, C.D. Campbell, D.Ryan,

and D.N. Dowling. 2004. Colonisation of poplar trees by gfp expressing

bacterial endophytes. FEMS Microbiol. Ecol. 48:109-118.

Germida, J.J., S.D. Siciliano, J.R. de Freitas, and A.M. Seib. 1998. Diversity of root-

associated bacteria associated with field grown canola (Brassica napus L.) and

wheat (Triticum aestivum L.). FEMS Microbiol. Ecol. 26:43-50.

Ghiadoni, L., A. Magagna, D. Versari, I. Kardasz, Y. Huang, S. Taddei, and A.

Salvetti. 2003. Different effect of antihypertensive drugs on conduit artery

endothelial function. Hypertension. 41:1281-1286.

Ghorbel, R.E., S. Maktouf, E.B. Massoud, S. Bejar , and S.E. Chaabouni. 2009. New

thermostable amylase from Bacillus cohnii US147 with abroad pH

applicability. Appl. Biochem. Biotech. 157:150-160

Gibbs, P.A., R.J. Seviour, and F. Schmid. 2000. Growth of filamentous fungi in

submerged culture: problems and possible solutions. Crit. Rev. Biotechnol.

20:17-48.

Godfrey, T. and S. West. 1996. Industrial Enzymology. pp: 1-609. The Macmillan Press

Ltd, Stockton Press, London.

248

Gogichaeva, N.V., T. Williams, and M.A. Alterman. 2007. MALDI TOF/TOF tandem

mass spectrometry as a new tool for amino acid analysis. J. Am. Soc. Mass

Spectrom. 18:279-284.

Goldman, N. 2009. Methods for optimizing enzymatic hydrolysis of xylan to improve

xylooligosaccahride yield. Basic Biotechnol. 5:31-36.

Gomes, I., J. Gomes, W. Steiner, and H. Esterbauer. 1992. Production of xylanase and

cellulase by a wild strain of Trichoderma viridae. Appl. Microbiol. Biotechnol.

36:701-707.

Goodman, R.N., Z. Kiraly, and R.K.S.Wood. 1986. The biochemistry and physiology of

plant disease, University of Missouri Press, Columbia.

Gouda, M. And Y. Elbahloul. 2008. Statistical optimization and partial characterization

of amylases produced by halotolerant Penicillium sp. World. J. Agr. Sci. 4:359-

368.

Graham, R., C. Graham, and G. McMullan. 2007. Microbial proteomics: a mass

spectrometry primer for biologists. Microb. Cell Fact. 6:26-40.

Greco, M., A. Patriarca, L. Terminiello, V. Fernández Pinto, and G. Pose. 2012.

Toxigenic Alternaria species from Argentinean blueberries. Int. J. Food.

Microbiol. 154:187-191.

Griffin, D.H. 1994. Fungal Physiology, 2nd Edition. Wiley-Liss, New York.

Grimm, L.H., S. Kelly, R. Krull, and D.C. Hempel. 2005. Morphology and productivity

of filamentous fungi. Appl. Microbiol. Biotechnol. 69:375-84.

249

Grinyer, J., M. McKay, H. Nevalainen, and B. Herbert. 2004. Fungal proteomics: initial

mapping of biological control strain Trichoderma harzianum. Curr. Genet.

45:163-169.

Grünig, C.R., A. Duò, T.N. Sieber, and O. Holdenrieder. 2008. Assignment of species

rank to six reproductively isolated cryptic species on the Phialocephala fortinii

s.1.-Acephala applanata species complex. Mycologia. 100:47-67.

Gu, W., H.M. Ge, Y.C. Song, H. Ding, H.L. Zhu, X.A. Zhao, and R.X. Tan. 2007.

Cytotoxic Benzo[j]fluoranthene metabolites from Hypoxylon truncatum IFB-

18, an endophyte of Artemisia annua. J. Nat. Prod. 70:114-117.

Guarro, J., J. Gene and A.M. Stchigel. 1999. Developments in fungal taxonomy. Clin.

Microbiol Rev. 12:454-500.

Guimarães, N.C.A., M. Sorgatto, S.C. Peixoto-Nogueira, J.H.A. Betini, F.F. Zanoelo,

M.R. Marques, M.L.T.M. Polizeli, and G.C. Giannesi. 2013. Xylanase

production from Aspergillus japonicus var aculeatus: production using

agroindustrial residues and biobleaching effect on pulp. J Biocatal.

Biotransformation. 2:1-6.

Gunatilaka, A.A.L. 2006. Natural products from plant-associated microorganisms:

distribution, structural diversity, bioactivity, and implications of their

occurrence. J. Nat. Prod. 69:509-526.

Guo, B., J. Dai, S. Ng, Y. Huang, C. Leong, W. Ong, and B.K. Carte. 2000a. Cytonic

acids A and B: novel tridepside inhibitors of hCMV protease from the

endophytic fungus Cytonaema species. J. Nat. Prod. 63:602-604.

250

Guo, B., Y. Wang, X. Sun, and K. Tang. 2008a. Bioactive natural products from

endophytes: a review. Appl. Biochem. Microbiol. 44:136-142.

Guo, L.D., G.R. Huang, and Y. Wang. 2008b. Seasonal and tissue age influences on

endophytic fungi of Pinus tabulaeformis (Pinaceae) in the Dongling Mountains,

Beijing. J. Int. Plant Biol. 50:997-1003.

Guo, L.D., K.D. Hyde, and E.C.Y. Liew. 2000b. Identification of endophytic fungi

from Livistona chinensis (Palmae) using morphological and molecular

techniques. New Phytol. 147:617-630

Guo, L.D., L. Xu, W.H. Zheng, and K.D. Hyde. 2004. Genetic variation of Alternaria

alternata, an endophytic fungus isolated from Pinus tabulaeformis as

determined by random amplified microsatellites (RAMS). Fungal. Divers.

16:53-65.

Gupta, A., N. Gautam, and D.R. Modi. 2010. Optimization of α-amylase production

from free and immobilized cells of Aspergillus niger. E3. J. Biotechnol.

Pharmaceut. Res. 1:1-8.

Gupta, R. 2004. A Textbook of Fungi, Nangia. APH Publishing Corporation. New

Delhi.

Gupta, R., P. Gigras, H. Mohapatra, V.K. Goswami, and B. Chauhan. 2003. Microbial

α-amylases: a biotechnological perspective. Process. Biochem. 38:1599-1616.

Gupta, R., Q.K. Beg, and P. Lorenz. 2002. Bacterial alkaline proteases: molecular

approaches and industrial applications. Appl. Microbiol. Biotechnol. 59:15-32.

251

Gutierrez-Zamora, M. and E. Martinez-Romero. 2001. Natural endophytic association

between Rhizobium etli and maize (Zea mays). J. Biotechnol. 91:117-126.

Haidle, A.M. and A.G. Myers. 2004. Anenantioselective, modular, and general route to

the cytochalasins: synthesis of L-696,474 and cytochalasin B. Proc. Natl. Acad.

Sci. 101:12048-53.

Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and

analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series.

41:95-98

Hallmann, J., A. Quadt-Hallmann, W.F. Mahaffee and J.W. Kloepper. 1997. Bacterial

endophytes in agricultural crops. Can. J. Microbiol. 43:895-914.

Haltrich, D., B. Laussamayer, and w. Steiner. 1994. Xylanase formation by Sclerotium

rolfsii: effect of growth substrates and development of culture medium using

statistically designed experiments. Appl. Microbiol. Biotechnol. 42:522-530.

Haltrich, D., B. Nidetzky, K.D. Kulbe, W. Steiner, and S. Zupancic. 1996. Production

of fungal xylanases. Bioresour. Technol. 58:137-161.

Han, Z., W.L. Mei, H.B. Cui, Y.B. Zeng, H.P. Lin, and K. Hong. 2008. Antibacterial

constituents from the endophytic fungus Penicillium sp. of mangrove plant

Cerbera manghas. Chem. J. Chinese U. 29:749-752.

Hankin, L. and S.L. Anagnostakis. 1975. The use of solid media for detection of

enzyme production by fungi. Mycologia. 67:597-607.

252

Haq, I. and H. Mukhtar. 2004. Biosynthesis of proteases by Rhizopus oligosporus

IHS13 in low-cost medium by solid-state fermentation. J. Basic. Microbiol.

44:280-287.

Haraguchi, H., K. Abot Hashimoto, and A. Yagi. 1992. Action-mode of antimicrobial

altersolanol A in Pseudomonas aeruginosa. Biosci. Biotechnol. Biochem.

56:1221-1224.

Harper, J.K., E.J. Ford, G.A. Strobel, A. Arif, D.M. Grant, J. Porco, D.P. Tomer, and

K. Oneill. 2003. Pestacin: a 1, 3- dihydro isobenzofuran from Pestalotiopsis

microspora possessing antioxidant and antimycotic activities. Tetrahedron.

59:2471-2476.

Hashemi, M., S.M. Mousavi, S.H. Razavi, and S.A. Shojaosadati. 2011. Mathematical

modeling of biomass and α-amylase production kinetics by Bacillus sp. in

solid-state fermentation based on solid dry weight variation. Biochem. Eng. J.

53:159-164.

Hatakeyama, T., H. Kohzaki, and N. Yamasaki. 1992. A microassay for proteases using

succinylcasein as a substrate. Anal. Biochem. 204:181-4.

Hawksworth, D.C. and A.Y. Rossman. 1987. Where are the undescribed fungi?

Phytopathology. 87:888-891.

Hazalin, N.A., K. Ramasamy, S.M. Lim, A.L. Cole, and A.B. Majeed. 2012. Induction

of apoptosis against cancer cell lines by four ascomycetes (endophytes) from

Malaysian rainforest. Phytomedicine. 19:609-17.

Hazalin, N.A., K. Ramasamy, S.M. Lim, I.A. Wahab, A.L. Cole, and A.B. Majeed.

2009. Cytotoxic and antibacterial activities of endophytic fungi isolated from 253

plants at the National Park, Pahang, Malaysia. BMC Complement. Altern.

Med. 9:46-50.

Henrissat, B. and P.M. Coutinho. 2001. Classification of glycoside hydrolases and

glycosyltransferases from hyperthermophiles. Methods. Enzymol. 330:183-

201.

Henrissat, B., M. Claeyssens, P. Tomme, L. Lemesle, and J.P. Mornon. 1989. Cellulase

families revealed by hydrophobic cluster analysis. Gene. 81:83-95.

Herpoël-Gimbert, I., A. Margeot, A. Dolla, G. Jan, D. Molle, S. Lignon, H. Mathis, J.C.

Sigoillot, F. Monot, and M. Asther. 2008. Comparative secretome analyses of

two Trichoderma reesei RUT-C30 and CL847 hypersecretory strains.

Biotechnol. Biofuels. 1:18-30.

Higginbotham, S.J., A. E. Arnold, A. Ibanez1, C. Spadafora, P. D. Coley1, and T. A.

Kursar. 2013. Bioactivity of Fungal endophytes as a function of endophyte

taxonomy and the taxonomy and distribution of their host plants. PLoS ONE.

8:e73192.

Higgins, K.L., P.D. Coley, and T.A. Kursar. 2011. Culturing and direct PCR suggest

prevalent host gneralism among diverse fungal endophytes of tropical forest

grasses. Mycologia.103:247-60.

Hill, N.S., D.P. Belesky, and W.C. Stringer. 1991 . Competitiveness of tall fescue as

influenced by Acremonium coenophialum. Crop Sci. 31:185-190.

Hillis, D.M. and M.T. Dixon. 1991. Ribosomal DNA: Molecular evolution and

phylogenetic inference. Q. Rev. of Biol. 66:411-453.

254

Hmidet, N., N.E.H. Ali, A. Haddar, S. Kanoun, S.K. Alya, and M. Nasri. 2009. Alkaline

proteases and thermostable a-amylase co-produced by Bacillus licheniformis

NH1: characterization and potential application as detergent additive. Bio.

Chem. Eng. J. 47:71-79.

Hoegger, P., A. Majcherczyk, R. Dwivedi, K. Svobodová, S. Kilaru, and U. Kües.

Enzymes in wood degradation. pp. 383-431. In: U. Kües [Eds.] 2007. Wood

production, Wood technology, and biotechnological impacts.

Universitätsverlag Göttingen, Göttingen, Germany.

Hoff, J.A., N.B. Klopfenstein, G.I. McDonald, J.R. Tonn, M.S. Kim, P.J. Zambino,

P.F. Hessburg, J.D. Rogers, T.L. Peever, and L.M. Carris. 2004. Fungal

endophytes in woody roots of Douglas-fir (Pseudotsuga menziesii) and

ponderosa pine (Pinus ponderosa). Forest Pathol. 34:255-271.

Hoffman, A.M., S.G. Mayer, G.A. Strobel, W.M. Hess, G.W. Sovocool, A.H. Grange,

J.K. Harper, A.M. Arif, D.M. Grant, and E.G. Kelley-Swift. 2008. Purification,

identification and activity of phomodione, a furandione from an endophytic

Phoma species. Phytochemistry. 69:1049-1056.

Hoq, M.M. and W.D. Deckwer. 1995. Cellulase-free xylanase by thermophillic fungi: a

comparison of xylanase production by two Thermomyces lanuginosus strains.

Appl. Microbiol. Biotechnol. 43:604-609.

Horn, S.J., G. Vaaje-Kolstad, B. Westereng, and V.G.H. Eijsink. 2012. Novel enzymes

for the degradation of cellulose. Biotechnol. Biofuels. 5:45-57.

Hu, Z.Y., Y.Y. Li, Y.J. Huang, Y.J. Su, and Y.M. Shen. 2008. Three new

sesquiterpenoids from Xylaria sp. NCY2. Helv. Quim. Acta. 91:46-52.

255

Huang Z.J., X.L. Cai, C.L. Shao, Z.G. She, X.K. Xia, and Y.G. Chen. 2008a. Chemistry

and weak antimicrobial activities of phomopsins produced by mangrove

endophytic fungus Phomopsis sp ZSU-H76. Phytochemistry. 69:1604-1608.

Huang, H., Z. She, Y. Lin, L.L.P. Vrijmoed, and W. Lin. 2007c. Cyclic peptides from

an endophytic fungus obtained from a mangrove leaf (Kandelia candel). J. Nat.

Prod. 70:1696-1699.

Huang, W., Y. Cai, S. Surveswaran, K. Hyde, H. Corke, and M. Sun. 2009. Molecular

phylogenetic identification of endophytic fungi isolated from three Artemisia

species. Fungal Diversity. 36:69-88

Huang, W.Y., and Y.Z. Cai, K.D. Hyde, H. Corke, and M. Sun. 2008b. Biodiversity of

endophytic fungi associated with 29 traditional Chinese medicinal plants.

Fungal Divers. 33:61-75.

Huang, W.Y., Y. Cai, K.D. Hyde, H. Corke, and M. Sun. 2007b. Endophytic fungi

from Nerium oleander L (Apocynaceae): main constituents and antioxidant

activity, World J. Microbiol. Biotechnol. 23:1253-1263.

Huang, W.Y., Y.Z. Cai, J. Xing, H. Corke, and M. Sun. 2007a. A potential antioxidant

resource: endophytic fungi isolated from traditional Chinese medicinal plants.

Econ. Bot. 61:14-30.

Hughes, S., S. Riedmuller, J. Mertens, X.-L. Li, K. Bischoff, N. Qureshi, M. Cotta, and

P. Farrelly. 2006. High-throughput screening of cellulase F mutants from

multiplexed plasmid sets using an automated plate assay on a functional

proteomic robotic workcell. Proteome Sci. 4:10-23.

256

Hurek, B.R. and T. Hurek. 1998. Life in grasses: diazotrophic endophytes. Trends

Microbiol. 6:139-144

Ia, K.K., G.R. Jeschke, Y. Deng, M.A. Kamaruddin, N.A. Williamson, D.B. Scanlon,

J.G. Culvenor, M.I. Hossain, A.W. Purcell, S. Liu, H.J. Zhu, B. Catimel, B.E.

Turk, and H.C. Cheng. 2011. Defining the substrate specificity determinants

recognized by the active site of C-Terminal Src kinase-homologous kinase

(CHK) and identification of β-Synuclein as a potential CHK physiological

substrate. Biochemistry. 50:6667-77.

Imanaka, T. and S. Sakurai. 1992. Method of washing super precision devices,

semiconductors, with enzymes. United States Patent. 5:780-802.

Irshad, M., Z. Anwar, M. Gulfraz, H.I. Butt, A. Ejaz, and H. Nawaz. 2012. Purification

and characterization of α-amylase from Ganoderma tsuage growing in waste

bread medium. Afr. J. Biotechnol. 11:8288-8294.

Isaka, M., P. Berkaew, K. Intereya, S. Komwijit, and T. Sathitkunanon. 2007.

Antiplasmodial and antiviral cyclohexadepsipeptides from the endophytic

fungus Pullularia sp. BCC 8613. Tetrahedron. 63:6855-6860.

Iwassa, K., M. Moriyasu, and Y. Tachibana. 2001. Simple isoquinoline and

benzylisoquino line alkaloids potential antimicrobial, antimalarial, cytotoxic,

and anti-HIV agents. Bioorg. Med. Chem. 9:2871-84.

Ji, Z.Q., W.J. Wu, M.A. Wang, and A.G. Gu. 2005. Identification of fungicidal

compounds from endophytic fungi Fusarium proliferatum in Celastrus

angulatus. J. North West Sci. Tech. Univers. Agricult. Forest. 33:61-4.

257

Joseph, B. and M.R. Priya. 2011. Bioactive Compounds from endophytes and their

potential in pharmaceutical effect: a review. Am J. Biochem. Mol. Biol. 1:291-

309.

Jun H., T. Kieselbach, and J.L. Jönsson. 2011. Enzyme production by filamentous

fungi: analysis of the secretome of Trichoderma reesei grown on

unconventional carbon source. Microb. Cell. Fact. 10:68-78.

Jung, J.H., D.H. Seo, J.F. Holden, and C.S. Park. 2013. Maltose-forming α-amylase

from the hyperthermophilic archaeon Pyrococcus sp. ST04. Appl. Microbiol.

Biotechnol. doi: 10.1007/s00253-013-5068-6.

Junker, C., D. Siegfried, and B. Schulz. 2012. A fine line – endophytes or pathogens in

Arabidopsis thaliana. Fungal Ecol. 5:657-662.

Kalpana Devi, M., A. Rasheedha Banu, G.R. Gnanaprabhal, B.V. Pradeep and M.

Palaniswamy. 2008. Purification, characterization of alkaline protease enzyme

from native isolates Aspergillus niger and its compatibility with commercial

detergents. Indian J. Sci. Technol. 1:1-6.

Kamal Kumar, B., H. Balakrishnan, and M.V. Rele. 2004. Compatibility of alkaline

xylanases from an alkaliphilic Bacillus NCL (87-6-10) with commercial

detergents and proteases. J. Ind. Microbiol. Biotechnol. 31:83-7.

Kamat, T., C. Rodrigues, and C.G. Naik. 2008. Marine-derived fungi as a source of

proteases. Indian J. Mar. Sci. 37:326-328.

Kashyap, D.R., P.K. Vohra, S. Chopra, and R. Tewari. 2001. Applications of pectinases

in the commercial sector: a review. Bioresource Technology. 77:215-227.

258

Katapodis, P., M. Vardakou, E. Kalogeris, D. Kekos, B.J. Macris, and P.

Christakopoulos. 2003. Enzymic production of a feruloy- lated oligosaccharide

with antioxidant activity from wheat flour arabinoxylan. Eur. J. Nutr. 42:55-60.

Katapodis, P., V. Christakopoulou, D. Kekos, and P. Christakopoulos. 2007.

Optimization of xylanase production by Chaetomium thermophilum in wheat

straw using response surface methodology. Biochem. Eng. J. 35:136-141.

Kaul, S., S. Gupta, M. Ahmed, and M. K. Dhar. 2012. Endophytic fungi from medicinal

plants: a treasure hunt for bioactive metabolites. Phytochem. Rev. 11:487-505.

Kavanagh, K. Fungal fermentation systems and products. pp. 89-112. In: K. Kavanagh

[Eds.] 2005. Fungi: biology and applications. Wiley, Chichester, West Sussex.

Kiiskinen, L.L., K. Kruus, M. Bailey, E. Ylosmaki, M. Siika-aho, and M. Saloheimo.

2004. Expression of Melanocarpus albomyces laccase in Trichoderma reesei

and characterization of the purified enzyme. Microbiology. 150:3065-3074.

Kim, S., D.S. Sin, T. Lee, and J.B. Oh. 2004. Periconicins two new fusicoccane

diterpenes produced by an endophytic fungus Periconia sp. with antibacterial

activity. J. Nat. Prod. 67:448-450.

Kimura, M. 1980. A simple method for estimating evolutionary rate of base

substitutions through comparative studies of nucleotide sequences. J. Mol.

Evol. 16:111-120.

Kinahan, J.J., E.P. Kowal, and G.B. Grindey. 1981. Biochemical and antitumor effects

of the combination of thymidine and 1-d-arabinofuranosylcytosine against

eukemla L1210. Cancer Res. 41:445-51.

259

Kingston, D.G.I. 1993. Taxol, an exciting anticancer drug from Taxus brevifolia. Am.

Chem. Soc. Symp. Ser. 534:138-148.

Kirk, O., T.V. Borchert, and C.C. Fuglsang. 2002. Industrial enzyme applications. Curr.

Opin. Biotechnol. 13:345-351.

Kirkby, K.A., J.E. Pratley, D.E. Hume, M.J. Faville, M. An, and H. Wu. 2011.

Incidence of endophyte Neotyphodium occultans in Lolium rigidum from

Australia. Weed Res. 51:261-272.

Kjer, J., V. Wray, R.A. Edrada-Ebel, R. Ebel, A. Pretsch, W.H. Lin, and P. Proksch.

2009. Xanalteric Acid and related phenolic compounds from endophytic

Alternaria sp. isolated from the mangrove plant Sonneratia alba. J. Nat. Prod.

72:2053-2057

Knob, A. S.M. Beitel, D. Fortkamp, C. R. F. Terrasan, and A. F. de Almeida. 2013.

Production, purification, and characterization of a major Penicillium glabrum

xylanase using brewer’s spent grain as substrate. BioMed Res. Int.

http://dx.doi.org/10.1155/2013/728735.

Ko, C.H., C.H. Tsai, J. Tu, B.Y. Yang, D.L. Hseih, W.N. Jane, and T.L. Shih. 2011.

Identification of Paenibacillus sp. 2S-6 and application of its xylanase on

biobleaching. Int. Biodeterior. Biodegrad. 65:334-339.

Kongsaeree, P., S. Prabpai, N. Sriubolmas, C. Vongvein, and S. Wiyakrutta. 2003.

Antimalarial dihydroisocoumarins produced by Geotrichum sp., an endophytic

fungus of Crassocephalum crepidioides. J. Nat. Prod. 66:709-11

260

Konno, K., C. Hirayama, M. Nakamura, K. Tateishi, Y. Tamura, M. Hattori, K. Kohno.

2004. Papain protects papaya trees from herbivorous insects: role of cysteine

proteases in latex. Plant. J. 37:370-378.

Koushki, M.M., H. Rouhani, and M. Farsi. 2011. Genetic manipulation of fungal strains

for the improvement of heterologous genes expression (a mini-review). Afr. J.

Biotechnol. 10:7939-7948.

Krings, M., T.N. Taylor, H. Hass, H. Kerp, N. Dotzler, and E.J. Hermsen. 2007. Fungal

endophytes in a 400-million-yr-old land plant: infection pathways, spatial

distribution, and host responses. New Phytol. 174:648-657.

Krohn, K., I. Kock, B. Elsasser, U. Florke, B. Schulz, S. Draeger, G. Pescitelli, S.

Antus, and T. Kurtan. 2007. Bioactive natural products from the endophytic

fungus Ascochyta sp. from Meliotus dentatus configurational assignment by

solid-state CD and TDDFT calculations. Eur. J. Org. Chem. 2007:1123-1129.

Kruys, A. and M. Wedin. 2009. Phylogenetic relationships and an assessment of

traditionally used taxonomic characters in the Sporormiaceae (Pleosporales,

Dothideomycetes, Ascomycota), utilising multi-gene phylogenies. Syst.

Biodivers. 7:465-478.

Kuhad, R.C.and A. Singh. 2007. Lignocellulose biotechnology: future prospects, I. K.

International Publishing House, New Delhi.

Kulkarni, N., A. Shendye, and M. Rao. 1999. Molecular and biotechnological aspects of

xylanases. FEMS Microbiol. Rev. 23:411-456.

Kumar, D.S.S. and K.D. Hyde. 2004. Biodiversity and tissue-recurrence of endophytic

fungi in Tripterygium wilfordii. Fungal Divers. 17:69-90. 261

Kumaresan, V. and T.S. Suryanarayanan. 2001. Occurrence and distribution of

endophytic fungi in a mangrove community. Mycol. Res. 105:1388-91.

Kunkel, B.A., P.S. Grewal, and M.F. Quigley. 2004. A mechanism of acquired

resistance against an entomopathogenic nematode by Agrotis ipsilon feeding

on perennial ryegrass harboring a fungal endophyte. Biol. Control. 29:100-108.

Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head

of bacteriophage T4. Nature. 227:680-685.

Laird, S.A., R. Wynberg, and S. Johnston. 2006. Recent trends in the biological

prospecting, IP116, XXIX antarctic treaty consultative meeting (ATCM),

Agenda item 18. UNU-IAS, Edinburgh.

Lam, K.S. 2007. New aspects of natural products in drug discovery. Trends Microbiol.

15:279-289.

Lange, L. Tropical biodiversity, an industrial perspective. pp. 296-300. In: M. Bellot-

Rojas, S. Bernier [Eds.] 2004. International expert workshop on access to

genetic resources and benefit sharing. Bellot-Rojas, Cuernavaca, Mexico.

Lantz, M.S. and P. Ciborowski. 1994. Zymographic techniques for detection and

characterization of microbial proteases. Methods. Enzymol. 235:563-594.

Latch, C.G.M. 1993. Physiological interactions of endophytic fungus and their host.

Biotic stress tolerance imparted to grasses by endophytes. Agric. Ecosyst.

Environ. 44:143-156.

Lawrence, H.A. and E.A. Palombo. 2009. Activity of essential oils against Bacillus

subtilis spores. J. Microbiol. Biotechnol. 19:1590-1595.

262

Laxman, R.S., A.P. Sonawane, S.V. More, B.S. Rao, M.V. Rele, V.V. Jogdand, V.V.

Deshpande, and M.B. Rao. 2005. Optimisation and scale up of production of

alkaline protease from Conidiobolus coronatus. Process Biochem. 40:3152-

3158.

Lee, J., E. Lobkovsky, N.B. Pliam, G.A. Strobel, and J. Clardy. 1995. Subglutinols A

and B: immunosuppressive compounds from the endophytic fungus Fusarium

subglutinans. J. Org. Chem. 60:7076-7077.

Lewis, G.C. 2004. Effects of biotic and abiotic stress on the growth of three genotypes

of Lolium perenne with and without infection by the fungal endophyte

Neotyphodium lolii. Ann. Appl. Biol. 144:53-63.

Li, E., L. Jiang, L. Guo, H. Zhang, and Y. Che. 2008a. Pestalachlorides A-C, antifungal

metabolites from the plant endophytic fungus Pestalotiopsis adusta. Bioorg.

Med. Chem. 16:7894-7899.

Li, E., R. Tian, S. Liu, X. Chen, L. Guo, and Y. Che. 2008b. Pestalotheols A-D,

bioactive metabolites from the plant endophytic fungus Pestalotiopsis theae. J.

Nat. Prod. 71:664-668.

Li, J.W.H and J.C.Vederas. 2009. Drug discovery and natural Products: end of an era or

an endless frontier? Science. 325: 161-165.

Li, J.Y and G.A. Strobel. 2001. Jesterone and hydroxy-jesterone antioomycete

cyclohexenone epoxides from the endophytic fungus Pestalotiopsis jesteri.

Phytochemistry. 57:261-265.

Li, J.Y., J.K. Harper, D.M. Grant, B.O. Tombe, B. Bashyal, W.M. Hess, and G.A.

Strobel. 2001. Ambuic acid, a highly functionalized cyclohexenone with 263

antifungal activity from Pestalotiopsis spp. and Monochaetia sp.

Phytochemistry. 56:463-468.

Li, Y., Y.C. Song, J,Y. Liu, Y.M. Ma, and R.X. Tan. 2005. Anti-Helicobacter pylori

substances from endophytic fungal cultures. World J. Microb. Biotech. 21:553-

558.

Lin, X., J.H. Yao, Z.H. Zheng, J.S. Wen , X.M. Qian, and Y.M. Shen. 2010.

Endophytes from the pharmaceutical plant, Annona squamosa: isolation,

bioactivity, identification and diversity of its polyketide synthase gene. Fungal

Divers. 41:41-51

Lin, Z.J., Z.Y. Lu, T.J. Zhu, Y.C. Fang, Q.Q. Gu, and W.M. Zhu. 2008. Penicillenols

from Penicillium sp. GQ-7, an endophytic fungus associated with Aegiceras

corniculatum. Chem. Pharm. Bull. 56:217-221.

Lindstrom, J.T., S. Sun, and F.C. Belanger. 1993. A nove1 funga1 protease expressed in

endophytic infection of Poa Species. Plant Physiol. 102:645-650.

Linke, D., H. Bouws, T. Peters, M. Nimtz, R.G. Berger, and H. Zorn. 2005. Laccases of

Pleurotus sapidus: characterization and cloning. J. Agr. Food Chem. 53:9498-

9505.

Liska, A.J., and A. Shevchenko. 2003. Expanding the organismal scope of proteomics:

Cross-species protein identification by mass spectrometry and its implications.

Proteomics. 3:19-28.

Liu, B., L. Huang, H. Buchenauer, and Z. Kang. 2010a. Isolation and partial

characterization of an antifungal protein from the endophytic Bacillus subtilis

strain EDR4. Pestic. Biochem. Physiol. 98:305-311. 264

Liu, L., S. Liu, L. Jiang, X. Chen, L. Guo, and Y. Che. 2008. Chloropupukeananin, the

first chlorinated pupukeanane derivative, and its precursors from Pestalotiopsis

fici. Org. Lett. 10:1397-1400.

Liu, L., S.C. Liu, X.L. Chen, L.D. Guo, and Y.S. Che. 2009. Pestalofones A–E

bioactive cyclohexanone derivatives from the plant endophytic fungus

Pestalotiopsis fici. Bioorgan. Med. Chem. 17:606-613.

Liu, Y.H., Z.S. Liang, B. Chen, D.F. Yang, and J.L. Liu. 2010b. Elicitation of alkaloids

in in vitro PLB (protocorm-like body) cultures of Pinellia ternate. Enzyme

Microb. Technol. 46:28-31.

Lodewyckx, C., S. Taghavi, M. Mergeay, J. Vangronsveld, H. Clijsters and D. van der

Lelie. 2001. The effect of recombinant heavy metal resistant endophytic

bacteria on heavy metal uptake by their host plant. Int. J. Phytorem. 3:173-187.

Lodewyckx, C.M., J. Mergeay, H. Vangronsfeld, D. Clijsters, and D. van der Lelie.

2002. Isolation, characterization, and identification of bacteria associated with

the zinc hyperaccumulator Thlaspi caerulescens subsp. calaminaria. Int. J.

Phytorem. 4:101-105.

Logrieco, A., A. Moretti, and M. Solfrizzo. 2009. Alternaria toxins and plant diseases:

An overview of origin, occurrence and risks. World Mycotoxin. J. 2:129-140.

Loiret, F., E. Ortega, D. Kleiner, P. Ortega-Rodes, R. Rodes and Z. Dong. 2004. A

putative new endophytic nitrogen-fixing bacterium Pantoea sp. from sugarcane,

J. Appl. Microbiol. 97:504-511.

Lopez, J. and H. Jensen. 2002. Generic model of morphological changes in growing

colonies of fungi. Phys. Rev. E. Stat. Nonlin. Soft Matter Phys. 65:021903. 265

Lopez, M.J., M.d.C.Vargas-Garcia, F. Suarez-Estrella, N.N. Nichols, B.S. Dien, and J.

Moreno. 2007. Lignocellulose-degrading enzymes produced by the ascomycete

Coniochaeta ligniaria and related species: application for a lignocellulosic

substrate treatment. Enzym. Microb. Technol. 40:794-800.

Losgen, S., J. Magull, B. Schulz, S. Draeger, and A. Zeeck. 2008. Isofusidienols: novel

chromone-3-oxepines produced by the endophytic fungus Chalara sp. Eur. J.

Org. Chem. 698-703.

Lu, H., W.X. Zou, and J.C. Meng. 2000. New bioactive metabolites produced by

Colletotrichum sp., an endophytic fungus in Artemisia annua. Plant Sci.

151:67-73.

Lu, Y., C. Chen, H. Chen, J. Zhang, and W. Chen. 2012. Isolation and identification of

endophytic fungi from Actinidia macrosperma and investigation of their

bioactivities. Evid. Based. Complement. Alternat. Med.

doi:10.1155/2012/382742.

Lue, Y.P.R., S.Y.D. Yeo, L.P. Tan, G.Y.J. Chen, and S.Q. Yao. Novel strategies in

protein microarray generation and detection. pp. 13-42. In: M. Schena [Eds.]

2005. Protein microarrays. Jones and Bartlett Publishers, Sudbury, MA.

Lumyong, S., P. Lumyong, E.H.C. McKenzie, and K.D. Hyde. 2002. Enzymatic activity

of endophytic fungi of six native seedling species from Doi Suthep-Pui

National Park, Thailand. Can. J. Microbiol. 48:1109-1112.

Lv, Y.L., F.S. Zhang, J. Chen, J.L. Cui, Y.M. Xing, X.D. Li, and S.X. Guo. 2010.

Diversity and antimicrobial activity of endophytic fungi associated with the

alpine alant Saussurea involucrate. Biol. Pharm. Bull. 33:1300-1306.

266

Lyons, P.C., J.J. Evans, and C.W. Bacon. 1990. Effects of the fungal endophyte

Acremonium coenophialum on nitrogen accumulation and metabolism in tall

fescue. Plant Physiol. 92:726-732.

Lόpez-Otín, C. and J.S. Bond. 2008. Proteases: multifunctional enzymes in life and

disease. J. Biol. Chem. 283:30433-30437.

Ma´rquez, S.S., G.F. Bills, N. Herrero, and I´.Zabalgogeazcoa. 2012. Non systemic

fungal endophytes of grasses. Fungal Ecol. 5:289-297.

Macarrón, R., C. Acebal, M. Castillón, and M. Claeyssens. 1996. Mannanase activity of

endoglucanase III from Trichoderma reesei QM9414. Biotechnol. Lett. 18:599-

602.

Macías-Rubalcava, M.L., B.E. Hernández-Bautista, M. Jiménez-Estrada, M.C.

González, A.E. Glenn, and R.T. Hanlin. 2008. Naphthoquinone spiroketal with

allelochemical activity from the newly discovered endophytic fungus Edenia

gomezpompae. Phytochemistry 69:1185-96.

Maheshwari, R., G. Bharadwaj, and M.K. Bhat. 2000. Thermophilic fungi: their

physiology and enzymes. Microbiol. Mol. Biol Rev. 64:461-488.

Maheswari, C.U. and A. Sankaralingam. 2010. Role of toxin produced by Alternaria

alternata in leaf blight of watermelon and its degradation by biocontrol agents.

Arch. Phytopathology. Plant. Protect. 43:41-50.

Maheswari, C.U. and A. Sankaralingam. 2010. Role of toxin produced by Alternaria

alternata in leaf blight of watermelon and its degradation by biocontrol agents.

Arch. Phytopathology Plant Protect. 43:41-50.

267

Malinowski, D.P. and D.P. Belesky. 1999. Endophyte infection enhances the ability of

tall fescue to utilize sparingly available phosphorus. J. Plant Nutr. 22:835-853.

Malinowski, D.P. and D.P. Belesky. 2000. Adaptations of endophyte-infected cool-

season grasses to environmental stresses: mechanisms of drought and mineral

stress tolerance. Crop Sci. 40:923-940.

Malinowski, D.P., D.K. Brauer, and D.P. Belesky. 1999. The endophyte Neotyphodium

coenophialum affects root morphology of tall fescue grown under phosphorous

deficiency. J. Agron. Crop Sci. 183:53-60

Mandels, M., J. Weber, and R. Parizek. 1971. Enhanced cellulase production by a

mutant of Trichoderma viride. App. Microbiol. 21:152-154.

Mandyam. K. and A. Jumpponen. 2005. Seeking the elusive function of root-colonizing

dark septate endophytic fungi. Stud. Mycol. 53:173-189.

Mapperson, R.R., M. Kotiw, R. D. Davis and J. D.W. Dearnaley. 2014. The diversity

and antimicrobial activity of Preussia sp. endophytes isolated from Australian

dry rainforests. Curr. Microbiol. 68:30-7.

Margulies, M., M. Egholm, W.E. Altman, S. Attiya, J.S. Bader, L.A. Bemben, J. Berka,

M.S. Braverman, Y.J. Chen, Z. Chen, S.B. Dewell, L. Du, J.M. Fierro, X.V.

Gomes, B.C. Godwin, W. He, S. Helgesen, C.H. Ho, G.P. Irzyk, S.C. Jando,

M.L.I. Alenquer, T.P Jarvie, K.B Jirage, J.B. Kim, J.R. Knight, J.R Lanza, J.H.

Leamon, S.M. Lefkowitz, M. Lei, J. Li, K.L. Lohman, H. Lu, V.B Makhijani,

K.E. McDade, M.P. McKenna, E.W. Myers, E. Nickerson, J.R. Nobile, R.

Plant, B.P. Puc, M.T. Ronan, G.T. Roth, G.J. Sarkis, J.F. Simons, J.W. impson,

M. Srinivasan, K.R. Tartaro, A. Tomasz, K.A. Vogt, G.A. Volkmer, S.H.

268

Wang, Y. Wang, M.P. Weiner, P. Yu, R.F. Begley, J.M. Rothberg. 2005.

Genome sequencing in microfabricated high-density picolitre reactors. Nature.

437:376-380.

Maria, G.L., K.R. Sridhar, and N.S. Raviraj. 2005. Antimicrobial and enzyme activity

of mangrove endophytic fungi of southwest coast of India. J. Agr. Technol.

1:67-79.

Marinelli, F. 2009. From microbial products to novel drugs that target a multitude of

disease indications. Methods in Enzymology. 458:29-58.

Martin, K.J. and P.T. Rygiewicz. 2005. Fungal-specific PCR primers developed for

analysis of the ITS region of environmental DNA extracts. BMC

Microbiology. 5:28-39.

Marx, I.J., N. Wyk, S. Smit, D. Jacobson, M. Viljoen-Bloom, and H. Volschenk. 2013.

Comparative secretome analysis of Trichoderma asperellum S4F8 and

Trichoderma reesei Rut C30 during solid-state fermentation on sugarcane

bagasse. Biotechnol. Biofuels. 6:172-185.

Mathlouthi, N., H. Juin, and M. Larbier. 2003. Effect of xylanase and beta-glucanase

supplementation of wheat- or wheat- and barley-based diets on the

performance of male turkeys. Br. Poult. Sci. 44:291-298.

Matos, A.J.F.S., R.M.F. Bezerra, and A.A. Dias. 2007. Screening of fungal isolates and

properties of Ganoderma applanatum intended for olive mill wastewater

decolourization and dephenolization. Lett. Appl. Microbiol. 45:270-275.

269

Matrinez ,T.F., F.J. Alarcon, M.D. Lopez MD, and F.J. Moyano. 2000. Improved

detection of amylase activity by sodium dodecyl sulfate-polyacrylamide gel

electrophoresis with copolymerized starch. Electrophoresis. 21:2940-43.

Matsumura, S., K. Sakiyama, and K. Toshima. 1999. Preparation of octyl-B-D D-

xylobioside and xyloside by xylanase catalyzed direct transglycosylation

reaction of xylan and octanol. Biotechnol. Lett. 21:17-22.

Matte, A. and C.W. Forsberg. 1992. Purification, characterization, and mode of action

of endoxylanases 1 and 2 from Fibrobacter succinogenes S85. Appl. Environ.

Microbiol. 58:157-168.

McAuliffe, J.C., W. Aehle, G.M. Whited, and D.E. Ward. Industrial enzymes and

biocatalysis. pp. 1375-1420. In: J.A. Kent [Eds.] 2007. Kent and Riegel's

handbook of industrial chemistry and biotechnology, Springer, New York.

McCann, M.C. and N.C. Carpita. 2008. Designing the deconstruction of plant cell walls.

Curr. Opin. Plant Biol. 11:314-320.

Medina, M.L., P.A. Haynes, L. Breci, and W.A. Francisco. 2005. Analysis of secreted

proteins from Aspergillus flavus. Proteomics. 5:3153-3161.

Medina, M.L., U.A. Kiernan, and W.A. Francisco. 2004. Proteomic analysis of rutin-

induced secreted proteins from Aspergillus flavus. Fungal Genet. Biol. 41:327-

335.

Mellitzer, A., R. Weis, A. Glieder, and K. Flicker. 2012. Expression of lignocellulolytic

enzymes in Pichia pastoris. Microb. Cell Fact. 11:61-72.

270

Mendicuti-Castro, P.L., A.B. Trejo-Aguilar, and A.G. Osorio. 1997. Thermostable

xylanase produced at 37 °C and 45 °C by a thermotolerant Aspergillus strain.

FEMS Microbiol. Letters. 146:97-102.

Meshram, M., A. Kulkarni, V.K. Jayaraman, B.D. Kulkarni, and S. Lele. 2008.Optimal

xylanase production using penicillium janthinellum NCIM 1169: A model

based approach. J. Biochem. Eng. 40:348-356.

Messias, J.M., B.Z. da Costa, V.M.G. de Lima, R.F.H. Dekker, M.I. Rezende, N.

Krieger, and A.M. Barbosa. 2009. Screening Botryos phaeria species for

lipases: Production of lipase by Botryosphaeria ribis EC-01 grown on soybean

oil and other carbon sources. Enzyme Microb. Technol. 45:426-431.

Michelin, M., T.M. Silva, V.M. Benassi, S.C. Peixoto-Nogueira, A.L.B. Moraes, J.M.

Leão, J.A. Jorge, H.F. Terenzi, M.D. Lourdes, and T.M. Polizeli. 2010.

Purification and characterization of a thermostable a-amylase produced by the

fungus Paecilomyce svariotii. Carbohyd. Res. 345:2348-2353.

Mielenz, J.R. 2001. Ethanol production from biomass: technology and

commercialization status. Curr. Opin. Microbiol. 4:324-329.

Miller, G.L.1959. Use of dinitro salicylic acid reagent for determination of reducing

sugar. Anal. Chem. 31:426-429.

Miller, K.I., C. Qing, D. Man Yuen Sze, and B. A. Neilan. 2012. Investigation of the

biosynthetic potential of endophytes in traditional Chinese anticancer herbs.

PLoS ONE. 7: e35953.

271

Mirzaei, H. and H. Mirzaei. 2010. Optimizing effective factors on alkaline protease

production by Bacillus lichiniformis under submerged fermentation. Minerva

Biotecnologica. 22:91-95.

Mishra, P. D., S.A.Verekar, A. Kulkarni-Almeida, and S.K. Roy. 2013. Anti-

inflammatory and anti-diabetic naphtha-quinones from an endophytic fungus

Dendryphion nanum (Nees) S. Hughes. Indian. J. Chem. 52:565-567.

Misko, A.L. and J.J. Germida. 2002. Taxonomic and functional diversity of

pseudomonads isolated from the roots of field-grown canola. FEMS Microbiol.

Ecol. 42:399-407.

Mole, P.G. and S. Waterman. 1994. Analysis of phenolic plant metabolites. Blackwell

Scientific Publications, London.

Molina, G., M. Pimentel, T. Bertucci, and G. Pastore. 2012. Application of fungal

endophytes in biotechnological processes. Chem. Eng. Trans. 27:289-294.

Monnet, F., N. Vaillant, A. Hitmi, A. Coudret, and H. Sallanon. 2001. Endophytic

Neotyphodium lolii induced tolerance to Zn stress in Lolium perenne. Physiol.

Plantarum. 113:557-563.

Moore, D., L. McNulty, and A. Meskauskas. 2005. Branching in fungal hyphae and

fungal tissues: growing mycelia in a desktop computer. Branching

Morphogenesis. 1:75-90.

More, S.M., A.V. Girde, and M.M.V. Baig. 2009. In vitro protease synthesis by the seed

borne Alternaria alternata (Fr.) Keissl. Biomed Pharmacol. J. 2:153-156.

272

Morgan N.L., M.J. Waites, J.S. Rockey, and G. Higton. Microbial enzymes. pp. 133-

143. In: N.L. Morgan, M.J. Waites, J.S. Rockey, and G. Higton [Eds.] 2009.

Industrial microbiology: an introduction. Blackwell Science Ltd., London.

Mousa, W.K. and M.N. Raizada. 2013. The diversity of anti-microbial secondary

metabolites produced by fungal endophytes: an interdisciplinary perspective.

Front Microbiol. 4:65-85.

Moy, M., H.M. Li, R. Sullivan, Jr.J.F. White, and F.C. Belanger. 2002. Endophytic

fungal β-1,6-glucanase expression in the infected host grass. Plant Physiol.

130:1298-1308.

Mueller, O., R. Kahmann, G. Aguilar, B. Trejo-Aguilar, A. Wu, and R.P. de Vries.

2008. The secretome of the maize pathogen Ustilago maydis. Fungal Genet.

Biol. 45:S63-S70.

Mukesh Kumar, D.J., B. Jayanthisiddhuraj, B. Amutha, D. Monica Devi, M.D. Bala

Kumaran, and P.T. Kalaichelvan. 2012. Purification and characterization of α-

amylase and β-Galactosidase from Bacillus sp. MNJ23 produced in a

concomitant medium. American-Eurasian J. Agric. Environ. Sci. 12:566-573.

Murthy, S.P. and M.M. Naidu. 2010. Protease Production by Aspergillus oryzae in

solid-state fermentation utilizing coffee by-products. World Appl. Sci. J.

8:199-205.

Murugan, K., S. Saravanababu, and M. Arunchalam. 2007. Screening of tannin acyl

hydrolase (E.C.3.1.1.20) producing tannery effluent fungal isolates using

simple agar plate and SmF process. Bioresour. Technol. 98:946-949.

273

Musetti, R., R. Polizzotto, A. Vecchione, S. Borselli, L. Zulini, M. D'Ambrosio, L.S. di

Toppi, and I. Pertot. 2007. Antifungal activity of diketopiperazines extracted

from Alternaria alternata against Plasmopara viticola: an ultrastructural study.

Micron. 38:643-50.

Muthulakshmi, C., D. Gomathi, D.G. Kumar, G. Ravikumar, M. Kalaiselvi, and C.

Uma. 2011. Production, purification and characterization of protease by

Aspergillus flavus under solid state fermentation. Jordan. J. Biol. Sci. 4:137-

148.

Nagendran, S., H.E. Hallen-Adams, J.M. Paper, N. Aslam, and J.D. Walton. 2009.

Reduced genomic potential for secreted plant cell-wall-degrading enzymes in

the ectomycorrhizal fungus Amanita bisporigera, based on the secretome of

Trichoderma reesei. Fungal Genet. Biol. 46:427-435.

Najafi, M.F., D. Deobagkar, and D. Deobagkar. 2005. Potential application of protease

isolated from Pseudomonas aeruginosa PD100. Electron. J. Biotechnol. 8:197-

203.

Nakamura, S., K. Wakabayashi, R. Nakai, R. Aono, and K. Horikoshi. 1993.

Purification and some properties of an alkaline xylanase from alkaliphilic

Bacillus sp. Strain 41M-1. Appl. Microbiol. Biotechnol. 59:2311-2316.

Narisawa, K., H. Kawamata, R.S. Currah, and T. Hashiba. 2002. Suppression of

Verticillium wilt in Eggplant by some fungal root endophytes. Eur. J. Plant

Pathol. 108:103-109.

274

Negi, S. and R. Banerjee. 2010. Optimization of culture parameters to enhance

production of amylase and protease from Aspergillus awamori in a single

fermentation. Afr. J. of Biochem. Res. 4:73-80.

Nevalainen, H. 2001. Strain improvement in filamentous fungi-an overview. pp. 289-

304. In: G. G. Khachatourians, and D. K. Arora [Eds.] 2001. Applied

mycology and biotechnology. Elsevier, Amsterdam.

Nevalainen, K.M.H. and V.S.J. Te’o. 2003. Enzyme production in industrial fungi-

molecular genetics strategies for integrated strain improvement. Appl. Mycol.

Biotechnol. 3:241-259.

Newman, L.A. and C.M. Reynolds. 2005. Phytoremediation and bacteria: new uses of

endophytic bacteria in plants. Trends Biotechnol. 23:6-8.

Ng, L.T., M. Noreha, H. Jamilah, and L.T. Tan. Prolyl endopeptidase (PEP) inhibitory

activity from an endophytic fungus isolated in Sarawak. In: R. Manurung,

C.A. Zaliha, B.A. Fashiuddin, and C. kuek [Eds.] 2010. Proceedings of the

biodiversity and biotechnology symposium. Sarawak Biodiversity Centre,

Sarawak.

Nguyen, Q.D., J.M-R. Szabo, M. Claeyssens, I. Stals, and A. Hoschke. 2002.

Purification and characterisation of amylolytic enzymes from thermophilic

fungus Thermomyces lanuginosus strain ATCC 34626. Enzym. Microb. Tech.

31:345-352.

Ni, Z.W., G.H. Li, P.J. Zhao, and Y.M. Shen. 2008. Antimicrobial components of the

endophytic fungal strain Chaetomium globosum Ly50 from Mantenus hookeri.

Nat. Prod. Res. Dev. 20:33-36.

275

Nigam, P. and D. Singh. 1995. Enzymes and microbial system involved in starch

processing enzyme. Enz. Microbial. Technol. 17:770-778.

Nilsson, R.H., E. Kristiansson, M. Ryberg, N. Hallenberg, and K.H. Larsson. 2008.

Intraspecific ITS variability in the kingdom fungi as expressed in the

international sequence databases and its implications for molecular species

identification. Evol. Bioinform. 4:193-201.

Nimal Christhudas, I.V.S., P. Praveen Kumar, and P. Agastian P. 2013. In vitro α-

glucosidase inhibition and antioxidative potential of an endophyte species

(Streptomyces sp. Loyola UGC) isolated from Datura stramonium L. Curr.

Microbiol. 67:69-76.

Nimal Christhudas, I.V.S., P. Praveen Kumar, and P. Agastian. 2012. Antimicrobial

activity and HPLC analysis of tropane alkaloids in Streptomyces spp. isolated

from Datura stramonium L. Asian J. Pharm. Clin. Res. 5:278-282.

Nirmal, N.P., S. Shankar, and R.S. Laxman. 2011. Fungal proteases: an overview. Int. J.

Biotech. Biosci. 1:1-40.

Noble, H.M., D. Langley, P.J. Sidebottom, S.J. Lane, and P.J. Fisher. 1991. An

echinocandin from an endophytic Cryptosporiopsis sp. and Pezicula sp. in

Pinus sylvestris and Fagus sylvatica. Mycological Res. 95:1439-40.

Nogueira, M.A., M.A.S.C. Chellegatti, G.H. Braun, H.P. Ramos, G.A. Antonucci, S.V.

Sampaio, M.T. Pupo, and S. Said. 2008. Fungi prospecting and their products:

L-asparaginase, lipase and antimicrobial substances. In: XII International

Congress of Mycology, Istanbul, Turkey.

276

Noh, M., J. Yang, K. Kim, Y. Yoon, K. Kang, H. Han, S. Him, and H. Park. 1999.

Isolation of a novel microorganism Pestalotia heterocornis, producing

paclitaxel. Biotech Bioeng. 64:620-623.

North, M.J. 1982. Comparative biochemistry of the proteinases of Eucaryotic

microorganisms. Microbiol. Rev. 46:308-340.

Noser, J., P. Schneider, M. Rother, and H. Schmutz 2011. Determination of six

Alternaria toxins with UPLC-MS/MS and their occurrence in tomatoes and

tomato products from the Swiss market. Mycotoxin Res. 27:265-71.

Nouani, A., F. Moulti- Mati, S. Belbraouet, and M.M. Bellal. 2011. Purification and

characterization of a milk-clotting protease from Mucor pusillus: Method

comparison. Afr. J. Biotech. 10:1655-1665.

Nwagu, T.N. and B.N. Okolo. 2011. Extracellular amylase production of a

thermotolerant Fusarium spp. isolated from eastern Nigerian soil. Braz. Arch

Biol Techn. 54:649-658.

Oda, K., D. Kakizono, O. Yamada, H. Iefuji, O. Akita, and K. Iwashita. 2006.

Proteomic analysis of extracellular proteins from Aspergillus oryzae grown

under submerged and solid-state culture conditions. App. Environ. Microbiol.

72:3448-3457.

Oliveira, J.M.P. and L.H. Graaff. 2011. Proteomics of industrial fungi: trends and

insights for biotechnology. Appl. Microbiol. Biotechnol. 89:225-237.

Ouyang, J., M. Yan, D. Kong, and L. Xu. 2006. A complete protein pattern of cellulase

and hemicellulase genes in the filamentous fungus Trichoderma reesei.

Biotechnol. J. 1:1266-1274. 277

Owen, N.L. and N. Hundley .2004. Endophytes-the chemical synthesizers inside plants.

Sci. Prog. 87:79-99.

Pain, A. and C. Hertz-Fowler. 2008. Genomic adaptation: a fungal perspective. Nature

Rev. Microbiol. 6:572-573.

Pala, H., M. Mota, and F.M. Gama. 2004. Enzymatic versus chemical deinking of non-

impact ink printed paper. J. Biotechnol. 108:79-89.

Pandey, A., C.R. Soccol, and D. Mitchell. 2000a. New developments in solid state

fermentation. Process. Biochem. 35:1153-1169.

Pandey, A., P. Nigam, V.T. Soccol, D. Singh, and R. Mohan. 2000b. Advances in

microbial amylases. Biotechnol. Appl. Biochem. 31:135-152.

Pandey, A., P. Selvakumar, C.R. Soccol, and P. Nigam. 1999. Solid state fermentation

for the production of industrial enzymes. Curr. Sci. 77:149-162.

Pańka, D., C.P. West, C.A. Guerber, and M.D. Richardson. 2013. Susceptibility of tall

fescue to Rhizoctonia zeae infection as affected by endophyte symbiosis. Ann.

Appl. Biol. 163:257-268.

Paper, J.M., J.S. Scott-Craig, N.D. Adhikari, C.A. Cuomo, and J.D. Walton. 2007.

Comparative proteomics of extracellular proteins in vitro and in planta from

the pathogenic fungus Fusarium graminearum. Proteomics. 7:3171-3183.

Patil, M. and N. V. Shastri. 1985. Purification and properties of proteases produced by

Alternaria alternata (Fr.) Keissl, regulation of production by fructose. J. Biosci.

9:1-11.

278

Pengthamkeerati, P., S. Numsomboon, T. Satapanajaru, and P. Chairattanamanokorn.

2012. Production of α-Amylase by Aspergillus oryzae from cassava bagasse

and wastewater sludge under solid-state fermentation. Environ. Prog. Sustain.

31:122-129.

Pennacchio, M., A.S. Kemp, R.P. Taylor, K.M. Wickens, and L. Kienow. 2004.

Interesting biological activities from plants traditionally used by Native

Australians. J. Ethnopharmacol. 96:597-601.

Penttïlä, M., H. Nevalainen, M. Rättö, E. Salminen, and J. Knwles. 1987. A versatile

transformation system for the cellulolytic filamentous fungus Trichoderma

reesei. Gene. 61:155-164.

Peppler, H.J. and D. Periman. 1978. Microbiological Technology, 2nd Edition. pp. 7-16.

Academic Press, New York.

Perkins, D.N., D.J.C. Pappin, D.M. Creasy, and J.S. Cottrell. 1999. Probability-based

protein identification by searching sequence databases using mass spectrometry

data. Electrophoresis. 20:3551-3567.

Peterson, R., J. Grinyer, and H. Nevalainen. 2011a. Extracellular hydrolase profiles of

fungi isolated from koala faeces invite biotechnological interest. Mycol. Prog.

10:207-218.

Peterson, R., J. Grinyer, H. Nevalainen. 2011b. Secretome of the coprophilous fungus

Doratomyces stemonitis C8, isolated from koala feces. Appl. Environ.

Microbiol. 77:3793-3801.

279

Peterson, R., J. Grinyer. J. Joss, A. Khan, and H. Nevalainen. 2009b. Fungal proteins

with mannanase activity identified directly from a Congo Red stained

zymogram by mass spectrometry. J. Microbiol Meth. 79:374-377.

Peterson, R.A., J.R. Bradner, T.H. Roberts, and K.M.H. Nevalainen. 2009a. Fungi from

koala (Phascolarctos cinereus) faeces exhibit a broadrange of enzyme activities

against recalcitrant substrates. Lett. Appl. Microbiol. 48:218-225.

Petrini, O. Fungal endophytes of tree leaves. pp. 179-197. In: J.H. Andrews, and S.S

Hirano [Eds.] 1991. Microbial ecology of leaves. Springer, Verlag, New York.

Petrini, O. Taxonomy of endophytic fungi of aerial plant tissue. pp. 175-187. In: N.

Fokkema, and J. van den Heuvel [Eds.] 1986. Microbiology of the

phyllosphere. Cambridge University Press, Cambridge.

Petrini, O., T.N. Sieber, L. Toti, and O. Viret. 1992. Ecology, metabolite production,

and substrate utilization in endophytic fungi. Nat. Toxins. 1:185-196.

Pimentel, M.R., G. Molina, A.P. Dionísio, M.R. Maróstica Junior, and G.M. Pastore.

2010. The use of endophytes to obtain bioactive compounds and their

application in biotransformation process. Biotechnol. Res. Int. 2011:1-11.

Pogori, N., Y. Xu, and A. Cheikhyoussef. 2007. Potential aspects of lipases obtained

from Rhizopusfungi. Research Journal of Microbiology. 2:101-116.

Polaina, J. and A.P. MacCabe. 2007. Industrial Enzymes: Structure, Function and

Applications, Springer, Netherlands.

280

Polizeli, M., A. Rizzatti, R. Monti, H. Terenzi, J. Jorge, and D. Amorim. 2005.

Xylanases from fungi: properties and industrial applications. Appl. Microbiol.

Biotechnol. 67:577-591.

Pongcharoen, W., V. Rukachaisirikul, S. Phongpaichit, T. Kuhn, M. Pelzing, J.

Sakayaroj, and W.C. Taylor. 2008. Metabolites from the endophytic fungus

Xylaria sp. PSU-D14. Phytochemistry. 69:1900-1902.

Prade, R.A. 1995. Xylanases: from biology to biotechnology. Biotech. Genet. Eng. Rev.

13:100-131.

Prema, K. and R. Vandana. 2012. Silver recovery from waste X-ray films using alkaline

protease from Aspergillus wentii and its antibacterial studies. Res. J.

Biotechnol. 7:19-24.

Prema, P. Xylanase. pp. 333-346. In: A. Pandey, C. Webb, C. R. Soccol, and C.

Larroche [Eds.] 2006. Enzyme technology. Springer, New York.

Proksch, P., A. Putz, S. Ortlepp, J. Kjer, and M. Bayer. 2010. Bioactive natural

products from marine sponges and fungal endophytes. Phytochem. Rev. 9:475-

489.

Promputtha, I., K. D. Hyde, E.H.C. McKenzie, J. F. Peberdy, and S. Lumyong. 2010.

Can leaf degrading enzymes provide evidence that endophytic fungi becoming

saprobes? Fungal Diversity. 41:89-99.

Pupo, M.T., K.B. Borges, W.S. Borges, and P.S. Bonato. Fungal biotransformations: a

powerful tool in drug metabolism studies. pp. 47-66. In: R. Saikai, R. L.

Bezbaruah, and T. Ch. Bora [Eds.] 2008. Microbial biotechnology. New India

Publishing Agency, New Delhi. 281

Puri, S.C., A. Nazir, R. Chawla, R. Arora, S. Riyaz-ul-Hassan, T. Amna, B. Ahmed, V.

Verma, S Singh, R.K. Sagar, A.K. Sharma, R. Kumar, R.K. Sharma and G.N.

Qazi. 2006. The endophytic Trametes hirsuta as a novel alternative source of

podophyllotoxin and related aryl tetralin lignans. J. Biotechnol. 122:494-510.

Puri, S.C., V. Verma, T. Amna, G.N. Qazi, and M. Spiteller. 2005. An endophytic

fungus from Nothapodytes foetida that produces camptothecin. J. Nat. Prod.

68:1717-1719.

Purkarthofer, H., M. Sinner, and W. Steiner. 1993. Cellulase-free xylanase from

Thermomyces lanuginosus: optimization of production in submerged and solid-

state culture. Enzyme. Microb. Technol. 15:677-68.

Qin, J.C., Y.M. Zhang, J.M. Gao, M.S. Bai, S.X. Yang, and H. Laatschb. 2009.

Bioactive metabolites produced by Chaetomium globosum, an endophytic

fungus isolated from Ginkgo biloba. Bioorg. Med. Chem. Lett. 19:1572-1574.

Qin, S., H. Hussaina, B. Schultz, S. Draegerb, and K. Krohn. 2010. Two new

metabolites, epoxydine A and B, from Phoma sp. Helv. Chim. Acta. 93:169-

174.

Qinnghe, C., Y. Xiaoyu, N. Tiangui, J. Cheng, and M. Qiugang. 2004. The screening of

culture condition and properties of xylanase by white-rot fungus Pleurotus

ostreatus. Process Biochem. 39:1561-1566.

Qiu, M., R. Xie, Y. Shi, H. Zhang, and H. Chen. 2010. Isolation and identification of

two flavonoid-producing endophytic fungi from Ginkgo biloba L. Ann.

Microbiol. 60:143-150.

282

Rackova, L., M. Majekova, and D. Kostalova. 2004. Antiradical and antioxidant

activities of alkaloids isolated from Mahonia aquifolium – structural aspects.

Bioorg. Med. Chem. Lett. 12:4709-4715.

Radford, A. Polysaccharides. pp. 233-248. In: R. Bramble, and G. A. Marzluf [Eds.]

2004. The mycota: biochemistry and molecular biology. Springer, Berlin.

Radji, M., A. Sumiati1, R. Rachmayani and B. Elya .2011. Isolation of fungal

endophytes from Garcinia mangostana and their antibacterial activity. Afr. J.

Biotechnol. 10:103-107.

Rafiqi, M., L. Jelonek, N. F. Akum, F. Zhang, and K.H. Kogel. 2013. Effector

candidates in the secretome of Piriformospora indica, a ubiquitous plant-

associated fungus. Front Plant Sci. 4:228-233.

Ragazzi, A., S. Moricca, P. Capretti, and I. Dellavalle. 1999. Endophytic presence of

Discula quercina on declining Quercus cerris. J. Phytopathol. 147:437-440.

Rajmalwar, S. and P.S. Dabholkar. 2009. Production of protease by Aspergillus sp.

using solid-state fermentation. Afr. J. Biotech. 8:4197-4198.

Ramasamy, K., S.M. Lim, H. Abu Bakar, N. Ismail, M.S. Ismail, M.F. Ali, J.F. Weber,

and A.L. Cole. 2010. Antimicrobial and cytotoxic activities of Malaysian

endophytes. Phytother Res. 24:640-3.

Rani, K., R. Rana, and S. Datt. 2012. Review on latest overview of proteases. Int. J.

Curr. Life. Sci. 2:12-18.

283

Rao, M.B., A.M. Tanksale, M.S. Ghatge, and V.V. Deshpande. 1998. Molecular and

biotechnological aspects of microbial proteases. Microbiology and Molecular

Biology Reviews. 62:597-635.

Raps, A. and S. Vidal. 1998. Indirect effects of an unspecialized endophytic fungus on

specialized plant-herbivorous insect interactions. Oecologia. 114:541-547.

Raviraja, N.S. 2005. Fungal endophytes in five medicinal plant species from

Kudremukh Range, Western Ghats of India. J. Basic. Microbiol. 45:230-235.

Raviraja, N.S., G.L. Maria, and K.R. Sridhar. 2006. Antimicrobial evaluation of

endophytic fungi inhabiting medicinal plants of the Western Ghats of India,

Eng. Life Sci. 6:515-520.

Reis, V.M., J.I. Baldani, V.L.D Baldani, and J. Dobereiner. 2000. Biological N2

fixation in graminae and palm trees. Crit. Rev. Plant Sci. 19:227-247

Reiter, B., U. Pfeifer, H. Schwab, and A. Sessitsch. 2002. Response of endophytic

bacterial communities in potato plants to infection with Erwinia carotovora

subsp. atroseptica. Appl. Environ. Microbiol. 68:2261-2268.

Ren, Y., G.A. Strobel, J.C. Graff, M. Jutila, S.G. Park, S. Gosh, D. Teplow, M.

Condron, E. Pang, W.M. Hess, and E. Moore. 2008. Colutellin A, an

immunosuppressive peptide from Colletotrichum dematium. Microbiologia.

154:1973-1979.

Reyed, M.R. 2007. Biosynthesis and properties of extracellular amylase by

encapsulation Bifidobatrium bifidum in batch culture. Aust. J. Basic. Appl. Sci.

1:7-14.

284

Rezende, M.I., A.M. Barbosa, A.F.D. Vasconcelos, and A.S. Endo. 2002. Xylanase

production by Trichoderma harzianum rifai by solid state fermentation on

sugarcane bagasse. Brazil. J. Microbiol. 33:67-72.

Richmond, G.S., and E.L. Ghisalberti. 1994. The Australian desert shrub Eremophila

(Myoporaceae): medicinal, cultural, horticultural and phytochemical uses. Eco.

Botany. 48:35-59.

Robl, D., P. da Silva Delabona, C.M. Mergel, J.D. Rojas, P. dos Santos Costa, I.C.

Pimentel, V. A. Vicente, J.G. da Cruz Pradella, and G. Padilla. 2013. The

capability of endophytic fungi for production of hemicellulases and related

enzymes. BMC Biotech. 13:94-102.

Rocha, M.V., D. Romanini, B.B. Nerli, and G. Tubio. 2012. Pancreatic serine protease

extraction by affinity partition using a free triazine dye. Int. J. Biol. Macromol.

50:303-309.

Rodrigues-Heerklotz, K.F., K. Drandarov, J. Heerklotz, M. Hesse, and C. Werner. 2001.

Guignardic acid, a novel type of secondary metabolite produced by the

endophytic fungus Guignardia sp.: isolation, structure elucidation, and

asymmetric synthesis. Helv. Chim. Acta. 84:3766-3772.

Rodríguez Couto, S. and M.A. Sanromán. 2005. Application of solid-state fermentation

to ligninolytic enzyme production. Biochem. Eng. J. 22:211-219.

Rodríguez, E., F.J. Ruiz-Dueñas, R. Kooistra, A. Ram, Á.T. Martínez, M.J. Martínez.

2008. Isolation of two laccase genes from the white-rot fungus Pleurotus

eryngii and heterologous expression of the pel3 encoded protein. J. Biotechnol.

134:9-19.

285

Rodriguez, K.F. and G.J. Samuels. 1999. Fungal endophytes of Spondias mombin in

Brazil: A preliminary study. J. Basic Microbiol. 39:131-135.

Rodriguez, R.J., D. Cullen, C.P. Kurtzman, G.G. Khachatourians, and D.D. Hegedus.

Molecular methods for discriminating taxa, monitoring species and assessing

fungal diversity. pp. 77-104. In: G.M. Mueller, G.F. Bills, and M.S. Foster

[Eds.] 2004. Biodiversity of fungi: inventory and monitoring methods. Elsevier

Academic Press, San Diego.

Rodriguez, R.J., J.F. White, A.E. Arnold, and R.S. Redman. 2009. Fungal endophytes:

diversity and functional roles. New Phytologist. 182:314-330.

Rottkamp, C.A., A. Nunomura, K. Hirai, L.M. Sayre, G. Perry, and M.A. Smith. 2000.

Will antioxidants fulfill their expectations for the treatment of Alzheimer’s

disease? Mech. Ageing Dev. 116:169-179.

Rubini, M.R., R.T. Silva-Ribeiro, A.W.V. Pomella, C.S. Maki, W.L. Araújo, D.R. dos

Santos, and J.L. Azevedo. 2005. Diversity of endophytic fungal community of

cacao (Theobroma cacao L.) and biological control of Crinipellis perniciosa,

causal agent of witches' broom disease. Int. J. Biol. Sci. 1:24-33.

Ruisi, S., D. Barreca, L. Selbmann, L. Zucconi, and S. Onofri. 2007. Fungi in

Antarctica. Rev. Environ. Sci. Biotechnol. 6:127-141.

Rukachaisirikul, V., U. Sommart, S. Phongpaichit, J. Sakayaroj, and K. Kirtikara. 2008.

Metabolites from the endophytic fungus Phomopsis sp. PSU-D15.

Phytochemistry. 69:783-787.

Russell, J.R., J. Huang, P. Anand, K. Kucera, A. G. Sandoval, K. W. Dantzler, D.

Hickman, J. Jee, F. M. Kimovec, D. Koppstein, D. H. Marks, P. A. 286

Mittermiller, S. J. Nu´n˜ez, M. Santiago, M. A. Townes, M. Vishnevetsky, N.

E. Williams, M. P. Nu´n˜ez Vargas, L.A Boulanger, C. Bascom-Slack, and S.

A. Strobel. 2011. Biodegradation of polyester polyurethane by endophytic

fungi. App. Environ. Microbiol. 77:6076-6084.

Sadrati, N., H. Daoud, A. Zerroug, S. Dahamna, and S. Bouharati. 2013. Screening of

Antimicrobial and Antioxidant Secondary Metabolites from Endophytic Fungi

Isolated from Wheat (Triticum Durum). J. Plant Prot Res. 53:128-136.

Saha, B.C. 2003. Hemicellulose bioconversion. J. Ind. Microbiol. Biotechnol. 30:279-

291.

Sahnoun, M., S. Bejar, A. Sayari, M.A. Triki, M. Kriaa, and R. Kammoun. 2012.

Production, purification and characterization of two α-amylase isoforms from a

newly isolated Aspergillus oryzae strain S2. Process. Biochem. 47:18-25.

Saikkonen, K., P. Wali, M. Helander, and S.H. Faeth. 2004. Evolution of endophyte-

plant symbioses. Trends. Plant. Sci. 9:275-280.

Sajedi, R.H., H. Naderi-Manesh, K. Khajeh, R. Ahmadvand, B. Ranjbar , A. Asoodeh

and F. Moradian . 2005. A Ca-independent α-amylase that is active and stable

at low pH from the Bacillus sp. KR-8104. Enzyme. Microb. Tech. 36:666-671.

Sakthiselvan, P., B. Naveena, and N. Partha. 2012. Effect of medium composition and

ultrasonication on xylanase production by Trichoderma harzianum MTCC

4358 on novel substrate. Afr. J. Biotech. 11:12067-12077.

Samson, R.A. 1991. Problems caused by new approaches in fungal taxonomy.

Mycopathologia. 116: 149-150.

287

Samuels, G.J., R. Pardo-Schultheiss, K.P. Hebbar, R.D. Lumsden, C.N. Bastos, J.C.

Costa, and J.L. Bezerra. 2000. Trichoderma stromaticum sp. nov., a parasite of

the cacao witches broom pathogen. Mycol. Res. 104:760-764.

Sandhiya, G.S., T.C. Sugitha, D. Balachandar, and K. Kumar. 2005. Endophytic

colonization and in planta nitrogen fixation by a diazotrophic Serratia sp. in

rice. Indian. Exp. J. Biol. 43:802-807.

Santiago, I.F., T.M. Alves, A. Rabello, P.A. Sales Junior, A.J. Romanha, C.L. Zani,

C.A. Rosa, and L.H. Rosa. 2012. Leishmanicidal and antitumoral activities of

endophytic fungi associated with the Antarctic angiosperms Deschampsia

antarctica Desv. and Colobanthus quitensis (Kunth) Bartl. Extremophiles.

16:95-103.

Sappapan, R., D. Sommit, N. Ngamrojanavanich, S. Pengpreecha, S. Wiyakrutta, N.

Sriubolmas, and K. Pudhom. 2008. 11- hydroxymonocerin from the plant

endophytic fungus Exserohilum rostratum. J. Nat. Prod. 71:1657-1659.

Saran, S., J. Isar, and R.K. Saxena. 2007. A modified method for the detection of

microbial proteases on agar plates using tannic acid. J. Biochem. Bioph. Meth.

70:697-699.

Saranpuetti, C. M. Tanaka, T. Sone, K. Asano, and F. Tomita. 2006. Determination of

enzymes from Colletotrichum sp. AHU9748 essential for lepidimoide

production from okra polysaccharide. J. Biosci. Bioeng. 102:452-456.

Sasi, A., M. Kani, A. Panneerselvam, G. Jegadeesh, K. Muthu, and M.R Kumar. 2010.

Optimizing the conditions of α-amylase by an Esturian strain of Aspergillus

spp. Afr. J. Microbiol. Res. 4:581-586.

288

Sato, S., F. Liu, H. Koc, and M. Tien. 2007. Expression analysis of extracellular

proteins from Phanerochaete chrysosporium grown on different liquid and

solid substrates. Microbiology. 153:3023-3033.

Satynanarayana, T., M.R. Uma, and M. Ezhilcannan. Alpha amylase. In: A. Pandey, C.

Webb, R. Soccol, C. Larroche [Eds.] 2006. Enzyme technology. Springer, New

York.

Schardl, C.L. and T.D. Phillips. 1997. Protective grass endophytes: where are they from

and where are they going? Plant Dis. 81:430-438.

Schardl, C.L., A. Leuchtmann and M.J. Spiering. 2004. Symbioses of grasses with

seedborne fungal endophytes. Ann. Rev. Plant Biol. 55:315-340.

Schena, L., F. Nigro, I. Pentimone, A. Ligorio, and A. Ippolito. 2003. Control of

postharvest rots of sweet cherries and table grapes with endophytic isolates of

Aureobasidium pullulans. Postharvest Biol. Technol. 30:209-220.

Schmidt, O. 2006. Wood and Tree Fungi: Biology, Damage, Protection, and Use.

Springer-Verlag, Berlin.

Schulz, B. and C. Boyle. 2005. The endophytic continuum. Mycol. Res. 109:661-686.

Schulz, B., A.K. Rommert, U. Dammann, H.J. Aust, and D. Strack. 1999. The

endophyte–host interaction: a balanced antagonism? Mycol. Res. 10:1275-

1283.

Schulz, B., C. Boyle, S. Draeger, A. Rommert, and K. Krohn. 2002. Endophytic fungi: a

source of novel biologically active secondary metabolites. Mycological.

Research. 106:996-1004.

289

Schulz, B.U., U. Wanke, S. Drager, and H.J. Aust. 1993. Endophytes from herbaceous

plants and shrubs: Effectiveness of surface sterilization methods. Mycol. Res.

97:1447-1450.

Schutz, B. 2001. Endophytic fungi: a source of novel biologically active secondary

metabolites. In: British mycological society, international symposium

proceedings: bioactive fungal metabolites impact and exploitation. University

of Wales, Swansea, Wales.

Schwartsmann, G., M.J. Ratain, G.M. Cragg, J.E. Wong, N. Saijo, D.R. Parkinson, Y.

Fujiwara, R. Pazdur, D.J. Newman, R. Dagher, and L. Di Leone. 2002.

Anticancer drug discovery and development throughout the world. J. Clin.

Oncol. 20:47-59.

Scott, B. 2001. Epichloë endophytes: fungal symbionts of grasses. Curr. Opin.

Microbiol. 4:393-398.

Seidler, J., N. Zinn, M.E. Boehm, and W.D. Lehmann. 2010. De novo sequencing of

peptides by MS/MS. Proteomics. 10:634-649.

Selvanathan, S., I. Indrakumar, and M. Johnpaul .2011. Biodiversity of the endophytic

fungi isolated from Calotropis gigantea (L.) R.BR. Recent Res. Sci. Technol.

3:94-100.

Senthilkumar, S.R., B. Ashokkumar, K. Chandra Raj, and P. Gunasekaran. 2005.

Optimization of medium composition for alkali-stable xylanase production by

Aspergillus fischeri Fxn 1 in solid-state fermentation using central composite

rotary design. Bioresour. Technol. 96:1380-1386.

290

Shah, P., J.A. Atwood, R. Orlando, H. El Mubarek, G.K. Podila, and M.R. Davis. 2009.

Comparative proteomic analysis of Botrytis cinerea secretome. J. Proteome.

Res. 8:1123-1130.

Shankar, S., M. Rao, and S.R. Laxman. 2011. Purification and characterisation of an

alkaline protease by a new strain of Beauveria sp. Process. Biochem. 46:579-

585.

Sharma, M. S. Mehta, and A. Kumar. 2013. Purification and characterization of alkaline

xylanase secreted from Paenibacillus macquariensis. Adv. Microbiol. 3:32-41.

Shi, H., Y. Zhang, X. Li, Y. Huang, L. Wang, Y. Wang, H. Ding, and F. Wang. 2013. A

novel highly thermostable xylanase stimulated by Ca2+ from Thermotoga

thermarum: cloning, expression and characterization. Biotechnol Biofuels.

6:26-35.

Shimokawa, T., M. Ishida, S. Yoshida, and M. Nojiri. 2009. Effects of growth stage on

enzymatic saccharification and simultaneous saccharification and fermentation

of bamboo shoots for bioethanol production. Bioresour. Technol. 100:6651-

6654.

Shiono, Y., M. Tsuchinari, K. Shimanuki, T. Miyajima, T. Murayama, T. Koseki, H.

Laatsch, T. Funakoshi, K. Takanami, and K. Suzuki. 2007. Fusaristatins A and

B, two new cyclic lipopeptides from an endophytic Fusarium sp. J. Antiobiot.

60:309-316.

Siala, R., A. Sellami-Kamoun, M. Hajji, I. Abid, N. Gharsallah, M. Nasri. 2009.

Extracellular acid protease from Aspergillus niger I1: purification and

characterization. Afr. J. Biotechnol. 8:4582-4589.

291

Sicard, R. and J.-L. Reymond. Introduction. pp. 1-14. In: J.L. Reymond [Eds.] 2006.

Enzyme assays: high-throughput screening, genetic selection, and

fingerprinting. Wiley-VCH, Weinheim, Germany.

Siciliano, S.D., N. Fortin, A. Mihoc, G. Wisse, S. Labelle, D. Beaumier, D. Ouellette,

R. Roy, L.G. Whyte, M.K. Banks, P. Schwab, K. Lee, and C.W. Greer. 2001.

Selection of specific endophytic bacterial genotypes by plants in response to

soil contamination. Appl. Environ. Microbiol. 67:2469-2475.

Siegel, M.R. and L.P. Bush. Toxin production in grass/endophyte associations. pp. 185-

208. In: G.C. Carroll, and P. Tudzynski [Eds.] 1997. The mycota V: plant

relationships, part B. Springer, Berlin Heidelberg.

Siegel, M.R., G.C.M. Latch, and M.C. Johnson. 1987. Fungal endophyte of grasses,

Annu. Rev. Phytopathol. 25:293-315.

Silva, G. H., H. L.Teles, L.M. Zanardi M.C.M. Young, M.N. Eberlin R. Haddad, L.H.

Pfenning C.M. Costa-Neto, I. Castro-Gamboa, V.S. Bolzani, and A.R. Araújo.

2006. Cadinane sesquiterpenoids of Phomopsis cassiae, an endophytic fungus

associated with Cassia spectabilis (Leguminosae). Phytochemistry. 67:1964-

1969.

Singh S.B., J.G. Ondeyka, N. Tsipouras, C. Ruby, V. Sardana, M. Schulman, M.

Sanchez, F. Pelaez, M.W. Stahlhut, S. Munshi, D.B. Olsen, and R.B. Lingham.

2004. Hinnuliquinone, a C2-symmetric dimeric non-peptide fungal metabolite

inhibitor of HIV-1 protease. Biochem. Biophys. Res. Comm. 324:108-13.

292

Singh, B. and F. Pelaez. Biodiversity, chemical diversity and drug discovery. pp. 141-

174. In: F. Petersen, and R. Amstutz [Eds.] 2008. Natural compound as drugs

volume 1. progress in drug Research. Birkhäuser, Basel, Switzerland.

Singh, M.P., J.E. Janso, S.W. Luckman, S.F. Brady, J. Clardy, M. Greenstein, and

W.M. Maiese. 2000. Biological activity of guanacastepene, a novel diterpenoid

antibiotic produced by an unidentified fungus CR115. J. Antibiot. 53:256-261.

Singh, P., O. Sulaiman, R. Hashim, P. Rupani, and L. Peng. 2010. Biopulping of

lignocellulosic material using different fungal species: a review. Rev Environ.

Sci. Biotechnol. 9:141-151.

Singh, S., V. Sharma and M.L. Soni. 2011. Biotechnological applications of industrially

important amylase enzyme. Int. J. Pharm. Bio. Sci. 21:486-496.

Singh, S.B., D.L. Zink, Z. Guan, J. Collado, F. Pelaez, P.J. Felock, and D.J. Hazuda.

2003. Isolation, structure, and HIV-1 integrase inhibitory activity of

xanthoviridicatin E and F, two novel fungal metabolites produced by

Penicillium chrysogenum. Helv. Chim. Acta. 86:3380-3385.

Sivaramakrishnan, S., D. Gangadharan, K.N. Madhavan, A. Pandey.2006. Solid

culturing of Bacillus amyloliquefaciens for α-amylase production. Food

Technol. Biotechnol. 44:269-274.

Smith, H., M.J. Wingfield, and O. Petrini. 1996. Botryosphaeria dothidea endophytic in

Eucalyptus grandis and Eucalyptus nitens in South Africa. For. Ecol. Manage.

89:189-195.

Soares, F.E.F., F.R. Braga, H.L.A. Geniêr, J.V. de Araújo, S.R. Ferreira, J.M. Araujo,

A. de Oliveira Tavela, V.L.R. Vilela, and J.H. de Queiróz. 2010. Optimization 293

of medium composition for protease production by Paecilomyces marquandii

in solid-state fermentation using response surface methodology. Afr. J.

Microbiol. Res. 24:2699-2703.

Soliman, M.H., A.A. Sherief, and B.A. EL-Tanash. 2012. Production of Xylanase by

Aspergillus niger and Trichoderma viride using some agriculture residues. Int.

J. Agric. Res. 7:46-57.

Song, A.R., X.M. Tian, G.F. Feng, and Y.Q. Zhang. 2001. A study of the utilizatin of

Pleurotus eryngii with different carbon and nitrogen Sources. Acta Edulis

Fungi. 8:10-4.

Song, Y., Y.G. Lee, I.S. Choi, K.H. Lee, E.J. Choc, and H.J Baea. 2013. Heterologous

expression of endo-1, 4--xylanase A from Schizophyllum commune. in Pichia

pastoris and functional characterization of the recombinant enzyme. Enzyme

Microbial. Technol. 52:170-176.

Song, Y.C., W.Y. Huang, C. Sun, F.W. Wang, and R.X. Tan. 2005. Characterization of

graphislactone A as the antioxidant and free radical-scavenging substance from

the culture of Cephalosporium sp. IFB-E001, an endophytic fungus in

Trachelospermum jasminoides. Biol. Pharm. Bull. 28:506-509.

Sousa, C.P., I.L. Cruz-Hernández, A. Baptista-Neto, J.C. Teodoro, M. Cerri, S.C.A.

Ortiz, M.L.G.C. Araujo, A.C. Badino, and C.O. Hokka. Challenges attending

upon studies on clavulanic acid production. pp. 739-743. In: A. Mendez-Vilas

[Eds.] 2009. Current research topics in applied microbiology and microbial

biotechnology. World scientific publishing Co, Singapore.

294

Souza, P.M. and P.O. Magalhaes. 2010. Application of Microbial α-amylase in industry

– a review. Braz. J. Microbiol. 41:850-861.

Stadler, M. and B. Schulz. 2009. High energy biofuel from endophytic fungi. Trends

Plant Sci. 14:353-355.

Stamford, T.L., N.P. Stamford, L.C. Coelho, and J.M. Araujo. 2001. Productionand

characterization of a thermostable α-amylase from Nocardiopsis sp. endophyte

of yam bean. Bioresour. Technol. 77:137-141.

Staniek, A., H. J. Woerdenbag, and O. Kayser. 2008. Endophytes: exploiting

biodiversity for the improvement of natural product-based drug discovery. J.

Plant Interact. 3:75-93.

Steen, H. and M. Mann. 2004. The abc's (and xyz's) of peptide sequencing. Nature. Rev.

Mol. Cell Biol. 5:699-711.

Stierle, A., G.A. Strobel, and D.B. Stierle. 1993. Taxol and taxane production by

Taxomyces andreanae, an endophytic fungus of Pacific yew. Science. 260:214-

216.

Stierle, D.B., A.A. Stierle, and T. Bugni. 2003. Sequoiamonascins A-D: novel

anticancer metabolites isolated from a redwood endophyte. J. Org. Chem.

68:4966-4969.

Stinson, M., D. Ezra, W.M. Hess, J. Sears, and G. Strobel. 2003. An endophytic

Gliocladium sp. of Eucryphia cordifolia producing selective volatile

antimicrobial compounds. Plant Sci. 165:913-922.

295

Strobel, G. 2011. Muscodor species- endophytes with biological promise. Phytochem

Rev. 10:165-172.

Strobel, G. and B. Daisy. 2003. Bioprospecting for microbial endophytes and their

natural products. Microbiol. Mol. Biol. Rev. 67:491-502.

Strobel, G., B. Daisy, U. Castillo and J. Harper. 2004. Natural products from endophytic

microorganisms. J. Nat. Prod. 67: 257-268.

Strobel, G., B. Knighton, K. Kluck, Y. Ren, T. Livinghouse, M. Griffin, D. Spakowicz,

and J. Sears. 2008. The production of myco-diesel hydrocarbons and their

derivatives by the endophytic fungus Gliocladium roseum (NRRL 50072).

Microbiology. 154:3319-3328.

Strobel, G.A. 2002. Microbial gifts from rain forests. Can. J. Plant Pathol. 24:14-20.

Strobel, G.A. 2003. Endophytes as sources of bioactive products. Microbes Infect.

5:535-544.

Strobel, G.A., E. Dirksie, J. Sears, and C. Markworth. 2001. Volatile antimicrobials

from a novel endophytic fungus. Microbiology. 147:2943-2950.

Strobel, G.A., E. Ford, J. Worapong, J.K. Harper, A.M. Arif, D.M. Grant, P.C. Fung,

and K. Chan. 2002. Isopestacin, an isobenzofuranone from Pestalotiopsis

microspora, possessing antifungal and antioxidant activities. Phytochemistry.

60:179-183.

Strobel, G.A., J.Y. Li, F. Sugawara, H. Koshino, J. Harper, and W. M. Hess. 1999a.

Oocydin A, a chlorinated macrocyclic lactone with potent anti-oomycete

activity from Serratia marcescens. Microbiology. 145:3557-3564.

296

Strobel, G.A., R. Torzynski, and A. Bollon. 1997. Acremonium sp. a leucinostatin A

producing endophyte of European yew (Taxus baccata). Plant Sci. 128:97-108.

Strobel, G.A., R.V. Miller, C. Martinez-Miller, M.M. Condron, D.B. Teplow, and W.M.

Hess. 1999b. Cryptocandin a potent antimycotic from the endophytic fungus

Cryptospor iopsis cf. quercina. Microbiology. 145:1919-26.

Strobel, G.A., W.M. Hess, E. Ford, R.S. Sidhu, and X. Yang. 1996. Taxol from fungal

endophytes and the issue of biodiversity. J. Ind. Microbiol. 17:417-423.

Sturz, A.V. and J. Nowak. 2000. Endophytic communities of rhizobacteria and the

strategies required to create yield enhancing associations with crops. Appl. Soil

Ecol. 15:183-190.

Sturz, A.V., B.R. Christie, and B.G. Matheson. 1998. Associations of bacterial

endophyte populations from red clover and potato crops with potential for

beneficial allelopathy. Can. J. Microbiol. 44:162-167.

Su, X., Y. Han, D. Dodd, Y.H. Moon, S. Yoshida, R.I. Mackie, and I.K. Cann. 2013.

Reconstitution of a thermostable xylan-degrading enzyme mixture from the

bacterium Caldicellulosiruptor bescii. Appl. Environ. Microbial. 79:1481-1490.

Suárez, M.B., L.Sanz, M.I. Chamorro, M. Rey, F.J. González, A. Llobell, and E. Monte.

2005. Proteomic analysis of secreted proteins from Trichoderma harzianum:

Identification of a fungal cell wall-induced aspartic protease. Fungal Genet.

Biol. 42:924-934.

Sumantha, A., P. Deepa, C. Sandhya, G. Szakacs, C.R. Soccol, and A. Pandey. 2006.

Rice bran as a substrate for proteolytic enzyme production. Braz. Arch. Biol.

Technol. 49:843-851. 297

Sun, W.C., C.H. Cheng, and W.C. Lee. 2008. Protein expression and enzymatic activity

of cellulases produced by Trichoderma reesei Rut C-30 on rice straw. Process

Biochem. 43:1083-1087.

Sunitha, V.H., D. Nirmala Devi, and C. Srinivas. 2013. Extracellular Enzymatic

Activity of Endophytic Fungal Strains Isolated from Medicinal PlantsWorld J.

Agric. Sci. 9:01-09.

Sunna, A. and G. Antranikian. 1997. Xylanolytic enzymes from fungi and bacteria. Crit.

Rev. Biotechnol. 17:39-67.

Supaphon, P., S. Phongpaichit, V. Rukachaisirikul, and J. Sakayaroj. 2013.

Antimicrobial Potential of Endophytic Fungi Derived from Three Seagrass

Species: Cymodocea serrulata, Halophila ovalis and Thalassia hemprichii.

PLoS ONE. 8:e72520.

Sur, P., M. Das, A. Gomes, J.R. Vedasiromoni, N.P. Sahu, and S. Banerjee. 2001.

Trigonella foenum-graecum (fenugreek) seed extract as an antineoplastic

agent. Phytother. Res. 15:257-259.

Suryanarayanan, T.S., N. Thirunavukkarasu, M.B. Govindarajulu, F. Sasse, R. Jansen,

and T.S. Murali. 2009. Fungal endophytes and bioprospecting. Fungal. Biol.

Rev. 23:9-19.

Syed, S., S. Riyaz-Ul-Hassan, and S. Johri. 2013. A novel cellulase from an endophyte,

Penicillium sp. NFCCI 2862. Am. J. Microbiol. Res. 1:84-91.

Talbot, N. pp. 23-31. Nucleic acid isolation and analysis. In: N. Talbot [Eds.] 2001.

Molecular and cellular biology offilamentous fungi. Oxford University Press,

Oxford, UK. 298

Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011.

MEGA5: Molecular Evolutionary Genetics Analysis using Maximum

Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol.

Biol. Evol. 28:2731-2739.

Tan, R.X. and W.X. Zou. 2001. Endophytes: a rich source of functional metabolites.

Nat. Prod. Rep. 18:448-459.

Tanaka, A., B.A. Tapper, A. Popay, E.J. Parker, and B. Scott. 2005. A symbiosis

expressed non-ribosomal peptide synthetase from a mutualistic fungal

endophyte of perennial ryegrass confers protection to the symbiotum from

insect herbivory. Mol. Microbiol. 57:1036-1050.

Tansuwan, S., S. Pornpakakul, S. Roengsumran, A. Petsom, N. Muangsin, p. Sihanonta,

and N. Chaichit. 2008. Antimalarial benzoquinones from an endophytic

fungus, Xylaria sp. J. Nat. Prod. 70:1620-1623.

Tanyildizi, M.S., D. Ozer, and M. Elibol. 2005.Optimization of α-amylase production

by Bacillus sp. using response surface methodology. Process Biochem.

40:2291-2296.

Tao, Y., C. Mou, X. Zeng, F. Xu, X. Cai, Z. She, S. Zhou, and Y. Lin. 2008. 1H and

13C assignments of two new diaryl ethers phomopsides A and B fron the

mangrove endophytic fungus (ZZF08). Magn. Reson. Chem. 46:761-764.

Taralova, H.E., J. Schlecht, K. Barnard, and M.B. Pryor. 2011. Modelling and

visualizing morphology in the fungus. Fungal Biol. 115:1163-1173.

299

Taylor, T.N. and E.L. Taylor. The rhynie chert ecosystem: a model for understanding

fungal interactions. pp. 31-48. In: C.W. Bacon, and J.F. White [Eds.] 2000.

Microbial endophytes. Marcel Decker Inc, NewYork.

Teather, R.M. and P.J. Wood. 1982. Use of congo red-polysaccharide interactions in

enumeration and characterization of cellulolytic bacteria from the bovine

rumen. Appl. Environ. Microbiol. 43:777-780.

Tejesvi, M.V., D. R. Segura, K. M. Schnorr, D. Sandvang, S. Mattila, P. B. Olsen, S.

Neve, T. Kruse, H. H. Kristensen, and A. M. Pirttilä. 2013. An antimicrobial

peptide from endophytic Fusarium tricinctum of Rhododendron tomentosum

Harmaja. Fungal. Divers. 60:153-159.

Tejesvi, M.V., K.R. Kini, H.S. Prakash, V. Subbiah, and H.S. Shetty. 2007a. Genetic

diversity and antifungalactivity of species of Pestalotiopsis isolated as

endophytes from medicinal plants. Fungal Divers. 24:37-54.

Tejesvi, M.V., K.R. Kini, H.S. Prakash, V. Subbiah, and H.S. Shetty. 2008.

Antioxidant, antihypertensive, and antibacterial properties of endophytic

Pestalotiopsis species from medicinal plants. Can. J. Microbiol. 54:769-780.

Tejesvi, M.V., M.S. Nalini, B. Mahesh, H.S. Prakash, K.R. Kini, H.S. Shetty, and V.

Subbiah. 2007b. New hopes from endophytic fungal secondary metabolites.

Bol. Soc. Quím. Méx. 1:19-26.

Téllez-Jurado, A., A. Arana-Cuenca, A.E. González Becerra, G. Viniegra-González,

and O. Loera. 2006. Expression of a heterologous laccase by Aspergillus niger

cultured by solid-state and submerged fermentations. Enzyme Microb.

Technol. 38:665-669.

300

Tenguria, R., F. Khan, and S. Quereshi. 2011. Endophytes- mines of pharmacological

therapeutics. World J. Sci. Techn. 1:127-149.

Tenguria, R.K. and F. Naem Khan. 2011. Distribution of endophytic fungi in leaves of

Azadirachta indica A. JUSS. (Neem) of Panchmarhi Biosphere Reserve. Curr.

Botany. 2: 27-29.

Teter, S.A. and J.R. Cherry. 2005. Improving cellulose hydrolysis with new cellulase

compositions. pp. 12027-12033. American Institute of Chemical Engineers

(AIChE) Annual Meeting Conference Proceedings, Cincinnati, USA.

Theantana, T., K.D. Hyde, and S. Lumyong. 2009. Asparaginase production by

endophytic fungi from Thai medicinal plants: cytoxicity properties. Int. J.

Integrative Biol. 7:1-8.

Tian, M. 2004. A Kazal-like extracellular serine protease inhibitor from Phytophthora

infestans targets the tomato pathogenesis-related protease P69B. J. Biol. Chem.

279:26370-7.

Tikhomirov, D.F., A.P. Sinitsyn, I.N. Zorov, and C. Williams. Non-starch

polysaccharide hydrolysing microbial enzymes in grain processing. pp. 413-

418. In: C. M. Courtin, W. S. Veraverbeke, and J. A. Delcour [Eds.] 2003.

Recent advances in enzymes in grain processing. Kat. Univ. Leuven, Leuven

Ting, A.S.Y., S.W. Mah, and C.S. Tee. 2010. Identification of volatile metabolites from

fungal endophytes with biocontrol potential towards Fusarium oxysporum F.

sp. cubense Race 4. Am. J. Agric. and Biol. Sci. 5:177-182.

Tobias, J.S. and D. Hochhauser. 2010. Cancer and its management, 6th Edition. Wiley-

Blackwell Press, UK. 301

Tong, W.Y., L. Darah, and Z. Latiffah .2011. Antimicrobial activities of endophytic

fungal isolates from medicinal herb Orthosiphon stamineus Benth. J.Med.

Plants Res. 5:831-836.

Truscheit, E., W. Frommer, B. Junge, L. Müller, D.D. Schmidt, and W. Wingender.

1981. Chemistry and biochemistry of microbial α-glucosidase inhibitors.

Angew Chem. Int. Ed. 20:744-761.

Tsang, A., G. Butler, J. Powlowski, E.A. Panisko, and S.E. Baker. 2 009. Analytical and

computational approaches to define the Aspergillus niger secretome. Fungal

Genet. Biol. 46:S153-S160.

Tuntiwachwuttikul, P., T. Taechowisan, and A. Wanbanjob, Thadaniti S and W.C.

Taylor. 2008. Lansai A-D, secondary metabolites from Streptomyces sp.

SUC1.Tetrahedron 64:7583-6.

Turk, B. 2006. Targeting proteases: succeses, failures and future prospects. Nat. Rev.

Drug. Discov. 5:785-799.

Tyo, K.E., H.S. Alper, and G.N. Stephanopoulos. 2007. Expanding the metabolic

engineering toolbox: more options to engineer cells. Trends Biotechnol.

25:132-137.

Ueda, M., T. Kubo, K. Miyatake, and T. Nakamura. 2007. Purification and

characterization of fibrinolytic alkaline protease from Fusarium sp. BLB. Appl.

Microbiol. Biotechnol. 74:331-338.

UpaDek, H. and B. Kottwitz. Application of amylases in detergents. pp. 203-212.

In: J.H. Van Ee, O. Misset, and E.J. Baas [Eds.] 1997. Enzymes in detergency.

Marcel Dekker Inc, New York. 302

Van Aken B., J.M. Yooh, and J.L. Schnoor. 2004. Biodegradation of nitro-Substituted

explosives 2,4,6-trinitrotoluene, hexahydro-1,3,5-trinitro-1,3,5-triazine, and

octahydro-1,3,5,7-tetranitro-1,3,5-tetrazocine by a phytosymbiotic

Methylobacterium sp. associated with poplar tissues (Populus deltoides×nigra

DN34). Appl. Environ. Microbiol. 70:508-517.

Vanden Wymelenberg, A., G. Sabat, D. Martinez, A.S. Rajangam, T.T. Teeri, J.

Gaskell, P.J. Kersten, and D. Cullen. 2005. The Phanerochaete chrysosporium

secretome: database predictions and initial mass spectrometry peptide

identifications in cellulose-grown medium. J. Biotechnol. 118:17-34.

Vanden Wymelenberg, A., J. Gaskell, M. Mozuch, G. Sabat, J. Ralph, O. Skyba, S.D.

Mansfield, R.A. Blanchette, D. Martinez, I. Grigoriev, P.J. Kersten, and D.

Cullen. 2010. Comparative transcriptome and secretome analysis of wood

decay fungi Postia placenta and Phanerochaete chrysosporium. App. Environ.

Microbiol. 76:3599-3610.

Vanden Wymelenberg, A., J. Gaskell, M. Mozuch, P. Kersten, G. Sabat, D. Martinez,

and D. Cullen. 2009. Transcriptome and secretome analyses of Phanerochaete

chrysosporium reveal complex patterns of gene expression. App. Environ.

Microbiol. 75:4058-4068.

Vanden Wymelenberg, A., P. Minges, G. Sabat, D. Martinez, A. Aerts, A. Salamov, I.

Grigoriev, H. Shapiro, N. Putnam, P. Belinky, C. Dosoretz, J. Gaskell, P.

Kersten, and D. Cullen. 2006. Computational analysis of the Phanerochaete

chrysosporium v2.0 genome database and mass spectrometry identification of

peptides in ligninolytic cultures reveal complex mixtures of secreted proteins.

Fungal Genet. Biol. 43:343-356. 303

Varalakshmi, K.N., B.S. Kumudini, B.N. Nandini, J. Solomon, R. Suhas, B. Mahesh,

and A.P. Kavitha. 2009. Production and characterization of α-amylase from

Aspergillus niger JGI 24 isolated in Bangalore. Pol. J. Microbiol. 58:29-36.

Vellard, M. 2003. The enzyme as drug: application of enzymes as pharmaceuticals.

Curr. Opin. Biotechnol. 14:1-7.

Vermelho, A.B., M.N. Meirelles, A. Lopes, S.D. Petinate, A.A. Chaia, and Branquinha.

M.H. 1996. Detection of extracelluar proteases from microorganisms on agar

plates. Mem. Inst. Oswaldo. Cruz. 91:755-760.

Vikarii, L., A. Kantelinen, J. Sandquist, and M. Linko. 1994. Xylanases in bleaching:

from an idea to the industry, FEMS Microbiol. Rev. 13:335-350.

Vinzant, T.B., W.S. Adney, S.R. Decker, J.O. Baker, M.T. Kinter, N.E. Sherman, J.W.

Fox, and M.E. Himmel. 2001. Fingerprinting Trichoderma reesei hydrolases in

a commercial cellulase preparation. Appl. Biochem. Biotechnol. 91-93:99-107.

Virupakshi, S., K.G. Babu, S.R. Gaikwad, and G.R. Naik. 2005. Production of a

xylanolytic enzyme by a thermoalkaliphilic Bacillus sp. JB-99 in solid state

fermentation. Process. Biochem. 40:431-435.

Vu, T., R. Hauschild, and R.A. Sikora. 2006. Fusarium oxysporum endophytes induced

systemic resistance against Rado- pholus similis on banana. Nematology

8:847-852.

Wachtel-Galor, S. and I.F.F. Benzie. Herbal Medicine: an introduction to its history,

usage, Regulation, current trends, and research needs. pp. 428-31. In: I.F.F.

Benzie, and S. Wachtel-Galor [Eds.] 2011. Herbal medicine: biomolecular and

clinical aspects. Boca Raton (FL), CRC Press, USA. 304

Wagenaar, M., J. Corwin, G.A. Strobel, and J. Clardy. 2000. Three new chytochalasins

produced by an endophytic fungus in the genus Rhinocladiella. J. Nat. Prod.

63:1692-1695.

Walker, J.M. Protein structure, purification, characterisation and function analysis. pp.

349-404. In: K. Wilson, and J. M. Walker [Eds.] 2005. Principles and

techniques of biochemistry and molecular biology. Cambridge University

Press, New York.

Waller, F., B. Achatz, H. Baltruschat, J. Fodor, K. Becker, M. Fischer, T. Heier, R.

Huckelhoven, C. Neumann, D. Von Wettstein, P. Franken, and K.H. Kogel.

2005. The endophytic fungus Piriformis indica reprograms barley to salt-stress

tolerance, disease resistance, and higher yield. Proc. Natl. Acad. Sci. USA.

102:13386-13391.

Wang, H.W., H. Zhu, X.F. Liang, W. Du, and C.C. Dai. 2014. Molecular cloning and

expression of a novel laccase showing thermo- and acid-stability from the

endophytic fungus Phomopsis liquidambari and its potential for growth

promotion of plants. Biotechnol Lett. 36:167-73.

Wang, F.W., R.H. Jiao, A.B. Cheng, S.H. Tan, and Y.C. Song. 2007. Antimicrobial

potentials of endophytic fungi residing in Quercus variabilis and brefeldin A

obtained from Cladosporium sp. World J. Microbiol. Biotechnol. 23:79-83.

Wang, J., C. Machado, D.G. Panaccione, H.F. Tsai, and C.L. Schardl. 2004. The

determinant step in ergot alkaloid biosynthesis by an endophyte of perennial

ryegrass. Fungal Genet. Biol. 41:189-198.

305

Wang, J.W., J.H. Wu, W.Y. Huang, and R.X. Tan. 2006. Laccase production by

Monotospora sp., an endophytic fungus in Cynodon dactylon. Bioresour.

Technol. 97:786-789.

Weber, D., O. Sterner, T. Anke, S. Gorzalczancy, V. Martino, and C. Acevedo. 2004.

Phomol, a new antiinflammatory metabolite from an endophyte of the

medicinal plant Erythrina crista-galli. J. Antibiot. 57:559-563.

Webster, J. and R. Weber. 2007. Introduction to Fungi. Cambridge University Press.

Cambridge, UK.

Wei, B.Q., Q.Y. Xue, L.H. Wei, D.D. Niu, H.X. Liu, L.F. Chen, and J.H. Guo. 2009. A

novel screening strategy to identify biocontrol fungi using protease production

or chitinase activity against Meloidogyne root-knot nematodes. Biocontrol. Sci.

Techn. 19:859-870.

Weibel, E.K., P. Hadvary, E. Hochuli, E. Kupfer, and H. Lengsfeld. 1987. Lipstatin, an

inhibitor of pancreatic lipase, produced by Streptomyces toxytricini. J.

Antibiot. 40:1081-1085.

Weihua, Q. and C. Hongzhang. 2008. An alkali-stable enzyme with laccase activity

from entophytic fungus and the enzymatic modification of alkali lignin.

Bioresour. Technol. 99:5480-5484.

White, T.J., T. Bruns, S. Lee, and J. Taylor.Amplification and direct sequencing of

fungal ribosomal RNA genes for phylogenetics. pp. 315-322. In: M. Innis, D.

Gelfand, J. Sninsky and T. White [Eds.] 1990. PCR protocols. Academic Press,

Inc., New York, N.Y.

306

Wicklow, D.T. and S.M. Poling. 2009. Antimicrobial activity of pyrrocidines from

Acremonium zeae against endophytes and pathogens of maize.

Phytopathology. 99:109-115.

Wicklow, D.T., S. Roth, S.T. Deyrup, and Gloer. 2005. A protective endophyte of

maize: Acremonium zeae antibiotics inhibitory to Aspergillus flavus and

Fusarium verticillioides. Mycol. Res. 109:610-618.

Wiegand, I., Hilpert, and K. Hancock. R. 2008. Agar and broth dilution methods to

determine the minimal inhibitory concentration (MIC) of antimicrobial

substances. Nat. Protoc. 3:163-175.

Wilkie, N., P.B. Wingrove, J.G. Bilsland, L. Young, S.J. Harper, F. Hefti, S. Ellis, and

S.J. Pollack. 2001. The non-peptidyl fungal metabolite L-783, 281 activates

TRK neurotrophin receptors. J. Neurochem. 78:1135-1145.

Wilkins, M.R. and K.L. Williams. 1997. Cross-species protein identification using

amino acid composition, peptide mass fingerprinting, isoelectric point and

molecular mass: a theoretical evaluation. J. Theor. Biol. 186:7-15.

Wilkinson, H.H., M.R. Siegel, J.D. Blankenship, A.C. Mallory, and L.P. Bush. 2000.

Contribution of fungal loline alkaloids to protection from aphids in a grass-

endophyte mutualism. Mol. Plant-Microbe Interact. 13:1027-1033.

Winkelmann, G. pp. 215-243. In: H.J. Rehm, and G. Reed [Eds.] 1986. Iron complex

products (siderophores). Biotechnology, Weinheim, VCH.

Wiseman, A. 1980. Topics in enzyme and fermentation technology. Willey, New York.

307

Wiyakrutta, S., N. Sriubolmas, W. Panphut, N. Thongon, K. Danwiserkanjana, N.

Ruangrungsi, and V. Meevootisom. 2004. Endophytic fungi with antimicrobial,

anticancer, anti-malarial activities isolated from Thai medicinal plants. World

J. Microbiol. Biotechnol. 20:265-272.

Wong, K.K.Y., L.U.L Tan, and J.N. Saddler. 1988. Multiplicity of beta-1, 4-xylanases

in microorganisms: functions and applications. Microbiol. Rev. 52:305-317.

Wool, I.G., Y.L. Chan, and A. Gluck. 1995. Structure and evolution of mammalian

ribosomal proteins. Biochem. Cell Biol. 73:933-947.

Wu, L.Q., Y.L. Lv. Z.X. Meng, J. Chen, and S.X. Guo. 2010. The promoting role of an

isolate of dark-septate fungus on its host plant Saussurea involucrata Kar. et

Kir. Mycorrhiza. 20:127-135.

Wu, S.H., R. Huang, C.P. Miao, and Y.W. Chen. 2013. Two new steroids from an

endophytic fungus Phomopsis sp. Chem Biodivers. 10:1276-83.

Wu, S.H., Y.W. Chen, S.C. Shao, L.D. Wang, Z.Y. Li, L.Y. Yang, S.L. Li, and R.

Huang. 2008. Ten-membered lactones from Phomopsis sp., an endophytic

fungus of Azadirachta indica. J. Nat. Prod. 71:1651-1654.

Wu, T.Y., A.W. Mohammad, J.M.d. Jahim, and N. Anuar. 2006. Investigations on

protease production by a wild-type Aspergillus terreus strain using diluted

retentate of pre-filtered palm oil mill effluent (POME) as substrate. Enzyme.

Microb. Tech. 39:1223-1229.

Xavier-Santos, S., C. Carvalho, M. Bonfá, R. Silva, M. Capelari, and E. Gomes. 2004.

Screening for pectinolytic activity of wood-rotting basidiomycetes and

characterization of the enzymes. Folia Microbiol. 49:46-52. 308

Xia, X.K., H.R. Huang, Z.G. She, J.W. Cai, L. Lan, J.Y. Zhang, L.W. Fu, L.L.P.

Vrijmoed, and Y.C. Lin. 2007. Structural and biological properties of

vermistatin and two new vermistatin derivatives iso lated from the marine-

magrove endophytic fungus Guignardia sp. No. 4382. Helv. Quim. Acta.

90:1925-1931.

Xiao, Z., H. Bergeron, and P.C. Lau. 2012. Alternaria alternata as a new fungal enzyme

system for the release of phenolic acids from wheat and triticale brans.

Antonie. Van. Leeuwenhoek. 101:837-844.

Xiao, Z., M. Wu, S. Grosse, M. Beauchemin, M. Lévesque, P.C.K. Lau. 2013. Genome

mining for new α-Amylase and glucoamylase encoding sequences and high

level expression of a glucoamylase from Talaromyces stipitatus for potential

raw starch hydrolysis. Appl. Biochem. Biotechnol. doi:10.1007/s12010-013-

0460-3.

Xu, L., L. Zhou, J. Zhao, J. Li, X. Li, and J. Wang. 2008a. Fungal endophytes from

Dioscoreazingi berensis rhizomes and their antibacterial activity. The Society

for Applied Microbiology. Lett. Appl. Microbiol. 46:68-72.

Xu, Y., Y. Li, S. Xu, Y. Liu, X. Wang, and J. Tang. 2008b. Improvement of xylanase

production by Aspergillus niger XY-1 using response surface methodology for

optimizing the medium composition. J. Zhejiang. Univ. Sci. B. 9:558-566.

Yang, T., W. Du, J. Zhou, X.-X. Wang, and C. Dai. 2013. Effects of the symbiosis

between fungal endophytes and Atractylodes lancea on rhizosphere and

phyllosphere microbial communities. Symbiosis. 61:23-36.

309

Yates, J.R., J.K Eng, K.R. Clauser, and A.L. Burlingame. 1996. Search of sequence

databases with uninterpreted high-energy collision-induced dissociation spectra

of peptides. J. Am. Soc. Mass. Spectrom. 7:1089-1098.

Yeolekar, M.E. and M.M. Shete. 2002. Homocysteine and hypertention. J. Assoc.

Physicians India. 50:29-35.

Yeoman, C.J., Y. Han, D. Dodd, C.M. Schroeder, R.I. Mackie, and I.K. Cann, 2010.

Thermostable enzymes as biocatalysts in the biofuel industry. Adv. Appl.

Microbiol. 70:1-55.

Yoon, J., J.I. Maruyama, K. Kitamoto, 2010. Disruption of ten protease genes in the

filamentous fungus Aspergillus oryzae highly improves production of

heterologous proteins. App. Microbiol. Biotechnol. 89:747-759.

You, F., T. Han, J.Z. Wu, B.K. Huang, and L.P. Qin. 2009. Antifungal secondary

metabolites from endophytic Verticillium sp. Biochem. Syst. Ecol. 37:162-165.

Yu, B.Z., N. Zhua, and Z.Z. Du. 2010a. Two New 7-Dehydrobrefeldin A Acids from

Cylindrocarpon obtusisporum, an Endophytic Fungus of Trewia nudiflora.

Helv. Chim. Acta. 93:324-328.

Yu, H., L. Zhang, L. Li, C. Zheng, L. Guo, and W. Li, P. Sun, and L. Qin. 2010b.

Recent developments and future prospects of antimicrobial metabolites

produced by endophytes. Microbiol. Res. 165:437-449.

Yu, H., L. Zhang, L. Li, C. Zheng, L. Guo, W. Li, P. Sun, and L. Qin. 2010c. Recent

developments and future prospects of antimicrobial metabolites produced by

endophytes. Microbiol. Res. 165:437-449.

310

Zaferanloo, B., A. Virkar, P.J. Mahon, and E.A. Palombo. 2013. Endophytes from an

Australian native plant are a promising source of industrially useful enzymes.

World. J. Microbiol. Biotechnol. 29:335-345.

Zaferanloo, B., P.J. Mahon, and E.A. Palombo. Endophytes from medicinal plants as

novel sources of bioactive compounds. pp. 355-411. In: R. Rai, L. Rastrelli,

M. Marinof, J.L. Martinez, and G. Cordell [Eds.] 2012. Medicinal plants:

diversity and drugs. Science Publisher, USA.

Zámocký, M., C. Schümann, C. Sygmund, J. O'Callaghan, A.D.W. Dobson, R. Ludwig,

D. Haltrich, C.K. Peterbauer. 2008. Cloning, sequence analysis and

heterologous expression in Pichia pastoris of a gene encoding a thermostable

cellobiose dehydrogenase from Myriococcum thermophilum. Prot. Expr. Purif.

59:258-265.

Zhang, B., G. Salituro, D. Szalkowski, Z. Li, Y. Zhang, I. Royo, D. Vilella, M. Dez, F.

Pelaez, C. Ruby, R.L. Kendall, X. Mao, P. Griffin, J. Calaycay, J.R. Zierath,

J.V. Heck, R.G. Smith, and D.E. Moller. 1999. Discovery of small molecule

insulin mimetic with antidiabetic activity in mice. Science. 284:974-981.

Zhang, H.W., Y.C. Song, and R.X. Tan. 2006. Biology and chemistry of endophytes.

Nat. Prod. Rep. 23:753-771

Zhang, W., K. Krohn, Z. Ullah, U. Florke, G. Pescitelli, L. Di Bari, S. Antus, T.

Kurtan, J. Rheinheimer, S. Draeger, and B. Schulz. 2008. New mono and

dimeric members of the secalonic acid family: blennolides A-G isolated from

the fungus Blennoria sp. Chem. Eur. J. 14:4913-4923.

311

Zhang, Y., X.M. Li, and B.G. Wang. 2007. Nigerasperones A-C, newmonomeric and

dimeric naphto-γ-pyrones from a marine algaderived endophytic fungus

Aspergillus niger EN-13. J. Antibiot. 60:204-210.

Zhao, X.M., Z.Q. Wang, S.H. Shu, W.J. Wang, H.J. Xu, Y.J. Ahn, M. Wang, and X.

Hu. 2013. Ethanol and methanol can improve huperzine a production from

endophytic colletotrichum gloeosporioides ES026. PLoS ONE. 8:e61777.

Zhou, B. and S.Qiang. 2008. Environmental, genetic and cellular toxicity of tenuazonic

acid isolated from Alternaira alternata. Afr. J. Biotechnol. 7:1151-1156.

Zhou, D.P. and X.W. Ping. 2001. Study on isolation of taxol-producing fungus. J.

Microbiol. 21:18-20.

Zhou, X., H. Zhu, L. Liu, J. Lin, and K. Tang, 2010. A review: recent advances and

future prospects of taxol-producing endophytic fungi. Appl. Microbiol.

Biotechnol. 86:1707-17.

Zia, T., S.N. Hasnain, and S.K. Hasan. 2002. Evaluation of the oral hypoglycaemic

effect of Trigonella foenum-graecum L. (methi) in normal mice. J.

Ethnopharmacol. 75:191-5.

Zorn, H., T. Peters, M. Nimtz, and R.G. Berger. 2005. The secretome of Pleurotus

sapidus. Proteomics. 5:4832-4838.

312

Appendix

Appendix 2.1: DNA Extraction of Fungal

Protocol

1. Add one square of fungal to the ZR BashingBead™ Lysis Tube then add 750 μl Lysis Solution to the tube. 2. Secure in a Disruptor Genie™ and using high-speed cell disrupters for 40 seconds. 3. Centrifuge the ZR BashingBead™ Lysis Tube in a microcentrifuge at 10,000 x g for 1 minute. 4. Transfer up to 400 μl supernatant to a Zymo-Spin™ IV Spin Filter in a Collection Tube and centrifuge at 7,000 rpm for 1 minute. 5. Add 1,200 μl of Fungal/Bacterial DNA Binding Buffer to the filtrate in the Collection Tube from Step 4. 6. Transfer 800 μl of the mixture from Step 5 to a Zymo-Spin™ IIC Column in a Collection Tube and centrifuge at 10,000 x g for 1 minute. 7. Discard the flow through from the Collection Tube and repeat Step 6. 8. Add 200 μl DNA Pre-Wash Buffer to the Zymo-Spin™ IIC Column in a new Collection Tube and centrifuge at 10,000 x g for 1 minute. 9. Add 500 μl Fungal/Bacterial DNA Wash Buffer to the Zymo-Spin™ IIC Column and centrifuge at 10,000 x g for 1 minute. 10. Transfer the Zymo-Spin™ IIC Column to a clean 1.5 ml microcentrifuge tube and add 100 μl DNA Elution Buffer directly to the column matrix. 11. Centrifuge at 10,000 x g for 30 seconds to elute the DNA.

313

Appendix 2.2: Detection the quality and quantity of DNA:

1-Set up the horizontal Minnie Gel Unit( Hoefer, Holliston, USA) electrophoresis, then prepare gel tray by sealing ends of gel chamber with tape and place appropriate number of combs in gel tray. 2-Making 500ml TAE buffer by diluting 10ml of 50xTAE in 490ml sterile water. Making 100ml of 50x TAE 1-Add the following to 900 ml distilled H₂O 24.2 gr Tris base 5.71 ml Glasial acetic acid 1.86 gr EDTA 2-Adjust volume to 1 L with additional distilled H₂O 3-Making 1% agarose gel:

Procedure: 1. For a 1% agarose gel, weigh out 0.25g of agarose into a flask and add 25ml of 1 x TAE (diluted from 50x TAE). 2. Heat solution in a microwave until agarose is completely dissolved. 3. Allow cooling down where can hold the flask by hand, then under the hood add 2.5µl GelRed Nucleic Acid (10,000 x in water) in the molten agarose, then pour them to the gel tray and Allow to cool for for 15-30 min at room temperature. 4. Remove the comb, place in electrophoresis chamber and cover with buffer (TAE as used previously) until the gel is just sub merged. 5. Load 3µl DNA standard (1Kb) into the first well of gel and in separate tubes mix 1µl loading dye buffer to the 5µl of each samples then add these 6µl of different samples to the different wells. 6. Electrophorese at 100V and for 50 min. 7. Visualize DNA bands by using UV light box.

314

Appendix 2.3: Wizard® SV Gel and PCR Clean-Up System

DNA Purification by Centrifugation Gel Slice and PCR Product Preparation A. Dissolving the Gel Slice 1. Following electrophoresis, excise DNA band from gel and place gel slice in a 1.5ml microcentrifuge tube. 2. Add 10μl Membrane Binding Solution per 10mg of gel slice. Vortex and incubate at 50–65°C until gel slice is completely dissolved. B. Processing PCR Amplifications 1. Add an equal volume of Membrane Binding Solution to the PCR amplification. Binding of DNA 1. Insert SV Minicolumn into Collection Tube. 2. Transfer dissolved gel mixture or prepared PCR product to the Minicolumn assembly. Incubate at room temperature for 1 minute. 3. Centrifuge at 16,000 × g for 1 minute. Discard flowthrough and reinsert Minicolumn into Collection Tube. Washing 4. Add 700μl Membrane Wash Solution (ethanol added). Centrifuge at 16,000 × g for 1 minute. Discard flowthrough and reinsert Minicolumn into Collection Tube. 5. Repeat Step 4 with 500μl Membrane Wash Solution. Centrifuge at 16,000 × g for 5 minutes. 6. Empty the Collection Tube and recentrifuge the column assembly for 1 minute with the microcentrifuge lid open (or off) to allow evaporation of any residual ethanol. Elution 7. Carefully transfer Minicolumn to a clean 1.5ml microcentrifuge tube. 8. Add 50μl of Nuclease-Free Water to the Minicolumn. Incubate at room temperature for 1 minute. Centrifuge at 16,000 × g for 1 minute. 9. Discard Minicolumn and store DNA at 4°C or –20°C

315

Appendix 2.4

Table 1: Recommended amounts of template and primer for sequencing reactions by AGRF

Template Recommended Quantity for PD Recommended Quantity for CS Samples (in 12µL) Samples PCR Product 100-200 bp 3 - 8 ng 1-3 ng PCR Product 200-400 bp 6 - 12 ng 2-4 ng PCR Product 400-600 bp 12 -18 ng 4-6 ng PCR Product 600-800 bp 18 - 30 ng 6-10 ng PCR Product >800 bp 30 - 75 ng 10-25 ng Plasmid, Single-stranded 150 - 300 ng 50-100 ng Plasmid, Double-stranded 600 - 1500 ng 200-500 ng Primer Quantity 9.6 pmol(0.8 pmol/µl) 3.2 pmol

316

Appendix 4.1: Vogel’s trace solution

The trace element solution (containing citric acid as a solubilizing agent) is made up as follows in 95 ml distilled water with the components dissolved successively with stirring at room temperature:

Citric acid.H2O 5.00 grams

ZnSO4.7H2O 5.00 grams

Fe (NH4)2(SO4)2.6 H2O 1.0 gram

CuSO4.5 H2O 0.25 gram

MnSO4.H2O 0.05 gram

H3BO3, anhydrous 0.05 gram

Na2MoO4.2H2O 0.05 gram

The resulting total volume is about 100 ml. Chloroform (1 ml) is added as a preservative, and the trace element solution is stored at room temperature. Biotin solution is prepared by dissolving 5.0 mg biotin in 50 ml distilled water. The solution obtained is dispensed in test tubes and stored frozen.

317

Appendix 4.2: A standard curve was plotted using the absorbance readings of the BSA standard at 595 nm

Standard curve for protein concentration 0.45 0.389 0.395 0.4 0.378

0.347 0.35 0.315 0.3 0.277 0.235 y = 0.3042x 0.25 0.224 0.195 R² = 0.9893 0.2 0.145 0.15 0.121 0.106 0.1 Absorbance values at 595 nm 0.056 0.038 0.05

0 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 1.1 1.2 1.3 1.4 1.5 Concentration of BSA (mg/ml)

318

Appendix 4.3: A standard curve was plotted using the absorbance readings of the different concentration of maltose as the standard and end product of amylase activity at 540 nm

Conc of maltose (µg/ml) 0 50 100 150 200 250 300 350 400 450 500 Reading -0.005 0.096 0.231 0.358 0.477 0.603 0.716 0.86 0.996 1.127 1.209

Standard curve for amylase assay

1.4 y = 0.0024x R² = 0.9984 1.2 1.209 1.127 1 0.996 0.86 0.8 0.716 0.6 0.603 0.477 0.4 0.358 0.2 0.231

Absorbancereading at 540 nm 0.096 0 0.005 0 100 200 300 400 500 600

Cncentration of Maltose µg/ml

Calculation of amylase activity:

Blank corrected raw data for sample (EL-14 grown at 25 °C and pH 5): 1.257

Eq. (4.1) was used to find out the concentration of maltose (x) based on amylase activity produced by sample was calculated using Absorbance (y) and extinction coefficient (ɛ= 0.0024) from standard curve and calculated as Conc. = 523.75.

= (4.1)

Then to find out total enzyme activity, the following formula Eq. (4.2) was used.

= (4.2)

Considering dilution factor of 8 (50µl of diluted ½ sample in total 200µl based on assay), volume of 350ml and incubation time of 20 minutes at 37 °C and maltose molecular weight (342.29 g/mol), the total amylse activity will be 214.21 U µmol/ml. Accordingly, specific amylase activity was calculated based on the total activity divided by total protein concentration (2.08 mg) which is 102.98 U/mg (Fig 4.10).

319

Appendix 4.4: A standard curve was plotted using the logarithmic absorbance readings of the different concentration of trypsin as the standard at 450 nm

Conc. of Trypsin (µg/ml) 500 100 20 4 0.8 0.16 0.032 Absorbance (U) 0.492 0.429 0.319 0.276 0.167 0.078 0.05

Standard curve for protease activity y = 0.0484ln(x) + 0.1917 0.6 R² = 0.9869

0.5 0.492 0.429 0.4

0.3 0.319 0.276 0.2 0.167 0.1 0.078 0.05 0 Absorbance values at 450 nm 0.01 0.1 1 10 100 1000 Logarithmic scale of concentration (µg/ml)

Calculation of protease activity:

Blank corrected raw data for sample (EL-17 grown at 37 °C and pH 5.5): 0.502

The concentration of trypsin produced by sample was calculated (x) based on Absorbance (y) and extinction coefficient from standard curve.

The concentration of enzyme produced by sample (x) was calculated to be 0.608597 (mg/ml). Considering the protease assay kit, 1mg of Trypsin has approximately activity equal to 40 BAEE units/mg and dilution factor of 5 (50µl sample in 250µl total volume), the total protease activity will be 121.71 BAEE U/ml. If it divided by total protein (1.8 mg/ml), will be resulted of 68.5 BAEE U/mg (Fig 4.16).

320

Appendix 5.1: Calculation of sample volume based on protein concentration. Intens. x10 0 1 2 3 4 5 250. 173.0 1+ 201.0 200 D 290.1 1+

300 319.1 1+ 101

364.1 1+ T SIYFALTDR 391.2

1+ 400 113 443.2

500 504.2 L 1+

534.2 71

575.3 1+ A

600 147 677.4

1+ 695.4 700 1+ 722.4 1+ F

796.4 800 1+ 163

885.4 +MS2(544.1), 11.9-12.0min #595-#599 11.9-12.0min +MS2(544.1), 1+ 900 911.4 Y

1000 m/z

321

Appendix 5.2: Calculation of sample volume based on protein concentration.

Parameters in 2D gel 7cm 11cm Rehydration volume 125µl 185µl Protein concentration 50-100µg 100-200µg 0.02% Standard (fresh) 2.5µl 3.7µl 0.01% Carrier ampholyte(fresh) 1.25µl 1.85µl 0.002% Bromophenol blue 0.5µl 0.74µl (fresh) IEF protocol 4000 V (7000-10000 V- 8000 V (20000-40000 V- hr) hr) Equilibration buffer (1 and 2) 2ml [0.04gm of DTT and 4ml [0.08gm of DTT and volume 0.05 g of Iodoacetamide]. 0.1g of Iodoacetamide].

Mineral oil 1 ml 2ml Protein sample Calculated Calculated

Strip Size; V-hr Programmed pH 3-10 pH 4-7 7 cm, 8000 V-hr 2 hr 30 min 2 hr 11 cm, 20000 V-hr 4hr 50 min 3 hr 45 min

For example, Protein concentration obtained from Bradford assay: 7.62 Protein load for 11cm strip: 100-200 µg Volume of sample to be loaded = 1/7.62 x 200 = 26.25µl Hence, rehydration of the gel strips was done as followed: Volume of protein sample: 26.25 µl Volume of carrier ampholyte: 1.85 µl Volume of standard (# 161-0320- Bio Rad): 3.7 µl Volume of bromophenol blue: 0.74µl Volume of solubilizing buffer: 152.46µl Therefore, the total volume loaded onto IPG gel strip was 185µl. Volume of, carrier ampholyte (0.01%) for 7cm gel: Calculation: For 1 ml we need 10µl. Therefore, in 125µl, the volume is 10/1000 x 125 =1.25µl. Volume of bromophenol blue, (0.002%) for 7 cm gel: Calculation: For 1ml we need 2µl. Therefore, in 125µl, the volume is 2/1000 x 125=0.3µl. (0.5µl was used) Volume of standard (0.02%), for 7cm gel: Calculation: For 1000µl we need 20µl. Therefore, for 125µl, the volume is 20/1000 x 125= 2.5µl.

322

Appendix 5.3: Using PROTEIN PILOT proved the present of two 9-mer peptide as SIYFALTDR and NALAYLLAR which were similar peptides to α-amylase in Magnaporthe oryzae.

323

324