Page 1 of 53 Diabetes

The metabolic regulator 9 contributes to glucose homeostasis

abnormality induced by hepatitis C virus infection

Jizheng CHEN2, Ning WANG1, Mei DONG1, Min GUO2, Yang ZHAO3, Zhiyong

ZHUO3, Chao ZHANG3, Xiumei CHI4, Yu PAN4, Jing JIANG4, Hong TANG2, Junqi

NIU4, Dongliang YANG5, Zhong LI1, Xiao HAN1, Qian WANG1* and Xinwen Chen2

1 Jiangsu Province Key Lab of Human Functional Genomics, Department of

Biochemistry and Molecular Biology, Nanjing Medical University, Nanjing, 210029,

China

2 State Key Lab of Virology, Wuhan Institute of Virology, Chinese Academy of

Sciences, Wuhan, 430071, China

3 Key Laboratory of Infection and Immunity, Institute of Biophysics, Chinese

Academy of Sciences, Beijing, 100101, China

4 Department of Hepatology, The First Hospital of Jilin University, Changchun,

130021, China

5 Department of Infectious Diseases, Union Hospital, Tongji Medical College,

Huazhong University of Science and Technology, Wuhan, 430074, China

1

Diabetes Publish Ahead of Print, published online September 29, 2015 Diabetes Page 2 of 53

*Correspondence:

Qian WANG, Ph.D.

Jiangsu Province Key Lab of Human Functional Genomics

Department of Biochemistry and Molecular Biology

Nanjing Medical University

Nanjing 210029, China

Email: [email protected]

Fax: +86258362 1065

Tel: +86258686 2729

2 Page 3 of 53 Diabetes

ABSTRACT

Class IIa histone deacetylases (HDACs), such as HDAC4, HDAC5, and HDAC7

provide critical mechanisms for regulating glucose homeostasis. Here we report

HDAC9, another class IIa HDAC, regulates hepatic gluconeogenesis via

deacetylation of a Forkhead box O (FoxO) family transcription factor, FoxO1,

together with HDAC3. Specifically, HDAC9 expression can be strongly induced upon

hepatitis C virus (HCV) infection. HCVinduced HDAC9 upregulation enhances

gluconeogenesis by promoting the expression of gluconeogenic , including

phosphoenolpyruvate carboxykinase and glucose6phosphatase, indicating a major

role for HDAC9 in the development of HCVassociated exaggerated gluconeogenic

responses. Moreover, HDAC9 expression levels and gluconeogenic activities were

elevated in livers from HCVinfected patients and persistent HCVinfected mice,

emphasizing the clinical relevance of these results. Our results suggest HDAC9 is

involved in glucose metabolism and HCVinduced abnormal glucose homeostasis and

type2 diabetes.

3 Diabetes Page 4 of 53

INTRODUCTION

Hepatitis C virus (HCV) infection is the leading cause of viral hepatitis, which may lead to chronic hepatitis in up to 60–80% of infected adults and can progress to liver fibrosis, cirrhosis, and eventually hepatocellular carcinoma (1; 2). In addition, HCV infection may cause a variety of clinical extrahepatic manifestations (3). It is now widely recognized that chronic HCV infection is a metabolic disease that is associated with the subsequent development of hyperglycemia and type2 diabetes (T2DM) (4).

The association between HCV and T2DM was recognized over 30 years ago (5).

Since then, many observational studies assessing the association between HCV and

T2DM have been published, which have provided mixed results. However, metaanalyses have demonstrated that HCV infection can promote the increased prevalence of T2DM (6). It is generally accepted that glucose intolerance is more prevalent in chronic hepatitis associated with HCV infection than in other chronic liver diseases, including hepatitis B infection (7). HCV infection per se is associated with insulin resistance in the target pathways of endogenous glucose production and total body glucose disposal (8). Thus, chronic HCV infection may directly predispose the host to abnormal glucose metabolism and is thus considered as a risk factor for developing T2DM. However, the precise mechanisms underlying T2DM manifestation are poorly understood.

Glucose homeostasis is maintained physiologically through a balance between

4 Page 5 of 53 Diabetes

glucose production by the liver and glucose utilization by the peripheral tissues, via

the gluconeogenic and glycolytic pathways, respectively. Gluconeogenesis is largely

controlled at the transcriptional level by ratelimiting such as

phosphoenolpyruvate carboxykinase (PEPCK) and glucose6phosphatase (G6PC).

Expression of these enzymes is controlled by the hormonal modulation of

transcription factors and coactivators, including Forkhead box O (FoxO) proteins (9).

The insulinsignaling pathway is a major pathway responsible for suppressing

gluconeogenic transcription. Insulindependent control of gluconeogenesis is largely

mediated through Akt, which phosphorylates and inactivates FoxO transcription

factors (mainly FoxO1 and FoxO3) in mammalian livers (10). Recent studies indicate

that HCV promotes hepatic gluconeogenesis through a phosphoFoxO1dependent

pathway (11; 12). However, in addition to phosphorylationdependent regulation,

FoxO activity is also modulated through acetylation by histone acetyltransferase

(HAT) enzymes, such as p300. Acetylation of FoxO transcription factors occurs in

response to oxidative stress or DNA binding, and can be reversed by the action of

deacetylases (13).

Four families of deacetylases counteract the activity of HATs: class I (HDAC1, 2, 3,

and 8) and II histone deacetylases (HDACs), class III NAD+dependent HDACs

known as (SIRTs; SIRT1–7), and HDAC 11, the sole class IV HDAC (14).

Class II HDACs are further subdivided into IIa (HDAC4, 5, 7, and 9) and IIb

(HDAC6 and 10) subfamilies. Among the HDACs, HDAC3 and SIRT1 are

5 Diabetes Page 6 of 53

wellknown regulators of fatty acid and glucose metabolism (15; 16). Recent studies indicate that class IIa HDACs (HDAC4, 5, and 7) are hormoneactivated regulators of

FoxO and mammalian glucose homeostasis, especially gluconeogenesis (17). It is of great interest and importance to understand the biology of other HDACs in glucose homeostasis regulation and whether HDACs influence glucose metabolism abnormality in HCVinfected hepatocytes.

Here, we report HDAC9 regulates hepatic gluconeogenesis via deacetylation of

FoxO1 and HCVinduced HDAC9 upregulation caused an exaggerated gluconeogenic response. Moreover, both persistent HCVinfected transgenic mice and HCVinfected patients exhibited upregulated HDAC9 in liver and induced gluconeogenic activity.

These findings provide a clue to the possible mechanisms underlying the development of HCVinduced abnormal glucose homeostasis and T2DM.

6 Page 7 of 53 Diabetes

RESEARCH DESIGN AND METHODS

Patients and biopsies

Human liver tissue samples from fine needle biopsies were obtained from

HCVinfected patients. Normal human liver tissue was obtained from either spare

donor tissue intended for transplantation or from normal liver tissue resected from

patients with benign hepatic tumours. All human tissue samples were collected from

the Liver Unit of the First Hospital of Jilin University and TongJi Hospital, TongJi

Medical College of Huazhong University of Science and Technology with local

research ethics committee approval and informed patient consent. Diagnosis of

chronic HCV infection patients and analysis of all biopsies were based on standard

serological assays and the presence of abnormal serum aminotransferase levels for at

least six months. All HCV patients tested positive for HCV antibody based on a

thirdgeneration ELISA test. HCV infection was confirmed by detection of circulating

HCV RNA using HCV PCRbased assay (Qiagen). At time of biopsy, liver tissue

(2–3 mm) was immediately frozen in Trizol and stored at 80°C. Fasting glucose and

insulin were measured on the days of biopsy. Insulin resistance was assessed by the

HOMAIR score (homeostasis model assessment, calculated as (fasting insulin ×

fasting glucose)/22.5).

Cells and virus

Human hepatoma cell lines HuH7.5.1 (kindly provided by Frank Chisari) were

cultured as described (18). HuH7.5.1H77 cells (H77, genotype 1a), HuH7.5.1Con1

7 Diabetes Page 8 of 53

cells (CON1, genotype 1b), and HuH7.5.1SGRJFH1 cells (SGR, genotype 2a), which harbour the subgenomic HCV replicon, were derived from HuH7.5.1 cells and maintained in the same medium as HuH7.5.1 cells supplemented with 0.5 mg/ml

G418 (Gibco). Primary hepatocytes (PHT) cells isolated from C/OTg mice were performed as described (19). The HCV J399EM strain was derived from the JFH1 virus by insertion of enhanced green fluorescent protein (EGFP) into the HCV NS5A region (20). Virus production and infection was performed as described (21).

Mockinfected control was performed in parallel to virus infections, but in the absence of virus. For infection in vitro, PHTTg or HuH7.5.1 cells (1 x 106) were infected with J399EM for the indicated time with indicated multiplicities of infection

(MOI).

Real-time PCR and western blot analysis

RNA isolation, cDNA synthesis, quantitative PCR with indicated primers

(Supplementary Table. 1), and Western blotting were performed as described (21).

The NS5A antibody was a gift from Pro. Rice. All other antibodies were purchased from Abcam (HDAC9, ab18970), Santa Cruz Biotechnology (AcetylFoxO1, sc49437, phosphoFoxO1 (Ser256), sc16307 and ACTIN, sc1616) or Cell Signaling

Technology (FoxO1, 9454, HDAC3, 3949, PEPCK, 12940, GAPDH, 2118).

RNA interference

For knockdown experiments, 50 pmol small interfering RNA (siRNA) specific for

8 Page 9 of 53 Diabetes

HDAC9 and negative control (Qiagen, Supplementary Table 1) were transfected into

HuH7.5.1 or SGR cells via the Lipofectamine 2000 (Invitrogen).

Glucose production assay

The production of glucose was measured using an Amplex® Red Glucose/Glucose

oxidase assay kit (Invitrogen) according to the manufacturer’s instructions.

Co-immunoprecipitation and immunofluorescence assay

Coimmunoprecipitation and immunofluorescence assay were performed as described

(21).

PEPCK activity assay

PEPCK activity was assayed using an NADHcoupled system as described

(22) .

Transgenic Mice and Animal study design

The transgenic C/OTg mice harboring both human CD81 and OCLN genes were

constructed as described (19). We used 812 weeks of age and gendermatched mice

for in vivo experiments. The information of HCV infected (n = 36) and mockinfected

(n = 12) C/OTg mice raised in synchronization were listed in Supplementary Table 2,

and more information were shown previously (19). The animal studies were approved

by the Institutional Animal Care and Use Committee of Nanjing Medical University.

9 Diabetes Page 10 of 53

Metabolic studies

Glucose and insulin tolerance tests were performed by intraperitoneal injection of mice with glucose (2.0 g/kg), insulin (0.5 U/kg), or pyruvate (2.0 g/kg) according to methods described previously (23). FLEXMAP 3D quantification (Luminex, TX) of concentrations of insulin and Cpeptide were performed.

Statistical analysis

Data are presented as means ± SEM. Statistical analysis was carried out using

Student’s ttest when comparing two groups and ANOVA when comparing multiple groups. Differences were considered significant at P < 0.05 (*, p < 0.05; **, p < 0.01).

Statistical analyses were performed using GraphPad Prism.

10 Page 11 of 53 Diabetes

RESULTS

Upregulated HDAC9 and PEPCK expression in liver biopsies from

HCV-infected patients

Previous studies suggest that the class IIa HDAC4, HDAC5, and HDAC7 proteins

play a central role in metabolic homeostasis. A comparison of the transcriptomes of

HCVinfected and mockinfected HuH7.5.1 cells revealed that HDAC9 expression

was enhanced by 16.25fold in JFH1infected cells, whereas among the other

HDACs, only SIRT1 and HDAC5 expression levels were increased 2.25 and 2.03 fold,

respectively (data not shown). To confirm the results, we examined HDAC9

expression in liver biopsy samples from HCVinfected patients. The demographic and

clinicopathological characteristics of 38 biopsies obtained from HCVinfected

patients and 10 biopsies from normal control patients included in the study are shown

in supplementary Table 3. We observed a statistically significant elevation of HDAC9

expression in liver biopsies from HCVinfected patients (Fig. 1A and B). In the group

of 38 HCVinfected patients, HDAC9 mRNA expression levels were positively

associated with HCV viral loads in the liver (Fig. 1C), but not in the serum (data not

shown). PEPCK mRNA levels were also found to be elevated in HCVinfected

patients (Fig. 1D). Remarkably, PEPCK enzymatic activity in samples from

HCVinfected patients was 3 to 4fold higher than in parallel samples from normal

control patients (Fig. 1E). In HCVinfected subjects, the degree of HDAC9 and

PEPCK induction appeared to be positively correlated (Fig. 1F). Further, we

compared the induction of HDAC9 with PEPCK enzymatic activities, and again, a

11 Diabetes Page 12 of 53

significant positive correlation was observed (Fig. 1G). To determine if the HDAC9 overexpression observed in patients infected with HCV correlated with systemic insulin resistance, we measured fasting glucose and insulin levels on the day of the liver biopsy. A positive correlation was found in 38 subjects between the induction of

HDAC9 and their HOMAIR values (Fig. 1H).

HCV infection upregulates host HDAC9 expression in an HCV-dependent manner

We further analyse our clinical findings in vitro. As shown in Fig. 2A, HDAC9 expression is upregulated in time and dosedependent manners following HCV infection, in parallel with increasing HCV RNA levels. Similar HDAC9 upregulation was observed at the protein level (Fig. 2B, Supplementary Fig. 1C and 2A). Moreover, the expression levels of the other HDACs, including HDAC17 and SIRT1, were not upregulated (Supplementary Fig. 1). HDAC9 mRNA and protein levels were also increased in H77 cells, CON1 cells, and SGR cells (Fig. 2C and D), which harbor the

HCV 1a, HCV 1b, and HCV 2a subgenomic replicons, respectively, indicating that

HCVdependent HDAC9 upregulation was not genotypespecific.

To determine whether the observed HDAC9 induction was HCVdependent,

HCVinfected cells were treated with 2mAde (an HCV inhibitor that targets the viral

NS5B protein). As shown in Fig. 2E and F, 2mAde treatment dramatically decreased

HCV levels and HDAC9 upregulation in HCVinfected cells, whereas HDAC9

12 Page 13 of 53 Diabetes

expression levels in control cells were not affected. Similar results were observed in

HCV replicon cells (Supplementary Fig. 2B and C). Transfection with siHCV, a small

interfering RNA (siRNA) targeting HCV, reduced HDAC9 expression by 80% and

intracellular HCV RNA levels by ~90% (Fig. 2G), consistent with the fact that HCV

infection stimulates HDAC9 expression. Interestingly, HCVinfected cells transfected

with siRNAs targeting the HDAC9 sequence (siHDAC92~5) decreased both HDAC9

and HCV RNA expression levels (Fig. 2G). siHDAC91 did not reduce either the

expression of HDAC9 or HCV RNA levels. Two combinations of siRNAs

(siHDAC92+3+4 and siHDAC92+4+5) significantly decreased HDAC9 expression

levels to ~30% or 40% of the control level in HCVinfected cells (Fig. 2G),

respectively, in agreement with the effect in HuH7.5.1 cells (Supplementary Fig. 2D

and E). These siRNA combinations also reduced HCV RNA levels to 14% or 15%,

respectively, as also suggested by comparable downregulation of the NS3 proteins

(Fig. 2H). Transfection with HDAC9 siRNAs exerted similar effects in HCV replicon

cells (Supplementary Fig. 2F and G). Downregulation of the NS3 proteins was also

observed in HCVinfectedHDAC9 shRNA cells (Supplementary Fig. 4A).

Furthermore, the small molecule HDAC inhibitors sodium butyrate (NaB) and

trichostatin A (TSA) significantly decreased HCV RNA and NS3 protein levels

(Supplementary Fig. 2H and I), without affecting the viability of HuH7.5.1 cells (data

not shown). These results suggest that, while HCV infection can upregulate HDAC9

expression in an HCVdependent manner, HDAC9 silencing can also inhibit HCV

replication.

13 Diabetes Page 14 of 53

HDAC9 mediates HCV-dependent gluconeogenesis

Recent studies indicate that HCV promotes hepatic gluconeogenesis (12). In agreement, we found that PEPCK mRNA and protein levels were increased in a time and dosedependent manner following HCV infection (Fig. 3A, B and Supplementary

Fig. 3A). In addition, HCV infection induced the expression of another ratelimiting enzyme, G6PC (Supplementary Fig. 3B). 2mAde treatment blocked PEPCK (Fig. 3C) and G6PC (Supplementary Fig. 3C) elevation in HCVinfected cells, confirming its dependency on the presence of HCV, similar to the effects observed in SGR cells

(Supplementary Fig. 3D). To assess the physiological relevance of HDAC9 and key gluconeogenic enzyme upregulation by HCV infection, we assayed for cellular glucose production, which reflects endogenous gluconeogenesis. The results showed that HCV infection caused elevated glucose production, relative to the mockinfected control (Fig. 3D). In contrast, 2mAde treatment in HCVinfected cells (Fig. 3D) or

SGR cells (Supplementary Fig. 3E) significantly abrogated the increase in glucose production, suggesting that the elevation in gluconeogenesis was HCVdependent.

Class IIa HDACs are hormoneactivated regulators of glucose homeostasis, especially gluconeogenesis. We next investigated whether the induction of gluconeogenic enzymes was HDAC9dependent. Treatment with TSA and NaB reduced PEPCK (Fig.

3C) and G6PC (Supplementary Fig. 3C) mRNA levels relative to the control in mock and HCVinfected cells. HDAC9 silencing significantly attenuated PEPCK (Fig. 3E, F

14 Page 15 of 53 Diabetes

and Supplementary Fig. 4A) and G6PC (Supplementary Fig. 3F) expression in

HuH7.5.1 cells excluding the function of other HDACs. Furthermore, HDAC9

depletion also resulted in a marked decrease of HCVinduced PEPCK expression in

both HCVinfected cells (Fig. 3E, F and Supplementary Fig. 4A) and SGR cells

(Supplementary Fig. 3G), similar to the effect on G6PC expression (Supplementary

Fig. 3F). Consistently, glucose production in HuH7.5.1 cells, HCVinfected cells, and

SGR cells was dramatically reduced compared to the control following HDAC9

knockdown (Fig. 3G, Supplementary Fig. 3H and I) or treatment with HDAC

inhibitors NaB and TSA (Fig. 3D).

Taken together, these results demonstrate that HDAC9 plays roles in regulating

gluconeogenesis in hepatic cells and in HCVpromoted gluconeogenesis.

Involvement of HDAC9-dependent FoxO1 acetylation in HCV-induced

gluconeogenesis

The FoxO1 transcription factor stimulates PEPCK and G6PC expression by binding

directly to their promoters. This binding is controlled by various posttranslational

modifications, including phosphorylation, ubiquitylation, and acetylation. We

examined whether HDAC9 influences the acetylation of FoxO1.

Immunoblot analysis revealed that FoxO1 acetylation was dramatically decreased in

HCVinfected cells compared with the mockinfected control, whereas total FoxO1

15 Diabetes Page 16 of 53

protein levels were comparable (Fig. 4A). Conversely, treatment of HCVinfected cells with 2mAde restored FoxO1 acetylation to approximately the same level as seen in mockinfected cells (Fig. 4A). In addition, HDAC9 depletion led to increased acetylation of endogenous FoxO1 in both HuH7.5.1 (Fig. 4B) and HCVinfected cells

(Fig. 4C and Supplementary Fig. 4A). In a parallel experiment, HCV replicon cells exhibited similar result following 2mAde treatment or HDAC9 knockdown

(Supplementary Fig. 4B and C).

We further tested whether HDAC9 and FoxO1 are physically associated. HDAC9 coimmunoprecipitated with both the acetylated and nonacetylated forms of FoxO1 in both mock and HCVinfected cells (Fig. 4D, second and third panel). It has been reported that class IIa HDACs are catalytically inactive and exhibit activity only when associated with the catalytically active class I HDAC family member HDAC3 (17;

24). Consistent with these observations, endogenous HDAC9 coimmunoprecipitated with HDAC3 (Fig. 4D, second and forth panel). Of note, HCV infection greatly enhanced the association between endogenous FoxO1 and HDAC3, suggesting that

HDAC9 upregulation stabilizes complex formation between HDAC9, FoxO1, and

HDAC3 (Fig. 4D, third and forth panel).

Data from a previous study showed that HCV infection in human hepatocytes can impair insulininduced FoxO1 translocation from the nucleus to the cytoplasm (25).

We tested whether HDAC9 is involved in HCVpromoted FoxO1 nuclear

16 Page 17 of 53 Diabetes

accumulation. Mockinfected HuH7.5.1 cells were treated similarly for comparison

purposes (Fig. 4E and Supplementary Fig. 4D). Consistent with the decreased levels

of endogenous FoxO1 acetylation observed in HCVinfected cells, most HCVinfected

cells displayed nuclear FoxO1 localization, whereas treatment with 2mAde induced

FoxO1 translocation to the cytoplasm (Fig. 4E). HDAC9knockdown increased

endogenous FoxO1 acetylation (Fig. 4C), which was excluded from the nuclei in

these cells (Fig. 4E and Supplementary Fig. 4E). Similar results were observed

following NaB and TSA treatment (Fig. 4E). A cell fractionation study further

indicated that HDAC9 depletion reduced nuclear FoxO1 in HCVinfected cells, and

the acetylation form of FoxO1 was significantly reduced in both cytoplasmic and

nuclear fractions (Fig. 4C). Moreover, HDAC9 accumulated in the nuclear fraction in

both mock and HCVinfected cells (Fig. 4C and E).

Taken together, these results suggest that HDAC9 can control FoxO1 acetylation in

hepatocytes and that HCVinduced nuclear HDAC9 upregulation suppressed FoxO1

acetylation, leading to the nuclear accumulation of FoxO1.

Exaggerated gluconeogenic response via HDAC9 upregulation in persistent

HCV-infected mice

We further demonstrated the relevance of our clinical and in vitro findings in

transgenic ICR mice (C/OTg) that specifically expressed human CD81 and OCLN in

their hepatocytes. The same cohort of transgenic mice, which can support persistent

17 Diabetes Page 18 of 53

infection by HCV particles derived from either cell cultures or chronically infected patients, was described previously (19). Elevated fasting plasma glucose (FPG) levels were observed in chronically HCVinfected C/OTg mice during the 10 months postinfection (mpi) period, compared with mockinfected control mice

(supplementary Table 2). Administration of glucose to HCVinfected transgenic mice revealed a significant impairment of glucose tolerance at 1 mpi, compared with control mice of the same age (Fig. 5A). The insulin tolerance test conducted at 1 mpi revealed that the reduction in plasma glucose concentrations after intraperitoneal (IP) insulin administration was impaired in chronic HCVinfected C/OTg mice, which displayed higher plasma glucose levels than did control mice at all time points measured (Fig. 5B). Accordingly, the homeostatic model assessmentinsulin resistance (HOMAIR) values, a measure of systemic insulin resistance, were also elevated in HCVinfected mice compared to controls (Supplementary Table 2).

We then determined the effect of HCV infection on gluconeogenesis in vivo by examining blood glucose levels in mice following IP injection of pyruvate, a major gluconeogenic substrate. HCV infection induced pyruvate tolerance in C/OTg mice, as represented by a significant elevation in the area under the curve (AUC; Fig. 5C), suggestive of an increased hepatic glucose output in HCVinfected C/OTg mice.

Furthermore, PEPCK enzymatic activities in liver samples of C/OTg mice were significant increased over time following HCV infection for over 10 months (Fig.

5D).

18 Page 19 of 53 Diabetes

HDAC9 expression levels were analyzed to assess the correlation between HDAC9

expression and glucose homeostasis abnormality in HCVinfected mice. In contrast to

mockinfected mice, HDAC9 expression at both mRNA and protein levels increased

continuously during the 10 mpi period in chronical HCVinfected C/OTg mice (Fig. 5E,

F and Supplementary Fig. 5). This result was confirmed by in vitro studies showing

that infection of primary hepatocytes isolated from C/OTg mice with HCV induced

HDAC9 expression (Fig. 5G and H). Consistent with the in vitro findings, FoxO1

acetylation and phosphorylation dramatically decreased in both HCVinfected C/OTg

mice (Fig. 5F) and primary hepatocytes (Fig. 5H) compared with the controls,

whereas total FoxO1 protein levels were comparable.

19 Diabetes Page 20 of 53

DISCUSSION

HDACs regulate acetylation of histones and transcriptional factors involved in glucose homeostasis and play a central role in the regulation of glucose metabolism

(26). In this study, we demonstrated that HDAC9, a class IIa HDAC, is involved in gluconeogenesis in liver via deacetylation of the FoxO1 transcription factor together with HDAC3. In particular, HDAC9 can be strongly induced upon stimulation, such as HCV infection. HDAC9 upregulation induced by HCV infection promoted the expression of gluconeogenic genes such as PEPCK and enhanced gluconeogenesis.

These results suggest a plausible molecular mechanism for HCVinduced abnormal glucose homeostasis and T2DM.

Previous studies showed that class IIa HDACs such as HDAC4, 5, and 7 regulate

FoxO and glucose homeostasis responses to fasting hormone glucagon in the liver

(17). Glucagoninduced dephosphorylation of HDAC4, 5, and 7 results in the nuclear translocation and deacetylation of FoxO, enhancing its association with gluconeogenic gene promoters. We found that HDAC9 showed a predominant nuclear localization in hepatocytes. Within the nuclei, HDAC9 may act as a scaffold to recruit

HDAC3, similar to its mode of action in regulatory T cells (27). The resulting catalytically active HDAC complex can deacetylate nuclear FoxO1, leading to the acute transcriptional induction of gluconeogenic enzymes. HDAC9 suppression in hepatocytes results in the inhibition of gluconeogenic genes and gluconeogenesis.

These results indicate HDAC9 may regulate glucose homeostasis under normal

20 Page 21 of 53 Diabetes

physiological conditions. Unlike other class IIa HDACs that are regulated by

posttranslational modification responses to fasting in liver (17), HDAC9 regulates

gluconeogenesis specifically via eliciting gene expression level changes. HCV

infection only significantly upregulated the expression of HDAC9, but not other

HDACs, suggesting that class IIa HDACs may be induced via different mechanisms.

It is of interest to identify the stimulus for HDAC9 induction under physiological

conditions and to investigate the mechanism whereby HDAC9 responds to a given

stimulus to maintain normal glucose homeostasis. Knockdown of HDAC9 expression

in vivo completely protected mice from the consequences of highfat feeding,

including elevated blood sugar, cholesterol levels, and fatty liver disease (28). Thus,

HDAC9 may play a role in regulating gluconeogenesis and glucose homeostasis

during highfat feeding.

It has been reported that increased oxidative stress may be an initial key event that

triggers highfatdietinduced insulin resistance (29; 30). Hepatic oxidative stress is a

prominent feature of chronic HCV infection, and oxidative stress upregulates HDAC

activity (31; 32). We found that HCVinduced oxidative stress increased HDAC9

expression, whereas the antioxidant NacetylLcysteine restored HDAC9 expression

in HCVinfected cells (Supplementary Fig. 6A and B) and HCV replicon cells

(Supplementary Fig. 6D and E). However, while antioxidant treatment markedly

reduced glucose production and gluconeogenesis following HCV infection

(Supplementary Fig. 6C and F), its effect on gluconeogenesis was weaker than that of

21 Diabetes Page 22 of 53

an HDAC9 siRNA or a HDAC inhibitor, suggesting that HDAC expression is regulated by other factors in addition to reactive oxygen species. However, the individual expression of each HCV protein could not enhance HDAC9 expression

(data not shown). HCV replication is associated with the endoplasmic reticulum (ER), where the virus causes stress. It is reported that ER stress is emerging as a potential contributor to the onset of type2 diabetes by making cells insulinresistant.

Understanding the role of ER stress that HCV exerts will provide insight. Moreover, as the bestcharacterized 1433 target chromatinmodifying enzymes are class IIa

HDACs (33; 34), it will be interesting to determine whether HCV also regulates

HDAC regulators, such as the 1433 proteins.

FoxO1 regulates multiple metabolic pathways in the liver, including gluconeogenesis, glycolysis, and lipogenesis (9). HCV infection may promote FoxO1 activation by a

2pronged mechanism, wherein diminished insulin signaling results in dephosphorylation of the Akt sites in FoxO1, allowing its reentry into the nucleus (12;

25). In addition, HCVinduced expression of HDAC9 may cause deacetylation of nuclear FoxO1, enhancing FoxO1 DNAbinding activity and association with gluconeogenic gene promoters, thereby enhancing the transcription of ratecontrolling gluconeogenic enzymes. HDAC9knockdown in both hepatic cells and HCV replicon cells resulted in increased acetylation and phosphorylation of endogenous FoxO1 (Fig.

4B and Supplementary Fig. 4C). These results support the observation that FoxO acetylation renders FoxO phosphorylation sites more accessible to Akt and other

22 Page 23 of 53 Diabetes

inactivating kinases (35). Our findings therefore suggest a mechanism by which

aberrant HDAC9 induction may contribute to the development of HCVinduced

glucose homeostasis abnormality.

Our recent study showed that transgenic ICR mice expressing both the human CD81

and occludin genes (C/OTg) are permissive to HCV infection (19). Persistent HCV

infection in this mice model further exhibited disease manifestations, including

chronic viral hepatitis, steatosis, and fibrosis. Herein, we report that persistent

hepatitis C virus infection in this model also resulted in insulin resistance and

hyperglycemia, as reported in HCVinfected chronic patients (Supplementary Table 2

and 3). Furthermore, both HDAC9 expression levels and gluconeogenic activity were

elevated in liver tissues from chronic HCVinfected rodent models and HCVinfected

patients. Thus, HCV infection may lead to abnormal glucose homeostasis through

HDAC9 upregulation which results in deacetylation of nuclear FoxO1, enhancement

of FoxO1 DNAbinding activity and association with gluconeogenic gene promoters,

and finally increased hepatic gluconeogenesis. This potential mechanism indicates

that HDAC9 may be potential therapeutic targets for suppressing hepatic

gluconeogenesis and lowering blood glucose, and smallmolecule inhibitors of class

I/IIa HDACs may be useful as HCVassociated T2DM therapeutics. Currently, several

panHDAC inhibitors are in phase I–III clinical trials. Vorinostat, the first HDAC

inhibitor developed, has already been approved for treatment of a malignant disease

(36; 37). The potential utility of HDAC inhibitors for treating metabolic disease

23 Diabetes Page 24 of 53

therefore merits consideration.

24 Page 25 of 53 Diabetes

ACKNOWLEDGEMENTS

We are grateful to Drs T Wakita (National Institute of Infectious Diseases, Japan) for

pJFH1 clone, F Chisari (The Scripps Research Institute) for HuH7.5.1 cell line, and

C Rice (The Rockefeller University) for NS5A antibody. This work was supported by

grants from the National Natural Sciences Foundation of China [grant number

81271828, 31101011, 31271268], the National Basic Research Program of China

[grant number 2015CB554304], and a Project Funded by the Priority Academic

Program Development of Jiangsu Higher Education. The authors who have taken part

in this study declared that they do not have anything to disclose regarding funding or

conflict of interest with respect to this manuscript.

The authors who have taken part in this study declared that they do not have anything

to disclose regarding funding or conflict of interest with respect to this manuscript.

The study was designed by Q.W. and JZ.C.; Experiments in HCVinfected cells were

performed by JZ.C., M.D. and M.G.. Experiments in replicon cells were performed by

Q.W. and N.W.. Patients’ studies were performed by JZ.C., XM.C, Y.P., J.J..

Transgenic mice and animal study was performed by JZ.C., Z.Y., ZY.Z, C.Z.

Experimental analysis was performed by Q.W., XW.C., JZ.C., Z.L., X.H., H.T., DL.

Y., and JQ. N.; and the manuscript was written by Q.W.. Q.W. is the guarantor of this

work and, as such, had full access to all the data in the study and takes responsibility

for the integrity of the data and the accuracy of the data analysis.

25 Diabetes Page 26 of 53

REFERENCES

1. Lauer GM, Walker BD: Hepatitis C virus infection. N Engl J Med 2001;345:4152

2. Magiorkinis G, Magiorkinis E, Paraskevis D, Ho SY, Shapiro B, Pybus OG, Allain

JP, Hatzakis A: The global spread of hepatitis C virus 1a and 1b: a phylodynamic and phylogeographic analysis. PLoS medicine 2009;6:e1000198

3. Agnello V, De Rosa FG: Extrahepatic disease manifestations of HCV infection: some current issues. J Hepatol 2004;40:341352

4. Lecube A, Hernandez C, Genesca J, Simo R: Glucose abnormalities in patients with hepatitis C virus infection: Epidemiology and pathogenesis. Diabetes Care

2006;29:11401149

5. Allison ME, Wreghitt T, Palmer CR, Alexander GJ: Evidence for a link between hepatitis C virus infection and diabetes mellitus in a cirrhotic population. J Hepatol

1994;21:11351139

6. White DL, Ratziu V, ElSerag HB: Hepatitis C infection and risk of diabetes: a systematic review and metaanalysis. J Hepatol 2008;49:831844

7. Mason AL, Lau JY, Hoang N, Qian K, Alexander GJ, Xu L, Guo L, Jacob S,

Regenstein FG, Zimmerman R, Everhart JE, Wasserfall C, Maclaren NK, Perrillo RP:

Association of diabetes mellitus and chronic hepatitis C virus infection. Hepatology

1999;29:328333

8. Vanni E, Abate ML, Gentilcore E, Hickman I, Gambino R, Cassader M, Smedile A,

Ferrannini E, Rizzetto M, Marchesini G, Gastaldelli A, Bugianesi E: Sites and mechanisms of insulin resistance in nonobese, nondiabetic patients with chronic

26 Page 27 of 53 Diabetes

hepatitis C. Hepatology 2009;50:697706

9. Zhang W, Patil S, Chauhan B, Guo S, Powell DR, Le J, Klotsas A, Matika R, Xiao

X, Franks R, Heidenreich KA, Sajan MP, Farese RV, Stolz DB, Tso P, Koo SH,

Montminy M, Unterman TG: FoxO1 regulates multiple metabolic pathways in the

liver: effects on gluconeogenic, glycolytic, and lipogenic gene expression. J Biol

Chem 2006;281:1010510117

10. Puigserver P, Rhee J, Donovan J, Walkey CJ, Yoon JC, Oriente F, Kitamura Y,

Altomonte J, Dong H, Accili D, Spiegelman BM: Insulinregulated hepatic

gluconeogenesis through FOXO1PGC1alpha interaction. Nature 2003;423:550555

11. Bernsmeier C, Calabrese D, Heim MH, Duong HT: Hepatitis C virus dysregulates

glucose homeostasis by a dual mechanism involving induction of PGC1alpha and

dephosphorylation of FoxO1. J Viral Hepat 2014;21:918

12. Deng L, Shoji I, Ogawa W, Kaneda S, Soga T, Jiang DP, Ide YH, Hotta H:

Hepatitis C virus infection promotes hepatic gluconeogenesis through an

NS5Amediated, FoxO1dependent pathway. J Virol 2011;85:85568568

13. Calnan DR, Brunet A: The FoxO code. Oncogene 2008;27:22762288

14. Yang XJ, Gregoire S: Class II histone deacetylases: from sequence to function,

regulation, and clinical implication. Mol Cell Biol 2005;25:28732884

15. Sun Z, Miller RA, Patel RT, Chen J, Dhir R, Wang H, Zhang D, Graham MJ,

Unterman TG, Shulman GI, Sztalryd C, Bennett MJ, Ahima RS, Birnbaum MJ, Lazar

MA: Hepatic Hdac3 promotes gluconeogenesis by repressing lipid synthesis and

sequestration. Nat Med 2012;18:934942

27 Diabetes Page 28 of 53

16. Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM, Puigserver P: Nutrient control of glucose homeostasis through a complex of PGC1alpha and SIRT1. Nature

2005;434:113118

17. Mihaylova MM, Vasquez DS, Ravnskjaer K, Denechaud PD, Yu RT, Alvarez JG,

Downes M, Evans RM, Montminy M, Shaw RJ: Class IIa histone deacetylases are hormoneactivated regulators of FOXO and mammalian glucose homeostasis. Cell

2011;145:607621

18. Pei R, Zhang X, Xu S, Meng Z, Roggendorf M, Lu M, Chen X: Regulation of hepatitis C virus replication and gene expression by the MAPKERK pathway. Virol

Sin 2012;27:278285

19. Chen J, Zhao Y, Zhang C, Chen H, Feng J, Chi X, Pan Y, Du J, Guo M, Cao H,

Wang Z, Pei R, Wang Q, Pan L, Niu J, Chen X, Tang H: Persistent hepatitis C virus infections and hepatopathological manifestations in immunecompetent humanized mice. Cell Res 2014;24:10501066

20. Han Q, Xu C, Wu C, Zhu W, Yang R, Chen X: Compensatory mutations in NS3 and NS5A proteins enhance the virus production capability of hepatitis C reporter virus. Virus Res 2009;145:6373

21. Wang Q, Chen J, Wang Y, Han X, Chen X: Hepatitis C virus induced a novel apoptosislike death of pancreatic beta cells through a caspase 3dependent pathway.

PLoS One 2012;7:e38522

22. She P, Shiota M, Shelton KD, Chalkley R, Postic C, Magnuson MA:

Phosphoenolpyruvate carboxykinase is necessary for the integration of hepatic energy

28 Page 29 of 53 Diabetes

metabolism. Mol Cell Biol 2000;20:65086517

23. Crapo PA, Kolterman OG, Henry RR: Metabolic consequence of twoweek

fructose feeding in diabetic subjects. Diabetes Care 1986;9:111119

24. Fischle W, Dequiedt F, Hendzel MJ, Guenther MG, Lazar MA, Voelter W, Verdin

E: Enzymatic activity associated with class II HDACs is dependent on a multiprotein

complex containing HDAC3 and SMRT/NCoR. Mol Cell 2002;9:4557

25. Banerjee A, Meyer K, Mazumdar B, Ray RB, Ray R: Hepatitis C virus

differentially modulates activation of forkhead transcription factors and

insulininduced metabolic gene expression. J Virol 2010;84:59365946

26. Crunkhorn S: Metabolic disease: New role for HDACs in glucose homeostasis.

Nat Rev Drug Discov 2011;10:492

27. de Zoeten EF, Wang L, Sai H, Dillmann WH, Hancock WW: Inhibition of

HDAC9 increases T regulatory cell function and prevents colitis in mice.

Gastroenterology 2010;138:583594

28. Chatterjee TK, Basford JE, Knoll E, Tong WS, Blanco V, Blomkalns AL, Rudich

S, Lentsch AB, Hui DY, Weintraub NL: HDAC9 knockout mice are protected from

adipose tissue dysfunction and systemic metabolic disease during high fat feeding.

Diabetes 2013;

29. Vial G, Dubouchaud H, Couturier K, CottetRousselle C, Taleux N, Athias A,

Galinier A, Casteilla L, Leverve XM: Effects of a highfat diet on energy metabolism

and ROS production in rat liver. J Hepatol 2011;54:348356

30. MatsuzawaNagata N, Takamura T, Ando H, Nakamura S, Kurita S, Misu H, Ota

29 Diabetes Page 30 of 53

T, Yokoyama M, Honda M, Miyamoto K, Kaneko S: Increased oxidative stress precedes the onset of highfat dietinduced insulin resistance and obesity. Metabolism

2008;57:10711077

31. Shimazu T, Hirschey MD, Newman J, He W, Shirakawa K, Le Moan N, Grueter

CA, Lim H, Saunders LR, Stevens RD, Newgard CB, Farese RV, Jr., de Cabo R,

Ulrich S, Akassoglou K, Verdin E: Suppression of oxidative stress by betahydroxybutyrate, an endogenous histone deacetylase inhibitor. Science

2013;339:211214

32. Miura K, Taura K, Kodama Y, Schnabl B, Brenner DA: Hepatitis C virusinduced oxidative stress suppresses hepcidin expression through increased histone deacetylase activity. Hepatology 2008;48:14201429

33. Grozinger CM, Schreiber SL: Regulation of histone deacetylase 4 and 5 and transcriptional activity by 1433dependent cellular localization. Proc Natl Acad Sci

U S A 2000;97:78357840

34. Nishino TG, Miyazaki M, Hoshino H, Miwa Y, Horinouchi S, Yoshida M: 1433 regulates the nuclear import of class IIa histone deacetylases. Biochem Biophys Res

Commun 2008;377:852856

35. Qiang L, Banks AS, Accili D: Uncoupling of acetylation from phosphorylation regulates FoxO1 function independent of its subcellular localization. J Biol Chem

2010;285:2739627401

36. Witt O, Deubzer HE, Milde T, Oehme I: HDAC family: What are the cancer relevant targets? Cancer Lett 2009;277:821

30 Page 31 of 53 Diabetes

37. Walkinshaw DR, Yang XJ: Histone deacetylase inhibitors as novel anticancer

therapeutics. Curr Oncol 2008;15:237243

31 Diabetes Page 32 of 53

FIGURE LEGENDS

Figure 1. HDAC9 expression and PEPCK enzymatic activity is upregulated in liver biopsies from HCV-infected patients. Box plot diagram showing the HDAC9 mRNA (A), PEPCK mRNA (D) levels and PEPCK enzymatic activity (E) in liver biopsies of 10 normal control patients and 38 patients with chronic hepatitis C.

Representative example of a western blot of HDAC9 showing samples of liver biopsy homogenate from normal control and HCV patients (B). Positive correlation between

HDAC9 mRNA levels in liver and PEPCK mRNA levels in liver (C), HCV virus load in liver (F), PEPCK enzymatic activity in liver (G), or HOMAIR score (H). Data are represented as mean ± SEM.

Figure 2. HCV infection upregulates host HDAC9 expression. HCV RNA,

HDAC9 mRNA (A), and HDAC9 protein (B) levels in mock or

HCVinfectedHuH7.5.1 cells at indicated multiplicities of infection (MOI) and time points (Hours post infection, hpi). HCV RNA, HDAC9 mRNA (C), and HDAC9 protein (D) levels in H77, CON1, and SGR cells, compared with HuH7.5.1 control cells. HCV RNA and relative intracellular HDAC9 mRNA (E) and HDAC9 protein levels (F) in mock or HCVinfected (1.0 MOI)cells treated with 2mAde (10 mM, 96 h). HCV RNA and relative intracellular HDAC9 mRNA levels (G) and HDAC9 protein levels (H) in mock or HCVinfected (1.0 MOI)cells pretransfected with

HDAC9 siRNAs for 48 h at 96 hpi. Data are represented as mean ± SEM. # indicates undetectable levels. *p<0.05; **p<0.001.

32 Page 33 of 53 Diabetes

Figure 3. HDAC9 mediates HCV-dependent gluconeogenesis. Relative

intracellular PEPCK mRNA (A) and protein (B) levels in mock or

HCVinfectedHuH7.5.1 cells at indicated MOI and time points. Relative intracellular

PEPCK mRNA levels (C) and cellular glucose production (D) in mock or HCV

J399EMinfected HuH7.5.1 cells treated with 2mAde (10 mM, 96 h), NaB (10 mM,

72 h), or TSA (400 nM, 24 h), respectively. Relative intracellular PEPCK mRNA

levels (E), protein levels (F), and cellular glucose production (G) as in Figure 2G.

Data are represented as mean ± SEM. *p<0.05; **p<0.001.

Figure 4. HDAC9-dependent FoxO1 acetylation is involved in HCV-induced

gluconeogenesis. FoxO1 and acetylFoxO1 (AcFoxO1) protein levels in mock or

HCV J399EMinfected (1.0 MOI) HuH7.5.1 cells treated with 2mAde (10 mM) for

96 h (A). HDAC9, FoxO1, AcFoxO1, and phosphoFoxO1 (PFoxO1, Ser256)

protein levels in HuH7.5.1 cells transfected with HDAC9 siRNAs (B). HDAC9,

FoxO1, AcFoxO1, and HDAC3 protein levels in whole cell lysate (WCL) or

cytoplasmic and nuclear fractions from mock or HCVinfected (1.0 MOI)cells

pretransfected with combination of siHDAC92 + 3 + 4 for 48 h at 96 hpi (C). (D)

Endogenous HDAC9 (second panel), FoxO1 (third panel), or HDAC3 (forth panel)

was immunoprecipitated from mock or HCV J399EM (1.0 MOI)infected cell lysates,

and immunoblotted with indicated antibodies. The whole cell lysate for

immunoprecipitation was trisected and immunoblotted with indicated antibodies (first

33 Diabetes Page 34 of 53

panel). GoatantirabbitIgG or Rabbitantimouse was used as the negative control.

(G) Endogenous FoxO1 protein was detected by immunofluorescence in mock or

HCV J399EMinfected (1.0 MOI) HuH7.5.1 cells treated with 2mAde, NaB, TSA, or

HDAC9 siRNA, repectively. Scale bars: 10 µm.

Figure 5. HDAC9 upregulation induced exaggerated gluconeogenic response in persistent HCV-infected mice. Male and female chronic HCVinfected C/OTg mice

(1 mpi) and mockinfected mice were fasted overnight. Blood glucose was monitored following intraperitoneal administration of glucose (2.0 g/kg, A), insulin (0.5 U/kg, B), or pyruvate (2.0 g/kg, C). Total AUC is expressed as mean SEM relative to average mockinfected control values. (n=6–12) (D) PEPCK enzymatic activity in liver after

C/OTg mice infected with HCV J399EM for the indicated time. Mockinfected C/OTg control mice were collected from different time post infection at random. (n=3–7). (E)

Intracellular HDAC9 mRNA levels in liver of C/OTg mice mockinfected or infected with HCV J399EM for the indicated time. (n=3–6). (F) HDAC9, FoxO1, and

AcFoxO1 protein levels as in Figure 5D. The data shown are representative of three independent experiments. Line charts below represent densitometric analysis performed to quantify the relative intensity of HDAC9, AcFoxO1/FoxO1 immunoreactive bands detected by western immunoblotting. HCV RNA and intracellular HDAC9 mRNA levels (G) and HDAC9, FoxO1, AcFoxO1, and

PFoxO1 (Ser256) protein levels (H) in HCV (1.0 MOI) infected C/OTg primary hepatocytes at indicated times. Data are represented as mean ± SEM. *p<0.05;

34 Page 35 of 53 Diabetes

**p<0.001.

35 Diabetes Page 36 of 53

Page 37 of 53 Diabetes

Diabetes Page 38 of 53

Page 39 of 53 Diabetes

Diabetes Page 40 of 53

Page 41 of 53 Diabetes

Supplementary Figures

Diabetes Page 42 of 53

Supplementary Figure 1. HCV infection upregulates host HDAC9 expression.

HCV RNA (A), and HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC7,

HDAC9, HDAC11, and SIRT1 mRNA (B) and HDAC1, HDAC2, HDAC3, HDAC4,

HDAC5, HDAC6, HDAC7, HDAC9, and SIRT1 protein (C) levels in mock- or

HCV-infected-HuH7.5.1 cells at indicated multiplicities of infection (MOI) and time points (Hours post infection, hpi). All antibodies were purchased from Cell Signaling

Technology (HDAC1, HDAC2, HDAC3, HDAC6, 9928; SIRT1, 8469) or Abcam

(HDAC4, ab12172, HDAC5, ab1439, HDAC7, ab12174). Data are represented as mean ± SEM. *p<0.05; **p<0.001. NS indicates no significant difference.

Page 4 of 533 Diabetes

Diabetes Page 44 of 53

Supplementary Figure 2. HCV infection upregulates host HDAC9 expression. (A)

HDAC9 protein levels in HCV J399EM-infected (0.01 and 0.1 MOI) or mock-infected HuH7.5.1 cells at indicated time points (Hours post infection, hpi).

(B-C) HCV RNA, relative intracellular HDAC9 mRNA (B), HDAC9 protein, and

NS3 protein (C) levels in HuH7.5.1 and SGR cells treated with 2mAde (10 mM, 96 h).

(D-E) Relative intracellular HDAC9 mRNA levels (D) and HDAC9 protein levels (E) in HuH7.5.1 cells transfected with HDAC9 siRNA for 48 h. (F-G) Relative intracellular HDAC9 mRNA (F) and HDAC9 protein levels (G) in HuH7.5.1 and SGR cells transfected with specific HDAC9 siRNA for 48 h. (H-I) HCV J399EM-infected

(0.1 MOI) or mock-infected HuH7.5.1 cells were treated with NaB (10 mM, 72 h),

TSA (400 nM, 24 h), respectively. HCV RNA (H) and NS3 protein (I) levels in cells.

Data are represented as mean ± SEM. # indicates undetectable levels. *p<0.05;

**p<0.001. Page 45 of 53 Diabetes

Diabetes Page 46 of 53

Supplementary Figure 3. HDAC9 mediates HCV-dependent gluconeogenesis. (A)

PEPCK protein levels in HCV J399EM-infected or mock-infected HuH7.5.1 cells at the indicated MOI and time points (Hours post infection, hpi). (B) Relative intracellular G6PC mRNA levels in HCV J399EM-infected or mock-infected

HuH7.5.1 cells at the indicated MOI and time points. (C) Relative intracellular G6PC mRNA levels in HCV J399EM-infected or mock-infected HuH7.5.1 cells treated with

2mAde (10 mM, 96 h), NaB (10 mM, 72 h), TSA (400 nM, 24 h), respectively. (D-E)

PEPCK mRNA levels (D) and cellular glucose production normalized to total cellular protein content (E) in HuH7.5.1 and SGR cells treated with 2mAde. (F) HuH7.5.1 cells were pretransfected with siRNA for 48 h. Relative intracellular G6PC mRNA levels in mock-infected cells or cells infected with HCV J399EM (1.0 MOI) at 96 hpi.

(G-H) PEPCK mRNA levels (G) and cellular glucose production normalized to total cellular protein content (H) in HuH7.5.1 and SGR cells transfected with siHDAC9. (I)

Cellular glucose production normalized to total cellular protein content in mock or

HCV J399EM (1.0 MOI)-infected HDAC9 shRNA cells at 96 hpi. Data are represented as mean ± SEM. *p<0.05; **p<0.001. Page 47 of 53 Diabetes

Diabetes Page 48 of 53

Supplementary Figure 4. HDAC9 controls acetylation of FoxO1. (A) HDAC9,

FoxO1, acetyl-FoxO1 (Ac-FoxO1), PEPCK, NS3 protein levels in mock infected-

(left panel), or HCV J399EM (1.0 MOI)-infected (right panel) HDAC9 shRNA cells at 96 hpi. (B) FoxO1 and acetyl-FoxO1 (Ac-FoxO1) protein levels in HuH7.5.1 and

SGR cells treated with 2mAde (10 mM) for 96 h. (C) FoxO1, Ac-FoxO1, phospho-FoxO1 (P-FoxO1), and NS3 protein levels in HuH7.5.1 and SGR cells transfected with siHDAC9. (D) Endogenous FoxO1, HDAC9, NS5A protein was detected by immunofluorescence in mock-infected HuH7.5.1 cells treated with NaB,

TSA, or siHDAC9, repectively. Scale bars: 10 µm. (E) Endogenous FoxO1, HDAC9,

NS5A protein was detected by immunofluorescence in HCV J399EM (1.0

MOI)-infected HDAC9 shRNA cells. Page 49 of 53 Diabetes

Supplementary Figure 5. HDAC9, FoxO1, and Ac-FoxO1 protein levels in liver of

mock-infected C/OTg mice for the indicated time. Histograms below represent

densitometric analysis performed to quantify the relative intensity of HDAC9-,

Ac-FoxO1/FoxO1-immunoreactive bands detected by western immunoblotting. Diabetes Page 50 of 53

Supplementary Figure 6. Oxidative stress contributes to HDAC9 induction and gluconeogenesis in HCV infected cells. (A-C) Levels of HCV RNA and HDAC9 mRNA (A), HDAC9 protein (B), and cellular glucose production (C) in HCV

J399EM-infected (1.0 MOI) or mock-infected HuH7.5.1 cells treated with or without

N-acetyl-L-cysteine (NAC). (D-F) Levels of HCV RNA and HDAC9 mRNA (D),

HDAC9 protein (E), and cellular glucose production (F) in HuH7.5.1 and SGR cells treated with or without NAC. Data are represented as mean ± SEM. *p<0.05;

**p<0.001. Page 51 of 53 Diabetes

Supplementary Tables

Supplementary Table 1. Primers and siRNA used in this study.

Strand/Gene Primer Sequence(5’-3’) HDAC9 (human) HDAC9F GCTGGTGGAGTTCCCTTACA HDAC9R GCAGACTGGGTTCGGTTCA PEPCK (human) PEPCKF TGAGATCAGAGGCCACAGC PEPCKR GCCAGGTATTTGCCGAAG FoxO1 (human) FOXO1F GAGGGTTAGTGAGCAGGTTAC FOXO1R AGTCCTTATCTACAGCAGCAC HCV (human) HCVF CCCTATCAGGCAGTACCACAAGG HCVR ACCTGCCCCTAATAGGGGCG Actin (human) ActinF GAAATCGTGCGTGACATTAA ActinR AAGGAAGGCTGGAAGAGTG G6PC (human) G6PCF CCTCAGGAATGCCTTCTACG G6PCR TCTCCAATCACAGCTACCCA hdac9 (mouse) HDAC9MF GCTGGTGGAGTTCCATTACA HDAC9MR GCAGACTGGGTTCGATTCA actin (mouse) ActinMF GAAATTGTTCGTGACATAAA ActinMR AAGGAAGGCTGGAAGAGTG siHDAC9-1 AAAGACACCCAACAAAATT siHDAC9-2 CAGCAACGCATTCTAATTCAT siHDAC9-3 CCAACTGGAAGTGTTACTGAA siHDAC9-4 TTGGCTCAGCTGGTCATTCAA siHDAC9-5 CAGCAACGAAAGACACTCCAA HCV siRNA GGUCUCGUAGACCGUGCAC

Diabetes Page 52 of 53

Supplementary Table 2. Information pertaining to the mice used in Figure 5.

Blood Liver PEPCK Glucose Insulin C-peptide HOMA hdac9 Gender Age Timepoint IU/mL IU/mg (mU/mg (mmol/L) （mIU/L) (pg/ml) -IR (fold) (Log10) (Log10) protein) 1 F 7 w mock # # 4.2 8.05 1402.07 1.5 1.42 5.9 2 F 9 w mock # # 4.4 9.24 1306.41 1.81 1.29 4.2 3 F 11 w mock # # 5 8.34 1086.75 1.85 0.76 3.1 4 F 15w mock # # 4.7 9.68 963.72 2.02 1.12 6.7 5 F 42 w mock # # 4.9 11.86 1057.5 2.58 0.74 6.4 6 M 7 w mock # # 4.8 10.03 1017.06 2.14 1.01 7.1 7 M 9 w mock # # 5.2 10.2 1156.86 2.36 0.84 3.5 8 M 11 w mock # # 4.4 6.41 788.78 1.25 1.24 4.4 9 M 15 w mock # # 4.2 10.9 949.44 2.03 0.68 3.9 10 M 30 w mock # # 5.2 7.21 773.61 1.67 0.84 4.7 11 M 30 w mock # # 4.8 9.17 841.36 1.96 0.89 5.2 12 M 42 w mock # # 4 8.55 988.78 1.52 1.16 6.1 13 F 7 w 2d 6.53 4.94 5 8.98 543.86 2 4.01 14 F 7 w 2d 6.23 4.99 4 14.47 2304.18 2.57 3.16 15 M 7 w 2d 5.75 4.55 4.5 12.72 1901.19 2.54 1.29 16 M 7 w 2d 5.87 4.59 4.5 12.05 1367.92 2.41 4.07 17 F 7 w 4d 5.45 4.7 5.5 10.9 1098.91 2.66 1.84 18 F 7 w 4d 5.65 4.62 4.4 10.68 1255.34 2.09 0.24 19 M 7 w 4d 5.01 4.25 7 10.32 979.72 3.21 2.94 20 M 7 w 4d 4.9 4.16 7.2 13.77 1887.11 4.41 0.84 21 F 8 w 1w 5.11 4.3 4.4 8.05 1539.54 1.57 0.24 22 F 8 w 1w 5.08 4.15 5 9.24 1681.86 2.05 0.46 23 F 8 w 1w 4.29 4.7 8.34 1633.68 1.74 0.35 24 M 8 w 1w 3.89 4.11 4.9 9.68 1454.41 2.11 0.67 25 M 8 w 1w 3.5 5.08 4.8 11.86 2048.44 2.53 0.8 26 M 8 w 1w 5 5.1 12.04 1937.82 2.73 0.35 27 F 9 w 2w 4.79 3.78 5.4 8.72 1397.58 2.09 0.68 11 28 F 9 w 2w 4.82 3.63 4.9 12.34 1512.22 2.69 2.06 11.3 29 F 9 w 2w 3.78 4.8 6.88 990.93 1.47 0.15 6.6 30 M 9 w 2w 4.84 3.68 5.2 10.02 1233.72 2.31 0.68 9.4 31 M 9 w 2w 4.86 3.76 6.1 19.81 2289.44 5.37 1.55 11.3 32 M 9 w 2w 3.65 7.5 18.55 1938.76 6.18 1.47 8.2 33 F 11 w 1m 4.07 3.65 7 19.77 2483.21 4.13 4.78 8.8 34 F 11 w 1m 3.97 3.68 4.6 10.94 1517.38 2.24 3.13 11.8 35 M 11 w 1m 3.54 3.77 5.2 6.95 810.96 1.61 1.14 22.1 36 M 11 w 1m 3.5 3.57 4.74. 8.34 1050.29 1.74 3.43 8 37 M 11 w 1m 4.39 3.57 7.1 4.57 597.3 1.44 2.43 12.3 38 F 11 w 1m 4.43 3.33 7 13.05 2089.06 4.06 3.78 11.4 39 M 11 w 1m 4.73 3.87 6.5 10.68 1233.3 3.09 2.5 9.7 40 M 11 w 1m 4.47 4.11 5.3 22.12 2227.02 5.21 4.57 11.2 41 F 15 w 2m 4.12 3.11 4.3 14.35 1022.42 2.74 3.49 11.6 42 M 15 w 2m 3.89 3.77 4.2 6.48 839.08 1.21 4.57 17.1 43 M 15 w 2m 3.5 3.11 4.1 16.31 1625.73 2.97 2.34 19.1 44 M 15 w 2m 3.46 3.67 8.6 10.86 1416.79 4.15 3.48 18 45 F 30 w 6m 3.09 4.13 7.7 16.07 1948.49 5.5 4.01 19.7 46 M 30 w 6m 3.18 3.9 7.6 12.72 1554.61 4.3 4.44 21.8 47 M 42 w 10m 3.17 4.11 10 9.24 1270.89 4.11 4.32 17.4 48 M 42 w 10m 3.2 4.19 8.2 15.58 1257.88 5.68 4.56 20

Page 53 of 53 Diabetes

Supplementary Table 3. Patients and liver biopsy data.

Blood Liver PEPCK Glucose Insulin C-peptide HOMA- Hdac9 Pepck Gender BMI IU/mL IU/mg (mU/mg (mmol/L) (mIU /L) (pg/ml) IR (fold) (fold) (Log10) (Log10) protein) 1 F 23.48 N N 4.30 8.06 1002.07 1.54 1.00 1.00 5.90 2 F 30.86 N N 5.12 7.26 863.71 1.65 1.25 1.12 3.10 3 F 20.73 N N 3.89 8.34 1169.29 1.44 1.74 0.74 6.70 4 F 35.06 N N 4.90 7.20 920.46 1.57 0.65 0.84 3.50 5 F 26.68 N N 5.02 8.16 1003.40 1.82 0.54 1.15 4.70 6 M 29.02 N N 4.46 8.55 1125.90 1.69 1.05 1.22 3.90 7 M 34.20 N N 4.29 13.38 1209.80 2.55 0.69 0.77 5.00 8 M 24.24 N N 4.17 10.19 1019.04 1.89 0.57 0.85 4.40 9 M 22.18 N N 4.05 6.40 960.74 1.15 1.21 1.05 3.20 10 M 22.68 N N 3.84 10.89 1488.78 1.86 1.37 1.23 5.10 11 F 24.24 6.53 8.12 5.76 11.68 1634.50 2.99 8.34 3.34 13.00 12 F 27.06 6.23 8.23 6.70 11.85 1573.61 3.53 7.85 2.85 12.30 13 F 24.22 5.75 8.39 10.60 12.03 1823.76 5.66 12.46 4.01 21.80 14 F 28.89 5.87 8.65 5.30 15.70 1388.30 3.67 6.79 2.89 17.60 15 F 26.95 6.08 8.04 5.80 25.25 2569.92 6.52 9.47 3.46 19.70 16 F 23.53 6.59 8.19 4.00 15.21 1543.86 2.71 6.66 2.99 12.40 17 M 24.26 5.63 8.63 5.20 12.42 1304.18 2.90 8.74 4.00 9.90 18 M 20.28 5.39 8.42 5.40 19.66 2001.65 4.71 10.48 3.37 15.30 19 M 24.22 6.42 8.00 4.07 10.41 2006.37 1.88 6.77 3.01 8.70 20 M 20.83 6.03 8.14 6.40 28.82 3399.21 8.15 14.38 5.01 14.30 21 M 25.61 5.81 8.38 6.10 9.83 1483.26 2.67 9.23 3.00 9.60 22 M 24.80 6.68 8.19 4.10 8.63 1073.24 1.58 7.41 2.89 14.50 23 F 24.49 6.41 8.16 4.60 10.81 952.62 2.22 8.55 3.42 13.00 24 M 24.49 6.58 8.10 4.00 13.60 1345.64 2.39 7.82 2.55 12.30 25 M 21.13 6.61 8.33 7.00 28.99 4248.51 9.07 11.79 4.32 21.80 26 F 17.96 7.00 8.64 5.70 16.07 1997.16 4.05 11.43 2.56 17.60 27 F 23.81 6.67 8.75 5.50 16.07 1779.60 3.90 6.65 3.67 19.70 28 F 23.44 6.41 8.09 6.70 22.72 3638.61 6.78 14.76 3.06 6.30 29 M 18.37 6.51 8.43 4.30 17.24 1771.91 3.26 6.44 4.00 7.40 30 F 23.26 6.65 7.80 5.00 9.52 1143.97 2.12 5.32 3.37 6.60 31 M 18.37 6.53 8.13 5.40 15.52 2980.46 3.76 9.77 3.01 11.10 32 M 23.74 5.75 8.37 5.10 8.97 1955.33 2.04 6.67 3.01 7.90 33 F 20.55 5.87 8.81 9.50 18.22 1598.91 7.73 5.49 2.88 8.40 34 F 22.89 4.83 7.04 4.60 11.22 887.11 2.30 4.31 1.22 6.30 35 M 22.49 6.68 8.30 5.50 14.46 1239.89 3.53 8.87 2.13 9.40 36 M 31.11 6.99 8.37 7.50 6.09 1281.86 2.05 7.96 1.98 10.20 37 M 27.34 6.89 8.17 6.50 35.42 3220.94 10.28 10.45 4.55 11.30 38 M 22.15 6.37 8.28 7.00 25.22 2383.44 7.91 9.96 3.14 9.60 39 M 20.76 5.08 8.14 7.10 21.90 2896.86 6.91 11.23 5.22 8.00 40 M 20.01 4.99 7.87 5.30 6.80 869.48 1.60 8.74 3.22 5.50 41 M 25.39 6.74 8.93 6.30 15.54 1833.70 4.37 5.34 2.78 7.90 42 M 29.41 4.89 6.30 6.60 22.14 2274.35 6.47 5.44 2.02 7.10 43 M 19.38 4.94 6.37 4.80 28.99 3325.84 6.21 6.67 1.98 6.70 44 M 27.43 5.08 7.39 7.20 23.45 2691.70 7.46 5.49 3.15 6.60 45 M 18.34 5.03 7.65 5.60 13.69 1836.55 3.39 7.23 4.55 8.00 46 M 27.68 4.98 6.14 5.80 20.49 1907.86 5.31 4.31 3.56 5.90 47 M 19.84 5.16 7.26 7.50 15.68 1304.51 5.22 8.45 4.32 6.20 48 M 24.49 5.20 6.38 6.40 14.56 1112.68 4.12 4.41 3.41 7.40 BMI = weight (kg) / height (m) square