Phenotypes of Salmonella Sdia in Mice and Pigs

Phenotypes of Salmonella sdiA in Mice and Pigs

DISSERTATION

Presented in partial fulfillment of the requirements for the degree Doctor of Philosophy in the Graduate School of The Ohio State University

Matthew Charles Swearingen, M.S. The Ohio State University Graduate Program in Microbiology The Ohio State University 2013

Dissertation Committee:

Associate Professor Brian Ahmer, Ph.D., Thesis Advisor Professor John Gunn, Ph.D. Professor Daniel Wozniak. Ph.D. Assistant Professor Sheryl Justice, Ph.D.

Abstract

Bacteria of the Salmonella genera encode a solo LuxR homolog, SdiA, capable of detecting N-acylhomoserine lactone molecules (acyl-HSLs) produced by other bacteria. In response to acyl-HSLs, SdiA activates seven putative host- interaction genes, however, it is unclear if acyl-HSLs exist in mammalian intestines. Previously, we demonstrated that Salmonella enterica serovar

Typhimurium could detect Yersinia enterocolitica acyl-HSLs through SdiA in the mouse gut, but acyl-HSL detection did not result in an sdiA fitness phenotype.

We attempted to study sdiA phenotypes modeling S. Typhimurium – Y. enterocolitica co-infections in conventional pigs because pigs are a known reservoir of both Salmonella and Yersinia. We measured SdiA activity using an

S. Typhimurium in vivo reporter system (RIVET) during an S. Typhimurium – Y. enterocolitica co-infection, and observed SdiA activity occurring in pig mesenteric lymph node samples (MLN). We did not, however, observe an sdiA fitness phenotype. We probed the Human Microbiome Project (HMP) gene catalog and

reviewed the literature for gut-commensal organisms with the potential to produce acyl-HSLs. We found that Hafnia alvei, Edwardsiella tarda, a Ralstonia species (HMP), and Acinetobacter baumannii, Citrobacter rodentium,

Pseudomonas aeruginosa, and Serratia odorifera (literature) all encode LuxI homologs. The human gut microbiome is biologically diverse and densely populated, but the Proteobacteria comprise ≤ 4% of the community. Disturbances in the gut community, however, result in a shift in the community that favors a bloom of proteobacterial species. Indeed, Salmonella-induced gut inflammation results in a proteobacterial bloom. Conventional mice are useful for studying invasive salmonellosis, but do not develop gastroenteritis after S. Typhimurium infection. However, germ-free mice colonized with human gut flora are susceptible to Salmonella infection, and do develop cecal inflammation. Thus, we hypothesized that SdiA detects the commensal proteobacteria bloom that occurs during Salmonella -induced inflammation. To test this hypothesis, we orally gavaged germ-free Swiss Webster mice with the feces of a healthy human donor, and infected them with the S. Typhimurium RIVET reporter. We did not detect SdiA activity in humanized mice, suggesting that acyl-HSLs were not present in the humanized mouse gut. We are currently investigating SdiA activity in mice during Salmonella-induced inflammation in a long-term persistence model in CBA/J mice. We tested the hypothesis that Salmonella-induced inflammation, which causes a proteobacterial bloom, would lead to the overgrowth of proteobacterial members that synthesize acyl-HSLs, and that SdiA would detect the quorum sensing molecules. Using a srgE-tnpR RIVET, we have iii

indeed observed SdiA activity for WT Salmonella recovered in the feces of CBA/J mice in the third week of infection, but no activity was observed for the sdiA mutant. Thus far, we can conclude that SdiA is active during long-term persistence in the CBA/J mouse gut, but more work is needed to determine I.) when inflammation begins and ends II.) the mouse gut microbial composition before, during, and after Salmonella-induced inflammation III.) how SdiA activity corresponds to inflammation, and IV.) which member(s) of the gut flora are responsible for acyl-HSL production.

Dedication

This research was conducted whole-heartedly and in the name of science, however, this work is dedicated to the hundreds of mice and pigs that died by my hands.

Acknowledgements

I would like to thank my advisor, Dr. Brian M. M. Ahmer, for his guidance and support. Dr. Ahmer encouraged me to think critically & independently, and allowed me to be creative. I would also like to thank my esteemed committee members, Dr. John Gunn, Dr. Dan Wozniak, and Dr. Sheryl Justice for their guidance and support throughout this dissertation. Never before have I met a wittier assemblage of scientists. I would like to sincerely thank my parents Glenn and Rebecca, who have devoted their lives to the success of all of their children, and I am no exception. I would like to thank my siblings Susan, Annie, Mike and

Charlie for their love and support. Finally, I thank my best friend and wife, Nikki, who has stood by me through challenging times and shared the joy of the good times.

Vita

October 1984 Born in Steubenville, Ohio

May 2007 B.S., Biology, Bethany College Bethany, West Virginia

June 2008 - Present. M.S., Ph.D. candidate, The Ohio State University Columbus, Ohio

Publications

Swearingen MC and Ahmer BMM. Are there acyl-homoserine lactones within mammalian intestines? J. Bacteriol. 2012 Jan 195(2): 173-9. Swearingen MC, Porwollik S, Desai PT, McClelland M, Ahmer BMM. Mouse Virulence of 32 Strains of Salmonella . PLoS ONE 2012 7(4): e36043. doi:10.1371/journal.pone.0036043

Dyszel JL, Smith JN, Lucas DE, Soares JA, Swearingen MC, Vross MA, Young GM, Ahmer BM. Salmonella enterica serovar Typhimurium can detect acyl homoserine lactone production by Yersinia enterocolitica in mice. J Bacteriol. 2010 Jan;192(1):29-37. Dyszel JL, Soares JA, Swearingen MC, Lindsay A, Smith JN, Ahmer BM. E. coli K-12 and EHEC genes regulated by SdiA. PLoS One. 2010 Jan 28;5(1):e8946.

Fields of Study: Microbiology

vii

Table of Contents Abstract ...... ii Dedication ...... v Acknowledgements ...... vi Vita ...... vii Table of Contents ...... viii List of Figures ...... x List of Tables ...... xii List of Abbreviations ...... xiii 1. Introduction ...... 1 1.1 Significance ...... 1 1.2 Bacterial Quorum Sensing Phenomena ...... 2 1.3 Gram Negative Bacterial Quorum Sensing ...... 3 1.3.1 LuxI-LuxR type quorum sensing systems ...... 3 1.3.2 LuxI-type enzymes synthesize HSLs ...... 5 1.3.3 LuxR homologous transcription factors ...... 7 1.4 Quorum Sensing Mediated Pathogenicity ...... 10 1.5 Escherichia coli sdiA ...... 12 1.6 Salmonella sdiA ...... 15 1.3.1 Salmonella eavesdropping ...... 19 2. Virulence of 32 Salmonella strains in mice ...... 24 2.1 Abstract ...... 25 2.3 Results ...... 28 2.3.1 Mouse virulence assays ...... 28 2.3.2 Fecal shedding and assessment of cross-protection ...... 28 2.4 Discussion ...... 30 2.5 Methods ...... 33 2.5.1 Ethics statement ...... 33 2.5.2 Bacterial strains and media ...... 33 2.5.3 Mouse virulence and fecal shedding ...... 33 viii

2.5.4 LD50 determinations ...... 34 3. The contribution of sdiA to Salmonella fitness in pigs and mice ...... 45 3.1 Abstract ...... 46 3.2 Introduction ...... 48 3.3 Results ...... 51 3.3.1 A pilot pig RIVET experiment indicated an sdiA-dependent shedding burst phenotype of Salmonella (performed by Jessica Dyszel and Darren Lucas) ...... 51 3.3.2 An sdiA-dependent fitness phenotype is observed in some organs ...... 52 3.3.3 Salmonella RIVET activity occurred primarily in pig mesenteric lymph nodes on day 6 post-Salmonella infection ...... 54 3.3.4 yenI+ Salmonella in pigs indicate a hyper-virulent phenotype for the sdiA mutant ...... 55 3.3.5 srgE does not contribute to the Salmonella sdiA- fitness advantage in the yenI+ background in pigs ...... 57 3.3.6 Determining if sdiA is expressed tissue-tropically using sdiA-tnpR RIVET 59 3.3.7 Genes required for general Salmonella fitness in pigs ...... 61 3.3.8 An sdiA phenotype is observed in mouse small intestines when Salmonella produces acyl-HSL ...... 62 3.3.9 Salmonella sdiA phenotypes are not observed in a humanized mouse model ...... 63 3.3.10 Salmonella SdiA is active in a long-term persistence mouse model of gut inflammation ...... 65 3.4 Conclusion ...... 66 3.4.1 Contribution of SdiA to Salmonella fitness in pigs ...... 66 3.4.2 Contribution of SdiA to Salmonella fitness in mice ...... 72 3.5 Materials and Methods ...... 75 3.5.1 Ethics statement ...... 75 3.5.2 Bacterial strains and media ...... 75 3.5.3 Salmonella enrichment from fecal samples ...... 75 3.5.4 Construction of pagC::camr ...... 76 3.5.5 Preparation of inocula and pig inoculations ...... 76 3.5.6 Sampling and sample preparation ...... 77 3.5.7 Measurement of RIVET activity ...... 78 3.5.8 Competitive indices ...... 78 3.5.9 Humanized mice ...... 79 4. Are there acyl-homoserine lactone molecules within mammalian intestines? ...... 95 4.1 Abstract ...... 96 4.2 Introduction ...... 97 4.4 Biological evidence suggesting a lack of acyl-HSLs in the mammalian intestine ..... 99 4.5 Potentially positive results from genomics and metagenomics ...... 101 4.6 The possibility of degradation ...... 103 4.7 New HSL variants ...... 105 4.8 Conclusions ...... 107 5. Summary and Discussion ...... 113 References ...... 124

List of Figures Chapter 2. Virulence of 32 Salmonella strains in mice

Figure 1. The Salmonella groups tested for virulence in the BALB/c mouse model ...... 35

Figure 2. Salmonella recovery and persistence in the feces ...... 36

Chapter 3. The contribution of sdiA to Salmonella fitness in pigs and mice

Figure 3. A pilot srgE-tnpR RIVET experiment monitoring pig feces over time with yersiniae co-infections ...... 80

Figure 4. srgE-tnpR RIVET in pig feces when pigs are co-infected with GY5456 ...... 81

Figure 5. srgE-tnpR RIVET in pig organs when pigs are co-infected with GY5456 ...... 82

Figure 6. srgE-tnpR RIVET in pig feces when pigs are co-infected with JB580v ...... 83

Figure 7. srgE-tnpR RIVET in pig organs when pigs are co-infected with JB580v ...... 84

Figure 8. srgE-tnpR RIVET in pig feces when pigs are co-infected with JB580v ...... 85

Figure 9. srgE-tnpR RIVET in pig organs when pigs are co-infected with JB580v ...... 86

Figure 10. sdiA competition in pigs when Salmonella express yenI ...... 87

Figure 11. srgE competition in pigs when Salmonella express yenI...... 88

Figure 12. sdiA-tnpR RIVET in five pigs pre-infected with JB580v ...... 89

Figure 13. sdiA competition in pigs when Salmonella express yenI...... 90

Figure 14. srgE-tnpR RIVET in Humanized Swiss Webster mice ...... 91 !

List of Tables

Chapter 2. Virulence of 32 Salmonella strains in mice

Table 1. Supplemental Information ...... 37

Chapter 3. The contribution of sdiA to Salmonella fitness in pigs and mice

Table 2. Strains and Plasmids ...... 92

Table 3. Oligonucleotides ...... 94

Chapter 4. Are there acyl-homoserine lactone molecules within mammalian intestines?

Table 4. Organisms encoding SdiA in the Human Microbiome ...... 110

Table 5. Organisms encoding LuxI/LuxR pairs in the Human Microbiome ...... 111

Table 6. Organisms encoding quorum-quenching enzymes in the Human Microbiome ...... 112

xii

List of Abbreviations

3-OH-C12, 3-hydroxy-C12 N-(3-hydroxydodecanoyl)-

homoserine lactone

Acyl-ACP Acyl-acyl carrier protein

Acyl-CoA Acyl-coenzyme A

AFI Acid-fitness island

AHL, acyl-HSL Acyl-homoserine lactone amp Ampicillin

AR-1 Acid-resistance system 1

AR-2 Acid-resistance system 2

ATP Adenosine triphosphate

BLAST Basic local alignment search tool bp Base pair

C6 N-hexanoylhomoserine lactone cam Chloramphenicol

xiii

cAMP Cyclic adenosine monophosphate

CDC Center for disease control

CFU Colony forming units

CI Competitive index

CIN Cefsulodin irgasan novobiocin

(Yersinia selective agar) cipro Ciprofloxacin

CRP cAMP-receptor protein

EA Ethyl acetate

EHEC Enterohaemorrhagic E. coli

ERC Early removal criteria

GI Gastrointestinal

HMP Human Microbiome project

HSL Homoserine lactone

HTH Helix-turn-helix

HuSWEBS Humanized Swiss Webster mice

IV-HSL Isovaleryl-homoserine lactone kan Kanamycin

LB Luria-Bertani

LEE Locus of enterocyte effacement

MEM Minimal E media

µg Microgram

xiv

mg Milligram

MIC Minimum inhibitory concentration mL Milliliter

µL Microliter

MLN Mesenteric lymph nodes nal Nalidixic acid nM Nanomolar nor Norfloxacin ofl Orfloxacin

Oxo-C12, 3-oxo-C12 N-(3-oxo-dodecanoyl)-homoserine

lactone

Oxo-C6 N-(3-oxohexanoyl)-homoserine

lactone

Oxo-C8 N-(3-oxo-octanoyl)-homoserine

lactone

PBS Phosphate-buffered saline

PCR Polymerase chain reaction p.i. Post-infection pM Picomolar

PON Human paraoxonase

PPs Peyer’s patches

QS Quorum sensing

RAJ Recto-anal junction

RIVET Recombination-based in vivo reporter

technology

SAM S-adenosylmethionine

SARB Salmonella reference collection B

SARC Salmonella reference collection C

SPI Salmonella pathogenicity island strept streptomycin

SWEBS Swiss Webster mice

T3SS Type-three secretion system

TBG Tetrathionate brilliant green broth tet Tetracycline

TF Transcription factor

TraSH Transposon site hybridization

WT Wild-type

XLD Xylose lysine desoxycholate

(Salmonella selection/screening

media)

xvi

1. Introduction

1.1 Significance

Salmonella is a member of the Gammaproteobacteria class, a medically relevant class of Gram-negative bacteria that can cause a vast range of diseases in humans and other animals. Some families of this class include the

Enterobacteriaceae (Escherichia, Shigella, Salmonella ), Vibrionaceae (Vibrio) and Pseudomonadaceae (Pseudomonas). Salmonella in particular is of global importance infecting up to 1.3 billion people annually (1), and the majority of its victims are young children (2).

There are two species of Salmonella, S. enterica and S. bongori. S. enterica is comprised of six subspecies: enterica, arizonae, diarizonae, houtenae, indica, and salamae. In 2009, a total of 2587 serovars were reported for Salmonella enterica (3). The majority of these serovars (1547/2587) are members of the Salmonella enterica subspecies enterica, which is responsible for ninety-nine percent of all human salmonellosis (4). S. bongori is not typically associated with disease in humans (5). Salmonella enterica subspecies enterica 1

serovar Typhimurium (S. Typhimurium) is a broad host range enteric pathogen capable of colonizing more than forty different animal species (chapter 2 and (6)), and is a main cause of human salmonellosis. In humans, S. Typhimurium can cause self-limiting enteritis, resulting in severe diarrhea, fever, nausea, and vomiting (7, 8), but symptoms usually subside without medical treatment.

Typhoid fever, also known as enteric fever, is caused by the human-restricted S. enterica serovar Typhi (S. Typhi) and S. enterica serovar Paratyphi. There are a large number of symptoms associated with typhoid fever, but the most common are headache, low to high-grade fever, nausea, lethargy, myalgia, cough, and weight loss (9). Typhoid fever is usually a more serious infection, and may require intravenous antibiotic treatment (10). Additionally, individuals infected with S. Typhi can develop an asymptomatic chronic carrier state in which S.

Typhi colonizes the gall bladder indefinitely, and is shed in the feces via host bile secretion (11).

1.2 Bacterial Quorum Sensing Phenomena

Many bacteria are capable of regulating gene expression according to their population density through secreted pheromones in a process termed quorum sensing (QS). A QS circuit contains at least two main components, a signal synthase and cognate signal receptor. The signal receptor may function as a transcription factor, or can be membrane-bound and transduce the QS signal to downstream regulators (12). The QS signal is proportional to the cell population

density, thus certain gene subsets are activated/repressed at a particular signal threshold concentration. In this way, a bacterial community can sense that a

“quorum” is reached and uniformly regulate gene expression. QS has been shown to modulate a number of critical cellular activities in both Gram positive and Gram negative bacteria such as biofilm formation, bioluminescence, motility, competence, conjugation, and the expression of virulence factors (12-16).

1.3 Gram Negative Bacterial Quorum Sensing

1.3.1 LuxI-LuxR type quorum sensing systems

The prototypical example of QS for Gram-negative bacteria is the

LuxI/LuxR system of Vibrio fischeri, a bioluminescent organism that exclusively colonizes the light organ of the bobtail squid, Euprymna scolopes. The production of light by V. fischeri requires the coordinated effort of the entire bacterial population. Bacteria growing within the light organ express LuxI signal synthase which catalyzes the production of the autoinducer N-(3-oxohexanoyl)- homoserine lactone (oxoC6, N-acyl homoserine lactone, acyl-HSL) (17, 18)

(acyl-HSL synthesis is described below in chapter 1.1.2). As LuxR binds oxoC6, it recognizes the lux box sequence upstream of the luciferase operon and activates transcription (19, 20). The luciferase operon is comprised of luxICDABE, thus, activation by LuxR-oxoC6 results in a positive feedback loop for luxI expression (12, 20). At approximately 1011 colony forming units (CFU) per

milliliter (mL), the concentration of oxoC6 in the light organ is sufficient to cause illumination (21-23).

Gram negative QS has been reported in other oceanic environments, including ecologically important coral communities (24, 25). Fresh water organisms also use QS. For example, Serratia strain ATCC39006 is able to coordinate the formation of intracellular gas vesicles via QS. It is hypothesized that Serratia forms gas vesicles to increase buoyancy, directing the facultative anaerobe to reach the water-air surface interface and respire aerobically, ultimately enhancing growth (26).

From surf-to-turf, QS is also prevalent in plant-bacterial symbioses.

Rhizobium species are of particular interest because they form root nodules on legume plants and can fix nitrogen, and reports have shown that this process is crucial for legume plant development and maturation (27, 28). It has been shown that Rhizobium root nodule formation and its ability to fix nitrogen hinges on QS.

The components necessary for R. leguminosarum root nodule formation and N2 fixation are encoded on a transmissible plasmid (pRL1JI). Adjacent to the plasmid transfer operon (traI-trbBCDEJKLFGHI) lies BisR, a solo LuxR homolog that, in donor strains, represses transcription of the signal synthase cinI which synthesizes N-(3-hydroxy-7-cis-tetradecenoyl)-L-homoserine lactone (29, 30).

Recipient strains in the population, however, do produce the acyl-HSL signal. As donor strain BisR binds acyl-HSL it activates expression of traR (formerly known as triR), which in turn activates expression of the plasmid transfer operon (30)

1.3.2 LuxI-type enzymes synthesize HSLs

Most QS species synthesize a main variant of acyl-HSL that is detected by their cognate LuxR. The main variant produced by V. fischeri is oxoC6 (31). A single LuxI homolog may produce other variants in addition to the predominant signal, albeit in lesser amounts (32). For instance, Yersinia YenI mainly produces equal amounts of oxoC6 and N-hexanoylhomoserine lactone (C6), but longer acyl chain types have also been detected in culture supernatants (33). Some organisms, such as the pseudomonads, express multiple LuxI homologs and therefore produce several acyl-HSL variants (34, 35).

LuxI homologous enzymes typically synthesize acyl-HSLs using the substrates S-adenosylmethionine (SAM) and acylated acyl carrier protein (acyl-

ACP). SAM and acyl-ACP are two cellular metabolites involved in metabolic methylation events and fatty acid biosynthesis, respectively (12, 18, 36-38). LuxI- type enzymes catalyze amide bond formation between the fatty acyl chain donated by acyl-ACP and SAM. LuxI then catalyzes the lactonization of the acyl-

SAM intermediate forming acyl-HSL and 5-methylthioadenosine (18, 39). As alluded to above, there are many variations of acyl-HSLs, and variations occur in the acyl-chain length (ranging from 4-18 carbons), carbonyl substitutions on the third carbon (hydrogen, hydroxyl, or carbonyl group), and acyl chains may or may not be saturated. Some exotic variations have aromatic side groups, branched acyl-chain tails, or carboxylated acyl tails (40-43).

It is believed that the acyl chain-accepting domain of LuxI-type synthases plays a role in the final acyl-HSL structure (12). Comparison of LasI of 5

Pseudomonas aeruginosa and EsaI of Pantoea stewartii suggest conservation in the enzyme’s principal domain, but the acyl-ACP accepting pocket varies. LasI produces a longer chain variant, oxoC12, and the acyl pocketing domain is tunnel-shaped (44). By contrast, the acyl-ACP binding domain of EsaI, which produces shorter length oxoC6, is abbreviated by large occluding amino acid residues (45).

Exotic variations of acyl-HSLs, such as those with branched acyl tails, also use acyl-ACP as the acyl chain donor (40), and branched acyl tails are indeed a product of fatty acid biosynthesis from amino acids (46). However, branched chain HSLs, such as isovaleryl-HSL (IV-HSL) produced by BjaI of

Bradyrhizobium japonicum, draw the acyl variant from acyl-CoA instead of ACP.

Furthermore, while most non-branching acyl-HSLs are detected by LuxR homologs at nano molar (nM) concentrations, IV-HSL is detected at concentrations as low as 10 pico molar (pM) (41). In retrospect, considering that

IV-HSL is itself a unique HSL and is produced in much smaller amounts (relative to commonly described acyl-HSLs), it is understandable how some HSL variants are overlooked in signal identification assays that use LuxR-type reporters that detect typical non-branched chain variants at [nM] levels.

Lastly, aryl-HSLs have refuted the long-held idea that the sole source of acyl chains for HSLs was derived from the cellular fatty acid pool. For example,

Schaefer and colleagues reported that the plant symbiont, Rhodopseudomonas palustris, uses plant-derived exogenous p-coumarate to synthesize its QS signal, p-coumaroyl-HSL (47). A closely related Bradyrhizobium species is also able to 6

utilize exogenous substrates such as cinnamate to produce cinnamoyl-HSL (42).

The idea that some QS species might acquire substrates for HSL synthesis from the environment is daunting because it reinforces the existing idea that HSL structures vary greatly, and increases the chance for false negatives in signal identification assays.

1.3.3 LuxR homologous transcription factors

LuxR-type transcription factors (TFs) can positively or negatively regulate

QS gene subsets upon binding HSLs. To date, there are five classes of LuxR- type transcription factors (45, 48-53). Class I and II receptors are similar since they both require ligand for protein stability. Class I receptors, though, appear to incorporate ligand during folding, hence, they bind ligand with high affinity and irreversibly (51, 54, 55). Class II receptors can fold in the absence of ligand, but are unstable unless they bind ligand, thus class II binding is reversible (50). In either case, class I and class II receptors bind ligand, stably fold or are stabilized, respectively, and then conduct DNA transactions (50). Class III receptors can fold and are stable in the absence of ligand, but are only active when ligand is present (50). Class IV receptors work in a reciprocal manner, that is, the apoprotein folds in the absence of signal and binds DNA (50). Upon binding signal, class IV receptors void the DNA, thus relieving regulation (50). Finally,

Stevens and colleagues describes class V receptors as those that do not have a cognate signal synthase, can detect the HSL variants produced by other organisms, and do not dimerize upon binding HSL (50). Stevens and colleagues

suggest that SdiA, the LuxR homolog reviewed and investigated in this work, is therefore a class V LuxR-type protein (50).

LuxR-type receptors are comprised of an amino-terminal (N-terminal) ligand binding domain and carboxy-terminal (C-terminal) DNA binding domain containing a helix-turn-helix motif (12, 56-59). Much of what is known about the biochemical activity of LuxR-type sensors comes from seminal work investigating

TraR of the plant pathogen Agrobacterium tumefaciens. TraR is a class I sensor, and it is possible to crystalize the TraR protein, but only in the presence of TraR ligand, oxoC8 (12, 51, 54, 55). TraR binds oxoC8 molecules in a 1:1 molar ratio

(60). The pheromone is virtually buried in the core of TraR in the N-terminal domain between an α-helix and a β-sheet (54, 55), and undergoes hydrophobic packing via hydrogen bonds with residues of the protein and the acyl chain of oxoC8. Thus, it is believed that oxoC8 is incorporated during protein folding (61).

Monomers of TraR-oxoC8 dimerize by virtue of interactions between parallel alpha helices in the N-terminal domain of each monomer (54, 55). As is the case with LuxR homologs, TraR-oxoC8 dimers recognize specific inverted sequence repeats in gene promoters (i.e. TraR recognizes the tra box), and bind DNA via the HTH motif in the C-terminal domain (54, 55, 62, 63). The HTH motif is typical of bacterial transcription factors, especially those belonging to the NarL-FixJ superfamily (61-66).

Class II LuxR-type sensors can reversibly bind pheromone, but require signal for protein stability (or the protein is degraded). Deletion of the N-terminal domain of V. fischeri LuxR renders the protein constitutively active, suggesting 8

that the amino acids in the N-terminus are responsible for luxR repression (57).

This suggests that a ligand-independent interaction between the N-terminus and

C-terminus exists where the N-terminus has a repressive affect on the DNA- binding C-terminal domain (4, 33, 57, 61, 67-69). Indeed, data indicates that, in the absence of oxoC6, the N-terminal domain folds over the HTH motif in the C- terminal domain, and ligand-binding relieves N-terminal repression (57, 59).

In apo-form, class IV sensors bind DNA, and depending on their position at the gene promoter may positively or negatively regulate gene expression. Little is known about the biochemical mechanism underpinning ligand-dependent relief of regulation except to say that studies of EsaR of P. stewartti found that ligand- binding causes a conformation change of the protein (it does not cause the dimer subunits to disengage) (48). Biochemical data for class III proteins, such as MrtR of Mesorhizobium tianshanense, is lacking, but Yang and colleagues demonstrated that MrtR could be purified in the presence or absence of signal, which is consistent with class III LuxRs (49). Finally, class V sensors are described as those that do not multimerize. In addition, class V sensors do not have cognate a LuxI-type synthase, but can still detect HSL variants produced by other organisms. SdiA has been characterized as a class V sensor (50). It has no known cognate signal synthase, can detect acyl-HSLs produced by other bacteria, and biochemical analyses suggest that, when bound to autoinducer,

SdiA exists as a monomer (32, 43, 50, 70-74).

1.4 Quorum Sensing Mediated Pathogenicity

It seems HSL-mediated QS is prevalent in nature, and while these systems share the homologous LuxI-LuxR infrastructure, the gene subsets regulated in response to population density fluxes differ greatly from organism-to-organism, even if they are closely related (75). In addition to regulating many key cellular processes, LuxI-LuxR systems can also control bacterial pathogenesis by indirectly or directly regulating the expression of host-interaction and/or virulence factors (12-16, 76).

Agrobacterium tumefaciens is a well-characterized plant pathogen that uses quorum sensing to regulate conjugation of the Ti (tumor-inducing) plasmid. A tremendous interest was generated in A. tumefaciens several decades ago when it was reported that it has the ability to directly transform plant eukaryotic cells

(77). The A. tumefaciens Ti plasmid is oncogenic, and newly transformed plant cells produce opine molecules in excess, which consequently leads to plant cell proliferation (61). The spur in cell proliferation leads to the formation of characteristic Crown gall tumors typically seen during A. tumefaciens infection.

The excess opines produced by the plant are a unique source of energy for A. tumefaciens, thus A. tumefaciens creates an exclusive niche for itself (61, 78).

The 200 kilobase (kb) Ti plasmid encodes a plethora of genes, including the TraI-

TraR QS system (61, 79-81). As stated previously, TraI produces oxoC8 that is detected by TraR. At high cell-population density, when oxoC8 levels are correspondingly high, TraR-oxoC8 activates the QS gene subset, which includes

genes responsible for Ti plasmid conjugation (82). Interestingly, traR is only expressed in the presence of specific opines (83), so conjugation is therefore dependent on opine production. Other plant pathogens have incorporated QS for virulence regulation including Pectobacterium carotovorum (ExpI/ExpR) which produces enzymes involved in plant soft-rot (84, 85), and Pseudomonas savastanoi (PssI-PssR) which causes knot formation in olive trees (86).

In humans, Pseudomonas aeruginosa is a major cause of nosocomial infections, especially in burn wounds (87). P. aeruginosa also develops into the predominant species occupying the cystic fibrosis (CF) lung airway towards the late stages of the disease (88, 89). Mutations in the human cystic fibrosis trans- membrane conductance regulator results in a malfunction of ion transport across lung epithelia. This mutation can have affects on several organ systems, but the bacterial load of P. aeruginosa in the lung is the underlying cause of decreased life expectancy in CF patients (90-92). A great body of literature exists concerning P. aeruginosa because it is a fierce opportunistic human pathogen

(93-95), and because of its exquisite QS circuitry mediating virulence (96).

P. aeruginosa employs two complete QS regulatory networks, prefixed Las and Rhl, and an additional solo LuxR homolog, QscR, for the regulation of virulence determinants (13, 34, 97-100). The regulation of virulence factors via

QS by P. aeruginosa is theorized to allow the bacterial population to coordinate the expression of factors contributing to its success in vivo once a sufficient population has accumulated (101). A hierarchy exists between the Las and Rhl

QS systems. LasI produces oxoC12, which is detected by LasR. Activated LasR 11

promotes transcription of some virulence factors including elastases, proteases, and an exotoxin, but LasR also activates transcription of rhlR (102). Activation of the Rhl system leads to the regulation of additional virulence factors including a type three secretion system (96).

Lastly, P. aeruginosa also has also incorporated QscR, a solo LuxR-type homolog. The use of “solo” to describe LuxR means that it has no known cognate signal synthase, but the protein has a reported function (29, 103). Little is known about QscR, except to say that it can bind different acyl-HSL variants produced by P. aeruginosa, such as LasI-produced oxoC12 (104). QscR biochemical properties (i.e. ligand binding and specificity) have been investigated, and the crystal structure has been reported (105, 106). It appears that QscR peptide can fold without acyl-HSL, but requires signal thereafter for stability and DNA binding

(104, 105). In addition, it has been deduced that QscR plays a role in virulence factor expression since it was reported that VqsR is an indirect negative regulator of P. aeruginosa QS (and therefore virulence factor production) (107, 108), and

VqsR binds an inverted repeat DNA motif in the promoter region of qscR (106).

1.5 Escherichia coli sdiA

Wang and colleagues first identified sdiA in a screen for genes whose products influenced cell division in E. coli (109). When over-expressed from a plasmid, the sdiA gene product enhanced ftsZ transcription by activating the expression of the ftsQAZ gene cluster, and overriding the MinC/MinD block on

cell division, hence sdiA stands for suppressor of division inhibition (109). The influence of SdiA on cell division, however, is an artifact of overexpression of sdiA, and no data thus far suggests that chromosomal sdiA influences cell division (75). Because of the similarity of SdiA to LuxR, it was originally hypothesized to function as an autoinducible QS regulator (110). Sitnikov and colleagues initially reported that supernatants from spent cultures of E. coli could induce a ftsQ-lacZY reporter fusion four-fold via SdiA, and synthetic C10 acyl-

HSL increased fusion activity to 7.4-fold (110). These findings were later refuted, though, when Garcia-Lara and colleagues demonstrated that the addition of culture supernatant to reporter fusion strains inadvertently added back nutrients and affected the growth rate (111).

Early work with sdiA was conducted using plasmid-borne sdiA, and the ligand for SdiA was unknown. An investigation to confirm if E. coli produced an extracellular factor that could activate SdiA was performed. It was reported that

SdiA target genes were activated in response to spent culture media from enterohemorrhagic E. coli (EHEC) and strain K-12 (112), however, subsequent work by our group could not repeat the results published by Kanamaru and colleagues (75). Nonetheless, with no known SdiA ligand, investigations using plasmid-borne sdiA indicated enhanced antibiotic resistance via up-regulation of the multi-drug efflux pump encoded by acrAB (75, 113, 114). However, chromosomal inactivation of sdiA had little effect on drug resistance (114), and interestingly, overexpressing sdiA in a acrAB deletion background did not abrogate drug resistance suggesting that SdiA may affect another drug efflux 13

system (75, 114). Previously, our group confirmed reports of enhanced drug resistance when sdiA is expressed from a plasmid, but determined that chromosomally expressed sdiA does not affect acrAB expression or antibiotic resistance, nor does addition of acyl-HSL (75).

In EHEC, plasmid-based sdiA was reported to negatively regulate the expression of flagellar genes, the virulence factors intimin and EspD (a type three secretion system translocon protein) (115), and led to a decrease in Caco-2 cell adherence (112). Work by the Sperandio group has supported these findings

(116) despite the fact that Kanamaru never tested for a response to acyl-HSLs

(112). Genes of the locus of enterocyte effacement (LEE) are repressed by SdiA and acid resistance genes are up-regulated in response to acyl-HSL (116). In addition, it is known that the LEE operon is required for successful colonization of the recto-anal junction (RAJ) of the bovine gastrointestinal tract (GI tract or gut), and it was determined that an EHEC sdiA mutant is defective in RAJ colonization

(116, 117). Our group observed sdiA-dependent repression of fliE in response to acyl-HSLs, which confirms previous reports of flagella expression repression by

SdiA (75). We also observed up-regulation of genes involved in acid resistance in response to acyl-HSLs (75)which agrees with findings that SdiA regulates acid fitness in response to acyl-HSLs (32).

Negative regulation of EHEC virulence factors by SdiA, such as the LEE, begs the question of whether or not acyl-HSLs are produced and are stable within the gut. This fundamental questions is fully discussed in chapter 4 (43).

Indeed, extracts from bovine rumen samples, but not intestinal samples, have 14

activity consistent with that of acyl-HSLs (116, 118, 119). Surprisingly, the organism(s) responsible for production of acyl-HSLs in bovine rumen samples could not be identified (119). Furthermore, assaying a collection of known bovine rumen commensals strains for acyl-HSL production yielded negative results

(119). The authors conclude that perhaps the in vitro conditions in which the characterized rumen commensal strains were tested did not permit the production of detectable acyl-HSLs (119). Regardless, a model has been proposed where acyl-HSLs present in the bovine rumen activate SdiA leading to the up-regulation of acid fitness genes (to resist the acidic pH of the rumen) and repression of the LEE (120). As EHEC transits to the RAJ, the pH becomes more neutral and acyl-HSLs are not present, thus, acid fitness genes are no longer activated and the LEE is de-repressed (120). Recently, the role of EHEC SdiA in long-term colonization of weaned calves was investigated (69). Sharma and

Bearson (2013) reported that an sdiA mutant was defective in long-term persistence (CFU recovered at 19-27 days post-infection) compared to the WT

EHEC (69). In addition, it was confirmed that SdiA represses the LEE via ler, the positive transcriptional regulator of the LEE, in response to acyl-HSLs (69).

1.6 Salmonella sdiA

The solo LuxR-type homolog SdiA is present in Gamma proteobacterial species spanning the Escherichia, Salmonella , Enterobacter, Klebsiella,

Shigella, Citrobacter, and Cronobacter bacterial genera (70, 109, 121, 122).

Salmonella sdiA was first identified in an S. Typhimurium genomic cosmid screen using an E. coli SdiA probe (121). Upon sequencing the Salmonella sdiA gene, it was determined that E. coli and Salmonella SdiA are 69% identical at the amino acid sequence level, and Salmonella sdiA is 26% identical and 47% similar to V. fischeri LuxR (121).

SdiA has no known cognate signal synthase, however, it was recently deduced that ExpI and/or PhzI of Erwinia and Pantoea, respectively, is potentially the lost cognate signal synthase (123). Genomic comparisons of representative species of the aforementioned genera indicate that sdiA is situated immediately downstream of yecC and upstream of yecF (121, 123). Salmonella yecC is 91% identical to that of E. coli, and is similar to a Salmonella histidine transporter, hisP, of the adenosine triphosphate (ATP)-binding cassette family (121). It is interesting to note that yecC is 60% similar to opaline and nopaline transporters of A. tumefaciens (121). Farther downstream of sdiA (beyond yecF) is sirA (121), a conserved ortholog of E. coli uvrY and Pseudomonas gacA. sirA encodes the response regulator of the SirA-BarA two-component regulatory system, and is involved in regulating virulence processes through the carbon storage regulator system including the expression of genes located within Salmonella pathogenicity island 1 (SPI1), biofilm formation, and motility (121, 124-128).

Salmonella SdiA activates seven genes located in two loci, several of which are putative virulence factors (70, 121). The rck operon, located on the

Salmonella virulence plasmid (pSLT), encodes six SdiA target genes. Rck is predicted to be an eight-stranded beta barrel protein located in the outer 16

membrane (129, 130). Rck inhibits the polymerization of the human complement component C9, and thus confers resistance to complement-mediated killing (131-

133). Rck is also involved in adherence to epithelial cells and extracellular matrices (laminin and fibronectin), and has been shown to induce actin-rich sites in epithelial cells resulting in zipper-like internalization (134, 135). The second locus is a single gene horizontal acquisition named srgE (SdiA-regulated gene), and it is located at 33.6 centisomes on the chromosome (70). The function of this gene has yet to be determined, but the predicted product contains a putative coiled-coil domain, and computational analysis and initial in vitro analysis suggests that it is a type III secreted substrate ((18, 70, 71, 136-141)and

Habyarimana and Ahmer unpublished) . Interestingly, the pef operon (plasmid- encoded fimbriae) is located immediately upstream of the rck operon. While SdiA does not directly regulate pef, two genes in the rck operon, pefI and srgA, may affect the transcription and function of this operon (142). pefI encodes a transcriptional regulator of the pef operon, and srgA is a dsbA paralog which catalyzes disulfide bond oxidation in fimbrial subunits (143, 144). To date, the remaining members of the sdiA regulon have unspecified functions. They include a putative lipoprotein, srgB, and two putative transcription factors srgC and srgD, although, a recent screen aimed at identifying genes involved in flagellar regulation identified srgD as an inhibitor of motility via fliC (145).

Despite the effort to characterize sdiA, little is known about the factors controlling sdiA expression. In V. fischerii, LuxR is expressed constitutively (12), however, sdiA appears only to be expressed in certain conditions (70, 85, 146). 17

Noel and colleagues determined that Salmonella SdiA could detect the acyl-

HSLs produced by Pectobacterium carotovorum in vitro, however, an S.

Typhimurium recombinase-based in vivo reporter system (RIVET) showed no activity during coinfection with P. carotovorum (in the presence of acyl-HSLs in a tomato soft rot wound (85). Our group previously demonstrated that SdiA is active in turtles colonized with acyl-HSL-producing Aeromonas hydrophila (71), in mice co-infected with Yersinia enterocolitica (72), and pigs co-infected with

Yersinia enterocolitica (chapter 3). In vitro, Salmonella sdiA is active in swarm cells (bacteria using gliding motility) and Luria-Bertani (LB) broth supplemented with 2% NaCl (147). Through understanding the in vitro conditions that are conducive to sdiA expression, the Surette group has identified cAMP-receptor protein (CRP) and LeuO to be the major and minor activators of sdiA, respectively (146). CRP is a global regulator in bacteria, and the co-inducer for

CRP is cAMP, a molecule synthesized in response to cellular glucose depletion and signifies a gluconeogenic state (148, 149). LeuO is an activator of the leucine biosynthetic operon (150, 151), and while the co-inducer for LeuO remains unknown (146, 152), LeuO has been shown to regulate Salmonella virulence in mice and worms (146, 153, 154). Turnbull and colleagues report that sdiA expression peaks twice whilst growing in broth, once in exponential phase, and a second time in stationary phase (which is RpoS-dependent) (146). Thus, growth phase-dependent sdiA expression is consistent with sdiA expression via metabolite sensing. It has been hypothesized that the role of CRP is to activate sdiA upon entering the intestine in response to carbon availability and prime 18

Salmonella for acyl-HSL detection (146). Other regulators, such as ferric uptake regulator (Fur), have also been reported to regulate sdiA expression, but they tend to have a lesser or indirect role in sdiA expression (146, 155).

Unlike typical LuxR homologs, SdiA functions with a high degree of signal promiscuity, that is, SdiA of Salmonella and E. coli are able to sense and respond to a variety of synthetic acyl-HSLs and those produced by some QS bacterial species (71-73, 121, 156). Smith and Ahmer (2003) reported

Salmonella SdiA is sensitive to 1 nM oxoC8 and 5 nM oxoC6 (70). SdiA is also sensitive to non-substituted acyl-HSL variants, such as C8 or C6, albeit with approximately 10-fold less sensitivity (70).

Lastly, somewhat less attention has been dedicated to the SdiA protein structure. One studying using nuclear magnetic resonance reported that SdiA exists as a monomer when bound to oxoC8(53). In this respect, it would represent a true class V LuxR-type protein (50). However, like TraR (A. tumefaciens) and LasR (P. aeruginosa), SdiA is predicted to be a symmetrical dimer with each monomer having an α − β − α fold (157); the quaternary arrangement of apo- or active- SdiA still may differ (157). One crystal structure of

E. coli SdiA was released in 2008 (74). Wu and colleagues report that they were able to crystallize the SdiA protein via overexpression, but no insight as to the biochemistry of SdiA-ligand interaction was given in the report (74).

1.3.1 Salmonella eavesdropping

Some bacteria can detect the QS signals produced by other species of bacteria in a phenomenon termed “eavesdropping”. For instance, in chapter 1.4, we review the proposed model where EHEC appears to eavesdrop on the acyl-

HSLs present in the bovine rumen to enhance acid fitness and inhibit LEE operon expression. In 2008, our group demonstrated that Salmonella SdiA was active during transit through turtles colonized with Aeromonas hydrophila through the use of recombination-based in vivo expression technology (RIVET) (71). The

RIVET reporter strains contained a srgE-tnpR fusion and a tetracycline resistance cassette (tetRA) elsewhere in the chromosome flanked by TnpR

(resolvase) target sites. SdiA activity triggers srgE-tnpR expression. Resolvase is expressed as SdiA binds ligand and activates the srgE-tnpR fusion, and resolvase performs site-specific recombination to delete the tetRA genes (this is termed “resolution”) (158). Resolution can be detected by screening Salmonella for tetracycline sensitivity. Competition experiments between a wild-type (WT or sdiA+) and an isogenic sdiA mutant (sdiA-) RIVET strain indicated a slight yet significant advantage for WT S. Typhimurium. In 2010, we demonstrated that S.

Typhimurium SdiA could sense acyl-HSLs secreted by Y. enterocolitica biovar 1B in the mouse intestinal tract using the RIVET reporter strains (formerly used in turtles) (72). Y. enterocolitica biovar 1B is a highly virulent acyl-HSL-producing enteric pathogen capable of colonizing and causing disease in mice. The yenI acyl-HSL synthase of Yersinia produces both oxoC6 and C6 (159), both of which

S. Typhimurium SdiA can detect (70). Detection of Yersinia acyl-HSLs by S.

Typhimurium primarily occurred in the Peyer’s patches (PPs). However, 20

competition experiments between WT and sdiA mutant (sdiA-) RIVET strains in mice pre-infected with Y. enterocolitica revealed that there was no fitness advantage for WT S. Typhimurium (72). It was hypothesized that this was due to inadequate interaction of S. Typhimurium with Y. enterocolitica in the host.

Further competitions in mice between a WT and an sdiA mutant that were engineered to express yenI, revealed that when S. Typhimurium is in constant exposure to acyl-HSLs in vivo the WT strain outcompetes the sdiA mutant. Using

SdiA regulon member mutant strains, we determined that each member of the

SdiA regulon was required for the WT fitness advantage. This also suggests that all members of the SdiA regulon are functional in mice (72).

SdiA was active during an S. Typhimurium and Y. enterocolitica co-infection in mice, however, this did not lead to an sdiA fitness phenotype (72). Thus, we reasoned that the mouse model might be insufficient for studying sdiA phenotypes. We hypothesized that sdiA phenotypes could be studied in a model where Salmonella and Yersinia commonly co-colonize, such as in conventional pigs (chapter 3) (160-169). To test this hypothesis, we used the Salmonella srgE- tnpR RIVET system to measure SdiA activity in pig feces and in organs. We observed the majority of SdiA activity occurring in the mesenteric lymph nodes

(MLN) on day 6 post-infection (p.i.). Interestingly, however, we did not detect

Yersinia in MLN samples on day 6 p.i.. Considering that RIVET resolution is permanent, one hypothesis is that Salmonella detected acyl-HSL at a location other than the MLN, possibly in the pig Peyer’s patch (PP), resolved, migrated to the MLN and underwent clonal expansion. Alternatively, if SdiA was truly active 21

in the MLN, this implies that SdiA was active independent of acyl-HSL. The latter possibility would represent a novel in vivo condition in which SdiA does not require ligand, but more testing is needed to determine the exact location in pigs in which SdiA is active.

Previous data from turtles and mice, and the data represented here from pigs, are in agreement that SdiA is active in intestines during co-infection with an acyl-HSL-producing pathogen. SdiA activity, however, has never resulted in an sdiA fitness phenotype. To reiterate, the overarching hypothesis for this specific work has been that Salmonella utilizes SdiA to detect the acyl-HSLs produced by the gut flora, and responds by activating the SdiA regulon. To date, however, no data has ever indicated that acyl-HSLs are made and/or are stable in mammalian intestines (43). This poses a more fundamental question regarding the existence of acyl-HSLs in healthy animal intestines. In chapter 4, we probed the Human

Microbiome Project gene catalog (HMP, www.hmp.org) for LuxI homologs. Our analysis of the HMP, and a review of the literature (chapter 4), suggests that at least seven mammalian gut-residing bacteria have the potential to produce acyl-

HSLs (i.e. encode LuxI homologs). They include Hafnia rodentium, Edwardsiella tarda, and a Ralstonia species (HMP) (40, 170), and Acinetobacter baumannii,

Citrobacter rodentium, Pseudomonas aeruginosa, and Serratia odorifera

(literature review) (40, 171). In parallel to this information, during intestinal inflammation, members of the Proteobacteria overgrow (172, 173), and we have since begun referring to this events as the proteobacterial bloom. Indeed,

Salmonella-induced gut inflammation also leads to a bloom of proteobacterial 22

species (172, 173). Currently, we are using RIVET to test if a long-term

Salmonella persistence model in CBA/J mice, reported to result in natural

Salmonella-induced inflammation (174, 175), results in SdiA activity. Thus far, we have observed SdiA activity occurring in week three post-infection for WT

Salmonella, but not the sdiA mutant.

Chapter 2. Virulence of 32 Salmonella strains in mice

This chapter was written in a format consistent with submission to the

Public Library of Science ONE (2012). Therefore, this chapter differs in format from the rest of the thesis. The authors are Matthew Swearingen, Stephen

Porwollik, Prerak Desai, Michael McClelland, and Brian Ahmer. Matthew

Swearingen conducted all animal experiments, Salmonella enumerations, comprehensive literature review for table 1, and supplied figure 1. Matthew

Swearingen and Brian Ahmer co-wrote the manuscript with the assistance of

Stephen Porwollik and Michael McClelland who supplied the Salmonella strains.

Prerak Desai analyzed Salmonella strain relatedness and produced figure 2.

2.1 Abstract

Virulence and persistence in the BALB/c mouse gut was tested for 32 strains of Salmonella enterica for which genome sequencing is complete or underway, including 17 serovars within subspecies I (enterica), and two representatives of each of the other five subspecies. Only serovar Paratyphi C strain BAA1715 and serovar Typhimurium strain 14028 were fully virulent in mice. Three divergent atypical Enteritidis strains were not virulent in BALB/c, but two efficiently persisted. Most of the other strains in all six subspecies persisted in the mouse intestinal tract for several weeks in multiple repeat experiments although the frequency and level of persistence varied considerably. Strains with heavily degraded genomes persisted very poorly, if at all. None of the strains tested provided immunity to Typhimurium infection. These data greatly expand on the known significant strain-to-strain variation in mouse virulence and highlight the need for comparative genomic and phenotypic studies.

2.2 Introduction

Salmonella is a pathogen of worldwide importance, causing disease in a vast range of hosts including humans. There are two species of Salmonella, S. bongori and S. enterica. S. enterica is comprised of six subspecies and over

2500 serovars (3) (Figure 1). There are over 1500 serovars within S. enterica subspecies enterica (also known as subspecies I) which cause ninety-nine percent of Salmonella infections in humans (4). Some serovars within this subspecies such as Typhi and Paratyphi A, B, and C cause typhoid and paratyphoid fever, respectively, in humans. Symptoms of typhoid fever include headache, low to high-grade fever, nausea, lethargy, myalgia, cough, and weight loss (9). The symptoms of paratyphoid fever may be indistinguishable from typhoid fever, except that they tend to be milder (9). Other serovars such as

Typhimurium and Enteritidis cause a self-limiting enteritis as well as more severe disease and even death in young children, the elderly or people with other diseases such as AIDS or malaria (176, 177). The other five subspecies of S. enterica are more commonly associated with reptiles and amphibians and rare cases of human infection are often associated with eating or keeping reptiles as pets (Reviewed in (178-180)). The advent of comparative genomics has provided a new method of identifying genes involved in host range and pathogenesis. The first step towards this goal is to determine the spectrum of phenotypes of

Salmonella in host infection. The genomes of hundreds of different isolates of

Salmonella enterica are being sequenced. Among strains with completed and 26

near completed genomes are two or more representatives of all six subspecies of

Salmonella enterica.

To assay Salmonella strains for virulence we chose as our initial model a host that was likely to be susceptible to Salmonella infection. Some mouse strains, those mutated at the slc11A1 locus (formerly known as Nramp1) such as

BALB/c and C57/BL6 (181), present with a typhoid-like disease when infected with Typhimurium and some other serovars. Mouse lines that are slc11A1+ are typically resistant to infection, but have proven to be important for investigating long-term persistence in the mouse, both in the intestine and the gallbladder

(182-189). Persistence is relevant because it occurs widely among salmonellae in a variety of animals, and it propagates the fecal-oral route of transmission. In this report, 32 Salmonella strains with completed or nearly completed genome sequences were screened for virulence and persistence in BALB/c mice. This work will facilitate future comparative genomic studies between the subspecies and serovars of Salmonella.

2.3 Results

2.3.1 Mouse virulence assays

Groups of BALB/c mice were orally inoculated with approximately 109 colony forming units (CFU) of each Salmonella strain, and their health was monitored daily. The mice were euthanized if they met any early removal criteria

(ERC - lethargy, hunched posture, or ruffled coat). Our laboratory strain, S. enterica subspecies enterica serovar Typhimurium strain ATCC14028 (14028), served as a virulent control. Only one other strain, serovar Paratyphi C BAA1715, was fully virulent, causing all mice to meet ERC in three separate experiments

(Table S1). We calculated the oral LD50 for Paratyphi C strain BAA1715 in mice

5 to be 1.6 x 10 CFU, which is close to the oral LD50 that was calculated for the

Typhimurium strain 14028 (4.5 x 105). One of the strains tested, serovar Stanley, killed only one of 13 mice tested (Table 5).

2.3.2 Fecal shedding and assessment of cross-protection

Only two of the 32 Salmonella strains studied in this report were fully mouse-virulent, but many of them were capable of colonizing the mouse intestine for several weeks. In each of the above experiments, fecal samples were collected from surviving mice toward the end of the study (between 14 and 23 days post-infection in the first experiment, at day 14 in the second experiment and between days 17 and 19 in the third experiment). In the first two experiments, the presence or absence of Salmonella in the feces was noted

(Table 5 and Figure 2), while in the third experiment the number of Salmonella in the feces was quantitated (Table 5 and Figure18). Although there was a lot of variability, the strains clearly differed in their ability to colonize the mice and to be shed in feces.

Avirulent Salmonella strains may exist that provide protection against virulent strains. These would be candidates for live vaccine strains. Therefore, at the end of each virulence experiment, all surviving mice were challenged intragastrically with 1 x 109 CFU of serovar Typhimurium strain 14028. None of the Salmonella strains provided protection against 14028.

2.4 Discussion

Among the 32 strains tested in this report only Typhimurium strain 14028 and Paratyphi C strain BAA1715 were fully virulent in mice. The oral LD50 for

14028 and BAA1715 were 4.5 x 105 and 1.6 x 105 CFU, respectively. While this particular strain of Paratyphi C had not been tested prior to this study, other strains of Paratyphi C have been shown to cause disease in mice (189-194).

However, the strains we tested from some serovars previously reported to be virulent in mice (Abortusovis, Enteritidis, and Montevideo, see references in

Table 5) were not found to be virulent in this study. The reason for the avirulence of the Abortusovis and Montevideo isolates is unknown. However, two of the

Enteritidis strains studied here, BAA1587 and BAA1734, were selected because their genomes differ markedly from the main Enteritidis clade, and they represent very rare genomovars of this serotype. Their inability to kill mice is therefore not surprising. The reason(s) for the discrepancies in virulence between individual strains of particular serovars or subspecies can be due to genetic variations between strains that belong to the same serotype but differ in phylogeny.

Porwollik et. al. demonstrated that there can be hundreds of genes differing between isolates of a single serovar (195).

The third avirulent strain of Enteritidis, BAA1714, was the earliest isolated strain of Enteritidis available to us. This strain was isolated from a guinea pig in

1948, prior to Enteritidis becoming widespread in chickens and a danger to humans (196, 197). Thus, it is possible that this strain has lost virulence during

its 60 years of storage or is not the lineage that expanded in chickens and proved to be pathogenic to humans. In this study, serovar Stanley led to the death of one out of 13 total mice tested. Serovar Stanley has not previously been reported to be virulent in mice although it has been isolated from rats and is a human pathogen (198-203). Serovars Thompson, Poona, Paratyphi A, and Infantis have never been shown to cause disease in mice, consistent with the results in this study, but they have been isolated from wild mice and rats (204, 205) and from laboratory mice (206). Consistent with this, we observed that our isolates of

Thompson, Poona, and Infantis were recovered from feces two to three weeks after inoculation. However, Paratyphi A was not. The genes required for these strains to colonize the intestinal tract are not known but could be the focus of future studies. Additionally, serovars Typhimurium, Enteritidis, Anatum and

California were commonly isolated from laboratory mice in the days before

Specific Pathogen Free certifications (206).

In reviewing the literature (Table 5) we found that some strains that belong to human-restricted serotypes have been isolated from peculiar places. One study reported that serovar Typhi had been isolated from camels in the United

Arab Emirates and Ethiopia (none of the animals presented symptoms) (207,

208). Another study suggested grey duiker antelope as a possible reservoir for S.

Typhi, as individuals who worked as bushmeat processors were seropositive for

S. Typhi. No attempt was made to isolate S. Typhi from the grey duiker antelope, but the animals were seropositive for S. Typhi (209). In 1977, Lavergne et. al. developed an asymptomatic carrier model in guinea pigs via a surgically 31

cannulated gall bladder, and Typhi could be isolated from the bile and feces for up to five months post-infection (210). It was later shown that Typhi could cause systemic infection by a more natural oral infection in newborn guinea pigs (211).

While the strains of Typhi and Paratyphi A that we tested in this experiment were not virulent in mice, an older report shows that isolates of these serovars, which had been isolated from the heart blood of a dead hen and rabbit, respectively, were able to kill laboratory mice (212). Whether or not the host-restricted strains can truly colonize these animals is not known, as there have not been repeated animal isolations or experimental confirmations. In contrast, the serovars that are considered to have a broad host-range, such as Typhimurium and Enteritidis, have been repeatedly isolated from up to forty host organisms. Table S1 exemplifies the ubiquitous nature of broad host-range Salmonella.

This work demonstrates that significant variations in pathogenicity can occur between strains of Salmonella that, according to serovar classification, are closely related. These results reinforce the need for strain genome sequencing, and suggest the need for additional genomovar classification of Salmonella strains. Furthermore, the fact that strains of the same serovar can vary significantly in pathogenesis within the same host highlights the possibility of identifying virulence factors using comparative genomics.

! !

2.5 Methods

2.5.1 Ethics statement

This study was performed in strict accordance with animal use protocols approved by The Ohio State University Institutional Animal Care and Use

Committee (IACUC, protocol number OSU 2009A0035). Mice were euthanized if they met any early removal criteria (lethargy, hunched posture, or ruffled coat) to limit suffering.

2.5.2 Bacterial strains and media

All Salmonella strains used in this study are listed in Table 1. Salmonellae were grown with shaking in Luria-Bertani (LB) broth at 37°C (EMD Chemicals,

Gibbstown, NJ).

2.5.3 Mouse virulence and fecal shedding

Female BALB/c mice (8 to 10 weeks old) were obtained from Harlan laboratories. Overnight cultures of each Salmonella strain were centrifuged at

5000xg and resuspended in fresh LB broth and kept on melting ice. Mice were inoculated intragastrically with 0.2 ml of each Salmonella strain (approximately

109 total CFU), and dilution plating of each inoculum was used to determine the actual dose administered.

Xylose-lysine-desoxycholate (XLD) agar (EMD Chemicals) plates were used for the recovery of Salmonella from feces. Fecal pellets from surviving mice were homogenized and dilution plated for enumeration. Surviving mice were challenged with 109 CFU of 14028 to assess if immunity was elicited by any test strains.

2.5.4 LD50 determinations

Inocula of 14028 and Paratyphi C strain BAA1715 were prepared as described above. The suspensions were serially diluted in LB broth and groups of five mice were inoculated with doses ranging from 101 to 109 CFU. Mice meeting ERC were euthanized. The LD50 was calculated using the method of

Reed and Muench (213).

ACKNOWLEDGEMENTS

We thank Pui (Yollande) Cheng, Mohamed Elmasry, Megan Miller,

Rashmi Tuladar and Omar Mohamed for their valuable assistance with this work.

Figure 1. The Salmonella groups tested for virulence in the BALB/c mouse model. Representatives of each of the six subspecies of Salmonella enterica and 17 serovars within subspecies enterica were tested for virulence in mice. Salmonella bongori was not tested.

Figure 2. Salmonella recovery and persistence in the feces. The left panel shows a cladogram that was inferred from core-genome SNPS using Maximum Parsimony. All positions containing gaps and missing data were eliminated. There were a total of 344642 positions of which 279065 were parsimony informative. The parsimony analysis was conducted using Mega5 (214). The middle panel shows Salmonella recovery from feces of surviving mice at 17 and 19 days post-infection. Dots represent individual measurements and the vertical line represents the median. The dotted line represents the 100 CFU/gm detection limit. The right panel represents the proportion of mice that were persistently infected with Salmonella. Black bars indicate that all mice met ERC. *One mouse met the ERC and was euthanized before the experiment was completed.

Table 1. Supplemental Information a ATCC# b Description c Name d Mice that e Mice that f Notes g Source reference met ERC shed Salmonell a in feces BAA1670 Abortusovis SSM004 0/5, 0/5, 5/5, 5/5, Source: Sergio Sheep (190, 215), Goat 1 0/5 5/5 Uzzau, Italy; isolated (215), cattle (215), mice in USSR before (189, 190) 1990; no IS1414 BAA1577 ssp. arizonae 05-0715 0/4, 0/3, 0/4, 3/3, Source: SGSC; from human (216-218), cat 0/5 3/5 SARC collection; (219), snake (220, 221), Serotype 62:z4,z23:- rat snake, boa (222), ; original strain pigs (223), boar (224), name: CDC 346-86, cattle (223, 225, 226), other strain names: buffalo (223), turtle (227, RKSs2980 & 228), lizard (229), SGSC3061; isolated chicken (230), lambs in 1986 from corn (231), turkey vulture snake in Oregon, (232), turkey (233), USA. Acc: chro horse (234), sheep (235, NC_010067.1 236), crocodile (237), rhinoceros (238), lynx (239), cockatoo (240), iguana (240), gecko (241)

BAA731 ssp. arizonae SARC05 0/5, 0/3, 5/5, 2/3, Source: SGSC; see above 0/5 1/5 SGSC 4074 BAA1739 Braenderup S-500 0/5, 0/3, 0/5, 2/3, Source: CDC; Humans (242, 243), 0/5 2/5 serotype 61:1,v:1,5 cockroaches (244), chicken and duck (223), turtle (245, 246), camel (208), cattle and birds (247), pigs (248, 249), quail (250), eagle (251), opossum (252), squirrel, woochuck, hawk (252), owl (252) BAA639 ssp. 01-005 0/5, 0/3, 4/5, 3/3, Source: CDC; Human (253) , diarizonae 0/5 0/5 serotype 48:i:z crocodiles (254), snakes (255), California King Snake, Common egg- eater Dasypeltis scabra, water dragon, veiled chameleon, chameleon, and frillneck lizard (222), ram (256) BAA1579 ssp. 05-0625 0/5, 0/3, 4/5, 0/3, Source: SGSC; from see above diarizonae 0/5 0/5 SARB collection, original strain name: IVB 176/82, other strain names: RKS761 & SGSC2474; isolated in Brazil Continued…

Table 1. Supplemental Information continued BAA1587 Enteritidis SARB17 0/5, 0/3, 0/5, 3/3, Source: CDC; old human (257-259), 0/5 2/5 Salmonella strain reptiles (222), mice isolated from a (192, 260, 261), cats guinea pig (NIH) (yr. (262, 263), dog (258, 1948) 264), chicken (265, 266), geese (265), hens (265), rat (267, 268), cattle (247, 269), camel (207, 208), horse (270), deer (246, 271), turkey (222), pig (247, 266), ducks (242), owl, fox (224), poultry and birds (247), sheep (247), mink (272), house fly (273), crocodile (237), dogs (223), stellar sea lion pups (274) BAA1714 Enteritidis 48-0811 0/5, 0/5, 5/5, 5/5, Source: SGSC; from see above 0/5 5/5 SARB collection; electrophoretic type En7; original strain name: IVB 470/82, other strain names: RKS1208 & SGSC2476; isolated in Switzerland BAA1734 Enteritidis SARB19 0/5, 0/3, 5/5, 1/3, Source: CDC; see above 0/5 4/5 serotype 48:g,z51:-. Acc: AGRM00000000.1 BAA1581 ssp. 05-0642 0/5, 0/3, 1/5, 3/3, Source: CDC; human (275-277), pigs, houtenae 0/5 0/5 serotype 50:z4,z23:- chicken, ducks (223), chameleon (278), cockateel (279), oppossum (280), tiger python, Common egg- eater Dasypeltis scabra, bearded dragon (222), iguana (222, 278) BAA1580 ssp. 99-0125 0/5, 0/3, 4/5, 2/3, Source: SGSC; see above houtenae 0/5 5/5 SARC collection; serotype 45:a:e,n,x; original strain name: CDC 1363-65, other strain names: RKSs2995 & SGSC3116; isolated in India (yr. 1965) BAA1578 ssp. indica SARC13 0/5, 0/3, 3/5, 0/3, Source: SGSC; human [113]* 0/5 0/5 SARC collection; serotype 11:b:e,n,x; original strain name: CDC 347-78, other strain names: RKSs3057 & SGSC3118; isolated (yr. 1978) Continued…

Table 1. Supplemental Information continued BAA1576 ssp. indica SARC14 0/5, 0/3, 0/5, 2/3, Source: SGSC; from see above 0/5 0/5 SARB collection; serotype 6,7:r:1,5; electrophoretic type In3; Biotype not given; original strain name: IVB 385/72, other strain names: RKS1452 & SGSC2484; isolated in Senegal. Acc: chro NZ_AFYI00000000. 1 BAA1675 Infantis SARB27 0/5, 0/3, 2/5, 3/3, Source: CDC; Human (242, 258, 259, 0/5 4/5 originated from New 281), pigs (282-284), Mexico; serotype cattle (242, 266, 269, 9,12:a1,5 from male 285), bovine (223), human stool (36 y) poultry (223, 286-288), horse (270, 289), turkey (222, 290), mink (272), freshwater snail (291), double-crested commorant (292), dog (293), house fly (273), deer (271), rat (268), quail (250), iguana (222), mice (206), birds,poultry, pigs (247), stellar sea lion pups (274) BAA1586 Miami 02-0341 0/5, 0/3, 2/5, 3/3, Source: SGSC; from Human (196, 294), 0/5 4/4 SARB collection; snake (246, 295), lizard Serotype (295) 6,7:g,m,[p],s:[1,2,7]; electrophoretic type Mo1; Biotype not given; original strain name: CDC B2131, other strain names: RKS1762 & SGSC2487; isolated from human in Georgia. Acc: AESU00000000.1 BAA1735 Montevideo SARB30 0/5, 0/3, 1/5, 0/3, Source: SGSC; from human (242, 296-298), 0/5 5/5 SARB collection; chicken/ducks (223), serotype 6,8:d:1,2; cattle (266, 299, 300), electrophoretic type mice (206, 301), sheep Mu3; biotype not (302, 303), birds and given; original strain poultry (222, 247, 304, name: IP25/88, 305), pigs (247), horse other strain names: (289), herring gull (306), RKS4300 & snake (307), foxhound SGSC2491; isolated (308), dog (309), ewe from human in (308), sea gulls (310), France (yr. 1988) salmon (311), bearded dragon (222), monitor (222) Continued…

Table 1. Supplemental Information continued BAA1674 Muenchen SARB34 0/5, 0/3, 0/5, 2/3, Source: SGSC; from human (197, 242, 312), 0/5 4/5 SARB collection; cattle (313), pigs (283, serotype 6,8:d:1,2; 314), camel (207, 208), electrophoretic type iguana (278), turtle (315, Mu1; biotype not 316), lizard (278), elk given; original strain (242), mice (204), goat name: ATCC8388, (317), chicken (223), other strain names: cattle (197), cheetah RKS3121 & (318), hawk (224), birds SGSC2489; and poultry (247), laboratory strain western grey kangaroos (319) BAA1676 Muenchen SARB32 0/5, 0/3, 2/5, 2/3, Source: CDC; see above 0/5 4/4 isolated from female human stool (23 y) BAA1575 Muenster 0065-00 0/5, 0/3, 4/5, 3/3, Source: SGSC; from human (320), pig (321), 0/5 5/5 SARB collection; cattle (247, 299, 300, serotype 322), turkey (222, 266, 1,2,12:a[1,5]; 323), sheep (247), birds electrophoretic type and poultry (247, 304) Pa1; Biotype not given; other strain names: RKS4993 & SGSC2499; laboratory strain. Acc: chro NC_006511.1 9150 Paratyphi A SARB42 0/5, 0/3, 5/5, 0/3, Source: SGSC; Human (324-326), rabbit 0/5 0/4 strain SPB7; isolated (212, 327), cattle (326), in Penang, Malaysia, hamster (328), lamb (yr. 2002) from (212), mice (206), hogs human stool; Acc: (212), rat (212) chro NC_010102.1 BAA1250 Paratyphi B SGSC41 0/5, 0/3, 0/5, 3/3, Source: SGSC; Human (325, 329-333), 50 0/5 4/4 serotype horse (334), mice (335), 1,4,[5],12:b:[1,2]; cattle (336-338) , goats electrophoretic type (223), poultry (339, 340), Pb7; Biotype 1g; turtle (341), darkling original strain name: beetle (342), rat (343), DMS53/81, other guineapigs (344), dog strain names: (223, 345), pigs (223), RKS3215 & snake (246), cats (223), SGSC2504; isolated shrew (198), grey duiker from human in Africa antelope (209) (yr. 1981) BAA1585 Paratyphi B SARB47 0/5, 0/3, 0/5, 3/3, Source: SGSC see above 0/5 4/5 (SGSC 4081) BAA1584 Paratyphi B S-1241 0/5, 0/3, 4/5, 3/3, Source: SGSC; from see above 0/5 3/4 SARB collection; serotype 6,7[Vi]:c:1,5; electrophoretic type Pc2; original strain name: IP2/88, other strain names: RKS4594 & SGSC2506; isolated from human in France (yr 1988). Acc: chro NC_012125.1, plsm NC_012124.1 Continued…

Table 1. Supplemental Information continued BAA1715 Paratyphi C SARB49 5/5, 3/3, N/A Source: Casey Humans (346-348), mice 5/5 Poppe, University of (193, 349), grey duiker Guelph, CANADA; antelope (209) strain# SA20023503; isolated from iguana intestine in Ontario, CA (yr. 1997) BAA1673 Poona SGSC49 0/5, 0/3, 1/5, 1/3, Source: CDC, human (350, 351), 34 0/5 3/4 serotype 47:b:1,5 iguana (278, 352), turtle (227, 229, 278), lizard (278), goats (353), sheep (247, 354), great cane rat (355), C. elegans (356, 357), guineapigs, dog, cat, pig, birds, mice (205) BAA1583 ssp. salamae 05-0626 0/5, 0/3, 4/5, 2/3, Source: SGSC, Crocodiles (254), sheep 0/5 4/5 SARC collection; (358), turtle (359) [, serotype: 58:d:z6; leopard gecko (222) original strain name: CDC 151-85, other strain names: RKSs2985 & SGSC3039; isolated from human in Massachussetts, USA (yr. 1985) BAA1582 ssp. salamae SARC03 0/5, 0/3, 0/5, 3/3, Source: CDC; see above 0/5 3/5 isolated in England; serotype 9,12:a1,5; aka CDC Stk.475 BAA1672 Sendai 55-2461 0/5, 0/3, 0/5, 2/3, Source: SGSC; from Human (360, 361) 0/5 0/5 SARB collection; serotype 1,3,19:g,[s],t:- -; electrophoretic type Sf1; Biotype not given; original strain name: NVSL6673, other strain names: RKS2358 & SGSC2516; isolated from chicken in Maryland, USA (yr. 1987) BAA1736 Senftenberg SARB59 0/5, 0/3, 0/5, 2/3, Source: SGSC; from Human (362), cattle 0/5 0/5 SARB collection; (223, 247), buffalo (223), serotype chicken (196, 223), 1,4,[5],12,27:d: 1,2; ducks (223), turkey electrophoretic type (222, 326), birds and St1; Biotype 26bei; poultry (247, 286), sea original strain name: gulls (310), pigs (249), DMS1112, other mink (272), oppossum, strain names: squirrel, woodchuck, RKS4264 & hawk, owl (252) SGSC2517; isolated in Scotland (yr. 1988) Continued…

Table 1. Supplemental Information continued BAA1737 Stanley SARB60 1/5, 0/3, 0/4, 0/3, Source: SGSC; from Human (199-203), pig 0/5 2/4 SARB collection; (199, 202, 223, 363), serotype 6,7:k:1,5; poultry (199, 223), sea electrophoretic type gulls (364), monkey Th1; Biotype not (223, 365), turtle (278), given; original strain cattle (366), shrews, name: CDC B2637, rats, dogs, guinea pigs, other strain names: shrew (198), stellar sea RKS1767 & lion pups (274) SGSC2519; isolated from human in Florida, USA

BAA1738 Thompson SARB62 0/5, 0/3, 0/5, 2/3, Source: SGSC; Human (196, 367), 0/5 5/5 strain # CDC1707- chicken (290, 368), 81; isolated in ducks (223), cattle (368, Liberia; O group D; 369), pigs (247, 266), antigenic formula landfowl (370), mice 9,12,Vi:d:-; Phage (204), owl (371), horse type UT (Vi - neg); (270, 368), sheep (247, ET 1 368), dog, snake (368), rodent, waterbird, eagle (246), turtle (372), turkey BAA1671 Typhi SGSC26 0/5, 0/3, 0/5, 0/3, Source: ATCC Human (373, 374), hen 61 0/5 1/5 strain, most common (212), guinea pigs (210), virulent Typhimurium newborn guineapigs strain used in (211), camel (207), mice laboratories, (212, 335), grey duiker Designations: CDC antelope (209) 6516-60 [4016, CIP 104115, NCTC 12023], Isolation: tissue, animal (pools of heart and liver from 4-week-old chickens) at CDC University of Missouri, USA. Acc: NC_016856.1, plsm NC_016855.1 Continued…

Table 1. Supplemental Information continued 14028 Typhimurium 5/5, 3/3, N/A Human (375), rhesus 5/5 macaques (376), mice (154, 375, 377), horse (309, 334, 340), camel (207, 208), frog (378), cat (262, 263, 379), cockroaches (244), sheep (380, 381), geese (265), chicken (265, 382), helminth (383), chicken egg (384), cattle (385-387), C. elegans (388, 389), pig (283), pigmy hogs (390), guineapig (344, 391), parakeet (379), rat (392), zebra finch (393), feeder bird (394), bobwhite quail (395), sika deer (396), ostrich (397), hedgehogs (278, 398), owl (399), fox (400), parrot, heron (196, 197), porcupine (246), snake (221, 246), turkey (221, 222), bison (242), goat (317), rabbit, opossum, dog (197, 264), cheetah (318), mink (272), crow, double-crested commorant (292), black marsh turtle (222)

a Current American Type Culture Collection (ATCC) strain numbers, b subspecies or serovar name, c specific strain collections if applicable, d number of mice meeting ERC out of the total tested in three different experiments, e number of mice that had Salmonella in feces between 14 and 23 days post-infection in the first experiment, at day 14 in the second experiment and between days 17 and 19 in the third experiment. In the first two experiments the presence/absence call had a detection limit of 100 CFU, f information about sources, antigenic formulae, electrophoretic types, and strain aliases, and g a literature review of the animal sources or models for the salmonellae tested. Abbreviations: Salmonella genetic stock center (SGSC), Salmonella reference collection B and C (SARB and SARC, respectively), year (yr.) years old (y), accession number (Acc:), chromosome (chro), plasmid (plsm), and Center for Disease Control (CDC).

Chapter 3. The contribution of sdiA to Salmonella fitness in pigs and mice

3.1 Abstract

Bacteria of the Salmonella genera possess a conserved LuxR-type transcription factor, SdiA, which can sense various N-acyl homoserine lactones

(acyl-HSLs). Salmonella species do not produce acyl-HSLs. The phenomenon of detecting and responding to acyl-HSLs produced by other bacterial species has been termed eavesdropping. Previously, we used a Salmonella enterica serovar

Typhimurium (S. Typhimurium) in vivo reporter system (RIVET) to investigate

SdiA activity in mice co-infected with the acyl-HSL-producing pathogen Yersinia enterocolitica. We found that SdiA could detect Y. enterocolitica acyl-HSLs SdiA, however, activation of the SdiA regulon (srgE and the rck operon) did not confer a fitness advantage for wild-type (WT) Salmonella over an isogenic sdiA mutant.

Thus, we were suspect of using mice to study Salmonella eavesdropping. It is known that pigs are a natural reservoir for both Salmonella and Yersinia species; therefore, pigs may be a host in which Salmonella and Yersinia frequently co- colonize. We used RIVET to test if an S. Typhimurium –Y. enterocolitica co- infection in conventional pigs would result in an sdiA fitness phenotype. In previous mouse experiments, we observed that RIVET was most active in mouse

Peyer’s patches, but in pigs the majority of SdiA activity occurred in the mesenteric lymph nodes (MLN) on day 6 post-infection (p.i.). Interestingly, we did not isolate Yersinia from MLN samples on day 6 p.i.. Since RIVET resolution is permanent, one hypothesis is that Salmonella detected acyl-HSL in a locale other than the MLN and resolved, migrated to the MLNs, and underwent clonal

expansion. A second hypothesis is that RIVET activity truly occurred in the MLN, and this would be indicative of novel ligand-independent activation of the SdiA regulon. Thus, it remains unclear if SdiA has been conserved for the detection of other pathogens in the gut. The Salmonella SdiA model poses an intriguing and fundamental question; do acyl-HSLs exist within mammalian intestines? We previously scanned scientific literature and probed the human Microbiome

(www.hmp.org) for representative gut commensal Proteobacteria that encode

LuxI (and/or LuxR) homologs. Indeed, the potential for acyl-HSL production exists since some organisms encoded LuxI homologs. Recently, improvements in metagenomic sequencing have led to numerous studies on the global effect of inflammation on the gut microbial community, and composition analyses have also been done during Salmonella -induced inflammation. Interestingly,

Salmonella -induced gut inflammation leads to a bloom of Proteobacteria species. Currently, we are investigating SdiA activity during Salmonella -induced gut inflammation.

3.2 Introduction

A subset of the Enterobacteriaceae family, including the Salmonella ,

Escherichia, Klebsiella, Enterobacter, and Shigella genera, do not produce acyl-

HSL signals, but do encode a solo LuxR-type transcription factor, named SdiA, that is capable of sensing and responding to acyl-HSL variants (32, 43, 71, 72,

121, 156, 401, 402). Salmonella SdiA in particular can detect several acyl-HSL variants, and those produced by other bacterial species (71, 72, 402). The

Salmonella SdiA regulon is comprised of seven genes across two genetic loci. srgE (sdiA-regulated gene) is a single horizontal gene acquisition located at 33.6 centisomes on the Salmonella chromosome. Computational bioinformatics predict that SrgE is a type three secreted effector (136, 160-166), and work performed by Fabien Habyarimana of our group confirms that SrgE is secreted via Salmonella type three secretion system two (T3SS-2)(Habyarimana unpublished). The second locus includes six genes, pefI-srgD-srgA-srgB-rck- srgC, which comprise the rck operon located on the Salmonella virulence plasmid (pSLT) (71, 158, 402). Rck is predicted to be an eight-stranded beta barrel protein located in the outer membrane (129, 130, 403, 404). Rck inhibits the polymerization of the human complement component C9, and thus confers resistance to complement-mediated killing (133, 405). Rck is also involved in adherence to epithelial cells and extracellular matrices (laminin and fibronectin), and has been shown to induce actin-rich sites in epithelial cells resulting in zipper-like internalization (72, 134, 135).

Previously, we tested the hypothesis that Salmonella uses SdiA to detect acyl-HSLs produce by the mammalian gut flora (71, 406). We reasoned that

Salmonella uses SdiA to detect its entry into the intestine through gut flora- produced acyl-HSLs, and in response to gut flora acyl-HSLs, up-regulates putative host interaction factors of the SdiA regulon. However, an S.

Typhimurium RIVET reporter system did not detect acyl-HSLs in the intestines of many animals (a cow, a rabbit, a guinea pig, conventional pigs, mice and chickens), except turtles (71, 72). While the turtles used in previous RIVET assays were otherwise healthy, they were chronically colonized with Aeromonas hydrophila, a known acyl-HSL-producer and fish pathogen. Strong, yet indirect evidence suggests A. hydrophila to be the organism responsible for RIVET activity (70, 71). To build on these results, we tested the hypothesis that RIVET would detect the acyl-HSL-producing gut pathogen, Yersinia enterocolitica, in a mouse co-infection model (72, 170). Indeed, mice co-infected with WT Y. enterocolitica caused RIVET activation, which occurred throughout the intestines and mostly in Peyer’s patches (72, 170). Surprisingly, competition experiments between WT and sdiA- Salmonella did not indicate an sdiA fitness phenotype (72,

167, 407-414).

It is known that Salmonella and Yersinia are frequent colonizers of pigs (160-

169) therefore, we reasoned that sdiA phenotypes could be studied in pigs where

S. Typhimurium - Y. enterocolitica co-colonization events occur naturally. For this study, we sought conventional pigs that had never been exposed to- or colonized-with Salmonella or Yersinia species. To do this, we purchased pigs 49

from specific pathogen-free pig vendors and attempted to model Salmonella -

Yersinia co-infections in the pigs to study sdiA phenotypes.

3.3 Results

3.3.1 A pilot pig RIVET experiment indicated an sdiA-dependent shedding burst phenotype of Salmonella (performed by Jessica Dyszel and Darren Lucas)

It was hypothesized that sdiA phenotypes would occur during an S.

Typhimurium –Y. enterocolitica co-infection in conventional pigs. To test this hypothesis, three groups of four-week-old weaned female Yorkshire pigs (five per group) were inoculated with either WT Y. enterocolitica biovar 1B (serogroup

O:8) strain JB580v, isogenic yenI- Y. enterocolitica GY4493, or PBS. 24 hours later, all pigs were orally inoculated with a 1:1 mixture of JLD1208 and JLD1205, the WT and sdiA- Salmonella RIVET reporter strains, respectively. Salmonella infection day is referred to as day zero post-Salmonella infection (p.i.). Rectal fecal samples were over an 18-day period, and we observed an sdiA-dependent shedding burst on day 9 p.i.. The shedding burst was characterized by a 100-fold increase in Salmonella shedding in the group of pigs infected with WT Y. enterocolitica, and 94% of the Salmonella screened from the burst were WT, of which 98% had resolved (fig. 19). Control group pigs, infected with yenI- Y. enterocolitica or PBS, did not exhibit the same sdiA-dependent shedding burst

(fig. 19). Interestingly, the shedding burst was not sustained in the following days.

This result implies that at least two populations of Salmonella existed within the pig, 1) those that had sensed acyl-HSLs and underwent a massive exodus, and

2) those that did not resolve and shed at a low-level rate for the duration of the experiment. For this pilot experiment, no attempt was made to recover Y.

enterocolitica organisms due to lack of culture selection conditions for JB580v.

3.3.2 An sdiA-dependent fitness phenotype is observed in some organs

Having observed an sdiA shedding phenotype in a pilot experiment, we wanted to determine where Salmonella SdiA is active in vivo. In mice, the majority of SdiA activity occurred in the Peyer’s patches (72, 413), so we hypothesized that Salmonella RIVET would also be active in pig Peyer’s patch tissue. To test this hypothesis, we inoculated a single group of 12 pigs (Midwest

Swine Research) with GY5456, a WT kanr Y. enterocolitica. After 24 hours, we inoculated the pre-infected pigs with a 1:1 mixture of JLD1208 and JLD1205

Salmonella RIVET strains. All inocula were suspended in PBS. The pilot pig

RIVET experiment indicated that resolution was dependent on co-infection with

WT Y. enterocolitica, and resolution did not occur in pigs infected with yenI- Y. enterocolitica or PBS mock-infection. Therefore, we did not repeat the yenI- or

PBS mock-infected control groups to avoid sacrificing additional pigs.

We obtained daily rectal fecal samples from pigs each day p.i. for 14 days.

We reasoned that daily fecal samples would allow us to pinpoint the exact day of the shedding burst. Considering that the Salmonella fecal shedding burst occurred on day 9 p.i., we attempted to determine the location of SdiA activity within pigs, thus, we dissected four pigs on days 6, 11, and 14 p.i.. Based on the pilot experiment, we anticipated that the shedding burst would occur on day 9 p.i., and predicted that day 6 and 11 dissection days would allows us to better

describe SdiA-active/inactive Salmonella populations within the pig prior to and after the shedding burst. Salmonella recovered from fecal samples and organ samples had very little-or-no detectable resolution (fig. 20 B), and logCI values for feces and organs samples did not significantly favor the WT or mutant (fig. 20

A). Strikingly, we recovered very little Yersinia in fecal and organ samples (fig. 20

D and 3 D, limit of detection, LOD 1 CFU / 3 mL total volume), and we believe that the low Yersinia load in pigs directly attributed to the lack of RIVET activity

(fig. 21 B). In an effort to enumerate Yersinia CFU in fecal and organ samples, we used a WT kan-selectable Y. enterocolitica strain, GY5456. However, we wondered if GY5456 had become avirulent prior to infection, as it is possible that during genetic manipulation or improper culturing, the Y. enterocolitica virulence plasmid, pYV, can be lost (72, 403, 404). Therefore, we analyzed GY5456 for the presence of pYV using polymerase chain reaction (PCR) to amplify the pYV- encoded Yersinia outer protein gene, yopO (Table 7, primers BA1968 and

BA1969). PCR indicated GY5456 had indeed lost the pYV (data not shown).

We repeated the RIVET experiment described above (pigs from Midwest

Swine Research), except this time we used WT Y. enterocolitica JB580v predicting that pYV would improve Y. enterocolitica colonization (72), and to enumerate Y. enterocolitica, we used specialized Yersinia-selective agar (see

Methods). Inocula were suspended in PBS. Yersinia CFU increased in fecal samples, although, they were still low relative to Salmonella , and Yersinia shedding in feces after 4 days p.i. was at or below the LOD (fig. 22 D).

Coincidentally, two of the pigs met early removal criteria and required euthanasia 53

on day 9 p.i., hence, figure 5 shows an extra day 9 p.i. time point. Yersinia colonization was sporadic, with the exception of tonsil tissues where colonization was consistently ≥100-fold higher on each dissection day than all other organ samples (fig. 23 D). We observed no RIVET resolution or significant competitive index values in pig fecal samples (fig. 22 A and B). There also was no detectable resolution in pig organs samples (fig. 5 B), however, we did observe significant logCI values favoring WT Salmonella recovered from Peyer’s patches on days 6 and 11, and the cecum wall, cecum contents, and large intestine contents also on day 11 (fig. 23 A). Only one sample from the MLN on day 11 and cecum contents on day 14 had detectable Salmonella, but competitive index values also indicated a fitness advantage for WT Salmonella in these samples (fig. 23 A).

Many of the significant logCI values occurred in samples where Yersinia was not detected. It is possible that another acyl-HSL-producer was colonizing the pigs, but we did not detect RIVET activity. Another possibility is that sdiA has ligand- independent activity in pigs. Whichever the case may be, this result did not occur in our first RIVET experiment using GY5456, and the pig pilot experiment indicates that sdiA is dependent on acyl-HSL-producing Y. enterocolitica.

3.3.3 Salmonella RIVET activity occurred primarily in pig mesenteric lymph nodes on day 6 post-Salmonella infection

Yersinia colonization in the pigs had thus far been low and/or sporadic, but we still wanted to verify if Salmonella could detect acyl-HSLs in vivo. Previously, we reported that 106 CFU of Y. enterocolitica are required to activate RIVET in

mice (72, 415, 416). We considered our methods for RIVET, and wondered if the

PBS-suspended inoculum hindered Yersinia colonization since Clark and colleagues previously demonstrated that a Luria-Bertani (LB) broth-suspended inoculum vastly improved Salmonella colonization of mice (173, 406). We predicted that LB would have a similar effect on Yersinia in pigs. We repeated the pig RIVET experiment (pigs from Isler Genetics) as before, but with Y. enterocolitica and Salmonella inocula suspended in LB broth. Indeed, Yersinia colonization was dramatically enhanced in both fecal and organ samples (fig. 24

D and 7 D). While there was little-or-no detectable RIVET activity in fecal samples (fig. 24 B), we did observe relatively high resolution (35%) occurring in the MLN on day 6 p.i. (srgE-tnpR in vitro resolution occurs at 23% in 0.3% agar infused with 1µM synthetic oxoC6, data not shown) (fig. 25 B). Resolution also occurred in the cecum wall, but at a lower level (12%). Inspection of these data revealed a contradiction; while the majority of resolution occurred in the MLN of pigs on day 6 p.i., we did not detect Yersinia (fig. 25 D, with a LOD 1:40) in those particular samples.

3.3.4 yenI+ Salmonella in pigs indicate a hyper-virulent phenotype for the sdiA mutant

The data from srgE-tnpR RIVET indicate that Salmonella can detect

Yersinia acyl-HSLs in pigs; it is unclear if detection is dependent on acyl-HSLs due to a lack of Yersinia in the MLN, but acyl-HSL-detection overall did not result in sdiA phenotypes. This result conflicts with a pilot experiment where an sdiA

shedding phenotype was observed, therefore, we wanted to determine if studying sdiA phenotypes in pigs is feasible. We competed the yenI+ Salmonella strains, as in chapter 3 (72, 172, 173, 417, 418), but in pigs (pigs from Isler Genetics).

We hypothesized that WT Salmonella would be more fit than the sdiA mutant when both strains express yenI. To test this hypothesis, we inoculated twelve pigs with a 1:1 mixture of JNS1201 and JLD1203. We took into account our previous srgE-tnpR RIVET data where we observed SdiA activity occurring on day 6 p.i. (fig. 25 B), and we adjusted our dissection time points to days 3, 6, and

10 p.i. to better describe Salmonella RIVET activity. The data from pig organ samples (fig. 26 B) represents a compelling finding that suggests the sdiA mutant is hyper-virulent in day 3 Peyer’s patches and MLN, and day 6 Ileum, cecum, large intestine and Peyer’s patch milieus.

Because JNS1201 and JNS1203 yenI+ strains only share one selectable antibiotic marker, we were met with difficulty in recovering Salmonella from pig feces since many gut-colonizing organisms were able to grow on XLD kan media. Thus, we do not have reportable CFU/g values for Salmonella in feces.

Given the circumstances, we elected to perform tetrathionate broth enrichment of pig fecal samples, and were successful at recovering kanr Salmonella. In vitro testing did not indicate an sdiA growth phenotype in modified tetrathionate brilliant green (TGB) broth as was used for feces (data not shown). Therefore, we assumed that the ratio of WT and sdiA mutant Salmonella in pig fecal samples would remain the same after enrichment, such that we could screen Salmonella from fecal sample enrichments for competitive indices. As was the case in pig 56

organs, we observed that the sdiA mutant was significantly enriched in pig fecal samples (fig. 26 A).

3.3.5 srgE does not contribute to the Salmonella sdiA- fitness advantage in the yenI+ background in pigs

In parallel to work with RIVET in pigs, Mohamed Ali of our group headed a forward genetics screen using a Transposon site hybridization (TraSH) method to identify genes required for Salmonella fitness during co-infection with Y. enterocolitica in pigs (Isler Genetics). TraSH is a powerful tool for massive parallel screening of genes required in different growth conditions. This approach requires a transposon mutant library, and for this experiment we used JLD200k, an S. Typhimurium transposon library made by Jessica Dyszel, consisting of

200,000 mutants (~40x genome saturation). This library was made using the

Epicentre kit that has both a kanamycin resistance marker and a phage T7 promoter pointing outwards. First, an input DNA library was grown in LB broth and the DNA was isolated. Dr. Peter White’s group at Nationwide Children’s

Hospital (Columbus, Ohio) then performed an in vitro transcription step using phage T7 RNA polymerase with fluorescently labeled nucleotides to amplify the transposon insertion sites. The labeled transcripts are kept short in size by performing a restriction enzyme step using RsaI. These resulting transcripts were directly hybridized to an S. Typhimurium microarray. The LB broth-grown input library also served as the inoculum for the genetic screen. For this experiment, we infected two panels of five pigs with the JLD200k input library; one panel was

pre-infected with Y. enterocolitica and another with mock LB-broth infection. On day 4 pi, the pigs were sacrificed, a cecum sample of each pig was dissected, and bacterial DNA was extracted. The extract DNA represents the output library, which was labeled as before and hybridized to the input array. Thus, microarray spots that intensify/diminish represent Salmonella mutants selected for/against.

We determined that the only gene required for fitness during a Y. enterocolitica co-infection was srgE. Given our results with yenI+ Salmonella in pigs, where the sdiA mutant was generally more fit than the WT, and the results obtained from our blind TraSH screen, we became interested in the role that srgE played in sdiA phenotypes.

The data obtained from yenI+ Salmonella in pigs may be indiscernible if sdiA is indeed expressed tissue-specifically, but TraSH indicated a strong selection for Salmonella srgE in pigs co-infected with Y. enterocolitica. Therefore, we hypothesized that WT Salmonella would be more fit than srgE- Salmonella in pig ceca. To test this hypothesis, we used srgE mutant derivatives of the yenI+

Salmonella strains. We performed WT vs. srgE- competitions in pigs (Isler

Genetics) in both WT and sdiA- backgrounds (to determine sdiA-dependency).

One panel of five pigs was infected with an equal mix of JLD1201 and JLD1227

(srgE+ and srgE-, respectively, in yenI+ background), and another panel of five pigs was infected with JLD1203 and JLD1229 (srgE+ and srgE-, respectively, in the sdiA- yenI+ background). However, there was not a srgE phenotype in either

WT or sdiA- background for fecal or organ samples (fig. 27 B, C, E, & F). It is interesting to note that, during the previous yenI+ competition in pigs, the sdiA 58

mutant was significantly favored in day 3 Peyer’s patches and MLN, and day 6

Ileum, cecum, large intestine and Peyer’s patch milieus, but when srgE is non- functional the hyper-virulent mutant phenotype is abrogated.

The original TraSH screen was performed during live co-infections with Y. enterocolitica. Thus, it is possible that excluding Y. enterocolitica from the above experiment abrogated the srgE phenotype. Therefore, we tested the hypothesis that Y. enterocolitica is required for the pig srgE phenotype. For this experiment, we did not test for sdiA-dependency of the srgE phenotype. Therefore, a single group of five pigs (Isler Genetics) was pre-infected with WT Y. enterocolitica.

After 24 hours, we infected the pigs with a 1:1 mixture of MA43 and MCS110

(srgE+ and srgE-, respectively). We took daily fecal samples, and on day 4 pi we sacrificed and dissected the pigs as before. Again, however, we observed no difference in wild-type and mutant numbers in either fecal or organ samples (data not shown).

3.3.6 Determining if sdiA is expressed tissue-tropically using sdiA-tnpR RIVET

One striking and consistent observation of the pig RIVET experiments is the high level of co-colonization of Salmonella and Yersinia in pig tonsil tissues

(see representative data in figs. 25 C & D), However, we never detected SdiA activity in tonsil tissues. In addition, even though the mutant was favored in a yenI+ Salmonella competition, we observed no difference in WT or sdiA mutant numbers in all tonsil samples (fig. 26 C). There are three possible explanations

for this phenomenon, 1) Salmonella and Y. enterocolitica may co-colonize the tonsil tissue, but do not co-localize sufficiently to activate RIVET, 2) Y. enterocolitica does not produce acyl-HSLs whilst living in tonsil tissue or 3) sdiA is not expressed in tonsils. We considered the following: First, LuxI proteins are typically expressed constitutively, and Jacobi and colleagues previously reported the production of acyl-HSLs by Y. enterocolitica in several organ systems in mice

(12, 172, 173, 419). Given these data, it seems unlikely that Y. enterocolitica does not make acyl-HSLs in tonsils. Secondly, our lab and others have previously reported that the expression of sdiA and the SdiA regulon is signal and/or conditional-dependent (43, 70, 75, 146). Thus, it is possible that tonsil colonization mimics non-inducing conditions for sdiA-expression. We therefore hypothesized that Salmonella sdiA expression is tissue-tropic in pigs.

To test this hypothesis, we pre-infected four pigs (Isler Genetics) with

JB580v Y. enterocolitica as described above, and 24 hours later we inoculated the pre-infected pigs with a RIVET strain containing an sdiA-tnpR fusion, named

MCS27. Noel and colleagues previously used JNS3216 to assess sdiA expression in tomatoes (85, 174, 175). MCS27 is a chloramphenicol marked

(phoN::camr) derivative of the parent JNS3216. Noel and colleagues reported low sdiA expression using sdiA-tnpR in tomatoes compared to 69% resolution in vitro

(growth on 0.3% agar at 22°C) (85, 420). Our MCS27 strain resolved comparably at 62% after growth in shaking LB-broth at 37°C (data not shown). However, we did not detect sdiA-tnpR expression in tonsils (data not shown), which is consistent with our hypothesis that sdiA is expressed tissue-specifically. 60

However, we observed little or no sdiA-tnpR activity (relative to in vitro testing) in any other organ or fecal sample (fig. 28 C & D). Preliminary testing of MCS27 in vitro indicated that sdiA is highly active in shaking LB-broth; the same conditions used to grow the pig inoculum. We grew MCS27 in the presence of tetracycline to maintain an inoculum of sdiA-tnpR+ Salmonella. In retrospect, it is possible that growth of the inoculum in the presence of tetracycline selected for a

Salmonella clonal population that does not resolve.

3.3.7 Genes required for general Salmonella fitness in pigs

Using TraSH, we identified genes that were required for S. Typhimurium fitness during Y. enterocolitica co-infection in pigs. However, we could not ignore that some genes were required for the general fitness of S. Typhimurium during pig infection. For example, two candidate genes, csgF and pagD, which are involved in outer membrane maintenance, (72, 167, 407-414), were required for

S. Typhimurium fitness under both co-infected and non-co-infected conditions.

Therefore, we hypothesized that csgF and pagD mutants would have fitness defects relative to WT S. Typhimurium during competition in pigs (Isler Genetics).

To test this hypothesis, we competed MA43/MCS122 (WT and csgF-, respectively) and MA43/MCS126 (WT and pagD-, respectively) in groups of five pigs each. As before, we screened for competitive indices in pig fecal samples and day 4 p.i. organ samples. Strikingly, we did not observe fitness defects for either csgF or pagD in any pig sample screened (data not shown).

3.3.8 An sdiA phenotype is observed in mouse small intestines when Salmonella produces acyl-HSL

In pigs, an sdiA mutant S. Typhimurium was more fit than WT when both strains expressed yenI+, yet this result is in contrast to yenI+ competitions conducted in CBA/J mice (72, 121). To reiterate, the goal of this work is to study sdiA phenotypes. Therefore, we proceeded to model yenI+ S. Typhimurium infections in mice. In chapter 3, it was not determined if S. Typhimurium colonizing the organs of mice emulated the sdiA shedding phenotype because

CBA/J mice are resistant to S. Typhimurium infection. Therefore, in this experiment, we wanted to determine if WT S. Typhimurium outcompetes an sdiA mutant during colonization of mouse organs. To do this, we competed WT and sdiA mutant S. Typhimurium expressing yenI in susceptible BALB/c mice. As in previous competitions experiments, BALB/c mice were given a 1:1 mixture of WT and sdiA mutant S. Typhimurium expressing yenI+. BALB/c mice rapidly succumb to a full-dose S. Typhimurium infection (3-5 days), and our previous results with

RIVET indicated SdiA activity occurred by day 4 p.i. in BALB/c mice (72, 421), hence we chose a day 4 p.i. time point for mouse necropsy. Using a group of 10 mice, we observed a significant competitive advantage for WT S. Typhimurium in the small intestine samples (fig. 29 A), but not in the cecum, large intestine,

Peyer’s patches, or MLN.

! 3.3.9 Salmonella sdiA phenotypes are not observed in a humanized mouse model

A previous report from our group demonstrated that S. Typhimurium

RIVET was not active in the intestines of most healthy animals, but was active in turtles colonized with A. hydrophila, a fish pathogen (71, 422). In chapter 3, we hypothesized that S. Typhimurium would detect the acyl-HSL produced by pathogenic Y. enterocolitica in mice, and indeed, RIVET was active in mice co- infected with WT Y. enterocolitica, but this interaction did not result in sdiA phenotypes as predicted (71, 72). In a review of the literature in chapter 4, we cite that at least three organisms represented in the Human Microbiome Project database encode LuxI homologs (Hafnia rodentium, Edwardsiella tarda, and a

Ralstonia species)

(43, 85). In addition, a search of the literature revealed four other possible mammalian intestinal commensals (Acinetobacter baumannii, Citrobacter rodentium, Pseudomonas aeruginosa, and Serratia odorifera) are capable of acyl-HSL synthesis (43, 71). In parallel to this idea, during intestinal inflammation, the gut microbial composition changes in a way that results in a bloom of proteobacteria species which otherwise make up a small percentage of the community (72, 172). Thus, for this experiment, we hypothesized that S.

Typhimurium-induced intestinal inflammation would lead to an overgrowth of

Proteobacterial species that produce detectable levels of acyl-HSLs, which S.

Typhimurium can detect through SdiA. A growing body of literature suggests that

S. Typhimurium purposely induces inflammation in the gut to create a niche, (8,

72, 423-428), and it has been shown that S. Typhimurium-induced inflammation also results in a bloom of Proteobacterial species (72, 173). While the mouse is a good model for Salmonella invasive disease, conventional mice do not normally develop intestinal inflammation after S. Typhimurium infection. While the commensal composition of mice and humans are highly similar, they do differ

(72, 172). Chung and colleagues have shown that humanized mice, but not WT conventional mice, are not only susceptible to S. Typhimurium infection, but develop gut inflammation after Salmonella infection (172, 420).

We wanted to test if S. Typhimurium-induced inflammation in humanized mice leads to RIVET activation. Therefore, we humanized germ-free Swiss

Webster mice (HuSWEBS) by oral gavage with the fecal slurry of a healthy adult male, and allowed the mice to stabilize for five days. Then, we orally inoculated five HuSWEBS with the srgE-tnpR RIVET strains as before. We hypothesized that S. Typhimurium RIVET would be active in an sdiA-dependent manner, and acyl-HSL detection would result in an sdiA fitness phenotype. Unlike conventional SWEBS, HuSWEBS were highly susceptible to S. Typhimurium infection as indicated by survivability over time (fig. 30 E). Two of the HuSWEBS mice died overnight, and we excluded them from the test results. Thus, our data represents three mice that met early removal criteria (ERC) and were euthanized. We harvested organ samples for S. Typhimurium recovery and screening (fig. 30 A and C). We also attempted to take fecal samples from the mice, but after day 4 p.i., the mice had stopped defecating due to illness. Thus, 64

only two fecal time points are represented in figure 14 B. S. Typhimurium RIVET was not active under these conditions. In contrast to chapter 3.3.8, we observed a small yet significant sdiA fitness phenotype in the small intestine samples that favored the sdiA mutant. Thus, we both by hypotheses were false that SdiA would be active and WT S. Typhimurium would be more fit than the sdiA mutant.

3.3.10 Salmonella SdiA is active in a long-term persistence mouse model of gut inflammation

An alternative model for studying S. Typhimurium-induced gut inflammation in mice was recently reported (174, 175, 429), and in this model S.

Typhimurium resistant mice develop cecal inflammation by day 10 p.i. (174). As stated above, S. Typhimurium-induced gut inflammation results in a bloom of

Proteobacteria. Thus, as an alternative to humanized mice, we wanted to measure SdiA activity in a long-term persistence model. We inoculated two panels of CBA/J mice with either WT or sdiA- S. Typhimurium RIVET strains and collected fecal samples over the course of 21 days. We recovered S.

Typhimurium from the feces, and screened them for SdiA activity. On day 19, mice infected with the WT RIVET strain averaged 12.5% resolution in fecal sheds, compared to no resolution in five mice infected with the sdiA- RIVET strain

(data not shown). Currently, we are confirming this result in additional mice, and are searching for the organism(s) responsible for SdiA activity.

3.4 Conclusion

3.4.1 Contribution of SdiA to Salmonella fitness in pigs

Previous work using RIVET indicated that S. Typhimurium does not detect acyl-HSLs in the intestinal tract of most animals (71). S. Typhimurium could, however, detect the acyl-HSLs produced by A. hydrophila and Y. enterocolitica in turtles and mice, respectively, in an sdiA-dependent manner (32, 43, 71, 72, 121,

156, 174, 401, 402). SdiA detection of Y. enterocolitica acyl-HSLs in mice did not confer a fitness advantage for WT S. Typhimurium (71, 72, 402), and while the mouse allows for efficient colonization of both S. Typhimurium and Y. enterocolitica, we suspected that the mouse model was not conducive to studying natural sdiA phenotypes. It is known that Salmonella and Yersinia are frequent colonizers of pigs (136, 160-166).Therefore, this work sought to investigate natural sdiA phenotypes by modeling S. Typhimurium –Y. enterocolitica co-infections in a conventional pig model. We hypothesized that S.

Typhimurium would detect Y. enterocolitica-produced acyl-HSLs in the intestine of pigs, and detection would confer a fitness advantage for WT S. Typhimurium over the sdiA- mutant . To test this, we used an S. Typhimurium srgE-tnpR RIVET reporter system (71, 158, 402). A pilot RIVET experiment in pigs co-infected with

Y. enterocolitica indicated an sdiA-dependent shedding burst (100-fold more S.

Typhimurium) on day 9 p.i., where 98% of the Salmonella excreted were WT, of which 94% had resolved (fig. 19).

To better characterize SdiA activity in vivo, we repeated the RIVET

experiment and dissected 12 pigs over the course of 14 days to identify the tissues and/or tissue constituents in which Salmonella SdiA activity takes place.

We hypothesized that the majority of SdiA activity would occur in the Peyer’s patches of pigs, but Yersinia colonization in this experiment was often below the limit of detection (fig. 20). We observed very little or no resolution in any organ or fecal samples taken, and there was no sdiA phenotype as indicated by competitive indices. In reviewing our methodology, we considered our use of

GY5456, a kanr WT Y. enterocolitica strain. It is known that genetic manipulation or some in vitro growth conditions can result curing of the pYV (129, 130, 403,

404), which is responsible for the delivery of Yops virulence effectors (133, 405).

Ultimately, we confirmed that the stock of GY5456 used to inoculate pigs did not contain pYV, and we reasoned that loss of the pYV might have contributed to poor Yersinia persistence. We repeated the pig RIVET experiment using WT Y. enterocolitica JB580v (pYV+). In this case, Yersinia shedding in feces was increased 10 – 100 fold in the first 6 days p.i., and trickled from high-to-low shedding before becoming undetectable (fig. 21). We observed significant log competitive indices favoring WT S. Typhimurium in Peyer’s patches on day 6 and

11 p.i., and in cecum and large intestine samples on day 11 p.i., but the RIVET reporter was inactive (fig. 22 A and 23 B). Previous mouse experiments determined that 106 CFU Yersinia is required to activate RIVET (72, 134, 135), and while Yersinia colonization of tonsil tissues was improved 100-1000 fold in this experiment (fig. 23 D), Yersinia was often undetectable through the intestines and systemic sites. We believe that the lack of Yersinia colonization in 67

feces and organs accounts for the inactivity of RIVET. However, observing sdiA fitness phenotypes in some organs with no indication of srgE-tnpR activity may be evidence of ligand-independent activity occurring in pigs, and this idea is discussed below in more detail.

In an effort to determine if S. Typhimurium could detect Y. enterocolitica acyl-HSLs in vivo, we attempted to enhance bacterial colonization in organs. To do this, we repeated the RIVET experiment above, but with inocula suspended in

LB-broth, as this has been reported to enhance pathogen colonization in mice

(71, 406). Indeed, LB inocula enhanced Y. enterocolitica colonization up to 1000 and 10,000-fold in organs and fecal samples, respectively (fig. 24 D and 7 D). In comparison to previous RIVET experiments, S. Typhimurium colonization was minimally enhanced (fig. 24 C and 7 C), but screening of S. Typhimurium recovered from organs indicated SdiA activity in day 6 p.i. MLN samples (35% of total S. Typhimurium screen, fig. 25 B). Surprisingly, RIVET activity in the MLN occurred in the absence of Yersinia. If RIVET activation is entirely acyl-HSL dependent, and previous studies firmly suggested that it is (71, 72)), it is possible that S. Typhimurium co-colonizing an organ with Yersinia resolved, migrated to the MLN, and clonally expanded. However, the resolution data from this experiment is an average of four random pigs (fig. 25 B). 2/4 pigs independently resulted in clonal expansion scenarios in the MLN. If clonal expansion is occurring at no less than 50% of the time in pigs, it could perhaps mean that

SdiA activity results in MLN invasion, In which case we would predict that WT

Salmonella would dominate the MLN. The actual logCI values in MLN samples, 68

however, are neutral (fig. 25 A).

In contrast to the clonal expansion hypothesis, these data partially agree with the previous RIVET experiment where A) we observed sdiA-phenotypes occurring in some organs samples, but in the absence of RIVET activity, and here, B) we observed RIVET activity, but this did not result in sdiA phenotypes.

While either case is peculiar, they both suggest that the SdiA regulon is activated independent of acyl-HSLs. For scenario A, one possibility is that we are observing ligand-independent activity in vivo that does not result in activation of the srgE-tnpR fusion. Thus, the sdiA phenotype could be due to specific activation of the rck operon. For scenario B, we observed srgE-tnpR activation, but it did not result in sdiA-phenotypes. Ligand-independent activity has been demonstrated for the srgE promoter by our group for both S. Typhimurium and E. coli in vitro when sdiA is over-expressed from a plasmid or at temperatures ≤

30°C. The rck operon, however, is only activated at 37°C (physiological temperature) in response to acyl-HSLs or when sdiA is overexpressed from a plasmid (70, 71). Therefore, one possible explanation for this phenomenon is that in certain conditions within the pig, sdiA itself is highly up-regulated and leads to the expression of SdiA regulon members, resulting in sdiA phenotypes. The caveat to this idea is that sdiA over-expression in vitro leads to activation of both srgE and rck, and if this is also true in vivo, then why do we not observe srgE- tnpR RIVET activity? Taken together, these data might indicate that rck, but not srgE, has a fitness phenotype in pigs. By coincidence, TraSH did indicate that srgE is required for fitness in pigs during co-infection with Y. enterocolitica, 69

however, 1:1 competitions did not indicate a srgE fitness phenotype (fig. 27 B, C,

E, and F). For the time-being, it remains unclear if srgE plays a role in

Salmonella fitness, but additional testing would be required to also address rck phenotypes in vivo. We propose that a good starting point would be to monitor sdiA expression in vivo in real-time, testing the hypothesis that sdiA expression is highly induced in vivo. It is possible that in vivo conditions lead to expression levels of sdiA not previously observed, and therefore ligand-independent activation of SdiA regulon members. We did attempt to monitor sdiA expression in vivo using RIVET, but these results remain inconclusive. While ligand- independent activation has not be reported for Salmonella or E. coli in vivo, work done by Sabag-Daigle of our group indicates that the mouse commensal

Enterobacter cloacae, which also encodes sdiA, does have an sdiA fitness phenotype in mice that is ligand-independent (Sabag-Daigle unpublished).

Our initial pilot pig RIVET experiment indicated an S. Typhimurium sdiA- dependent acyl-HSL-dependent shedding burst in feces. However, this result was irreproducible in three subsequent pig RIVET trials. In addition, results with

RIVET in pigs indirectly suggested acyl-HSL-independent activity, where one experiment resulted in sdiA phenotypes and one did not. In an attempt to ultimately determine if SdiA-acyl-HSL-detection results in sdiA phenotypes in pigs, we competed WT and sdiA- S. Typhimurium that expressed yenI in pigs.

Under these conditions, SdiA should be continually active. Strikingly, we observed a hyper-virulent phenotype for the sdiA mutant in some fecal and organ samples. This is not the first time that a hyper-virulent phenotype has been 70

observed in vivo upon deleting the LuxR homolog of an organism. For instance, deletion of the CroR of C. rodentium results in a similar phenotype in which the croR mutant is more fit than WT in mice (72, 170). It was speculated that deletion of croR leads to dysregulated surface attachment and over-invasiveness that ultimately lead to the faster killing of mice (72, 170). Because the in vivo function of the SdiA regulon members has not been precisely described, we cannot offer speculation as to why an sdiA mutant outcompetes the WT.

In parallel to the RIVET experiments, Mohamed Ali conducted a TraSH screen for genes involved in S. Typhimurium fitness during co-infection with Y. enterocolitica in pigs, and identified the SdiA target srgE (Ali unpublished). As mentioned above, 1:1 competitions between WT and srgE- S. Typhimurium did not indicate a fitness phenotype. In addition, we tested csgF and pagD for fitness phenotypes because TraSH indicated both genes to be required for the general fitness of S. Typhimurium in pigs. In 1:1 competition experiments, however, we did not detect fitness phenotypes for either csgF or pagD. Both CsgF and PagD are involved in outer membrane maintenance (discussed below), and SrgE is a type three secreted effector (Habyarimana unpublished). CsgF is involved in curli production and PagD is an outer membrane protein that may play a role in antimicrobial peptide resistance (72, 167, 407-414). CsgF from S. Typhi has been shown to elicit a pro-inflammatory response by peripheral blood monocytes

(160-169), and pagD has been implicated in virulence (72, 413). The function of

SrgE as a type three secreted effector has not been described, but since it is secreted into host cells, it undoubtedly plays a role in host-pathogen interaction. 71

Thus, the three genes tested in competition in this study may alter the host response in such a way that trans-complements an isogenic mutant in vivo, which would abrogate discernible competitive index phenotypes when the input ratio is 1:1. More work is needed to definitively conclude whether srgE, csgF, and pagD truly play a role in Salmonella fitness in pigs.

3.4.2 Contribution of SdiA to Salmonella fitness in mice

Previously we demonstrated that WT S. Typhimurium outcompetes the sdiA mutant in CBA/J mouse fecal sheds when both strains secrete acyl-HSLs

(72, 403, 404). This is in contrast to our result in pigs in chapter 3.3.4, where we observed a hyper-virulent phenotype for sdiA mutant S. Typhimurium colonizing organs. In chapter 3 mouse experiments, however, it was not determined if S.

Typhimurium colonizing the mouse organs emulated the WT shedding fitness phenotype (this is because CBA/J mice are resistant to S. Typhimurium infection). We considered both the mouse and pig competition results when using yenI+ S. Typhimurium. We reasoned that sdiA could play a role in shedding in the feces, but not in organ colonization. Using BALB/c mice (S. Typhimurium- susceptible), we tested for sdiA fitness phenotypes in mouse organs using yenI+

S. Typhimurium. We observed significant logCI values favoring WT S.

Typhimurium localized to the small intestines (fig. 29 A). We did not observe the fitness phenotype in Peyer’s patches, however, which are located at the terminal ileum of the small intestine. This is an interesting observation when considering our previous mouse RIVET studies in chapter 3, where we observed the SdiA 72

RIVET reporter to be most active in Peyer’s patches (72). Lastly, while we did separate Peyer’s patches from the small intestine (and observed a phenotypic difference), we did not lavage luminal contents of the small intestine. This oversight represents a caveat in this experiment since our objective was to determine if sdiA plays a role in organ colonization and/or fecal shedding. In retrospect, it is possible that the sdiA fitness phenotype is specific to the luminal contents (i.e. S. Typhimurium to be shed) and not for S. Typhimurium colonizing the small intestine epithelium and vice versa.

Metagenomic analyses of mammalian gut microbiotas indicate that the

Firmicutes and Bacteroidetes phyla dominate the gut (72, 415, 416), and that proteobacterial species represent a small percentage of the population (1 – 4%)

(173, 406). Analysis of the gut composition during inflammation or inflammation- mimicking conditions, however, indicate a decrease in overall species diversity and a bloom in proteobacterial species (72, 172, 173, 417, 418). A growing body of literature suggests that S. Typhimurium actively induces intestinal inflammation in order to create a livable niche, and indeed, S. Typhimurium- induced inflammation has been shown to give rise to the proteobacterial bloom

(12, 172, 173, 419). In our review article (chapter 4), we cite that at least seven known gut proteobacterial species are capable of producing acyl-HSLs (43, 70,

75, 146). Thus, we hypothesized that S. Typhimurium-induced inflammation would lead to SdiA activity/acyl-HSL detection via overgrowth of acyl-HSL- producing species. Therefore, to test our hypothesis, we humanized Swiss

Webster mice and used RIVET to observe SdiA activity during infection. Under 73

these conditions, we did not detect SdiA activity, and competitive indices did not indicate an sdiA fitness phenotype. This experiment indicates that acyl-HSLs were not present in humanized mice under inflammatory conditions, and begs the question of whether or not acyl-HSL-producing organisms exist in the human gut.

Lastly, we took an alternative approach to studying Salmonella -induced gut inflammation in mice recently reported in the literature (85, 174, 175). We infected two panels of CBA/J mice with either WT or sdiA- S. Typhimurium RIVET strains, and collected fecal samples over the course of 21 days. We did indeed observe resolution on day 19 in mice infected with WT S. Typhimurium, but not in days prior or in the mice infected with sdiA- S. Typhimurium. Currently, we are confirming this result in additional mice, are attempting to identify the commensal organism(s) responsible for activating SdiA by culture methods, and are preserving fecal specimens for DNA sequencing and confirmation.

3.5 Materials and Methods

3.5.1 Ethics statement

This study was performed in strict accordance with animal use protocols approved by The Ohio State University Institutional Animal Care and Use

Committee (IACUC, protocol number OSU 2009A0035).

3.5.2 Bacterial strains and media

All bacterial strains used are listed in Table 1. All strains were grown in

LB-broth with aeration (EMD Chemicals, Inc., Gibbstown, NJ). Salmonella strains were grown at 37°C, and Yersinia strains were grown at 30°C. When necessary, media were supplemented with appropriate antibiotics at the following concentrations (µg/mL): ampicillin (amp), 100; kanamycin (kan), 50; nalidixic acid

(nal), 20; tetracycline (tet), 20; and chloramphenicol (cam), 30. Xylose-lysine- deoxycholate (XLD, BD Difco, Sparks, MD) media was used for recovery of

Salmonella from pig feces and organs, and cefsulodin-irgasan-novobiocin (CIN,

BD Difco) media was used for the recovery of Y. enterocolitica from fecal and organ samples. LB-agar miller was used for patch plates (EMD).

3.5.3 Salmonella enrichment from fecal samples

To enrich for the growth of Salmonella from pig fecal samples, 1mL of fecal sample homogenate was subcultured 1:10 in modified TGB broth (EMD),

and grown standing at 37°C for 24 hours. As above, enriched samples were dilution-plated on XLD kan media to recover Salmonella e.

3.5.4 Construction of pagC::camr

Lambda red mutagenesis (85, 420) was used to make in-frame deletion of the downstream virulence-neutral intergenic region of the pagC. Oligonucleotides

BA1561 and BA1562 were designed to have homology to the targeted deletion site, and were appended to sequences that bind the priming region of pCLF3 (72,

167, 407-414). The primer sequences are listed in table 7. BA1561 and BA1562 were used in a PCR reaction with pCLF3 template to generate a product that included FRT-cam-FRT cassette flanked by deletion target homologous DNA.

The PCR product was electroporated into strain 14028 (pKD46) followed by selection for homologous recombination on LB-cam at 37°C. The presence of the insertion was confirmed by PCR, and resulting mutations were transduced into

14028 by phage P22HTint. The pagC::camr marker, and other mutants made for this study were transduced with P22HTint into the appropriate strain backgrounds as needed.

3.5.5 Preparation of inocula and pig inoculations

The inoculum for competition experiments was prepared as follows:

Overnight cultures of WT and mutant Salmonella - were grown in LB-broth with appropriate antibiotics at 37°C with aeration. The next morning, WT and mutant

strains were spun at 5000 x g for ten minutes, the spent culture supernatant was decanted, and the cell pellets were resuspended in fresh-sterile PBS or LB-broth.

The washed WT and mutant strains were mixed in a 1:1 ratio and kept on melting ice. This mixture served as the inoculum. Inocula containing single Salmonella or

Y. enterocolitica strains were prepared as follows: An overnight culture was prepared in LB-broth, with or without the appropriate antibiotics, at 37°C or 30°C, and with aeration. The next morning, the overnight culture was spun at 5000 x g for ten minutes, the spent culture supernatant was decanted, and the cell pellet was resuspended in fresh-sterile PBS or LB-broth, and kept on melting ice. This mixture served as the inoculum. Pigs were fed 2mL of inoculum via sterile plastic syringe. After inoculation, inocula were dilution-plated for enumeration. The total dose for S. Typhimurium and Y. enterocolitica inoculations was 109 CFU.

3.5.6 Sampling and sample preparation

Fecal samples were extract from pig rectums using sterile blue plastic standard fecal loops (9” x 3/8”) with a liberal amount of sterile, non-spermicidal water-based lubricant. Extracted fecal samples were immediately suspended in

3mL of sterile ice-cold 1x PBS in sterile 15mL snap-cap tubes, and kept on ice.

The mass of the fecal sample was measured in grams. Fecal samples were thoroughly vortexed to form homogenates, and homogenates were dilution- plated on respective media containing the appropriate antibiotics for strain selection.

Internal samples (tissues and organ constituents) were dissected immediately following euthanasia of pigs by ear vein injection with 10 mL

Euthasol (sodium pentobarb 390 mg/mL and sodium phenytoin 50 mg/mL) per

100 lbs. Internal samples were suspended in 30mL of sterile 1x PBS in 50mL

Falcon tubes and kept on melting ice. Internal samples were homogenized using

Omni International tissue homogenizer, and dilution plated as was done for fecal samples.

3.5.7 Measurement of RIVET activity

Resolution, in any case, was determined by screening for loss of tetracycline resistance. For srgE-tnpR RIVET Salmonella , we replica-patched recovered Salmonella (10 – 104 CFU/sample) on LB-kan amp and LB-kan tet agar media. Salmonella that were ampS/tetR, ampS/tetR, ampR/tetR, or ampR/tetS were WT unresolved, WT resolved, mutant unresolved, and mutant resolved, respectively. The percent WT resolved was determined by dividing the total number of resolved WT CFU, buy the total WT Salmonella from the patched sample.

3.5.8 Competitive indices

The competitive index (CI) equals the output ratio (CFU of mutant/CFU of wild type) divided by the input ratio (CFU of mutant/CFU of wild type). The log of the CI represents a normal distribution, thus, competitions are represented by

graphs of the logCI. A value of zero indicates neutrality between the WT and mutant in the sample, therefore the null hypothesis was zero. A significant negative value (p < 0.05) indicated that the WT was more fit than the mutant, and significant positive values indicated the mutant was more fit than the WT.

3.5.9 Humanized mice

An aliquot of human feces slurry was obtained from a fecal transplant donor from Dr. Razvan Arsenescu at The Ohio State University Wexner Medical

Center. Germ-free Swiss Webster mice housed in on-site gnotobiotic mouse isolators were orally gavage with 200mL of strained human feces slurry that was homogenized in sterile 1x PBS.

Figure 3. A pilot srgE-tnpR RIVET experiment monitoring pig feces over time with yersiniae co-infections. Left axis: Total Salmonella isolated from fecal samples of pigs. Graphed bars represent three groups of five pigs pre-infected with JB580v (black-filled bars), yenI- Yersinia (checkered bars), or PBS mock-infection (woven bars). Right axis: Percent resolution of WT Salmonella is represented by orange bar overlays. Days post-infection (Day PI) is used for either axes. Red box for day 9 pi JB580v group denotes the Salmonella shedding burst. Error bars represent standard deviation. The data shown here was generated by Jessica Dyszel and Darren Lucas, and graphed by Matthew Swearingen.

Figure 4. srgE-tnpR RIVET in pig feces when pigs are co-infected with GY5456. Inocula were suspended in PBS. A) Log values of competitive indices for Salmonella in pig feces over time. Column statistics are a one sample t test based on a hypothetical logCI value = 0 (neutral phenotype). B) Percent resolution of the WT in feces over time. C) Salmonella recovered in feces over time. D) Yersinia recovered in feces over time. Data from day 1 – 6 pi represent n (pigs) = 12, days 7 – 11 pi n = 8, and days 12 – 14 pi represent n = 4. Error bars: A) represent 95% confidence intervals, B) C) & D) represent standard deviations. Asterisk denotes a p value < 0.05. Pigs from Midwest Swine Research.

Figure 5. srgE-tnpR RIVET in pig organs when pigs are co-infected with GY5456. Inocula were suspended in PBS. A) Log values of competitive indices for WT and sdiA- Salmonella competition in pig organs over time. Column statistics are a one sample t test based on a hypothetical logCI value = 0 (neutral phenotype). B) Percent resolution of the WT Salmonella in organs over time. C) Salmonella recovered in organs over time. D) Yersinia recovered in organs over time. Data from day 1 – 6 pi represent n (pigs) = 12, days 7 – 11 pi n = 8, and days 12 – 14 pi represent n = 4. Error bars: A) represent 95% confidence intervals, B) C) & D) represent standard deviations. Asterisk denotes a p value < 0.05. Pigs from Midwest Swine Research. 83

Figure 6. srgE-tnpR RIVET in pig feces when pigs are co-infected with JB580v. Inocula were suspended in PBS. A) Log values of competitive indices for WT and sdiA- Salmonella competition in pig feces over time. Column statistics were based on a hypothetical logCI value = 0 (neutral). B) Percent resolution of the WT Salmonella in feces over time. C) Salmonella recovered in feces over time. D) Yersinia recovered in feces over time. Data from day 1 – 6 pi represent n (pigs) = 12, days 7 – 9 pi n = 8, days 10 – 11 pi n = 6, and days 12-14 pi n = 4. Error bars: A) represent 95% confidence intervals, B) C) & D) represent standard deviations. Asterisk denotes a p value < 0.05. Pigs from Midwest Swine Research.! 84

Figure 7. srgE-tnpR RIVET in pig organs when pigs are co-infected with JB580v. Inocula were suspended in PBS. A) Log values of competitive indices for WT and sdiA- Salmonella competition in pig organs over time. Column statistics were based on a hypothetical logCI value = 0 (neutral). B) Percent resolution of the WT Salmonella in organs over time. C) Salmonella recovered in organs over time. D) Yersinia recovered in organs over time. Data from day 1 – 6 pi represent n (pigs) = 12, days 7 – 9 pi n = 8, days 10 – 11 pi n = 6, and days 12-14 pi n = 4. Error bars: A) represent 95% confidence intervals, B) C) & D) represent standard deviations. Asterisk denotes a p value < 0.05. Pigs from Midwest Swine Research. 85

Figure 8. srgE-tnpR RIVET in pig feces when pigs are co-infected with JB580v. Inocula were suspended in LB broth. A) Log values of competitive indices for Salmonella in pig feces over time. Column statistics are a one sample t test based on a hypothetical logCI value = 0 (neutral phenotype). B) Percent resolution of the WT in feces over time. C) Salmonella recovered in feces over time. D) Yersinia recovered in feces over time. Data from day 1 – 6 pi represent n (pigs) = 12, days 7 – 11 pi n = 8, and days 12 – 14 pi represent n = 4. Error bars: A) represent 95% confidence intervals, B) C) & D) represent standard deviations. Asterisk denotes a p value < 0.05. Pigs from Isler Genetics.

Figure 9. srgE-tnpR RIVET in pig organs when pigs are co-infected with JB580v. Inocula were suspended in LB broth. A) Log values of competitive indices for WT and sdiA- Salmonella competition in pig organs over time. Column statistics are a one sample t test based on a hypothetical logCI value = 0 (neutral phenotype). B) Percent resolution of the WT Salmonella in organs over time. C) Salmonella recovered in organs over time. D) Yersinia recovered in organs over time. Data from days 1 – 6 pi represent n (pigs) = 12, days 7 – 11 pi n = 8, days 12 – 14 pi n = 4.. Error bars: A) represent 95% confidence intervals, B) C) & D) represent standard deviations. Asterisk denotes a p value < 0.05. Pigs from Isler Genetics.

Figure 10. sdiA competition in pigs when Salmonella e express yenI. Inoculum was suspended in LB-broth. A) Log values of competitive indices for WT and sdiA- Salmonella competition in pig feces over time. B) Log values of competitive indices for WT and sdiA- Salmonella competition in pig feces over time. Column statistics for A and B are a one sample t test based on a hypothetical logCI value = 0 (neutral phenotype). C) Salmnoella recovered in pig organs over time. Data from days 1 – 3 pi represent n (pigs) = 12, days 4 – 6 pi n = 8, and days 7 – 10 pi n = 4. For A and B, error bars represent 95% confidence intervals. For C, error bars represent standard deviation. Asterisk denotes a p value< 0.05. Pigs from Isler Genetics. 88

Figure 11. srgE competition in pigs when Salmonella e express yenI. Inocula were suspended in LB-broth. Panels A, B, & C and D, E, & F represent srgE competition in five pigs each for the sdiA+ and sdiA- background, respectively. Panels A & D are Salmonella recovered in organs over time. Panels B & E and C & F are log values of competitive indices for WT and srgE- Salmonella competition in pig organs and feces over time, respectively. Error bars for A and B represent standard deviation. Column statistics for B, C, E, and F are a one sample t test based on a hypothetical logCI value = 0 (neutral phenotype). Asterisk denotes a p value < 0.05. Pigs from Isler Genetics.

Figure 12. sdiA-tnpR RIVET in five pigs pre-infected with JB580v. Inocula were suspended in LB-broth. A) Salmonella recovered from pig feces over time. B) Yersinia recovered from pig feces over time. C) Percent resolution of WT Salmonella in feces over time. D) Percent resolution of WT Salmonella in pigs organs on day 6 pi. E) Salmonella recovered in organs on day 6 pi. F) Yersinia recovered in organs on day 6 pi. Error bars represent standard deviation. Pigs from Isler Genetics.

Figure 13. sdiA competition in pigs when Salmonella e express yenI. Inoculum was suspended in LB-broth. Panels A & B represent log values of competitive indices for WT and sdiA- Salmonella competition in BALB/c mouse organs and CBA/J mouse fecal sheds over time, respectively. Panels C & D represent Salmonella recovered from organs of BALB/c mice and fecal sheds of CBA/J mice over time respectively. BALB/c mouse organs were extracted on day 4 pi. Column statistics for panels A & B are a one sample t test based on a hypothetical logCI value = 0 (neutral phenotype). Error bars for panels D & C represent standard deviation. Asterisk denotes p value < 0.05. BALB/c mice are from Jackson and CBA/J mice are from Harlan.

Figure 14. srgE-tnpR RIVET in Humanized Swiss Webster mice. Inoculum was suspended in LB-broth. Panel A & B represent Salmonella recovered from organs and feces over time. Panels C & D are log values of competitive indices for WT and sdiA- Salmonella competition in mouse organs and feces over time, respectively. Column statistics are a one sample t test based on a hypothetical logCI value = 0 (neutral phenotype). E) represents survivability of HuSWEBS. Mouse organs were taken once ERC was met, n = 3. Fecal samples are from five mice. Panel A & B error bars represent standard deviation. Asterisk denotes a p value < 0.05.

Table 2. Strains and Plasmids Strain Genotype Source 14028 WT Salmonella enterica serovar American Type Typhimurium Culture Collection

IR715 Spontaneous nalr isolate of 10428 (121)

JS246 14028 zjg8103::res1-tetRA-res1 (421)

JB580v WT Yersinia enterocolitica Serogroup O:8; (422) (R- M+)

GY5456 WT marked Y. enterocolitica yenR::kanr (also pYV-)

JNS3206 JS246 srgE10-tnpR-lacZY (71)

JNS3216 14028 sdiA-tnpRlacZY (85)

JNS3226 JS246 srgE10-tnpR-lacZY sdiA1::mTn3 (71)

JLD1201 14028 λPR-yenI-FRT-kan-FRT (72)

JLD1203 14028 λPR-yenI-FRT-kan- (72) FRT sdiA1::mTn3

JLD1204 14028 pagC::cam This study

JLD1205 Derived from JNS3226, JS246 srgE10- This study tnpR-lacZY sdiA1::mTn3, pagC::camR

JLD1208 Derived from JNS3206, JS246 srgE10- This study tnpR-lacZY pagC::camR

BA5502 14028 phoN::strr This study

Continued…

92 Table 2. Strains and Plasmids continued JLD1227 14028 λPR-yenI-FRT-kan- (72) FRT srgE42::cam

JLD1229 14028 λPR-yenI-FRT-kan- (72) FRT srgE42::camsdiA1::mTn3

MA43 IR715 phoN::strr This study

MCS122 MA43 csgF::kanr This study

MCS126 MA43 pagD::kanr This study

Plasmids

pCLF3 FRT-cam-FRT oriR6K (Ampr) (420)

r pKD46 PBAD gam bet exo pSC101 oriTS (Amp ) (429)

Table 3. Oligonucleotides Name Sequence BA1561 CTTCTTTACCAGTGACACGTACCTGCCTGTCTTTTCTCTTGTG TAGGCTGGAGCTGCTTCG

BA1562 CGAAGGCGGTCACAAAATCTTGATGACATTGTGATTAACATAT GAATATCCTCCTTAG

BA1968 CATGAAAATCATGGGAACTATGCCACCGTCG

BA1969 CTATTACACATTCCAGATTAATATTCTCCGG

4. Are there acyl-homoserine lactone molecules within mammalian intestines?

This chapter was written in a review format consistent with submission of to the Journal of Bacteriology (2013). Therefore, this chapter differs in format from the rest of the dissertation. The authors are Matthew Swearingen, Anice

Sabag-Daigle, and Brian Ahmer. Matthew Swearingen and Brian Ahmer co-wrote the manuscript. Anice Sabag-Daigle performed human Microbiome metagenomic analyses.

95 4.1 Abstract

Many Proteobacteria are capable of quorum sensing using N-acylhomoserine lactone (acyl-HSL) signaling molecules that are synthesized by LuxI or LuxM homologs and detected by transcription factors of the LuxR family. Most quorum sensing species have at least one LuxR and one LuxI homolog.

However, members of the Escherichia, Salmonella , Klebsiella, and Enterobacter genera possess only a single LuxR homolog, SdiA, and no acyl-HSL synthase.

The most obvious hypothesis is that these organisms are eavesdropping on acyl-

HSL production within the complex microbial communities of the mammalian intestinal tract. However, there is currently no evidence of acyl-HSLs being produced within normal intestinal communities. A few intestinal pathogens, including Yersinia enterocolitica, do produce acyl-HSLs, and Salmonella can detect them during infection. Therefore, a more refined hypothesis is that SdiA orthologs are used for eavesdropping on other quorum sensing pathogens in the host. However, the lack of acyl-HSL signaling among the normal intestinal residents is a surprising finding given the complexity of intestinal communities. In this review, we examine the evidence for and against the possibility of acyl-HSL signaling molecules in the mammalian intestine and discuss the possibility that related signaling molecules might be present and awaiting discovery.

96 4.2 Introduction

One type of quorum sensing (QS) in Gram-negative bacteria is performed by LuxI/LuxR homologs. The LuxI homolog synthesizes a QS signal molecule, and the LuxR homolog binds the signal and responds by regulating gene transcription (12, 59, 430). LuxI homologs produce a spectrum of related acyl-

HSL signal molecules. The acyl-HSLs have a conserved homoserine lactone ring connected by an amide linkage to a variably structured acyl side chain. The acyl side chain can vary in length, ranging from 4-18 carbons, can be substituted with a carbonyl or hydroxyl group on the third carbon, and may or may not be saturated (the AinS/LuxM family of enzymes can also synthesize acyl-HSLs)

(171, 431, 432). Each individual LuxI produces a type of acyl-HSL specific for detection by its cognate LuxR. The predominant signal produced by Vibrio fischeri LuxI is N-(3-oxo-hexanoyl)-L-homoserine lactone (abbreviated oxoC6), which has a six carbon tail modified at the third position with a carbonyl group

(31). Unusual variations including aromatic side chains, branched-chain acyl tails, or carboxylated acyl tails have also been reported (40-42, 433).

Among the bacterial species where the LuxI/LuxR pairs are well characterized, the functions are often associated with host interactions, either with plant or animal, as a commensal or a pathogen. The paradigm is the

LuxI/luxR system of V. fischeri that regulates a commensal interaction between the bacterium and its host, Euprymna scolopes, the Bobtail squid (23, 430).

Numerous LuxI/LuxR systems are found in plant pathogens including TraI/TraR

97 of Agrobacterium tumefaciens (alpha-Proteobacteria), the causative agent of crown gall tumor formation (61, 434, 435), ExpI/ExpR of Pectobacterium carotovorum (gamma-Proteobacteria), which produces enzymes involved in plant soft-rot (84, 85), and the more recently described PssI/PssR of Pseudomonas savastanoi (gamma-Proteobacteria) responsible for knot formation in olive trees

(436). Mammalian pathogens including Yersinia enterocolitica and Pseudomonas aeruginosa also encode LuxI and LuxR homologs (68, 96, 437-439).

One branch of the gamma-Proteobacteria that includes the Escherichia,

Salmonella , Klebsiella, and Enterobacter, encodes a LuxR homolog named

SdiA, but there are no acyl-HSL synthase genes in their genomes and it has been experimentally verified that E. coli and Salmonella do not synthesize acyl-

HSLs (70, 440). While E. coli and Salmonella do not produce acyl-HSLs, they can sense and respond to a variety of acyl-HSLs produced by other QS bacterial species, a phenomenon described as eavesdropping (14, 29, 32, 103, 441, 442).

Because E. coli and Salmonella inhabit the intestinal environment of humans and many other animals (6), the simplest hypothesis is that E. coli and Salmonella use SdiA to detect the acyl-HSL production of the normal intestinal microbiota.

However, this hypothesis currently appears to be incorrect. There is no evidence for acyl-HSLs in the mammalian intestinal tract, except during infection with the acyl-HSL-producing pathogen Y. enterocolitica (72). Below, we outline the evidence for and against the possibility of acyl-HSLs in the mammalian intestinal tract. 6.3 Chemical evidence suggesting a lack of acyl-HSLs in the mammalian intestine

98 Attempts to chemically extract acyl-HSLs from the mammalian intestine have failed. An A. tumefaciens biosensor strain was used to screen extracts from bovine rumen, small intestine, and cecum for acyl-HSLs (116, 118, 120). While the majority of rumen samples had activity consistent with the presence of acyl-

HSLs, the intestinal samples did not (116, 118-120). Chemical extracts of mouse intestines were tested for acyl-HSLs using a LuxR-based biosensor (419).

Although acyl-HSLs were found in systemic organs infected with Y. enterocolitica, no acyl-HSLs were observed in the intestine (419). Both studies suggest that acyl-HSLs are not present in the bovine or murine intestine. The caveat to these results is the use of biosensors for detection. These have a detection limit in the nanomolar to micromolar range, depending on the acyl-HSL, and may not detect some acyl-HSLs at all. As described below, many new types of HSL signaling molecules have been discovered that may have been missed by these particular biosensors. New biosensors and mass spectrometry approaches should be applied to assay for the presence/absence of acyl-HSLs in the mammalian intestine.

4.4 Biological evidence suggesting a lack of acyl-HSLs in the mammalian intestine

An in vivo Salmonella reporter system failed to detect acyl-HSLs in mammalian GI tracts. The Salmonella LuxR homolog, SdiA, can detect acyl-HSL variants at concentrations ranging from 1 nM – 1 µM depending on the variant

99 (440, 443). This is similar to the sensitivities of other LuxR homologs, although

SdiA seems to detect a broader range of variants than other LuxR family members. Salmonella enterica serovar Typhimurium (Salmonella ) is a broad- host range enteric pathogen capable of colonizing over 40 different animal species(6) making the Salmonella SdiA system a versatile reporter for determining whether or not acyl-HSLs exist within host animals. However, it was recently determined that indole at concentrations of 1 mM can inhibit the ability of

SdiA to respond to acyl-HSLs (401). Indole concentrations in the mouse and human intestine range from 100 µM to 1 mM (444-446), so it is possible that indole might reduce the sensitivity of an SdiA reporter in vivo. An S. Typhimurium recombination-based in vivo expression technology (RIVET) reporter system was constructed in which sdiA-dependent detection of acyl-HSLs results in a permanent deletion of a tetracycline resistance gene in the Salmonella chromosome (71, 72, 447). With this system, if SdiA becomes active at any point during the transit of Salmonella through an animal, the Salmonella reporter permanently changes to tetracycline susceptible. Surprisingly, the RIVET reporter system failed to detect acyl-HSLs during transit through the GI tract of a variety of animals including a guinea pig, a rabbit, a cow, mice, pigs, and chickens (45). However, it did become active in turtles, which correlated with the presence of Aeromonas hydrophila, an important aquaculture pathogen (71, 448,

449). It also became active in mice that had been previously infected with the mammalian intestinal pathogen Y. enterocolitica (72). While A. hydrophila produces acyl-HSLs and seems to be a normal member of the turtle GI

100 microbiota, Y. enterocolitica is considered to be a pathogen rather than a normal member of the mammalian intestinal microbiota. Therefore, the normal mammalian microbiota does not appear to include species that can activate the

Salmonella SdiA reporter (71, 72).

4.5 Potentially positive results from genomics and metagenomics

The Human Microbiome Project (HMP, http://www.hmpdacc.org) includes an online database that can be used to scan deep sequencing reads of various human samples, including the GI tract. Also included in the project is a catalog of reference genomes that were collected from the same body sites as the metagenomic samples (450). We searched for SdiA homologs among these genome sequences using Basic Local Alignment Search Tool (BLAST) and, as expected, numerous E. coli, Citrobacter, Enterobacter, and Klebsiella isolates encoded sdiA (Table 1). Searching the metagenomic data gave a similar list of homologs (not shown). We then searched for LuxI and LuxR homologs in the draft and completed reference genomes using BLAST with LuxI/LuxR protein sequences from V. fischeri, P. aeruginosa, and A. tumefaciens. The search results indicated the presence of three organisms encoding LuxI/LuxR pairs in the GI tract: Hafnia alvei, Edwardsiella tarda, and Ralstonia sp. 5_7_47FAA

(Table 2). Salmonella is known to detect the acyl-HSLs produced by H. alvei in vitro (24). Serratia odorifera DSM 4582 also encodes a LuxI/LuxR pair but was only detected in the airways (Table 2). However, previous reports have isolated

101 S. odorifera from wild boar gut and horse manure (451, 452). Other organisms, such as Citrobacter rodentium and P. aeruginosa may also produce acyl-HSLs in the gut based on the presence of LuxI homologs in their genomes, although these organisms do not appear in the HMP metagenomic data. A mutant of C. rodentium lacking its luxI homolog, croI, is hypervirulent in mice during oral infection, suggesting that acyl-HSLs play a role in infection, although the site in which they are produced is not yet clear (170). It will be interesting to determine how frequently all six of these organisms are found within the mammalian GI tract and if they synthesize acyl-HSLs in that particular environment. We also searched for AinS and LuxM homologs, but none were found. It should be noted that homology searches will miss acyl-HSL synthase genes of previously undiscovered families. For instance, some marine bacteria produce acyl-HSLs but do not encode LuxI or LuxM homologs (453).

The HMP does not report the presence of Acinetobacter baumannii in stool samples, but A. baumannii was recently found within mouse intestinal crypts

(454). A. baumannii uses a LuxI homolog, AbaI, to produce 3-hydroxy-C12 (and other related molecules in lesser amounts) (455, 456). It is not known if the specific strains of A. baumannii found in mouse intestinal crypts have the ability to produce acyl-HSLs or if they actually produce acyl-HSLs in vivo. However, if this organism is producing acyl-HSLs in the crypts, further research is needed to determine why the Salmonella SdiA reporter system was not activated during the transit of Salmonella through mice. We recently used a cross-streak assay on

Luria Bertani agar at 37°C using an S. Typhimurium biosensor (pJNS25 (70)) to

102 test for an sdiA-dependent response to A. baumannii strain M2. The Salmonella

SdiA reporter system did not respond to this strain of A. baumannii (Swearingen and Ahmer, unpublished data). It is somewhat surprising that SdiA did not respond to the A. baumannii acyl-HSL, 3-OH-C12, because it does respond to 3- oxo-C12 at a concentration of 60 nM (443). SdiA responds to hydroxy variants with roughly 10-fold less sensitivity than oxo variants, so while 3-OH-C12 has not yet been tested, one could surmise that it may be detected at a concentration of roughly 600 nM (443). More work is needed to determine the detection limit of

Salmonella SdiA with regard to synthetic 3-OH-C12, and the concentrations of acyl-HSLs produced by A. baumannii in the gut and in culture.

Screening metagenomic libraries for their ability to activate a biosensor strain has been used successfully to identify three luxI homologs from activated sludge and soil (457). This approach was also used to identify signal synthases in a metagenomic library of the gypsy moth gut, revealing a monooxygenase that produces an acyl-HSL mimic compound (458). Theoretically, this type of approach could be used to identify acyl-HSL synthases among the mammalian intestinal microbiota, but to the best of our knowledge, this type of study has not been published.

4.6 The possibility of degradation

Several factors could affect the concentration of acyl-HSL in the intestine including pH and the presence of degradative enzymes (459, 460). Acyl-HSLs

103 are readily inactivated at alkaline pH which may be relevant in the intestine (461-

463). The pH of most of the intestinal tract ranges from pH 5.7 to 6.7, but there is a mildly basic region of pH 7.4 in the terminal ileum (464). With regard to enzymatic degradation, numerous enzymatic activities have been discovered that act on acyl-HSLs. These include acylases, oxidoreductases, and lactonases

(453, 465-472). BLAST analysis of the gastrointestinal HMP reference genomes with the lactonase AhlK reveals one homolog in a Klebsiella species (Table 3).

The same search with the acylase PvdQ reveals homologs in a Ralstonia species and in Bacteroides dorei (Table 3). A search with the short chain hydrogenase/reductase BpiB09 reveals over 200 homologs (not shown).

However, the primary function of this enzyme appears to be fatty acid metabolism and homology does not guarantee acyl-HSL modifying activity.

The human genome also encodes acyl-HSL degrading enzymes. The paraoxonases are a family of aryl-esterases that can cleave lactone rings, although this is probably not their primary function. Human paraoxonase 1

(PON1) and PON3 are derived from the liver and kidneys and circulate in the blood. PON2 has been reported to have the strongest acyl-HSL inactivating effect and is widely distributed throughout many tissue types including the colon and small intestine (473-475). An acylase that can degrade acyl-HSL has been isolated from porcine kidney, so this type of activity may be present in humans as well (476). Thus, if acyl-HSLs are produced by the normal microbiota, it is possible that the host or other microbes degrade them. The kinetics of acyl-HSL degradation in various tissues needs further investigation.

104

4.7 New HSL variants

To date, there has been no direct detection of acyl-HSLs within the normal mammalian intestinal tract, yet there are caveats to all of the negative results. It is possible that the LuxR-type biosensors used were not compatible with or sensitive to the concentration of acyl-HSLs found in the intestine. The chemical extraction reports used LuxR and TraR reporters, and the Salmonella in vivo reporter system used SdiA (72, 118, 419). While SdiA, LuxR and TraR can detect acyl-HSLs at concentrations as low as 1 nM, Bradhyrhizobium japonicum has a

LuxR homolog, BjaR, that can detect a novel branched chain isovaleryl-HSL at concentrations as low as 10 pM (41). If the concentrations of isovaleryl-HSL that are found in nature are lower than 1 nM, it is unlikely that any of the standard

LuxR-type reporter systems could detect them. Even if the environmental concentrations are much higher, the standard LuxR-type reporter systems may not be able to detect the unique branched acyl chain.

Similarly, a family of aryl-HSLs that have aromatic side chains (rather than acyl-chain tails) was reported in the alpha-proteobacteria, specifically in

Rhodopseudomonas and Bradyrhizobium (42, 47). Related members of the

Rhizobiales have been identified within the human intestine (477), but it has not been determined if these organisms produce aryl-HSLs in the intestinal environment. It is not known if the SdiA, LuxR, or TraR biosensor systems can detect aryl-HSLs. Thus, it is possible that aryl-HSLs are present in the intestine

105 but were not detected in previous experiments (71, 72). It is even possible that the aryl-HSLs quenched the reporter systems since synthetic aryl-HSLs have been found to act as antagonists for Pseudomonas and Aeromonas quorum sensing (478).

Finally, it was recently discovered that a member of the Archaea,

Methanosaeta harundinacea, produces a novel type of acyl-HSL (433). The filI gene product produced a carboxylated 10 to 14 carbon acyl-HSL that was detectable by an Agrobacterium TraR biosensor. This particular methanogen was not isolated from the mammalian GI tract, but other archaea are abundant in the intestinal community. Further work is required to determine if the intestinal archaea also synthesize acyl-HSL signaling molecules.

106 4.8 Conclusions

LuxI homologs are present in the insect gut (479-481). Turtles are frequently colonized by Aeromonas hydrophila, which produces acyl-HSLs (71), and biosensors have detected acyl-HSLs in chemical extracts of goat and cow rumens (116, 118-120). However, chemical extractions and an S. Typhimurium

SdiA reporter both failed to detect acyl-HSLs (or other HSL variants) within mammalian intestines (71, 72, 118, 419). The Salmonella SdiA reporter was able to detect the acyl-HSL production of the pathogen Yersinia enterocolitica in mice

(72). This leads to the hypothesis that the function of SdiA is to detect the acyl-

HSL production of other pathogens rather than the normal microbiota. In addition to Y. enterocolitica, other microbes also have the potential to produce acyl-HSLs within the mammalian intestine (A. baumannii, C. rodentium, H. alvei, E. tarda, P. aeruginosa, S. odorifera, Ralstonia sp.), but this has not yet been confirmed. In response to acyl-HSL, Salmonella increases the expression of the invasin, Rck, and a putative T3SS effector of unknown function (32). The advantage that

Salmonella would gain from detecting these other pathogens and activating these particular genes is not clear. Alternatively, it has been proposed that SdiA of enterohemorrhagic E. coli is used to detect the normal microbiota of the bovine rumen where it increases the expression of acid resistance genes and represses the locus of enterocyte effacement (LEE) pathogenicity island (116, 118, 120).

SdiA then fails to detect acyl-HSLs in the bovine intestine, which allows derepression of the LEE pathogenicity island. The regulon of SdiA is very

107 different in E. coli and Salmonella suggesting different scenarios in which SdiA provides a benefit (32, 116). Interestingly, Klebsiella, Enterobacter, Citrobacter, and Cronobacter also encode SdiA orthologs (123). The SdiA regulon of

Enterobacter cloacae is completely different than the regulons of E. coli and

Salmonella , so it appears that the SdiA regulon has different functions in each genus (Sabag-Daigle and Ahmer, unpublished).

Several new types of HSL signaling molecules have been discovered and it is currently unknown which of the typical gamma-proteobacterial LuxR-type biosensors can detect them, or at what concentrations. Intestinal extracts need to be screened with reporter systems based on these new LuxR homologs.

Additionally, mass spectrometry methods should be applied to these questions.

Mass spectrometry might detect HSLs with higher sensitivity and without the detection biases inherent to biosensors (471, 482, 483). This would determine the concentration of each type of signaling molecule in different regions of mammalian intestines, which would allow predictions of which LuxR family members might be activated. Kinetic studies of signal molecule synthesis and decay in the intestine and other body sites could also be addressed with these methods.

108 ACKNOWLEDGEMENTS

We thank Benjamin Daigle for critical review of the manuscript, Phil Rather for A. baumannii strains, and Young-Mo Kim, Thomas Metz, and Joshua Adkins for helpful discussions. Awards R01AI073971 and R01AI097116 from the

National Institute of Allergy and Infectious Diseases supported the project described.

109 Table 4. Organisms encoding SdiA in the Human Microbiome Organism Body Site Escherichia sp. 4_1_40B GI tract Escherichia coli SE11 GI tract Escherichia coli MS 196-1 GI tract Escherichia coli MS 146-1 GI tract Escherichia coli MS 117-3 GI tract Shigella sp. D9 GI tract Escherichia coli MS 145-7 GI tract Escherichia coli MS 182-1 GI tract Escherichia coli MS 78-1 GI tract Escherichia coli MS 107-1 GI tract Escherichia coli MS 79-10 GI tract Escherichia coli MS 84-1 GI tract Escherichia coli MS 85-1 GI tract Escherichia coli MS 198-1 GI tract Escherichia coli MS 187-1 GI tract Escherichia coli MS 175-1 GI tract Escherichia coli MS 116-1 GI tract Escherichia coli MS 69-1 GI tract Escherichia coli MS 115-1 GI tract Escherichia coli MS 119-7 GI tract Escherichia sp. 3_2_53FAA GI tract Escherichia coli MS 200-1 GI tract Escherichia coli MS 185-1 GI tract Escherichia coli MS 16-3 GI tract Escherichia coli MS 153-1 GI tract Escherichia coli MS 110-3 GI tract Escherichia coli MS 60-1 GI tract Escherichia coli MS 57-2 GI tract Escherichia coli MS 45-1 GI tract Escherichia coli O150:H5 SE15 GI tract Escherichia coli MS 21-1 GI tract Escherichia coli MS 124-1 GI tract Citrobacter sp. 30_2 GI tract Citrobacter youngae ATCC 29220 GI tract Enterobacter cancerogenus ATCC 35316 GI tract Klebsiella sp. MS 92-3 GI tract Klebsiella sp. 1_1_55 GI tract Yokenella regensburgei ATCC 43003 GI tract Enterobacter cloacae cloacae NCTC 9394 GI tract Escherichia coli 83972 UG tract Enterobacter hormaechei ATCC 49162 Oral Klebsiella pneumoniae rhinoscleromatis ATCC 13884 Nasal

Organisms in the catalog of reference genomes for the Human Microbiome that encode SdiA. Full-length E. coli MG1655 SdiA protein sequence was used to BLAST the reference catalog of complete and draft genomes at the HMP BLAST server (http://www.hmpdacc.org/resources/blast.php). Organisms listed had an E-value of 10-5 or less and were homologous along the full length of SdiA. Abbreviations: urogenitial tract (UG tract) and gastrointestinal tract (GI tract).

110

Table 5. Organisms encoding LuxI/LuxR pairs in the Human Microbiome

Organism Body Site Acyl-HSL Signal Source Serratia odorifera DSM 4582 Airways 3-oxo-C6 and C4 (484) Acinetobacter calcoaceticus Skin 3-hydroxy-C12 and C12 (456) RUH2202 Acinetobacter baumannii Skin 3-hydroxy-C12 (456) 6013150 Acinetobacter baumannii Skin 3-hydroxy-C12 (456) 6013113 Acinetobacter sp. RUH2624 Skin Acinetobacter sp. SH024 Skin Acinetobacter baumannii Skin 3-hydroxy-C12 (456) 6014059 Acinetobacter baumannii Urogenital 3-hydroxy-C12 (456) ATCC 19606 Hafnia alvei ATCC 51873 Gastrointestinal 3-oxo-C6 (487) Edwardsiella tarda ATCC Gastrointestinal C6 and C7 (488) 23685 Ralstonia sp. 5_7_47FAA Gastrointestinal C6 and C8 (489) Serratia odorifera DSM 4582 Airways 3-oxo-C6 and C4 (484)

Organisms in the catalog of reference genomes for the Human Microbiome that encode a LuxI/LuxR pair. The organism and body site at which the organism was detected is listed. The variant of acyl-HSL produced by each respective organism, in vitro, is listed along with references. Abbreviations: urogenitial tract (UG tract) and gastrointestinal tract (GI tract).

111 Table 6. Organisms encoding quorum-quenching enzymes in the Human Microbiome

Organism Body Site Homology Gemella haemolysans ATCC 10379 Oral PvdQ Aeromicrobium marinum DSM 15272 Oral PvdQ Achromobacter piechaudii ATCC 43553 Airways PvdQ Sporosarcina newyorkensis 2681 Blood PvdQ Desmospora sp. 8437 Blood PvdQ Sporosarcina newyorkensis 2681 Blood PvdQ Acinetobacter baumannii 6013150 Skin PvdQ Bacteroides dorei 5_1_36/D4 Gastrointestinal PvdQ Klebsiella sp. 1_1_55 Gastrointestinal AhlK Ralstonia sp. 5_7_47FAA Gastrointestinal PvdQ

Organisms in the catalog of reference genomes for the Human Microbiome that encode quorum- quenching enzymes. Full-length P. aeruginosa acylase PvdQ and Klebsiella pneumoniae lactonase AhlK protein sequences were used to BLAST the reference catalog of complete and draft genomes at the HMP BLAST server (http://www.hmpdacc.org/resources/blast.php). Organisms listed had an E-value of 10-5 or less and were homologous along the entire length of the query sequence.

112

5. Summary and Discussion

Many Proteobacteria use QS to coordinate gene expression to regulate critical cellular processes (12-16, 43, 167, 408-410). Some bacteria of the

Enterobacteriaceae family have lost the ability to make acyl-HSLs, but retained the ability to detect them through conserved solo LuxR-type proteins. In particular, bacteria of the Escherichia, Salmonella, and Enterobacter genera have retained sdiA, which is capable of detecting the acyl-HSLs produced by other QS bacteria (32, 70), and the conservation of sdiA is hypothesized to be for the purposes of QS signal eavesdropping (121, 123).

For E. coli, especially pathogenic EHEC, SdiA plays a role in increasing acid fitness and depressing the LEE operon (75, 120). Reports have indicated that acyl-HSLs are present in bovine rumens (116, 118), and increasing acid fitness via SdiA enables EHEC to resist the acidic environment of the bovine stomach, while simultaneously depressing LEE expression (120). Then, as

EHEC transits the bovine intestine, where acyl-HSLs are seemingly not present

(116, 118), SdiA repression of the LEE is relieved, and LEE expression

113 influences EHEC colonization of the bovine recto-anal junction (120). While members the S. Typhimurium SdiA regulon have been identified (70, 121), the physiological role of eavesdropping for S. Typhimurium in mammalian intestines remains largely unclear. Thus, this work aimed to investigate the contribution of

SdiA to Salmonella fitness in vivo.

In response to acyl-HSLs, SdiA activates genes of the rck operon located on the virulence plasmid pSLT, and a single horizontal gene acquisition in the chromosome that has been shown to be a type-three secreted effector, srgE

((70, 121) and Habyarimana unpublished). Several phenotypes have been reported for the rck operon, including resistance to complement-mediated killing, zippering internalization, and adherence to epithelial cells (131-135). With respect to srgE, data from Habyarimana of our group has confirmed that it is indeed an type three secreted effector, but the specific effect that SrgE has on host cells is unknown (Habyarimana unpublished). In addition, Habayarimana has demonstrated that SrgE is secreted through the S. Typhimurium T3SS-2 encoded by SPI-2, and it is generally accepted that T3SS-2 is expressed upon/post-invasion of a host cell (490), and largely enables Salmonella to maintain an intracellular lifestyle (491, 492). Like EHEC, S. Typhimurium is a major intestinal pathogen. Thus, we have proposed an overarching hypothesis that Salmonella uses SdiA to detect the acyl-HSLs produced by gut-residing bacteria, and activates the SdiA regulon (71). The gut is highly diverse and concentrated with microbes (416), and considering that acyl-HSL-type QS is prevalent among the Proteobacteria (43, 442), one presumption for our

114 hypothesis was that acyl-HSLs are produced and are stable somewhere in the GI tract of the host(s). Considering the putative functions of S. Typhimurium SdiA regulon members (likely involved in microbe-host interactions), we predicted that

SdiA would play a role in Salmonella fitness, and would therefore be an important virulence factor with the potential for vaccine development and/or drug targeting.

Previously, we tested this hypothesis using an S. Typhimurium srgE-tnpR RIVET reporter fusion, but we did not observe SdiA activity after transit through the GI tracts of most healthy animals (71). SdiA was active, however, during transit through turtles chronically infected with the acyl-HSL-producing fish pathogen A. hydrophila (71), and SdiA was also active in mice when mice were pre-infected with the acyl-HSL-producing gut pathogen Y. enterocolitica (72). While SdiA was capable of detecting the acyl-HSLs produced by co-infecting gut pathogens, especially in mice co-infected with Y. enterocolitica, mutations in sdiA never resulted in a prominent fitness phenotype that we predicted would occur through the activation of the SdiA regulon (71, 72).

We pondered our S. Typhimurium and Y. enterocolitica mouse co- infection model, and considered that the interaction between the organisms in mice might not be adequate to result in an sdiA fitness phenotype; perhaps we could study sdiA fitness phenotypes in an animal that is a common reservoir for both Salmonella and Yersinia species, such as the pig (160-166, 168, 169). A pilot experiment employing the S. Typhimurium srgE-tnpR RIVET strains resulted in an sdiA-dependent shedding burst on day 9 p.i.. The shedding burst was characterized by a 100-fold increase in total S. Typhimurium being shed, 98% of

115 which were WT S. Typhimurium, and of which 94% had resolved (fig. 3). The sdiA shedding phenotype only occurred in pigs co-infected with WT Y. enterocolitica, but not in pigs co-infected with yenI- Y. enterocolitica or PBS mock-infection (data not shown). The sdiA shedding phenotype observed in the pilot experiment receded by the next time point (day 14 p.i.), and since resolution of RIVET is irreversible, we believe this meant that at least two populations of S.

Typhimurium existed within the pigs: those that had sensed acyl-HSLs and underwent a super-shedding event, and those that did not detect acyl-HSLs and continued to shed at relatively low levels in feces.

Next, we wanted to determine the in vivo location in pigs in which SdiA activity occurs. In mice, the majority of resolution occurred in the Peyer’s patches

(72), and we hypothesized the same would be true in pigs. In our first attempt, we anticipated difficulty in recovering WT JB580v from pigs feces and organs on

XLD media, thus, we opted to co-infect pigs with a WT kanr version of JB580v, named GY5456. However, we observed little-to-no RIVET activity in fecal or organ samples (fig. 4 B and 5 B), and logCI values did not significantly favor the

WT or mutant in pig feces or organs (fig. 4 A and 5 A). GY5456 was later confirmed to have lost the pYV, and we believed this to contribute to the lack of colonization by Yersinia in pigs, and low Yersinia persistence is thought to be responsible for the lack of RIVET activity. Thus, we repeated the experiment using WT JB580v. To recover Y. enterocolitica from samples, we used specialized Yersinia selective agar, CIN. In this experiment, Yersinia shedding in the feces was enhanced by 1 – 2 orders of magnitude in initial time points (fig. 6

116 D), but colonization of pig organs remained low compared to the previous experiment (fig. 7 D). Under these conditions, we did not observe RIVET activity in fecal or organ samples. However, we observed significant logCI values in some organ samples on days 6, 9, and 11 p.i. that favored WT S. Typhimurium ( fig. 7 A). We also observed significant logCI values for fecal samples, but these tended to oscillate between WT and sdiA mutant S. Typhimurium over time (fig. 6

A). Thus, these data may indicate that SdiA is active in pigs independent of acyl-

HSLs, and we discuss this possibility in detail in conjunction with an additional

RIVET result below.

A previous report shows that the composition of the inoculum used for

Salmonella infections greatly affects Salmonella colonization of mice (406). The two in vivo RIVET assays mentioned above used PBS for inoculum suspensions.

Therefore, we hypothesized that switching our S. Typhimurium and Y. enterocolitica inocula to LB-broth would enhance bacterial colonization of pigs.

Indeed, we measured a dramatic increase in Yersinia load in both the feces and pig organs (fig. 8 D and 9 D). In this experiment, we observed SdiA activity in the

MLN samples on day 6 p.i.. Interestingly, we did not detect Yersinia in the day 6

MLN samples. One possibility is that S. Typhimurium RIVET became active at a different location within the animal, and migrated to the MLN and underwent clonal expansion. Interestingly, we observed 2/4 pigs had resolved Salmonella in the MLN in the absence of Yersinia. It is unclear if clonal expansion occurs in at least 50% of the pigs tested, but the frequency of this occurrence observed here may indicate that SdiA activity leads to systemic invasion. We did not, however,

117 observe a fitness phenotype in MLN samples, as might be expected if SdiA does indeed promote systemic invasion. A second possibility is that resolution occurred in the absence of acyl-HSL. This idea could explain reporter activity occurring in MLNs in the absence of Yersinia. Its important to note that novel signal-independent RIVET activation does not rule out clonal expansion, whereas, SdiA activity could still occur in the absence of ligand in a location other than the MLN, and resolved S. Typhimurium could still migrate to the MLN.

To summarize, in one RIVET experiment we observed significant sdiA fitness phenotypes in some organs but RIVET was not active. In a subsequent

RIVET experiment RIVET was active, but we did not observe an sdiA fitness phenotype in MLNs. Interestingly, both incidences of SdiA activity appeared to occur in the absence of ligand, which is indicated by a lack of Yersinia co- localization. In chapter 3.4, we offer a detailed conclusion about in vivo ligand- independent activation, which we ultimately predict could be due to highly up- regulated sdiA expression in certain in vivo conditions. Thus, an additional experiment quantitating the in vivo expression of sdiA would help to describe sdiA expression in vivo. Consequently, we have already inadvertently tested sdiA expression in vivo. Throughout our pig RIVET experiments, we observed high bacterial loads for both Salmonella and Yersinia in tonsil tissues, but this never resulted in RIVET activation. Operating under the dogma that S. Typhimurium and Y. enterocolitica co-localization results in RIVET activity, we infected a group of pigs with an sdiA-tnpR RIVET strain to measure sdiA expression. We were met with difficulty using the sdiA-tnpR strain in pigs, though, and believe

118 inoculum culturing methods may have selected for an S. Typhimurium clonal population that cannot/does not resolve.

To definitively conclude if SdiA activity results in a fitness phenotype in pigs, we competed WT and sdiA mutant S. Typhimurium that constitutively express acyl-HSLs. Previously, we demonstrated that WT S. Typhimurium dramatically outcompetes the sdiA mutant in mouse fecal sheds when both strains express acyl-HSLs, and in chapter 3.3.8, we further demonstrate the same WT fitness phenotype in the small intestines of mice (fig. 13 A). In pigs, however, we observed a compelling result that suggests the sdiA mutant is hyper-virulent relative to the WT when both strains express acyl-HSLs. It remains unclear as to the reason for this contrasting result in pigs, but it is speculated that sdiA could be differentially expressed in pigs, and expression of sdiA at inopportune times might be detrimental to Salmonella fitness. To support this idea, we cite the following data, 1) two srgE-tnpR RIVET experiments in pigs were indicative of ligand-independent SdiA activity, which has been shown to occur in vitro (but never in vivo) when sdiA is over-expressed, 2) RIVET activity never occurred in the tonsil tissue, even though Salmonella and Yersinia consistently co-colonize tonsils in all RIVET experiments, and in addition, 3) the sdiA hyper-virulent phenotype observed in pigs when S. Typhimurium express yenI does not occur in tonsil tissues. Perhaps sdiA is expressed at relatively low levels in tonsils compared to other in vivo locations. Considering the high load of

Salmonella and Yersinia in the tonsil tissues, it might be possible to perform qRT-

PCR to measure sdiA expression in tonsil tissues using a protocol formerly

119 developed in our lab by Anice Sabag-Daigle to address Salmonella gene expression in mouse organs.

Interestingly, a blind TraSH screen for genes required for S. Typhimurium fitness during Y. enterocolitica co-infection indicated the SdiA-regulated gene srgE was strongly required. We performed 1:1 competition experiments to test if srgE had a fitness phenotype in pigs, and this was done once with S.

Typhimurium strains expressing yenI and in a different experiment using a live Y. enterocolitica co-infection model. We did not observe significant logCI values in either experiment for either the WT or mutant. It is interesting to compare the srgE competition results of chapter 3.3.5 with the sdiA competition results of chapter 3.3.4 when Salmonella expressed yenI. We could interpret the srgE competition result to indicate that the sdiA hyper-virulent phenotype observed in chapter 3.3.4 is not dependent on srgE. Additional testing is needed to determine if the sdiA hyper-virulent phenotype is in any way reliant on the rck operon.

Much of what was observed in pigs was the inspiration for work done in chapter 4, where we review the literature pertaining to the existence of acyl-HSLs in mammalian intestines. One goal of the review was to identify any organisms with the potential to produce acyl-HSLs in the intestines. Indeed, we cite that

Hafnia rodentium, Edwardsiella tarda, and a Ralstonia species (represented in the HMP database), and Acinetobacter baumannii, Citrobacter rodentium,

Pseudomonas aeruginosa, and Serratia odorifera (reported in the literature from non-human mammals) are gut inhabitants with the potential to produce acyl-

HSLs. Aside from this, we were aware of the body of literature that demonstrates

120 that inflammation, including Salmonella-induced inflammation, results in a bloom of proteobacterial species in the gut. Thus, we wanted to test if S. Typhimurium- induced inflammation would result in RIVET activity. Conventional mice, however, do not develop intestinal inflammation after an S. Typhimurium infection, but others have shown that humanized mice do (172). Therefore, we humanized an in-house colony of germ-free mice using the feces of a single healthy human donor. While conventional mouse flora will protect a germ-free mouse from S. Typhimurium infection, the feces of humans (or even rats) will not protect germ-free mice (172). This is evident by the survival curve presented in chapter 3, (fig. 14 E). We did not observe SdiA activity in humanized mice, which suggests that acyl-HSLs were not present in humanized mouse intestines during inflammation. It is also possible that the human fecal sample we used to humanize the mice did not contain acyl-HSL-producing species, or that the mice did not permit colonization of an acyl-HSL-producing Proteobacteria species.

Currently, we are testing an S. Typhimurium-induced inflammation model in

CBA/J mice for RIVET activation since some reports have shown that perturbations in the gut flora (i.e. inflammation) result in a post-perturbation proteobacteria bloom (172, 173, 493). That is, the proteobacteria, which normally only comprises ≤ 4% of the flora, overgrow (173). In this condition, acyl-HSLs might be detectable by S. Typhimurium SdiA. Indeed, preliminary testing indicates that SdiA is active by week three post-infection (data not shown).

In this work, we have shown that S. Typhimurium SdiA is active in pigs co- infected with WT Y. enterocolitica, but like former turtle and mouse experiments,

121 SdiA activity does not affect S. Typhimurium fitness. This trend led us to ask a more fundamental question. Are there acyl-HSLs in mammalian intestines? Thus, we searched for gut-residing bacteria that have the potential to produce acyl-

HSLs. As demonstrated In Chapter 2, S. Typhimurium in particular has an extremely broad-host range specificity (table 1). Thus, in chapter 4, we probed the HMP for microbes that have LuxI homologs, but we also searched all available literature concerning other mammalian hosts, whether acyl-HSL- producing organisms live there, and if acyl-HSLs are present in mammalian intestines what factors might attribute to their degradation. We identified seven organisms that at least have the potential to make acyl-HSLs in intestines.

However, we found that abiotic factors such as alkaline pH or biotic factors such as degradative enzymes, either those produced by the host or the normal flora, could contribute to the apparent lack of acyl-HSLs in mammalian intestines.

Lastly, the conservation of sdiA for the Salmonella genus (and other members of Enterobacteriaceae family) has been brought into question. One could argue that sdiA is the remnant of a once complete QS system for which selection pressure has been lost. The loss of a luxI cognate signal synthase could be explained by the fact that HSL synthesis typically requires cellular SAM and fatty acid pool constituents, and is therefore physiologically and/or metabolically more taxing to the cell than SdiA activity. In addition, this work and our previous work (71, 72) did not yield a discernible sdiA phenotype in various animal models. Thus, we have yet to describe a physiological role for sdiA- dependent eavesdropping. It is possible that SdiA activity is merely

122 inconsequential, and not physiologically influential to the bacterium. In contrast to this idea, however, sdiA appears to be widely conserved among the

Enterobacteriaceae (123). From a genomic context, sdiA is consistently located upstream of sirA, an ancient response regulator of a conserved two-component system of Gram negative organisms, and sirA orthologs in the

Enterobacteriaceae (121, 123). Escherichia and Salmonella are considered closely related Enterobacteriaceae members, having diverged 140 million years ago, yet their genomes are approximately 50% similar (494). Sabag-Daigle and

Ahmer, however, recently reported their phylogenetic analysis of SdiA, citing that the Salmonella, Escherichia, Shigella, Citrobacter, Cronobacter, Klebsiella, and

Enterobacter genera have conserved sdiA despite their rapid divergence. These genera do not encode a cognate luxI homolog for sdiA, but Erwinia and Pantoea

(a distant subset of plant commensal microbes) encode expI and phzI, which are predicted to be the lost luxI cognate of sdiA (123). Thus, these data indicate that a selective pressure does indeed exists for sdiA, and efforts to understand its role in pathogenesis, especially during S. Typhimurium infection, should be fruitful.

123 References

1. Coburn B, Grassl GA, Finlay BB. 2007. Salmonella, the host and disease: a brief review. Immunol. Cell Biol. 85:112–118. 2. O'Ryan M, Prado V, Pickering LK. 2005. A millennium update on pediatric diarrheal illness in the developing world. Semin Pediatr Infect Dis 16:125–136. 3. Guibourdenche M, Roggentin P, Mikoleit M, Fields PI, Bockemühl J, Grimont PAD, Weill F-X. 2010. Supplement 2003-2007 (No. 47) to the White-Kauffmann-Le Minor scheme. Res. Microbiol. 161:26–29. 4. Lan R, Reeves PR, Octavia S. 2009. Population structure, origins and evolution of major Salmonella enterica clones. Infect. Genet. Evol. 9:996– 1005. 5. Aleksic S, Heinzerling F, Bockemuhl J. 1996. Human infection caused by Salmonellae of subspecies II to VI in Germany, 1977-1992. Zentralbl. Bakteriol. 283:391–398. 6. Swearingen MC, Porwollik S, Desai PT, McClelland M, Ahmer BMM. 2012. Virulence of 32 Salmonella strains in mice. PLoS ONE 7:e36043. 7. Saphra I, Winter JW. 1957. Clinical manifestations of salmonellosis in man; an evaluation of 7779 human infections identified at the New York Salmonella Center. N. Engl. J. Med. 256:1128–1134. 8. Santos RL, Tsolis RM, Zhang S, Ficht TA, Bäumler AJ, Adams LG. 2001. Salmonella-induced cell death is not required for enteritis in calves. Infect. Immun. 69:4610–4617. 9. Bhan MK, Bahl R, Bhatnagar S. 2005. Typhoid and paratyphoid fever. Lancet 366:749–762. 10. Chisti MJ, Bardhan PK, Huq S, Khan WA, Khan AM, Sharifuzzaman, Salam MA. 2009. High-dose intravenous dexamethasone in the management of diarrheal patients with enteric fever and encephalopathy. Southeast Asian J. Trop. Med. Public Health 40:1065–1073. 11. Gonzalez-Escobedo G, Marshall JM, Gunn JS. 2011. Chronic and acute infection of the gall bladder by Salmonella Typhi: understanding the carrier state. Nat. Rev. Microbiol. 9:9–14. 12. Ng W-L, Bassler BL. 2009. Bacterial quorum-sensing network architectures. Annu. Rev. Genet. 43:197–222. 13. Ramsey DM, Wozniak DJ. 2005. Understanding the control of Pseudomonas aeruginosa alginate synthesis and the prospects for management of chronic infections in cystic fibrosis. Mol. Microbiol. 56:309–322. 14. Smith JL, Fratamico PM, Yan X. 2011. Eavesdropping by bacteria: the role of SdiA in Escherichia coli and Salmonella enterica serovar Typhimurium quorum sensing. Foodborne Pathog. Dis. 8:169–178. 15. Swift S, Downie JA, Whitehead NA, Barnard AM, Williams P, Salmond GP. 2001. Quorum sensing as a population-density-dependent determinant of bacterial physiology. Adv. Microb. Physiol. 45:199–270.

124 16. Chen J, Xie J. 2011. Role and regulation of bacterial LuxR-like regulators. J. Cell. Biochem. 112:2694–2702. 17. Engebrecht J, Silverman M. 1984. Identification of genes and gene products necessary for bacterial bioluminescence. Proc. Natl. Acad. Sci. U.S.A. 81:4154–4158. 18. Schaefer AL, Val DL, Hanzelka BL, Cronan JE, Greenberg EP. 1996. Generation of cell-to-cell signals in quorum sensing: acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein. Proc. Natl. Acad. Sci. U.S.A. 93:9505–9509. 19. Kaplan HB, Sitnikov DM, Greenberg EP, Schineller JB, Baldwin TO. 1985. Diffusion of autoinducer is involved in regulation of the Vibrio fischeri luminescence system. J. Bacteriol. 163:1210–1214. 20. Stevens AM, Dolan KM, Greenberg EP. 1994. Synergistic binding of the Vibrio fischeri LuxR transcriptional activator domain and RNA polymerase to the lux promoter region. Proc. Natl. Acad. Sci. U.S.A. 91:12619–12623. 21. Miller MB, Bassler BL. 2001. Quorum sensing in bacteria. Annu. Rev. Microbiol. 55:165–199. 22. Hastings JW, Eberhard A, Nealson KH, Burlingame AL, Eberhard C, Kenyon GL, Nealson KH, Oppenheimer NJ. 1977. Bacterial bioluminescence. Annu. Rev. Microbiol. 31:549–595. 23. Nealson KH, Hastings JW. 1979. Bacterial bioluminescence: its control and ecological significance. Microbiol. Rev. 43:496–518. 24. Golberg K, Eltzov E, Shnit-Orland M, Marks RS, Kushmaro A. 2011. Characterization of quorum sensing signals in coral-associated bacteria. Microb. Ecol. 61:783–792. 25. Skindersoe ME, Ettinger-Epstein P, Rasmussen TB, Bjarnsholt T, de Nys R, Givskov M. 2008. Quorum sensing antagonism from marine organisms. Mar. Biotechnol. 10:56–63. 26. Ramsay JP, Williamson NR, Spring DR, Salmond GPC. 2011. A quorum-sensing molecule acts as a morphogen controlling gas vesicle organelle biogenesis and adaptive flotation in an enterobacterium. Proc. Natl. Acad. Sci. U.S.A. 108:14932–14937. 27. Wisedchaisri G, Dranow DM, Lie TJ, Bonanno JB, Patskovsky Y, Ozyurt SA, Sauder JM, Almo SC, Wasserman SR, Burley SK, Leigh JA, Gonen T. 2010. Structural underpinnings of nitrogen regulation by the prototypical nitrogen-responsive transcriptional factor NrpR. Structure 18:1512–1521. 28. Denison RF, Kiers ET. 2004. Lifestyle alternatives for rhizobia: mutualism, parasitism, and forgoing symbiosis. FEMS Microbiol. Lett. 237:187–193. 29. Subramoni S, Venturi V. 2009. LuxR-family “solos”: bachelor sensors/regulators of signalling molecules. Microbiology (Reading, Engl.) 155:1377–1385. 30. Wilkinson A, Danino V, Wisniewski-Dyé F, Lithgow JK, Downie JA. 2002. N-acyl-homoserine lactone inhibition of rhizobial growth is

125 mediated by two quorum-sensing genes that regulate plasmid transfer. J. Bacteriol. 184:4510–4519. 31. Eberhard A, Burlingame AL, Eberhard C, Kenyon GL, Nealson KH, Oppenheimer NJ. 1981. Structural identification of autoinducer of Photobacterium fischeri luciferase. Biochemistry 20:2444–2449. 32. Soares JA, Ahmer BMM. 2011. Detection of acyl-homoserine lactones by Escherichia and Salmonella. Curr. Opin. Microbiol. 14:188–193. 33. Atkinson S, Chang C-Y, Sockett RE, Cámara M, Williams P. 2006. Quorum sensing in Yersinia enterocolitica controls swimming and swarming motility. J. Bacteriol. 188:1451–1461. 34. Passador L, Santos RL, Cook JM, Tsolis RM, Gambello MJ, Zhang S, Rust L, Ficht TA, Iglewski BH, Bäumler AJ, Adams LG. 1993. Expression of Pseudomonas aeruginosa virulence genes requires cell-to- cell communication. Science 260:1127–1130. 35. Pearson JP, Teplitski M, Passador L, Goodier RI, Iglewski BH, Ahmer BMM, Greenberg EP. 1995. A second N-acylhomoserine lactone signal produced by Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U.S.A. 92:1490–1494. 36. Bright SW, Lea PJ, Miflin BJ. 1979. The regulation of methionine biosynthesis and metabolism in plants and bacteria. Ciba Found. Symp. 101–117. 37. Marinus MG, Casadesus J. 2009. Roles of DNA adenine methylation in host-pathogen interactions: mismatch repair, transcriptional regulation, and more. FEMS Microbiol. Rev. 33:488–503. 38. Magnuson K, Jackowski S, Rock CO, Cronan JE. 1993. Regulation of fatty acid biosynthesis in Escherichia coli. Microbiol. Rev. 57:522–542. 39. Hanzelka BL, Greenberg EP. 1996. Quorum sensing in Vibrio fischeri: evidence that S-adenosylmethionine is the amino acid substrate for autoinducer synthesis. J. Bacteriol. 178:5291–5294. 40. Thiel V, Thiel V, Kunze B, Kunze B, Verma P, Verma P, Wagner- Döbler I, Wagner-Döbler I, Schulz S, Schulz S. 2009. New structural variants of homoserine lactones in bacteria. Chembiochem 10:1861– 1868. 41. Lindemann A, Pessi G, Schaefer AL, Mattmann ME, Christensen QH, Kessler A, Hennecke H, Blackwell HE, Greenberg EP, Harwood CS. 2011. Isovaleryl-homoserine lactone, an unusual branched-chain quorum-sensing signal from the soybean symbiont Bradyrhizobium japonicum. Proc. Natl. Acad. Sci. U.S.A. 108:16765–16770. 42. Ahlgren NA, Harwood CS, Schaefer AL, Giraud E, Greenberg EP. 2011. Aryl-homoserine lactone quorum sensing in stem-nodulating photosynthetic bradyrhizobia. Proc. Natl. Acad. Sci. U.S.A. 108:7183– 7188. 43. Swearingen MC, Sabag-Daigle A, Ahmer BMM. 2013. Are There Acyl- Homoserine Lactones within Mammalian Intestines? J. Bacteriol. 195:173–179.

126 44. Gould TA, Schweizer HP, Churchill MEA. 2004. Structure of the Pseudomonas aeruginosa acyl-homoserinelactone synthase LasI. Mol. Microbiol. 53:1135–1146. 45. Bodman von SB, Majerczak DR, Coplin DL. 1998. A negative regulator mediates quorum-sensing control of exopolysaccharide production in Pantoea stewartii subsp. stewartii. Proc. Natl. Acad. Sci. U.S.A. 95:7687– 7692. 46. Dickschat JS, Bode HB, Kroppenstedt RM, Müller R, Schulz S. 2005. Biosynthesis of iso-fatty acids in myxobacteria. Org. Biomol. Chem. 3:2824–2831. 47. Schaefer AL, Greenberg EP, Oliver CM, Oda Y, Huang JJ, Bittan- Banin G, Peres CM, Schmidt S, Juhaszova K, Sufrin JR, Harwood CS. 2008. A new class of homoserine lactone quorum-sensing signals. Nature 454:595–599. 48. Schu DJ, Ramachandran R, Geissinger JS, Stevens AM. 2011. Probing the impact of ligand binding on the acyl-homoserine lactone- hindered transcription factor EsaR of Pantoea stewartii subsp. stewartii. J. Bacteriol. 193:6315–6322. 49. Yang M, Schaefer AL, Rumbaugh KP, Giel JL, Val DL, Griswold JA, Cai T, Hanzelka BL, Hamood AN, Zhong Z, Cronan JE, Zhu J, Greenberg EP. 2009. The LuxR family quorum-sensing activator MrtR requires its cognate autoinducer for dimerization and activation but not for protein folding. J. Bacteriol. 191:434–438. 50. Stevens AM, Queneau Y, Soulère L, Bodman von S, Doutheau A. 2011. Mechanisms and synthetic modulators of AHL-dependent gene regulation. Chem. Rev. 111:4–27. 51. Zhu J, winans SC. 2001. The quorum-sensing transcriptional regulator TraR requires its cognate signaling ligand for protein folding, protease resistance, and dimerization. Proc. Natl. Acad. Sci. U.S.A. 98:1507–1512. 52. Urbanowski ML, Lostroh CP, Greenberg EP. 2004. Reversible acylhomoserine lactone binding to purified Vibrio fischeri LuxR protein. J. Bacteriol. 186:631–637. 53. Yao Y, Martinez-Yamout MA, Dickerson TJ, Brogan AP, Wright PE, Dyson HJ. 2006. Structure of the Escherichia coli quorum sensing protein SdiA: activation of the folding switch by acyl homoserine lactones. J. Mol. Biol. 355:262–273. 54. Vannini A, Volpari C, Gargioli C, Muraglia E, Cortese R, De Francesco R, Neddermann P, Marco SD. 2002. The crystal structure of the quorum sensing protein TraR bound to its autoinducer and target DNA. EMBO J. 21:4393–4401. 55. Zhang R-G, Pappas KM, Pappas T, Brace JL, Miller PC, Oulmassov T, Molyneaux JM, Anderson JC, Bashkin JK, Winans SC, Joachimiak A. 2002. Structure of a bacterial quorum-sensing transcription factor complexed with pheromone and DNA. Nature 417:971–974. 56. Egland KA, Greenberg EP. 2001. Quorum sensing in Vibrio fischeri:

127 analysis of the LuxR DNA binding region by alanine-scanning mutagenesis. J. Bacteriol. 183:382–386. 57. Choi SH, Greenberg EP. 1991. The C-terminal region of the Vibrio fischeri LuxR protein contains an inducer-independent lux gene activating domain. Proc. Natl. Acad. Sci. U.S.A. 88:11115–11119. 58. Hanzelka BL, Greenberg EP. 1995. Evidence that the N-terminal region of the Vibrio fischeri LuxR protein constitutes an autoinducer-binding domain. J. Bacteriol. 177:815–817. 59. Fuqua WC, winans SC, Greenberg EP. 1994. Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators. J. Bacteriol. 176:269–275. 60. Qin Y, Luo ZQ, Smyth AJ, Gao P, Beck von Bodman S, Farrand SK. 2000. Quorum-sensing signal binding results in dimerization of TraR and its release from membranes into the cytoplasm. EMBO J. 19:5212–5221. 61. White CE, Winans SC. 2007. Cell-cell communication in the plant pathogen Agrobacterium tumefaciens. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 362:1135–1148. 62. Fuqua C, Greenberg EP. 2002. Listening in on bacteria: acylhomoserine lactone signalling. Nat. Rev. Mol. Cell Biol. 3:685–695. 63. Nelson HC. 1995. Structure and function of DNA-binding proteins. Curr. Opin. Genet. Dev. 5:180–189. 64. Hoskisson PA, Rigali S. 2009. Chapter 1: Variation in form and function the helix-turn-helix regulators of the GntR superfamily. Adv. Appl. Microbiol. 69:1–22. 65. Körner H, Sofia HJ, Zumft WG. 2003. Phylogeny of the bacterial superfamily of Crp-Fnr transcription regulators: exploiting the metabolic spectrum by controlling alternative gene programs. FEMS Microbiol. Rev. 27:559–592. 66. Da Re S, Guibourdenche M, Bertagnoli S, Roggentin P, Fourment J, Mikoleit M, Reyrat JM, Fields PI, Kahn D, Bockemühl J, Grimont PAD, Weill F-X. 1994. Intramolecular signal transduction within the FixJ transcriptional activator: in vitro evidence for the inhibitory effect of the phosphorylatable regulatory domain. Nucleic Acids Res. 22:1555–1561. 67. Castanie-Cornet MP, Penfound TA, Smith D, Elliott JF, Foster JW. 1999. Control of acid resistance in Escherichia coli. J. Bacteriol. 181:3525–3535. 68. Atkinson S, Sockett RE, Cámara M, Williams P. 2006. Quorum sensing and the lifestyle of Yersinia. Curr Issues Mol Biol 8:1–10. 69. Sharma VK, Bearson SMD. 2013. Evaluation of the impact of quorum sensing transcriptional regulator SdiA on long-term persistence and fecal shedding of Escherichia coli O157:H7 in weaned calves. Microb. Pathog. 70. Smith JN, Ahmer BMM. 2003. Detection of other microbial species by Salmonella: expression of the SdiA regulon. J. Bacteriol. 185:1357–1366. 71. Smith JN, Dyszel JL, Soares JA, Ellermeier CD, Altier C, Lawhon SD, Adams LG, Konjufca V, Curtiss R, Slauch JM, Ahmer BMM. 2008.

128 SdiA, an N-acylhomoserine lactone receptor, becomes active during the transit of Salmonella enterica through the gastrointestinal tract of turtles. PLoS ONE 3:e2826. 72. Dyszel JL, Smith JN, Lucas DE, Soares JA, Swearingen MC, Vross MA, Young GM, Ahmer BMM. 2010. Salmonella enterica serovar Typhimurium can detect acyl homoserine lactone production by Yersinia enterocolitica in mice. J. Bacteriol. 192:29–37. 73. Lindsay A, Ahmer BMM. 2005. Effect of sdiA on biosensors of N- acylhomoserine lactones. J. Bacteriol. 187:5054–5058. 74. Wu C, Lokanath NK, Kim DY, Nguyen LDN, Kim KK. 2008. Crystallization and preliminary X-ray studies of SdiA from Escherichia coli. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 64:19–21. 75. Dyszel JL, Soares JA, Swearingen MC, Lindsay A, Smith JN, Ahmer BMM. 2010. E. coli K-12 and EHEC genes regulated by SdiA. PLoS ONE 5:e8946. 76. Winzer K, Williams P. 2001. Quorum sensing and the regulation of virulence gene expression in pathogenic bacteria. Int. J. Med. Microbiol. 291:131–143. 77. Escobar MA, Dandekar AM. 2003. Agrobacterium tumefaciens as an agent of disease. Trends Plant Sci. 8:380–386. 78. Klapwijk PM, Scheulderman T, Schilperoort RA. 1978. Coordinated regulation of octopine degradation and conjugative transfer of Ti plasmids in Agrobacterium tumefaciens: evidence for a common regulatory gene and separate operons. J. Bacteriol. 136:775–785. 79. Moré MI, Finger LD, Stryker JL, Fuqua C, Eberhard A, winans SC. 1996. Enzymatic synthesis of a quorum-sensing autoinducer through use of defined substrates. Science 272:1655–1658. 80. Fuqua WC, winans SC. 1994. A LuxR-LuxI type regulatory system activates Agrobacterium Ti plasmid conjugal transfer in the presence of a plant tumor metabolite. J. Bacteriol. 176:2796–2806. 81. Hwang I, Li PL, Zhang L, Piper KR, Cook DM, Tate ME, Farrand SK. 1994. TraI, a LuxI homologue, is responsible for production of conjugation factor, the Ti plasmid N-acylhomoserine lactone autoinducer. Proc. Natl. Acad. Sci. U.S.A. 91:4639–4643. 82. Fuqua C, winans SC. 1996. Conserved cis-acting promoter elements are required for density-dependent transcription of Agrobacterium tumefaciens conjugal transfer genes. J. Bacteriol. 178:435–440. 83. Kerr A, Manigault P, Tempé J. 1977. Transfer of virulence in vivo and in vitro in Agrobacterium. Nature 265:560–561. 84. Charkowski AO. 2009. Decaying signals: will understanding bacterial- plant communications lead to control of soft rot? Curr. Opin. Biotechnol. 20:178–184. 85. Noel JT, Joy J, Smith JN, Fatica M, Schneider KR, Ahmer BMM, Teplitski M. 2010. Salmonella SdiA recognizes N-acyl homoserine lactone signals from Pectobacterium carotovorum in vitro, but not in a

129 bacterial soft rot. Mol. Plant Microbe Interact. 23:273–282. 86. Moretti C, Hosni T, Vandemeulebroecke K, Brady C, De Vos P, Buonaurio R, Cleenwerck I. 2011. Erwinia oleae sp. nov., isolated from olive knots caused by Pseudomonas savastanoi pv. savastanoi. Int. J. Syst. Evol. Microbiol. 61:2745–2752. 87. Rumbaugh KP, Ahmer BM, Griswold JA, van Reeuwijk J, Iglewski BH, Timmers CD, Hamood AN, Valentine PJ, Heffron F. 1999. Contribution of quorum sensing to the virulence of Pseudomonas aeruginosa in burn wound infections. Infect. Immun. 67:5854–5862. 88. Brugha RE, Davies JC. 2011. Pseudomonas aeruginosa in cystic fibrosis: pathogenesis and new treatments. Br J Hosp Med (Lond) 72:614–619. 89. Geller DE. 2009. Aerosol antibiotics in cystic fibrosis. Respir Care 54:658–670. 90. Kerem B, Rommens JM, Buchanan JA, Markiewicz D, Cox TK, Chakravarti A, Buchwald M, Tsui LC. 1989. Identification of the cystic fibrosis gene: genetic analysis. Science 245:1073–1080. 91. Rommens JM, Iannuzzi MC, Kerem B, Drumm ML, Melmer G, Dean M, Rozmahel R, Cole JL, Kennedy D, Hidaka N. 1989. Identification of the cystic fibrosis gene: chromosome walking and jumping. Science 245:1059–1065. 92. Riordan JR, Rommens JM, Kerem B, Alon N, Rozmahel R, Grzelczak Z, Zielenski J, Lok S, Plavsic N, Chou JL. 1989. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 245:1066–1073. 93. Freeman L. 1916. CHRONIC GENERAL INFECTION WITH THE BACILLUS PYOCYANEUS. Ann. Surg. 64:195–202. 94. Perkins RG. 1901. Report of Nine Cases of Infection with Bacillus pyocyaneus. J Med Res 6:281–297. 95. Williams EP, Cameron K. 1894. Infection by the Bacillus Pyocyaneus a Cause of Infantile Mortality. Public Health Pap Rep 20:355–360. 96. Jimenez PN, Koch G, Thompson JA, Xavier KB, Cool RH, Quax WJ. 2012. The multiple signaling systems regulating virulence in Pseudomonas aeruginosa. Microbiol. Mol. Biol. Rev. 76:46–65. 97. Brint JM, Ohman DE. 1995. Synthesis of multiple exoproducts in Pseudomonas aeruginosa is under the control of RhlR-RhlI, another set of regulators in strain PAO1 with homology to the autoinducer-responsive LuxR-LuxI family. J. Bacteriol. 177:7155–7163. 98. de Kievit TR, Iglewski BH. 2000. Bacterial quorum sensing in pathogenic relationships. Infect. Immun. 68:4839–4849. 99. Jones S, Ramsay JP, Yu B, Williamson NR, Bainton NJ, Spring DR, Birdsall M, Salmond GPC, Bycroft BW, Chhabra SR, Cox AJ, Golby P, Reeves PJ, Stephens S. 1993. The lux autoinducer regulates the production of exoenzyme virulence determinants in Erwinia carotovora and Pseudomonas aeruginosa. EMBO J. 12:2477–2482.

130 100. Davies DG, Parsek MR, Pearson JP, Iglewski BH, Costerton JW, Greenberg EP. 1998. The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science 280:295–298. 101. Bjarnsholt T, Givskov M. 2007. The role of quorum sensing in the pathogenicity of the cunning aggressor Pseudomonas aeruginosa. Anal Bioanal Chem 387:409–414. 102. Latifi A, Foglino M, Tanaka K, Williams P, Lazdunski A. 1996. A hierarchical quorum-sensing cascade in Pseudomonas aeruginosa links the transcriptional activators LasR and RhIR (VsmR) to expression of the stationary-phase sigma factor RpoS. Mol. Microbiol. 21:1137–1146. 103. Patankar AV, González JE. 2009. Orphan LuxR regulators of quorum sensing. FEMS Microbiol. Rev. 33:739–756. 104. Oinuma K-I, Greenberg EP. 2011. Acyl-homoserine lactone binding to and stability of the orphan Pseudomonas aeruginosa quorum-sensing signal receptor QscR. J. Bacteriol. 193:421–428. 105. Lintz MJ, Oinuma K-I, Wysoczynski CL, Greenberg EP, Churchill MEA. 2011. Crystal structure of QscR, a Pseudomonas aeruginosa quorum sensing signal receptor. Proc. Natl. Acad. Sci. U.S.A. 108:15763–15768. 106. Liang H, Deng X, Ji Q, Sun F, Shen T, He C. 2012. The Pseudomonas aeruginosa global regulator VqsR directly inhibits QscR to control quorum-sensing and virulence gene expression. J. Bacteriol. 194:3098– 3108. 107. Juhas M, Wiehlmann L, Huber B, Jordan D, Lauber J, Salunkhe P, Limpert AS, Götz von F, Steinmetz I, Eberl L, Tümmler B. 2004. Global regulation of quorum sensing and virulence by VqsR in Pseudomonas aeruginosa. Microbiology (Reading, Engl.) 150:831–841. 108. Juhas M, Wiehlmann L, Salunkhe P, Lauber J, Buer J, Tümmler B. 2005. GeneChip expression analysis of the VqsR regulon of Pseudomonas aeruginosa TB. FEMS Microbiol. Lett. 242:287–295. 109. Wang XD, de Boer PA, Rothfield LI. 1991. A factor that positively regulates cell division by activating transcription of the major cluster of essential cell division genes of Escherichia coli. EMBO J. 10:3363–3372. 110. Sitnikov DM, Schineller JB, Baldwin TO. 1996. Control of cell division in Escherichia coli: regulation of transcription of ftsQA involves both rpoS and SdiA-mediated autoinduction. Proc. Natl. Acad. Sci. U.S.A. 93:336– 341. 111. García-Lara J, Shang LH, Rothfield LI. 1996. An extracellular factor regulates expression of sdiA, a transcriptional activator of cell division genes in Escherichia coli. J. Bacteriol. 178:2742–2748. 112. Kanamaru K, Kanamaru K, Tatsuno I, Tobe T, Sasakawa C. 2000. SdiA, an Escherichia coli homologue of quorum-sensing regulators, controls the expression of virulence factors in enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 38:805–816. 113. Wei Y, Gould TA, Vollmer AC, Schweizer HP, LaRossa RA, Churchill

131 MEA. 2001. In vivo titration of mitomycin C action by four Escherichia coli genomic regions on multicopy plasmids. J. Bacteriol. 183:2259–2264. 114. Rahmati S, Yang S, Davidson AL, Zechiedrich EL. 2002. Control of the AcrAB multidrug efflux pump by quorum-sensing regulator SdiA. Mol. Microbiol. 43:677–685. 115. Kaper JB, Nataro JP, Mobley HL. 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2:123–140. 116. Hughes DT, Terekhova DA, Liou L, Hovde CJ, Sahl JW, Patankar AV, González JE, Edrington TS, Rasko DA, Sperandio V. 2010. Chemical sensing in mammalian host-bacterial commensal associations. Proc. Natl. Acad. Sci. U.S.A. 107:9831–9836. 117. Dziva F, van Diemen PM, Stevens MP, Smith AJ, Wallis TS. 2004. Identification of Escherichia coli O157 : H7 genes influencing colonization of the bovine gastrointestinal tract using signature-tagged mutagenesis. Microbiology (Reading, Engl.) 150:3631–3645. 118. Edrington TS, Farrow RL, Sperandio V, Hughes DT, Lawrence TE, Callaway TR, Anderson RC, Nisbet DJ. 2009. Acyl-homoserine-lactone autoinducer in the gastrointestinal [corrected] tract of feedlot cattle and correlation to season, E. coli O157:H7 prevalence, and diet. Curr. Microbiol. 58:227–232. 119. Erickson DL, Nsereko VL, Morgavi DP, Selinger LB, Rode LM, Beauchemin KA. 2002. Evidence of quorum sensing in the rumen ecosystem: detection of N-acyl homoserine lactone autoinducers in ruminal contents. Can. J. Microbiol. 48:374–378. 120. Sperandio V. 2010. SdiA sensing of acyl-homoserine lactones by enterohemorrhagic E. coli (EHEC) serotype O157:H7 in the bovine rumen. Gut Microbes 1:432–435. 121. Ahmer BM, van Reeuwijk J, Timmers CD, Valentine PJ, Heffron F. 1998. Salmonella typhimurium encodes an SdiA homolog, a putative quorum sensor of the LuxR family, that regulates genes on the virulence plasmid. J. Bacteriol. 180:1185–1193. 122. Lerat E, Moran NA. 2004. The evolutionary history of quorum-sensing systems in bacteria. Mol. Biol. Evol. 21:903–913. 123. Sabag-Daigle A, Ahmer BMM. 2012. ExpI and PhzI are descendants of the long lost cognate signal synthase for SdiA. PLoS ONE 7:e47720. 124. Teplitski M, Goodier RI, Ahmer BMM. 2006. Catabolite repression of the SirA regulatory cascade in Salmonella enterica. Int. J. Med. Microbiol. 296:449–466. 125. Teplitski M, Al-Agely A, Ahmer BMM. 2006. Contribution of the SirA regulon to biofilm formation in Salmonella enterica serovar Typhimurium. Microbiology (Reading, Engl.) 152:3411–3424. 126. Teplitski M, Goodier RI, Ahmer BMM. 2003. Pathways leading from BarA/SirA to motility and virulence gene expression in Salmonella. J. Bacteriol. 185:7257–7265. 127. Goodier RI, Ahmer BM. 2001. SirA orthologs affect both motility and

132 virulence. J. Bacteriol. 183:2249–2258. 128. Dieye Y, Dyszel JL, Kader R, Ahmer BMM. 2007. Systematic analysis of the regulation of type three secreted effectors in Salmonella enterica serovar Typhimurium. BMC Microbiol. 7:3. 129. Cirillo DM, Heffernan EJ, Wu L, Harwood J, Fierer J, Guiney DG. 1996. Identification of a domain in Rck, a product of the Salmonella typhimurium virulence plasmid, required for both serum resistance and cell invasion. Infect. Immun. 64:2019–2023. 130. Hackett J, Wyk P, Reeves P, Mathan V. 1987. Mediation of serum resistance in Salmonella typhimurium by an 11-kilodalton polypeptide encoded by the cryptic plasmid. J. Infect. Dis. 155:540–549. 131. Ho DK, Jarva H, Meri S. 2010. Human complement factor H binds to outer membrane protein Rck of Salmonella. J. Immunol. 185:1763–1769. 132. Ho DK, Tissari J, Järvinen HM, Blom AM, Meri S, Jarva H. 2011. Functional recruitment of human complement inhibitor C4B-binding protein to outer membrane protein Rck of Salmonella. PLoS ONE 6:e27546. 133. Heffernan EJ, Reed S, Hackett J, Fierer J, Roudier C, Guiney D. 1992. Mechanism of resistance to complement-mediated killing of bacteria encoded by the Salmonella typhimurium virulence plasmid gene rck. J. Clin. Invest. 90:953–964. 134. Crago AM, Koronakis V. 1999. Binding of extracellular matrix laminin to Escherichia coli expressing the Salmonella outer membrane proteins Rck and PagC. FEMS Microbiol. Lett. 176:495–501. 135. Rosselin M, Virlogeux-Payant I, Roy C, Bottreau E, Sizaret P-Y, Mijouin L, Germon P, Caron E, Velge P, Wiedemann A. 2010. Rck of Salmonella enterica, subspecies enterica serovar enteritidis, mediates zipper-like internalization. Cell Res. 20:647–664. 136. Samudrala R, Heffron F, McDermott JE. 2009. Accurate prediction of secreted substrates and identification of a conserved putative secretion signal for type III secretion systems. PLoS Pathog. 5:e1000375. 137. Dunlap PV. 1999. Quorum regulation of luminescence in Vibrio fischeri. J. Mol. Microbiol. Biotechnol. 1:5–12. 138. Lupp C, Urbanowski M, Greenberg EP, Ruby EG. 2003. The Vibrio fischeri quorum-sensing systems ain and lux sequentially induce luminescence gene expression and are important for persistence in the squid host. Mol. Microbiol. 50:319–331. 139. Meighen EA. 1993. Bacterial bioluminescence: organization, regulation, and application of the lux genes. FASEB J. 7:1016–1022. 140. Meighen EA. 1999. Autoinduction of light emission in different species of bioluminescent bacteria. Luminescence 14:3–9. 141. Milton DL. 2006. Quorum sensing in vibrios: complexity for diversification. Int. J. Med. Microbiol. 296:61–71. 142. Chessa D, Dorsey CW, Winter M, Bäumler AJ. 2008. Binding specificity of Salmonella plasmid-encoded fimbriae assessed by glycomics. J. Biol.

133 Chem. 283:8118–8124. 143. Bouwman CW, Kohli M, Killoran A, Touchie GA, Kadner RJ, Martin NL. 2003. Characterization of SrgA, a Salmonella enterica serovar Typhimurium virulence plasmid-encoded paralogue of the disulfide oxidoreductase DsbA, essential for biogenesis of plasmid-encoded fimbriae. J. Bacteriol. 185:991–1000. 144. Nicholson B, Low D. 2000. DNA methylation-dependent regulation of pef expression in Salmonella typhimurium. Mol. Microbiol. 35:728–742. 145. Wozniak CE, Lee C, Hughes KT. 2009. T-POP array identifies EcnR and PefI-SrgD as novel regulators of flagellar gene expression. J. Bacteriol. 191:1498–1508. 146. Turnbull AL, Kim W, Surette MG. 2012. Transcriptional regulation of sdiA by cAMP-receptor protein, LeuO, and environmental signals in Salmonella enterica serovar Typhimurium. Can. J. Microbiol. 58:10–22. 147. Kim W, Surette MG. 2006. Coordinated regulation of two independent cell-cell signaling systems and swarmer differentiation in Salmonella enterica serovar Typhimurium. J. Bacteriol. 188:431–440. 148. Kao KC, Tran LM, Liao JC. 2005. A global regulatory role of gluconeogenic genes in Escherichia coli revealed by transcriptome network analysis. J. Biol. Chem. 280:36079–36087. 149. Fandl JP, Thorner LK, Artz SW. 1990. Mutations that affect transcription and cyclic AMP-CRP regulation of the adenylate cyclase gene (cya) of Salmonella typhimurium. Genetics 125:719–727. 150. Henikoff S, Haughn GW, Calvo JM, Wallace JC. 1988. A large family of bacterial activator proteins. Proc. Natl. Acad. Sci. U.S.A. 85:6602–6606. 151. Hertzberg KM, Gemmill R, Jones J, Calvo JM. 1980. Cloning of an EcoRI-generated fragment of the leucine operon of Salmonella typhimurium. Gene 8:135–152. 152. Maddocks SE, Oyston PCF. 2008. Structure and function of the LysR- type transcriptional regulator (LTTR) family proteins. Microbiology (Reading, Engl.) 154:3609–3623. 153. Tenor JL, McCormick BA, Ausubel FM, Aballay A. 2004. Caenorhabditis elegans-based screen identifies Salmonella virulence factors required for conserved host-pathogen interactions. Curr. Biol. 14:1018–1024. 154. Lawley TD, Chan K, Thompson LJ, Kim CC, Govoni GR, Monack DM. 2006. Genome-wide screen for Salmonella genes required for long-term systemic infection of the mouse. PLoS Pathog. 2:e11. 155. Volf J, Sevcik M, Havlickova H, Sisak F, Damborsky J, Rychlik I. 2002. Role of SdiA in Salmonella enterica serovar Typhimurium physiology and virulence. Arch. Microbiol. 178:94–101. 156. Ahmer BMM. 2004. Cell-to-cell signalling in Escherichia coli and Salmonella enterica. Mol. Microbiol. 52:933–945. 157. Bottomley MJ, Muraglia E, Bazzo R, Carfì A. 2007. Molecular insights into quorum sensing in the human pathogen Pseudomonas aeruginosa

134 from the structure of the virulence regulator LasR bound to its autoinducer. J. Biol. Chem. 282:13592–13600. 158. Slauch JM, Camilli A. 2000. IVET and RIVET: use of gene fusions to identify bacterial virulence factors specifically induced in host tissues. Meth. Enzymol. 326:73–96. 159. Throup JP, Cámara M, Briggs GS, Winson MK, Chhabra SR, Bycroft BW, Williams P, stewart GS. 1995. Characterisation of the yenI/yenR locus from Yersinia enterocolitica mediating the synthesis of two N- acylhomoserine lactone signal molecules. Mol. Microbiol. 17:345–356. 160. Rostagno MH, Hurd HS, McKean JD, Ziemer CJ, Gailey JK, Leite RC. 2003. Preslaughter holding environment in pork plants is highly contaminated with Salmonella enterica. Appl. Environ. Microbiol. 69:4489–4494. 161. Rostagno MH, Hurd HS, Mckean JD. 2005. Resting pigs on transport trailers as an intervention strategy to reduce Salmonella enterica prevalence at slaughter. J. Food Prot. 68:1720–1723. 162. Hurd HS, Gailey JK, McKean JD, Rostagno MH. 2001. Experimental rapid infection in market swine following exposure to a Salmonella contaminated environment. Berl. Munch. Tierarztl. Wochenschr. 114:382–384. 163. Hurd HS, Gailey JK, McKean JD, Rostagno MH. 2001. Rapid infection in market-weight swine following exposure to a Salmonella typhimurium- contaminated environment. Am. J. Vet. Res. 62:1194–1197. 164. Côté S, Letellier A, Lessard L, Quessy S. 2004. Distribution of Salmonella in tissues following natural and experimental infection in pigs. Can. J. Vet. Res. 68:241–248. 165. Bonardi S, Pizzin G, Lucidi L, Brindani F, Paterlini F, Tagliabue S. 2003. Isolation of Salmonella enterica from slaughtered pigs. Vet. Res. Commun. 27 Suppl 1:281–283. 166. Ortiz Martínez P, Mylona S, Drake I, Fredriksson-Ahomaa M, Korkeala H, Corry JEL. 2010. Wide variety of bioserotypes of enteropathogenic Yersinia in tonsils of English pigs at slaughter. Int. J. Food Microbiol. 139:64–69. 167. Sheikh A, Khanam F, Sayeed MA, Rahman T, Pacek M, Hu Y, Rollins A, Bhuiyan MS, Rollins S, Kalsy A, Arifuzzaman M, Leung DT, Sarracino DA, Krastins B, Charles RC, Larocque RC, Cravioto A, Calderwood SB, Brooks WA, Harris JB, Labaer J, Qadri F, Ryan ET. 2011. Interferon-γ and proliferation responses to Salmonella enterica Serotype Typhi proteins in patients with S. Typhi Bacteremia in Dhaka, Bangladesh. PLoS Negl Trop Dis 5:e1193. 168. Hurd HS, McKean JD, Wesley IV, Karriker LA. 2001. The effect of lairage on Salmonella isolation from market swine. J. Food Prot. 64:939– 944. 169. McKean JD, Hurd HS, Larsen S, Rostagno M, Griffith R, Wesley I. 2001. Impact of commercial pre-harvest processes on the prevalence of

135 Salmonella enterica in cull sows. Berl. Munch. Tierarztl. Wochenschr. 114:353–355. 170. Coulthurst SJ, Clare S, Evans TJ, Foulds IJ, Roberts KJ, Welch M, Dougan G, Salmond GPC. 2007. Quorum sensing has an unexpected role in virulence in the model pathogen Citrobacter rodentium. EMBO Rep. 8:698–703. 171. Kuo A, Blough NV, Dunlap PV. 1994. Multiple N-acyl-L-homoserine lactone autoinducers of luminescence in the marine symbiotic bacterium Vibrio fischeri. J. Bacteriol. 176:7558–7565. 172. Chung H, Pamp SJ, Hill JA, Surana NK, Edelman SM, Troy EB, Reading NC, Villablanca EJ, Wang S, Mora JR, Umesaki Y, Mathis D, Benoist C, Relman DA, Kasper DL. 2012. Gut immune maturation depends on colonization with a host-specific microbiota. Cell 149:1578– 1593. 173. Stecher B, Robbiani R, Walker AW, Westendorf AM, Barthel M, Kremer M, Chaffron S, Macpherson AJ, Buer J, Parkhill J, Dougan G, Mering von C, Hardt W-D. 2007. Salmonella enterica serovar typhimurium exploits inflammation to compete with the intestinal microbiota. PLoS Biol. 5:2177–2189. 174. Lopez CA, Winter SE, Rivera-Chávez F, Xavier MN, Poon V, Nuccio S-P, Tsolis RM, Bäumler AJ. 2012. Phage-mediated acquisition of a type III secreted effector protein boosts growth of salmonella by nitrate respiration. MBio 3. 175. Rivera-Chávez F, Winter SE, Lopez CA, Xavier MN, Winter MG, Nuccio S-P, Russell JM, Laughlin RC, Lawhon SD, Sterzenbach T, Bevins CL, Tsolis RM, Harshey R, Adams LG, Bäumler AJ. 2013. Salmonella uses energy taxis to benefit from intestinal inflammation. PLoS Pathog. 9:e1003267. 176. MacLennan CA, Gilchrist JJ, Gordon MA, Cunningham AF, Cobbold M, Goodall M, Kingsley RA, van Oosterhout JJG, Msefula CL, Mandala WL, Leyton DL, Marshall JL, Gondwe EN, Bobat S, López- Macías C, Doffinger R, Henderson IR, Zijlstra EE, Dougan G, Drayson MT, MacLennan ICM, Molyneux ME. 2010. Dysregulated humoral immunity to nontyphoidal Salmonella in HIV-infected African adults. Science 328:508–512. 177. Roux CM, Butler BP, Chau JY, Paixao TA, Cheung KW, Santos RL, Luckhart S, Tsolis RM. 2010. Both hemolytic anemia and malaria parasite-specific factors increase susceptibility to Nontyphoidal Salmonella enterica serovar typhimurium infection in mice. Infect. Immun. 78:1520–1527. 178. Magnino S, Colin P, Dei-Cas E, Madsen M, McLauchlin J, Nöckler K, Maradona MP, Tsigarida E, Vanopdenbosch E, Van Peteghem C. 2009. Biological risks associated with consumption of reptile products. Int. J. Food Microbiol. 134:163–175. 179. Enriquez C, Nwachuku N, Gerba CP. 2001. Direct exposure to animal

136 enteric pathogens. Rev Environ Health 16:117–131. 180. Warwick C, Lambiris AJ, Westwood D, Steedman C. 2001. Reptile- related salmonellosis. J R Soc Med 94:124–126. 181. Nairz M, Fritsche G, Crouch M-LV, Barton HC, Fang FC, Weiss G. 2009. Slc11a1 limits intracellular growth of Salmonella enterica sv. Typhimurium by promoting macrophage immune effector functions and impairing bacterial iron acquisition. Cell. Microbiol. 11:1365–1381. 182. Monack DM, Bouley DM, Falkow S. 2004. Salmonella typhimurium persists within macrophages in the mesenteric lymph nodes of chronically infected Nramp1+/+ mice and can be reactivated by IFNgamma neutralization. J. Exp. Med. 199:231–241. 183. Kingsley RA, Humphries AD, Weening EH, De Zoete MR, Winter S, Papaconstantinopoulou A, Dougan G, Bäumler AJ. 2003. Molecular and phenotypic analysis of the CS54 island of Salmonella enterica serotype typhimurium: identification of intestinal colonization and persistence determinants. Infect. Immun. 71:629–640. 184. Weening EH, Barker JD, Laarakker MC, Humphries AD, Tsolis RM, Bäumler AJ. 2005. The Salmonella enterica serotype Typhimurium lpf, bcf, stb, stc, std, and sth fimbrial operons are required for intestinal persistence in mice. Infect. Immun. 73:3358–3366. 185. van der Woude MW, Bäumler AJ. 2004. Phase and antigenic variation in bacteria. Clin. Microbiol. Rev. 17:581–611– table of contents. 186. Crawford RW, Gibson DL, Kay WW, Gunn JS. 2008. Identification of a bile-induced exopolysaccharide required for Salmonella biofilm formation on gallstone surfaces. Infect. Immun. 76:5341–5349. 187. Crawford RW, Reeve KE, Gunn JS. 2010. Flagellated but not hyperfimbriated Salmonella enterica serovar Typhimurium attaches to and forms biofilms on cholesterol-coated surfaces. J. Bacteriol. 192:2981–2990. 188. Monack DM. 2012. Salmonella persistence and transmission strategies. Curr. Opin. Microbiol. 15:100–107. 189. Estevan M, Irache JM, Grilló MJ, Blasco JM, Gamazo C. 2006. Encapsulation of antigenic extracts of Salmonella enterica serovar. Abortusovis into polymeric systems and efficacy as vaccines in mice. Vet. Microbiol. 118:124–132. 190. Uzzau S, Marogna G, Leori GS, Curtiss R, Schianchi G, Stocker BAD, Rubino S. 2005. Virulence attenuation and live vaccine potential of aroA, crp cdt cya, and plasmid-cured mutants of Salmonella enterica serovar Abortusovis in mice and sheep. Infect. Immun. 73:4302–4308. 191. Mukkur TK, Stocker BA, Walker KH. 1991. Genetic manipulation of Salmonella serotype Bovismorbificans to aromatic-dependence and evaluation of its vaccine potential in mice. J. Med. Microbiol. 34:57–62. 192. Collins FM. 1968. Cross-protection against Salmonella enteritidis infection in mice. J. Bacteriol. 95:1343–1349. 193. Archer GT, Whitby JL. 1957. Protection of mice by living Vi and O

137 vaccines against death caused by Salmonella paratyphi C. J Hyg (Lond) 55:513–526. 194. Howard JG. 1961. Resistance to infection with Salmonella paratyphi C in mice parasitized with a relatively avirulent strain of Salmonella typhimurium. Nature 191:87–88. 195. Porta A, Eletto A, Török Z, Franceschelli S, Glatz A, Vígh L, Maresca B. 2010. Changes in membrane fluid state and heat shock response cause attenuation of virulence. J. Bacteriol. 192:1999–2005. 196. Boyd EF, Wang FS, Beltran P, Plock SA, Nelson K, Selander RK. 1993. Salmonella reference collection B (SARB): strains of 37 serovars of subspecies I. J. Gen. Microbiol. 139 Pt 6:1125–1132. 197. Beltran P, Plock SA, Smith NH, Whittam TS, Old DC, Selander RK. 1991. Reference collection of strains of the Salmonella typhimurium complex from natural populations. J. Gen. Microbiol. 137:601–606. 198. Joseph PG, Yee HT, Sivanandan SP. 1984. The occurrence of Salmonellae in house shrews and rats in Ipoh, Malaysia. Southeast Asian J. Trop. Med. Public Health 15:326–330. 199. Lee JA. 1974. Recent trends in human salmonellosis in England and Wales: the epidemiology of prevalent serotypes other than Salmonella typhimurium. J Hyg (Lond) 72:185–195. 200. Besznyak I, Pinter E, Turbok E. 1965. Thoracic empyema and lung abscess due to Salmonella stanley. Arch Surg 91:1023–1025. 201. Ray K, Aggarwal P, Rai Chowdhuri AN. 1983. Simultaneous isolation of Salmonella stanley and S. oranienburg from an outbreak of food poisoning at Maldives island. Indian J. Med. Res. 77:602–604. 202. Angkititrakul S, Chomvarin C, Chaita T, Kanistanon K, Waethewutajarn S. 2005. Epidemiology of antimicrobial resistance in Salmonella isolated from pork, chicken meat and humans in Thailand. Southeast Asian J. Trop. Med. Public Health 36:1510–1515. 203. Lazarus R, Waghorn D, Nash C. 2007. Cutaneous Salmonella infection. Scand. J. Infect. Dis. 39:257–258. 204. Shimi A, Keyhani M, Hedayati K. 1979. Studies on salmonellosis in the house mouse, Mus musculus. Lab. Anim. 13:33–34. 205. Franklin J, Richter CB. 1968. The isolation of Salmonella poona and a nonmotile variant from laboratory mice. Lab Anim Care 18:92–93. 206. Margard WL, Litchfield JH. 1963. Occurrence of unusual salmonellae in laboratory mice. J. Bacteriol. 85:1451–1452. 207. Wernery U. 1992. The prevalence of Salmonella infections in camels (Camelus dromedarius) in the United Arab Emirates. Br. Vet. J. 148:445– 450. 208. Molla B, Mohammed A, Salah W. 2004. Salmonella prevalence and distribution of serotypes in apparently healthy slaughtered camels (Camelus dromedarius) in Eastern Ethiopia. Trop Anim Health Prod 36:451–458. 209. Ogunsanmi AO, Taiwo VO, Iroeche PC, Sobaloju SO. 2001.

138 Serological survey of salmonellosis in grey duiker (Sylvicapra grimmia) in Asejire, Irewole Local Government Area, Osun State, Nigeria. Afr J Med Med Sci 30:115–118. 210. Lavergne GM, James HF, Martineau C, Diena BB, Lior H. 1977. The guinea pig as a model for the asymptomatic human typhoid carrier. Lab. Anim. Sci. 27:806–816. 211. Dima VF, Petrovici M, Lacky D. 1989. Reaction and response of newborn guinea pigs to experimental Salmonella typhi infection. Arch Roum Pathol Exp Microbiol 48:299–321. 212. Kulkarni VB, Narasimham AS. 1966. Isolation of unusual Salmonella types (S. typhi and S. paratyphi A) from a hen and rabbit respectively. Indian J Pathol Bacteriol 9:272–277. 213. Reed LJ, Muench H. 1938. A simple method of estimating fifty per cent endpoints. The American Journal of Hygiene 27:493–497. 214. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28:2731–2739. 215. Pioz M, Loison A, Gauthier D, Gibert P, Jullien J-M, Artois M, Gilot- Fromont E. 2008. Diseases and reproductive success in a wild mammal: example in the alpine chamois. Oecologia 155:691–704. 216. Arora S, Tyagi SC. 1976. Bacteremia due to Salmonella arizonae. J Assoc Physicians India 24:457–458. 217. Kaura YK, Sharma VK, Chandiramani NK. 1982. Enterotoxigenicity and invasiveness of Salmonella species. Antonie Van Leeuwenhoek 48:273– 283. 218. Bhatt BD, Zuckerman MJ, Foland JA, Polly SM, Marwah RK. 1989. Disseminated Salmonella arizona infection associated with rattlesnake meat ingestion. Am. J. Gastroenterol. 84:433–435. 219. Krum SH, Stevens DR, Hirsh DC. 1977. Salmonella arizonae bacteremia in a cat. J. Am. Vet. Med. Assoc. 170:42–44. 220. Cahan D, Sechter I, Gerichter CB, Greenberg Z, Sklut O, Bergner- Rabinowitz S. 1977. Six new Salmonella sub-genus III serotypes isolated from snakes in Israel. Ann. Microbiol. (Paris) 128A:69–73. 221. Chiodini RJ. 1982. Transovarian passage, visceral distribution, and pathogenicity of salmonella in snakes. Infect. Immun. 36:710–713. 222. Pedersen K, Hansen HC, Jørgensen JC, Borck B. 2002. Serovars of Salmonella isolated from Danish turkeys between 1995 and 2000 and their antimicrobial resistance. Vet. Rec. 150:471–474. 223. Joseph PG, Sivanandan SP, Yee HT. 1988. Animal Salmonella surveillance in Peninsular Malaysia, 1981-1985. Epidemiol. Infect. 100:351–359. 224. Millán J, Aduriz G, Moreno B, Juste RA, Barral M. 2004. Salmonella isolates from wild birds and mammals in the Basque Country (Spain). Rev. - Off. Int. Epizoot. 23:905–911.

139 225. Gaspar P. 1978. Isolation of Salmonella arizonae from an aborted bovine foetus. Bull Anim Health Prod Afr 26:230–231. 226. Rodriguez A, Pangloli P, Richards HA, Mount JR, Draughon FA. 2006. Prevalence of Salmonella in diverse environmental farm samples. J. Food Prot. 69:2576–2580. 227. Shane SM, Gilbert R, Harrington KS. 1990. Salmonella colonization in commercial pet turtles (Pseudemys scripta elegans). Epidemiol. Infect. 105:307–316. 228. D'Aoust JY, Daley E, Crozier M, Sewell AM. 1990. Pet turtles: a continuing international threat to public health. Am. J. Epidemiol. 132:233–238. 229. Mathewson JJ. 1979. Enterobacteriaceae isolated from iguanid lizards of west-central Texas. Appl. Environ. Microbiol. 38:402–405. 230. Silva EN, Hipolito O, Grecchi R. 1980. Natural and experimental Salmonella arizonae 18:z4,z32 (Ar. 7:1,7,8) infection in broilers. Bacteriological and histopathological survey of eye and brain lesions. Avian Dis. 24:631–636. 231. Harp JA, Myers LL, Rich JE, Gates NL. 1981. Role of Salmonella arizonae and other infective agents in enteric disease of lambs. Am. J. Vet. Res. 42:596–599. 232. Winsor DK, Bloebaum AP, Mathewson JJ. 1981. Gram-negative, aerobic, enteric pathogens among intestinal microflora of wild turkey vultures (Cathartes aura) in west central Texas. Appl. Environ. Microbiol. 42:1123–1124. 233. Jortner BS, Larsen C. 1984. Granulomatous ventriculitis of the brain in arizonosis of turkeys. Vet. Pathol. 21:114–115. 234. Adamson PJ, Jang SS. 1985. Ulcerative keratitis associated with Salmonella arizonae infection in a horse. J. Am. Vet. Med. Assoc. 186:1219–1220. 235. Hannam DA, Wray C, Harbourne JF. 1986. Experimental Salmonella arizonae infection of sheep. Br. Vet. J. 142:458–466. 236. Pritchard J. 1990. Alberta. Salmonella arizonae in sheep. Can. Vet. J. 31:42. 237. Manolis SC, Webb GJ, Pinch D, Melville L, Hollis G. 1991. Salmonella in captive crocodiles (Crocodylus johnstoni and C. porosus). Aust. Vet. J. 68:102–105. 238. Kenny DE, Baier J, Getzy DM. 1997. Salmonellosis in captive black rhinoceroses (Diceros bicornis). J. Zoo Wildl. Med. 28:307–311. 239. Macri NP, Stevenson GW, Wu CC. 1997. Salmonella arizonae sepsis in a lynx. J. Wildl. Dis. 33:908–911. 240. Orós J, Rodríguez JL, Fernández A, Herráez P, Espinosa de los Monteros A, Jacobson ER. 1998. Simultaneous occurrence of Salmonella arizonae in a sulfur crested cockatoo (Cacatua galerita galerita) and iguanas. Avian Dis. 42:818–823. 241. Briones V, Téllez S, Goyache J, Ballesteros C, del Pilar Lanzarot M,

140 Domínguez L, Fernández-Garayzábal JF. 2004. Salmonella diversity associated with wild reptiles and amphibians in Spain. Environ. Microbiol. 6:868–871. 242. Oloya J, Doetkott D, Khaitsa ML. 2009. Antimicrobial drug resistance and molecular characterization of Salmonella isolated from domestic animals, humans, and meat products. Foodborne Pathog. Dis. 6:273– 284. 243. Foley SL, Lynne AM. 2008. Food animal-associated Salmonella challenges: pathogenicity and antimicrobial resistance. J. Anim. Sci. 86:E173–87. 244. Devi SJ, Murray CJ. 1991. Cockroaches (Blatta and Periplaneta species) as reservoirs of drug-resistant salmonellas. Epidemiol. Infect. 107:357–361. 245. Feeley JC, Treger MD. 1969. Penetration of turtle eggs by Salmonella braenderup. Public Health Rep 84:156–158. 246. Gopee NV, Adesiyun AA, Caesar K. 2000. Retrospective and longitudinal study of salmonellosis in captive wildlife in Trinidad. J. Wildl. Dis. 36:284–293. 247. Sojka WJ, Wray C, Shreeve J, Benson AJ. 1977. Incidence of salmonella infection in animals in England and Wales 1968--1974. J Hyg (Lond) 78:43–56. 248. Kikuvi GM, Ombui JN, Mitema ES, Schwarz S. 2007. Antimicrobial resistance in Salmonella serotypes isolated from slaughter animals in Kenya. East Afr Med J 84:233–239. 249. Foley SL, Lynne AM, Nayak R. 2008. Salmonella challenges: prevalence in swine and poultry and potential pathogenicity of such isolates. J. Anim. Sci. 86:E149–62. 250. Pourciau SS, Springer WT. 1978. Frequency and duration of paratyphoid organism shedding by experimentally infected bobwhite quail (Colinus virginianus). J. Wildl. Dis. 14:203–207. 251. Bangert RL, Ward AC, Stauber EH, Cho BR, Widders PR. 1988. A survey of the aerobic bacteria in the feces of captive raptors. Avian Dis. 32:53–62. 252. Jijón S, Wetzel A, LeJeune J. 2007. Salmonella enterica isolated from wildlife at two Ohio rehabilitation centers. J. Zoo Wildl. Med. 38:409–413. 253. Chong Y, Kwon OH, Lee SY, Chung KS, Shimada T. 1991. Salmonella enterica subspecies diarizonae bacteremia in an infant with enteritis--a case report. Yonsei Med. J. 32:275–278. 254. Madsen M, Hangartner P, West K, Kelly P. 1998. Recovery rates, serotypes, and antimicrobial susceptibility patterns of salmonellae isolated from cloacal swabs of wild Nile crocodiles (Crocodylus niloticus) in Zimbabwe. J. Zoo Wildl. Med. 29:31–34. 255. Schröter M, Roggentin P, Hofmann J, Speicher A, Laufs R, Mack D. 2004. Pet snakes as a reservoir for Salmonella enterica subsp. diarizonae (Serogroup IIIb): a prospective study. Appl. Environ. Microbiol.

141 70:613–615. 256. Ferreras MDC, Muñioz M, Pérez V, Benavides J, García-Pariente C, Fuertes M, Adúriz G, García-Marín JF. 2007. Unilateral orchitis and epididymitis caused by Salmonella enterica subspecies diarizonae infection in a ram. J. Vet. Diagn. Invest. 19:194–197. 257. Sechter I, Katzenelson E, Reisfeld A. 1991. Salmonella serovars (others than Typhi and Paratyphi) from extra-intestinal sources. Israel, 1984-9. Epidemiol. Infect. 106:485–488. 258. Morse EV, Duncan MA, Estep DA, Riggs WA, Blackburn BO. 1976. Canine salmonellosis: A review and report of dog to child transmission of Salmonella enteritidis. Am J Public Health 66:82–84. 259. Metz H, Lieb U. 1980. [Enteritis salmonellae in man and animal from 1953 to 1975 in Southern Bavaria (author's transl)]. Zentralbl Bakteriol Mikrobiol Hyg B 171:231–255. 260. Silva CA, Blondel CJ, Quezada CP, Porwollik S, Andrews-Polymenis HL, Toro CS, Zaldívar M, Contreras I, McClelland M, Santiviago CA. 2012. Infection of mice by Salmonella enterica serovar Enteritidis involves additional genes that are absent in the genome of serovar Typhimurium. Infect. Immun. 80:839–849. 261. Quiroz TS, Nieto PA, Tobar HE, Salazar-Echegarai FJ, Lizana RJ, Quezada CP, Santiviago CA, Araya DV, Riedel CA, Kalergis AM, Bueno SM. 2011. Excision of an unstable pathogenicity island in Salmonella enterica serovar Enteritidis is induced during infection of phagocytic cells. PLoS ONE 6:e26031. 262. Van Immerseel F, Pasmans F, De Buck J, Rychlik I, Hradecka H, Collard J-M, Wildemauwe C, Heyndrickx M, Ducatelle R, Haesebrouck F. 2004. Cats as a risk for transmission of antimicrobial drug-resistant Salmonella. Emerging Infect. Dis. 10:2169–2174. 263. Fox JG, Beaucage CM. 1979. The incidence of Salmonella in random- source cats purchased for use in research. J. Infect. Dis. 139:362–365. 264. Thompson H, Wright NG. 1969. Canine salmonellosis. J Small Anim Pract 10:579–582. 265. Trawinska B, Saba L, Wdowiak L, Ondrasovicova O, Nowakowicz- Debek B. 2008. Evaluation of Salmonella rod incidence in poultry in the Lublin Province over the years 2001-2005. Ann Agric Environ Med 15:131–134. 266. Guerin MT, Martin SW, Darlington GA, Rajic A. 2005. A temporal study of Salmonella serovars in animals in Alberta between 1990 and 2001. Can. J. Vet. Res. 69:88–99. 267. Steffen EK, Wagner JE. 1983. Salmonella enteriditis serotype Amsterdam in a commercial rat colony. Lab. Anim. Sci. 33:454–456. 268. Lapuz R, Tani H, Sasai K, Shirota K, Katoh H, Baba E. 2008. The role of roof rats ( Rattus rattus) in the spread of Salmonella Enteritidis and S. Infantis contamination in layer farms in eastern Japan. Epidemiol. Infect. 136:1235–1243.

142 269. Richardson A. 1975. Outbreaks of bovine salmonellosis caused by serotypes other than S. dublin and S. typhimurium. J Hyg (Lond) 74:195– 203. 270. van Duijkeren E, van Klingeren B, Vulto AG, Sloet van Oldruitenborgh-Oosterbaan MM, Breukink HJ, van Miert AS. 1995. In vitro susceptibility to antimicrobial drugs of 62 Salmonella strains isolated from horses in The Netherlands. Vet. Microbiol. 45:19–26. 271. Renter DG, Gnad DP, Sargeant JM, Hygnstrom SE. 2006. Prevalence and serovars of Salmonella in the feces of free-ranging white-tailed deer (Odocoileus virginianus) in Nebraska. J. Wildl. Dis. 42:699–703. 272. Williams DR, Bellhouse R. 1974. The prevalence of salmonellas in mink. J Hyg (Lond) 72:71–78. 273. Olsen AR, Hammack TS. 2000. Isolation of Salmonella spp. from the housefly, Musca domestica L., and the dump fly, Hydrotaea aenescens (Wiedemann) (Diptera: Muscidae), at caged-layer houses. J. Food Prot. 63:958–960. 274. Carrasco SE, Burek KA, Beckmen KB, Oaks JL, Davis MA, Baker KNK, Mazet JAK. 2011. Aerobic oral and rectal bacteria of free-ranging Steller sea lion pups and juveniles (Eumetopias jubatus) in Alaska. J. Wildl. Dis. 47:807–820. 275. Ma J-S, Chen P-Y, Lau Y-J, Chi C-S. 2003. Brain abscess caused by Salmonella enterica subspecies houtenae in a patient with chronic granulomatous disease. J Microbiol Immunol Infect 36:282–284. 276. Wybo I, Potters D, Plaskie K, Covens L, Collard JM, Lauwers S. 2004. Salmonella enterica subspecies houtenae serotype 44:z4, z23:--as a rare cause of meningitis. Acta Clin Belg 59:232–234. 277. Tabarani CM, Bennett NJ, Kiska DL, Riddell SW, Botash AS, Domachowske JB. 2010. Empyema of preexisting subdural hemorrhage caused by a rare salmonella species after exposure to bearded dragons in a foster home. J. Pediatr. 156:322–323. 278. Woodward DL, Khakhria R, Johnson WM. 1997. Human salmonellosis associated with exotic pets. J. Clin. Microbiol. 35:2786–2790. 279. Phillips WE, Hatkin JM. 1978. Isolation of Salmonella houtenae from a cockateel. Avian Dis. 22:350–353. 280. Runkel NS, Rodriguez LF, Moody FG, LaRocco MT, Blasdel T. 1991. Salmonella infection of the biliary and intestinal tract of wild opossums. Lab. Anim. Sci. 41:54–56. 281. KOHLER PF. 1964. HOSPITAL SALMONELLOSIS. A REPORT OF 23 CASES OF GASTROENTERITIS CAUSED BY SALMONELLA INFANTIS. JAMA 189:6–10. 282. Magistrali C, Dionisi AM, De Curtis P, Cucco L, Vischi O, Scuota S, Zicavo A, Pezzotti G. 2008. Contamination of Salmonella spp. in a pig finishing herd, from the arrival of the animals to the slaughterhouse. Res. Vet. Sci. 85:204–207. 283. Loynachan AT, Nugent JM, Erdman MM, Harris DL. 2004. Acute

143 infection of swine by various Salmonella serovars. J. Food Prot. 67:1484– 1488. 284. Jayarao BM, Biró G, Kovács S, Domján H, Fábián A. 1989. Prevalence of Salmonella serotypes in pigs and evaluation of a rapid, presumptive test for detection of Salmonella in pig faeces. Acta Vet. Hung. 37:39–44. 285. MORTELMANS J, HUYGELEN C, PINCKERS F. 1958. Isolation of Salmonella infantis from an aborted bovine foetus. Nature 181:1539– 1540. 286. Tavechio AT, Ghilardi ACR, Peresi JTM, Fuzihara TO, Yonamine EK, Jakabi M, Fernandes SA. 2002. Salmonella serotypes isolated from nonhuman sources in São Paulo, Brazil, from 1996 through 2000. J. Food Prot. 65:1041–1044. 287. Bhatia TR, McNabb GD. 1980. Dissemination of Salmonella in broiler- chicken operations. Avian Dis. 24:616–624. 288. Roy P, Dhillon AS, Lauerman LH, Schaberg DM, Bandli D, Johnson S. 2002. Results of salmonella isolation from poultry products, poultry, poultry environment, and other characteristics. Avian Dis. 46:17–24. 289. Smith BP, Reina-Guerra M, Hardy AJ. 1978. Prevalence and epizootiology of equine salmonellosis. J. Am. Vet. Med. Assoc. 172:353– 356. 290. GORDON RF, TUCKER JF. 1957. The isolation of Salmonella infantis from a turkey poult. Mon Bull Minist Health Public Health Lab Serv 16:71. 291. Bartlett KH, Trust TJ. 1976. Isolation of salmonellae and other potential pathogens from the freshwater aquarium snail Ampullaria. Appl. Environ. Microbiol. 31:635–639. 292. White FH, Forrester DJ. 1979. Antimicrobial resistant Salmonella spp. isolated from double-crested cormorants (Phalacrocorax auritus) and common loons (Gavia immer) in Florida. J. Wildl. Dis. 15:235–237. 293. Sato Y, Kuwamoto R. 1999. A case of canine salmonellosis due to Salmonella infantis. J. Vet. Med. Sci. 61:71–72. 294. Selander RK, Beltran P, Smith NH, Helmuth R, Rubin FA, Kopecko DJ, Ferris K, Tall BD, Cravioto A, Musser JM. 1990. Evolutionary genetic relationships of clones of Salmonella serovars that cause human typhoid and other enteric fevers. Infect. Immun. 58:2262–2275. 295. Adesiyun AA, Caesar K, Inder L. 1998. Prevalence of Salmonella and Campylobacter species in animals at Emperor Valley Zoo, Trinidad. J. Zoo Wildl. Med. 29:237–239. 296. GORDON HS, HOFFMAN SJ. 1949. Serous arthritis of the knee joint; report of a case caused by Salmonella typhosa and Salmonella montevideo in a child. J Am Med Assoc 141:460. 297. GRONROOS JA. 1953. Infections caused by Salmonella montevideo and the bacteriological identification of this strain. Ann Med Exp Biol Fenn 31:339–347. 298. ELLENBOGEN NC, RAIM J, GROSSMAN L. 1955. Salmonella sp. (type Montevideo) osteomyelitis; report of a case and review of the literature.

144 AMA Am J Dis Child 90:275–279. 299. Fedorka-Cray PJ, Dargatz DA, Thomas LA, Gray JT. 1998. Survey of Salmonella serotypes in feedlot cattle. J. Food Prot. 61:525–530. 300. Sato K, Carpenter TE, Case JT, Walker RL. 2001. Spatial and temporal clustering of Salmonella serotypes isolated from adult diarrheic dairy cattle in California. J. Vet. Diagn. Invest. 13:206–212. 301. Simmons DJ, Simpson W. 1980. Salmonella montevideo salmonellosis in laboratory mice: successful treatment of the disease by oral oxytetracycline. Lab. Anim. 14:217–219. 302. Sharp JC, Reilly WJ, Linklater KA, Inglis DM, Johnston WS, Miller JK. 1983. Salmonella montevideo infection in sheep and cattle in Scotland, 1970-81. J Hyg (Lond) 90:225–232. 303. Linklater KA. 1983. Abortion in sheep associated with Salmonella montevideo infection. Vet. Rec. 112:372–374. 304. Kirk JH, Holmberg CA, Jeffrey JS. 2002. Prevalence of Salmonella spp in selected birds captured on California dairies. J. Am. Vet. Med. Assoc. 220:359–362. 305. Trudel F. 1947. Salmonella montevideo Infection. Can J Comp Med Vet Sci 11:245–246. 306. Coulson JC, Butterfield J, Thomas C. 1983. The herring gull Larus argentatus as a likely transmitting agent of Salmonella montevideo to sheep and cattle. J Hyg (Lond) 91:437–443. 307. Fonseca RJ, Dubey LM. 1994. Salmonella montevideo sepsis from a pet snake. Pediatr. Infect. Dis. J. 13:550. 308. Caldow GL, Graham MM. 1998. Abortion in foxhounds and a ewe flock associated with Salmonella montevideo infection. Vet. Rec. 142:138–139. 309. Schotte U, Borchers D, Wulff C, Geue L. 2007. Salmonella Montevideo outbreak in military kennel dogs caused by contaminated commercial feed, which was only recognized through monitoring. Vet. Microbiol. 119:316–323. 310. Nesse LL, Refsum T, Heir E, Nordby K, Vardund T, Holstad G. 2005. Molecular epidemiology of Salmonella spp. isolates from gulls, fish-meal factories, feed factories, animals and humans in Norway based on pulsed-field gel electrophoresis. Epidemiol. Infect. 133:53–58. 311. Nesse LL, Løvold T, Bergsjø B, Nordby K, Wallace C, Holstad G. 2005. Persistence of orally administered Salmonella enterica serovars Agona and Montevideo in Atlantic salmon (Salmo salar L.). J. Food Prot. 68:1336–1339. 312. MILLS KL. 1964. OSTEOMYELITIS OF THE SPINE DUE TO SALMONELLA MUENCHEN. J Bone Joint Surg Br 46:697–699. 313. Samuel JL, O'Boyle DA, Mathers WJ, Frost AJ. 1980. Isolation of Salmonella from mesenteric lymph nodes of healthy cattle at slaughter. Res. Vet. Sci. 28:238–241. 314. Gebreyes WA, Thakur S. 2005. Multidrug-resistant Salmonella enterica serovar Muenchen from pigs and humans and potential interserovar

145 transfer of antimicrobial resistance. Antimicrob. Agents Chemother. 49:503–511. 315. Kodjo A, Villard L, Prave M, Ray S, Grezel D, Lacheretz A, Bonneau M, Richard Y. 1997. Isolation and identification of Salmonella species from chelonians using combined selective media, serotyping and ribotyping. Zentralblatt Veterinarmedizin Reihe B 44:625–629. 316. Pasmans F, De Herdt P, Dewulf J, Haesebrouck F. 2002. Pathogenesis of infections with Salmonella enterica subsp. enterica serovar Muenchen in the turtle Trachemys scripta scripta. Vet. Microbiol. 87:315–325. 317. McOrist S, Miller GT. 1981. Salmonellosis in transported feral goats. Aust. Vet. J. 57:389–390. 318. Venter EH, van Vuuren M, Carstens J, van der Walt ML, Nieuwoudt B, Steyn H, Kriek NPJ. 2003. A molecular epidemiologic investigation of Salmonella from a meat source to the feces of captive cheetah (Acinonyx jubatus). J. Zoo Wildl. Med. 34:76–81. 319. Potter AS, Reid SA, Fenwick SG. 2011. Prevalence of Salmonella in fecal samples of western grey kangaroos (Macropus fuliginosus). J. Wildl. Dis. 47:880–887. 320. Bezanson GS, Khakhria R, Pagnutti D. 1983. Plasmid profiles of value in differentiating Salmonella muenster isolates. J. Clin. Microbiol. 17:1159–1160. 321. Vigo GB, Cappuccio JA, Piñeyro PE, Salve A, Machuca MA, Quiroga MA, Moredo F, Giacoboni G, Cancer JL, Caffer IG, Binsztein N, Pichel M, Perfumo CJ. 2009. Salmonella enterica subclinical infection: bacteriological, serological, pulsed-field gel electrophoresis, and antimicrobial resistance profiles--longitudinal study in a three-site farrow- to-finish farm. Foodborne Pathog. Dis. 6:965–972. 322. Sanford SE. 1984. Some respiratory and enteric diseases of cattle: an update. Mod Vet Pract 65:265–268. 323. Nayak R, Stewart-King T. 2008. Molecular epidemiological analysis and microbial source tracking of Salmonella enterica serovars in a preharvest turkey production environment. Foodborne Pathog. Dis. 5:115–126. 324. FAIRBROTHER RW. 1947. A case of enteric fever caused by Salm. paratyphi A. Mon Bull Minist Health Public Health Lab Serv 6:180–182. 325. Freerksen E, Rosenfeld M, Freerksen R, Krüger-Thiemer M. 1977. Treatment of chronic salmonella carriers. Study with 40 cases of S. typhi, 19 cases of S. paratyphi b and 28 cases of S. enteritidis strains. Chemotherapy 23:192–210. 326. George JT, Wallace JG, Morrison HR, Harbourne JF. 1972. Paratyphoid in man and cattle. Br Med J 3:208–211. 327. Roland KL, Tinge SA, Kochi SK, Thomas LJ, Killeen KP. 2010. Reactogenicity and immunogenicity of live attenuated Salmonella enterica serovar Paratyphi A enteric fever vaccine candidates. Vaccine 28:3679–3687.

146 328. Mikhail IA, Higashi GI, Edman DC, Elwan SH. 1982. Interaction of Salmonella paratyphi A and Schistosoma mansoni in hamsters. Am. J. Trop. Med. Hyg. 31:328–334. 329. Poon MC, Sanders MG. 1972. Hepatic abscess caused by Salmonella paratyphi B. Can Med Assoc J 107:529–531. 330. Broadhead RL, Sehgal KC. 1981. Necrotising enterocolitis associated with Salmonella paratyphi B type 4, 5. Ann Trop Paediatr 1:65–68. 331. Cağlar MK, Yalaz K, Cağlar M, Yilgör E. 1986. Lobar pneumonia and pneumatocele formation due to Salmonella paratyphi B in an infant. Turk. J. Pediatr. 28:279–283. 332. Spence JA, Mogere R, Palmer TJ, Rowe PH. 1987. Severe rectal bleeding due to Salmonella paratyphi B. Br Med J (Clin Res Ed) 294:1589. 333. GRAY RD, HARVEY SM. 1955. An outbreak of infection in a children's home by an unusual member of the Salmonella group related to Salm. paratyphi B. Mon Bull Minist Health Public Health Lab Serv 14:74–78. 334. Singh BR, Jyoti J, Chandra M, Babu N, Sharma G. 2009. Drug resistance patterns of Salmonella isolates of equine origin from India. J Infect Dev Ctries 3:141–147. 335. Carter PB, Collins FM. 1974. Growth of typhoid and paratyphoid bacilli in intravenously infected mice. Infect. Immun. 10:816–822. 336. Harbourne JF, Randall CJ, Luery KW, Wallace JG. 1972. Salmonella paratyphi B infection in dairy cows. I. Vet. Rec. 91:112–114. 337. Thomas GW, Harbourne JF. 1972. Salmonella paratyphi B infection in dairy cows. II. Investigation of an active carrier. Vet. Rec. 91:148–150. 338. Thomas GW. 1978. Salmonella paratyphi B in cattle. Vet. Rec. 103:512. 339. Van Immerseel F, Meulemans L, De Buck J, Pasmans F, Velge P, Bottreau E, Haesebrouck F, Ducatelle R. 2004. Bacteria-host interactions of Salmonella Paratyphi B dT+ in poultry. Epidemiol. Infect. 132:239–243. 340. Rodríguez I, Barownick W, Helmuth R, Mendoza MC, Rodicio MR, Schroeter A, Guerra B. 2009. Extended-spectrum {beta}-lactamases and AmpC {beta}-lactamases in ceftiofur-resistant Salmonella enterica isolates from food and livestock obtained in Germany during 2003-07. J. Antimicrob. Chemother. 64:301–309. 341. Nagano N, Oana S, Nagano Y, Arakawa Y. 2006. A severe Salmonella enterica serotype Paratyphi B infection in a child related to a pet turtle, Trachemys scripta elegans. Jpn. J. Infect. Dis. 59:132–134. 342. Hazeleger WC, Bolder NM, Beumer RR, Jacobs-Reitsma WF. 2008. Darkling beetles (Alphitobius diaperinus) and their larvae as potential vectors for the transfer of Campylobacter jejuni and Salmonella enterica serovar paratyphi B variant Java between successive broiler flocks. Appl. Environ. Microbiol. 74:6887–6891. 343. Saha SN, Khanna PN, Gupta BR, Varma KC. 1981. Isolation of Salmonella paratyphi B var odense in India. Indian J Public Health 25:85–

147 86. 344. Kumar AA, Mallick BB, Uppal PK. 1979. Isolation of Salmonella paratyphi B and Salmonella typhimurium from guineapigs. Indian J. Med. Res. 69:390–392. 345. CARTER HS, WEIR IBL. 1952. A dog as a probable source of human infection with Salmonella paratyphi-B. J Pathol Bacteriol 64:230–232. 346. Jacobs MR, Koornhof HJ, Crisp SI, Palmhert HL, Fitzstephens A. 1978. Enteric fever caused by Salmonella paratyphi C in South and South West Africa. S. Afr. Med. J. 54:434–438. 347. Freidin N, Merzbach D, Kleinhaus U, Eidelman S. 1985. Recurrent intraabdominal abscess caused by Salmonella paratyphi C. J. Clin. Microbiol. 21:284–285. 348. Lang R, Maayan MC, Lidor C, Savin H, Kolman S, Lishner M. 1992. Salmonella paratyphi C osteomyelitis: report of two separate episodes 17 years apart. Scand. J. Infect. Dis. 24:793–796. 349. Barber C, Eylan E. 1975. Heterologous protections in experimental salmonellosis. Zentralbl Bakteriol Orig A 230:452–457. 350. Bolivar R, Bodey GP, Velasquez WS. 1982. Recurrent Salmonella meningitis in a compromised host. Cancer 50:2034–2036. 351. Centers for Disease Control (CDC). 1991. Multistate outbreak of Salmonella poona infections--United States and Canada, 1991. MMWR Morb. Mortal. Wkly. Rep. 40:549–552. 352. Wu CC, de Gortari MJ, Lin TL, Barrett B. 1998. Ribotyping of Salmonella poona in iguana-associated zoonotic salmonellosis. J. Vet. Diagn. Invest. 10:188–190. 353. Falade S. 1976. Isolation of Salmonella poona from diarrhoeic Nigerian goats. Vet. Rec. 99:419. 354. Molla W, Molla B, Alemayehu D, Muckle A, Cole L, Wilkie E. 2006. Occurrence and antimicrobial resistance of Salmonella serovars in apparently healthy slaughtered sheep and goats of central Ethiopia. Trop Anim Health Prod 38:455–462. 355. Oboegbulem SI, Okoronkwo I. 1990. Salmonellae in the African great cane rat (Thryonomys swinderianus). J. Wildl. Dis. 26:119–121. 356. Caldwell KN, Adler BB, Anderson GL, Williams PL, Beuchat LR. 2003. Ingestion of Salmonella enterica serotype Poona by a free-living mematode, Caenorhabditis elegans, and protection against inactivation by produce sanitizers. Appl. Environ. Microbiol. 69:4103–4110. 357. Kenney SJ, Anderson GL, Williams PL, Millner PD, Beuchat LR. 2005. Persistence of Escherichia coli O157:H7, Salmonella Newport, and Salmonella Poona in the gut of a free-living nematode, Caenorhabditis elegans, and transmission to progeny and uninfected nematodes. Int. J. Food Microbiol. 101:227–236. 358. Sandberg M, Alvseike O, Skjerve E. 2002. The prevalence and dynamics of Salmonella enterica IIIb 61:k:1,5,(7) in sheep flocks in Norway. Prev. Vet. Med. 52:267–275.

148 359. Hidalgo-Vila J, Díaz-Paniagua C, de Frutos-Escobar C, Jiménez- Martínez C, Pérez-Santigosa N. 2007. Salmonella in free living terrestrial and aquatic turtles. Vet. Microbiol. 119:311–315. 360. Edwards PR, Moran AB. 1945. Salmonella Cultures Which Resemble the Sendai Type. J. Bacteriol. 50:257–260. 361. MCFADZEAN AJS, HUANG CT. 1952. Bacterial endocarditis due to Salmonella sp. (Type Sendai) with recovery. AMA Arch Intern Med 90:858–862. 362. Saha MR, Saha D, Dutta P, Mitra U, Bhattacharya SK. 2001. Isolation of Salmonella enterica serotypes from children with diarrhoea in Calcutta, India. J Health Popul Nutr 19:301–305. 363. Dorn-In S, Fries R, Padungtod P, Kyule MN, Baumann MPO, Srikitjakarn L, Chantong W, Sanguangiat A, Zessin K-H. 2009. A cross-sectional study of Salmonella in pre-slaughter pigs in a production compartment of northern Thailand. Prev. Vet. Med. 88:15–23. 364. Fenlon DR. 1983. A comparison of salmonella serotypes found in the faeces of gulls feeding at a sewage works with serotypes present in the sewage. J Hyg (Lond) 91:47–52. 365. Takasaka M, Kohno A, Sakakibara I, Narita H, Honjo S. 1988. An outbreak of salmonellosis in newly imported cynomolgus monkeys. Jpn. J. Med. Sci. Biol. 41:1–13. 366. Dahshan H, Shahada F, Chuma T, Moriki H, Okamoto K. 2010. Genetic analysis of multidrug-resistant Salmonella enterica serovars Stanley and Typhimurium from cattle. Vet. Microbiol. 145:76–83. 367. Scott WM. 1926. The “Thompson” Type of Salmonella. J Hyg (Lond) 25:398–405. 368. Chisholm SA, Crichton PB, Knight HI, Old DC. 1999. Molecular typing of Salmonella serotype Thompson strains isolated from human and animal sources. Epidemiol. Infect. 122:33–39. 369. Sternberg S, Johnsson A, Aspan A, Bergström K, Kallay TB, Szanto E. 2008. Outbreak of Salmonella Thompson infection in a Swedish dairy herd. Vet. Rec. 163:596–599. 370. Buxton A, GORDON RF. 1947. The epidemiology and control of Salmonella thompson infection of fowls. J Hyg (Lond) 45:265–281. 371. Kirkpatrick CE, Colvin BA. 1986. Salmonella spp. in nestling common barn-owls (Tyto alba) from southwestern New Jersey. J. Wildl. Dis. 22:340–343. 372. Gaertner JP, Hahn D, Rose FL, Forstner MRJ. 2008. Detection of salmonellae in different turtle species within a headwater spring ecosystem. J. Wildl. Dis. 44:519–526. 373. VOGELSANG TM, BØE J. 1948. Temporary and chronic carriers of Salmonella typhi and Salmonella paratyphi B. J Hyg (Lond) 46:252–261. 374. Daigle F. 2008. Typhi genes expressed during infection or involved in pathogenesis. J Infect Dev Ctries 2:431–437. 375. Lucas RL, Lee CA. 2000. Unravelling the mysteries of virulence gene

149 regulation in Salmonella typhimurium. Mol. Microbiol. 36:1024–1033. 376. Kastello MD, Spertzel RO. 1973. The Rhesus monkey as a model for the study of infectious disease. Am. J. Phys. Anthropol. 38:501–504. 377. Barber C, Eylan E. 1975. Confirmation of the protective role of proteins from S. typhimurium in infection of mice with their natural pathogen. Zentralbl Bakteriol Orig A 230:461–465. 378. Bartlett KH, Trust TJ, Lior H. 1977. Small pet aquarium frogs as a source of Salmonella. Appl. Environ. Microbiol. 33:1026–1029. 379. Madewell BR, McChesney AE. 1975. Salmonellosis in a human infant, a cat, and two parakeets in the same household. J. Am. Vet. Med. Assoc. 167:1089–1090. 380. Cooper BS, MacFarlane DJ. 1974. Single or double vaccination schedules in sheep against experimental infection with Salmonella typhimurium or Salmonella bovismorbificans. N Z Vet J 22:95–99. 381. Gough J, McEwen B. 2000. Salmonella typhimurium DT 104 in sheep. Can. Vet. J. 41:413. 382. Elissalde MH, Ziprin RL, Huff WE, Kubena LF, Harvey RB. 1994. Effect of ochratoxin A on Salmonella-challenged broiler chicks. Poult. Sci. 73:1241–1248. 383. Bottjer KP, Hirst DC, Slonka GF. 1978. Nematospiroides dubius as a vector for Salmonella typhimurium. Am. J. Vet. Res. 39:151–153. 384. Betancor L, Pereira M, Martinez A, Giossa G, Fookes M, Flores K, Barrios P, Repiso V, Vignoli R, Cordeiro N, Algorta G, Thomson N, Maskell D, Schelotto F, Chabalgoity JA. 2010. Prevalence of Salmonella enterica in poultry and eggs in Uruguay during an epidemic due to Salmonella enterica serovar Enteritidis. J. Clin. Microbiol. 48:2413–2423. 385. Watson PR, Galyov EE, Paulin SM, Jones PW, Wallis TS. 1998. Mutation of invH, but not stn, reduces Salmonella-induced enteritis in cattle. Infect. Immun. 66:1432–1438. 386. Lucas B, Bumann D, Walduck A, Koesling J, Develioglu L, Meyer TF, Aebischer T. 2001. Adoptive transfer of CD4+ T cells specific for subunit A of Helicobacter pylori urease reduces H. pylori stomach colonization in mice in the absence of interleukin-4 (IL-4)/IL-13 receptor signaling. Infect. Immun. 69:1714–1721. 387. Adaska JM, Silva AJ, Sischo WM. 2008. Comparison of Salmonella enterica subspecies enterica serovar Typhimurium isolates from dairy cattle and humans using in vitro assays of virulence. Vet. Microbiol. 128:90–95. 388. Labrousse A, Chauvet S, Couillault C, Kurz CL, Ewbank JJ. 2000. Caenorhabditis elegans is a model host for Salmonella typhimurium. Curr. Biol. 10:1543–1545. 389. Oza JP, Yeh JB, Reich NO. 2005. DNA methylation modulates Salmonella enterica serovar Typhimurium virulence in Caenorhabditis elegans. FEMS Microbiol. Lett. 245:53–59.

150 390. Rahman H, Deka PJ, Chakraborty A, Narayan G. 2005. Salmonellosis in pigmy hogs (Sus salvanius)--a critically endangered species of mammal. Rev. - Off. Int. Epizoot. 24:959–964. 391. Belfort R, Toledo MR, Burnier M, Smith RL, Silva VL, Trabulsi LR. 1985. Experimental guinea pig ocular infection by Salmonella typhimurium. Invest. Ophthalmol. Vis. Sci. 26:591–594. 392. Brunsson I. 1987. Enteric nerves mediate the fluid secretory response due to Salmonella typhimurium R5 infection in the rat small intestine. Acta Physiol. Scand. 131:609–617. 393. Sato Y, Wada K. 1995. Isolation of Salmonella typhimurium from zebra finches (Poephila guttata). J. Vet. Med. Sci. 57:137–138. 394. Prescott JF, Poppe C, Goltz J, Campbell GD. 1998. Salmonella typhimurium phage type 40 in feeder birds. Vet. Rec. 142:732. 395. Helm JD, Hines RK, Hill JE, Caver JA. 1999. Multiple drug-resistant Salmonella typhimurium DT104 and DT104b isolated in bobwhite quail (Colinus virginianus). Avian Dis. 43:788–791. 396. Sato Y, Kobayash C, Ichikawa K, Kuwamoto R, Matsuura S, Koyama T. 2000. An occurrence of Salmonella typhimurium infection in sika deer (Cervus nippon). J. Vet. Med. Sci. 62:313–315. 397. Verwoerd DJ. 2000. Ostrich diseases. Rev. - Off. Int. Epizoot. 19:638– 661. 398. Handeland K, Refsum T, Johansen BS, Holstad G, Knutsen G, Solberg I, Schulze J, Kapperud G. 2002. Prevalence of Salmonella typhimurium infection in Norwegian hedgehog populations associated with two human disease outbreaks. Epidemiol. Infect. 128:523–527. 399. Smith KE, Anderson F, Medus C, Leano F, Adams J. 2005. Outbreaks of salmonellosis at elementary schools associated with dissection of owl pellets. Vector Borne Zoonotic Dis. 5:133–136. 400. Handeland K, Nesse LL, Lillehaug A, Vikøren T, Djønne B, Bergsjø B. 2008. Natural and experimental Salmonella Typhimurium infections in foxes (Vulpes vulpes). Vet. Microbiol. 132:129–134. 401. Sabag-Daigle A, Soares JA, Smith JN, Elmasry ME, Ahmer BMM. 2012. The acyl homoserine lactone receptor, SdiA, of Escherichia coli and Salmonella enterica serovar Typhimurium does not respond to indole. Appl. Environ. Microbiol. 78:5424–5431. 402. Smith JL. 2003. The role of gastric acid in preventing foodborne disease and how bacteria overcome acid conditions. J. Food Prot. 66:1292–1303. 403. Haller JC, Carlson S, Pederson KJ, Pierson DE. 2000. A chromosomally encoded type III secretion pathway in Yersinia enterocolitica is important in virulence. Mol. Microbiol. 36:1436–1446. 404. Bhaduri S. 2011. Effect of salt and acidic pH on the stability of virulence plasmid (pYV) in Yersinia enterocolitica and expression of virulence- associated characteristics. Food Microbiol. 28:171–173. 405. Matsumoto H, Young GM. 2009. Translocated effectors of Yersinia. Curr. Opin. Microbiol. 12:94–100.

151 406. Clark MA, Hirst BH, Jepson MA. 1998. Inoculum composition and Salmonella pathogenicity island 1 regulate M-cell invasion and epithelial destruction by Salmonella typhimurium. Infect. Immun. 66:724–731. 407. Liu W-Q, Feng Y, Wang Y, Zou Q-H, Chen F, Guo J-T, Peng Y-H, Jin Y, Li Y-G, Hu S-N, Johnston RN, Liu G-R, Liu S-L. 2009. Salmonella paratyphi C: genetic divergence from Salmonella choleraesuis and pathogenic convergence with Salmonella typhi. PLoS ONE 4:e4510. 408. Parkhill J, Dougan G, James KD, Thomson NR, Pickard D, Wain J, Churcher C, Mungall KL, Bentley SD, Holden MT, Sebaihia M, Baker S, Basham D, Brooks K, Chillingworth T, Connerton P, Cronin A, Davis P, Davies RM, Dowd L, White N, Farrar J, Feltwell T, Hamlin N, Haque A, Hien TT, Holroyd S, Jagels K, Krogh A, Larsen TS, Leather S, Moule S, O'Gaora P, Parry C, Quail M, Rutherford K, Simmonds M, Skelton J, Stevens K, Whitehead S, Barrell BG. 2001. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413:848–852. 409. McClelland M, Sanderson KE, Spieth J, Clifton SW, Latreille P, Courtney L, Porwollik S, Ali J, Dante M, Du F, Hou S, Layman D, Leonard S, Nguyen C, Scott K, Holmes A, Grewal N, Mulvaney E, Ryan E, Sun H, Florea L, Miller W, Stoneking T, Nhan M, Waterston R, Wilson RK. 2001. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413:852–856. 410. Navarre WW, Halsey TA, Walthers D, Frye J, McClelland M, Potter JL, Kenney LJ, Gunn JS, Fang FC, Libby SJ. 2005. Co-regulation of Salmonella enterica genes required for virulence and resistance to antimicrobial peptides by SlyA and PhoP/PhoQ. Mol. Microbiol. 56:492– 508. 411. Gunn JS, Ernst RK, McCoy AJ, Miller SI. 2000. Constitutive mutations of the Salmonella enterica serovar Typhimurium transcriptional virulence regulator phoP. Infect. Immun. 68:3758–3762. 412. Gunn JS, Belden WJ, Miller SI. 1998. Identification of PhoP-PhoQ activated genes within a duplicated region of the Salmonella typhimurium chromosome. Microb. Pathog. 25:77–90. 413. Gunn JS, Alpuche Aranda CM, Loomis WP, Belden WJ, Miller SI. 1995. Characterization of the Salmonella typhimurium pagC/pagD chromosomal region. J. Bacteriol. 177:5040–5047. 414. van Velkinburgh JC, Gunn JS. 1999. PhoP-PhoQ-regulated loci are required for enhanced bile resistance in Salmonella spp. Infect. Immun. 67:1614–1622. 415. Ley RE, Peterson DA, Gordon JI. 2006. Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell 124:837– 848. 416. Ahmer BMM, Gunn JS. 2011. Interaction of Salmonella spp. with the Intestinal Microbiota. Front Microbiol 2:101. 417. Barthel M, Hapfelmeier S, Quintanilla-Martínez L, Kremer M, Rohde

152 M, Hogardt M, Pfeffer K, Rüssmann H, Hardt W-D. 2003. Pretreatment of mice with streptomycin provides a Salmonella enterica serovar Typhimurium colitis model that allows analysis of both pathogen and host. Infect. Immun. 71:2839–2858. 418. Looft T, Johnson TA, Allen HK, Bayles DO, Alt DP, Stedtfeld RD, Sul WJ, Stedtfeld TM, Chai B, Cole JR, Hashsham SA, Tiedje JM, Stanton TB. 2012. In-feed antibiotic effects on the swine intestinal microbiome. Proc. Natl. Acad. Sci. U.S.A. 109:1691–1696. 419. Jacobi CA, Bach A, Eberl L, Steidle A, Heesemann J. 2003. Detection of N-(3-oxohexanoyl)-L-homoserine lactone in mice infected with Yersinia enterocolitica serotype O8. Infect. Immun. 71:6624–6626. 420. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97:6640–6645. 421. Merighi M, Ellermeier CD, Slauch JM, Gunn JS. 2005. Resolvase-in vivo expression technology analysis of the Salmonella enterica serovar Typhimurium PhoP and PmrA regulons in BALB/c mice. J. Bacteriol. 187:7407–7416. 422. Kinder SA, Badger JL, Bryant GO, Pepe JC, Miller VL. 1993. Cloning of the Yen I restriction endonuclease and methyltransferase from Yersinia enterocolitica serotype O8 and construction of a transformable R. Gene. 423. Thiennimitr P, Winter SE, Winter MG, Xavier MN, Tolstikov V, Huseby DL, Sterzenbach T, Tsolis RM, Roth JR, Bäumler AJ. 2011. Intestinal inflammation allows Salmonella to use ethanolamine to compete with the microbiota. Proc. Natl. Acad. Sci. U.S.A. 108:17480– 17485. 424. Godinez I, Haneda T, Raffatellu M, George MD, Paixao TA, Rolán HG, Santos RL, Dandekar S, Tsolis RM, Bäumler AJ. 2008. T cells help to amplify inflammatory responses induced by Salmonella enterica serotype Typhimurium in the intestinal mucosa. Infect. Immun. 76:2008–2017. 425. Godinez I, Keestra AM, Spees A, Bäumler AJ. 2011. The IL-23 axis in Salmonella gastroenteritis. Cell. Microbiol. 13:1639–1647. 426. Winter SE, Thiennimitr P, Winter MG, Butler BP, Huseby DL, Crawford RW, Russell JM, Bevins CL, Adams LG, Tsolis RM, Roth JR, Bäumler AJ. 2010. Gut inflammation provides a respiratory electron acceptor for Salmonella. Nature 467:426–429. 427. Santos RL, Raffatellu M, Bevins CL, Adams LG, Tükel C, Tsolis RM, Bäumler AJ. 2009. Life in the inflamed intestine, Salmonella style. Trends Microbiol. 17:498–506. 428. Santos RL, Tsolis RM, Bäumler AJ, Smith R, Adams LG. 2001. Salmonella enterica serovar typhimurium induces cell death in bovine monocyte-derived macrophages by early sipB-dependent and delayed sipB-independent mechanisms. Infect. Immun. 69:2293–2301. 429. Santiviago CA, Reynolds MM, Porwollik S, Choi S-H, Long F, Andrews-Polymenis HL, McClelland M. 2009. Analysis of pools of

153 targeted Salmonella deletion mutants identifies novel genes affecting fitness during competitive infection in mice. PLoS Pathog. 5:e1000477. 430. Miyashiro T, Ruby EG. 2012. Shedding light on bioluminescence regulation in Vibrio fischeri. Mol. Microbiol. 84:795–806. 431. Milton DL, Chalker VJ, Kirke D, Hardman A, Cámara M, Williams P. 2001. The LuxM homologue VanM from Vibrio anguillarum directs the synthesis of N-(3-hydroxyhexanoyl)homoserine lactone and N- hexanoylhomoserine lactone. J. Bacteriol. 183:3537–3547. 432. Gilson L, Kuo A, Dunlap PV. 1995. AinS and a new family of autoinducer synthesis proteins. J. Bacteriol. 177:6946–6951. 433. Zhang G, Zhang F, Ding G, Li J, Guo X, Zhu J, Zhou L, Cai S, Liu X, Luo Y, Zhang G, Shi W, Dong X. 2012. Acyl homoserine lactone-based quorum sensing in a methanogenic archaeon. ISME J 6:1336–1344. 434. de Cleene M. 1979. Crown gall: economic importance and control. Zentralbl Bakteriol Naturwiss 134:551–554. 435. Piper KR, Piper KR, Beck von Bodman S, Beck von Bodman S, Farrand SK, Farrand SK. 1993. Conjugation factor of Agrobacterium tumefaciens regulates Ti plasmid transfer by autoinduction. Nature 362:448–450. 436. Hosni T, Moretti C, Devescovi G, Suarez-Moreno ZR, Fatmi MB, Guarnaccia C, Pongor S, Onofri A, Buonaurio R, Venturi V. 2011. Sharing of quorum-sensing signals and role of interspecies communities in a bacterial plant disease. ISME J 5:1857–1870. 437. Gray KM, Passador L, Iglewski BH, Greenberg EP. 1994. Interchangeability and specificity of components from the quorum-sensing regulatory systems of Vibrio fischeri and Pseudomonas aeruginosa. J. Bacteriol. 176:3076–3080. 438. Tsai C-S, Winans SC. 2011. The quorum-hindered transcription factor YenR of Yersinia enterocolitica inhibits pheromone production and promotes motility via a small non-coding RNA. Mol. Microbiol. 80:556– 571. 439. Williams P, Cámara M. 2009. Quorum sensing and environmental adaptation in Pseudomonas aeruginosa: a tale of regulatory networks and multifunctional signal molecules. Curr. Opin. Microbiol. 12:182–191. 440. Michael B, Smith JN, Swift S, Heffron F, Ahmer BM. 2001. SdiA of Salmonella enterica is a LuxR homolog that detects mixed microbial communities. J. Bacteriol. 183:5733–5742. 441. Joint I. 2006. Bacterial conversations: talking, listening and eavesdropping. A NERC Discussion Meeting held at the Royal Society on 7 December 2005., pp. 459–463. In. 442. Case RJ, Labbate M, Kjelleberg S. 2008. AHL-driven quorum-sensing circuits: their frequency and function among the Proteobacteria. ISME J 2:345–349. 443. Janssens JCA, Metzger K, Daniels R, Ptacek D, Verhoeven T, Habel LW, Vanderleyden J, De Vos DE, De Keersmaecker SCJ. 2007.

154 Synthesis of N-acyl homoserine lactone analogues reveals strong activators of SdiA, the Salmonella enterica serovar Typhimurium LuxR homologue. Appl. Environ. Microbiol. 73:535–544. 444. Zuccato E, Venturi M, Di Leo G, Colombo L, Bertolo C, Doldi SB, Mussini E. 1993. Role of bile acids and metabolic activity of colonic bacteria in increased risk of colon cancer after cholecystectomy. Dig. Dis. Sci. 38:514–519. 445. Sims J, Renwick AG. 1983. The effects of saccharin on the metabolism of dietary tryptophan to indole, a known cocarcinogen for the urinary bladder of the rat. Toxicol. Appl. Pharmacol. 67:132–151. 446. Karlin DA, Mastromarino AJ, Jones RD, Stroehlein JR, Lorentz O. 1985. Fecal skatole and indole and breath methane and hydrogen in patients with large bowel polyps or cancer. J. Cancer Res. Clin. Oncol. 109:135–141. 447. Camilli A, Beattie DT, Mekalanos JJ. 1994. Use of genetic recombination as a reporter of gene expression. Proc. Natl. Acad. Sci. U.S.A. 91:2634–2638. 448. Parker JL, Shaw JG. 2011. Aeromonas spp. clinical microbiology and disease. J. Infect. 62:109–118. 449. Janda JM, Abbott SL. 2010. The genus Aeromonas: taxonomy, pathogenicity, and infection. Clin. Microbiol. Rev. 23:35–73. 450. Human Microbiome Project Consortium. 2012. Structure, function and diversity of the healthy human microbiome. Nature 486:207–214. 451. Derlet RW, Carlson JR. 2002. An analysis of human pathogens found in horse/mule manure along the John Muir Trail in Kings Canyon and Sequoia and Yosemite National Parks. Wilderness Environ Med 13:113– 118. 452. Mokracka J, Koczura R, Kaznowski A. 2012. Transferable integrons of Gram-negative bacteria isolated from the gut of a wild boar in the buffer zone of a national park. Ann. Microbiol. 62:877–880. 453. Tait K, Williamson H, Atkinson S, Williams P, Cámara M, Joint I. 2009. Turnover of quorum sensing signal molecules modulates cross- kingdom signalling. Environ. Microbiol. 11:1792–1802. 454. Pédron T, Mulet C, Dauga C, Frangeul L, Chervaux C, Grompone G, Sansonetti PJ. 2012. A crypt-specific core microbiota resides in the mouse colon. MBio 3. 455. Clemmer KM, Bonomo RA, Rather PN. 2011. Genetic analysis of surface motility in Acinetobacter baumannii. Microbiology (Reading, Engl.) 157:2534–2544. 456. Niu C, Clemmer KM, Bonomo RA, Rather PN. 2008. Isolation and characterization of an autoinducer synthase from Acinetobacter baumannii. J. Bacteriol. 190:3386–3392. 457. Hao Y, Winans SC, Glick BR, Charles TC. 2010. Identification and characterization of new LuxR/LuxI-type quorum sensing systems from metagenomic libraries. Environ. Microbiol. 12:105–117.

155 458. Guan C, Ju J, Borlee BR, Williamson LL, Shen B, Raffa KF, Handelsman J. 2007. Signal mimics derived from a metagenomic analysis of the gypsy moth gut microbiota. Appl. Environ. Microbiol. 73:3669–3676. 459. Delalande L, Faure D, Raffoux A, Uroz S, D'Angelo-Picard C, Elasri M, Carlier A, Berruyer R, Petit A, Williams P, Dessaux Y. 2005. N- hexanoyl-L-homoserine lactone, a mediator of bacterial quorum-sensing regulation, exhibits plant-dependent stability and may be inactivated by germinating Lotus corniculatus seedlings. FEMS Microbiol. Ecol. 52:13– 20. 460. Horswill AR, Stoodley P, Stewart PS, Parsek MR. 2007. The effect of the chemical, biological, and physical environment on quorum sensing in structured microbial communities. Anal Bioanal Chem 387:371–380. 461. Byers JT, Lucas C, Salmond GPC, Welch M. 2002. Nonenzymatic turnover of an Erwinia carotovora quorum-sensing signaling molecule. J. Bacteriol. 184:1163–1171. 462. Pearson JP, Gray KM, Passador L, Tucker KD, Eberhard A, Iglewski BH, Greenberg EP. 1994. Structure of the autoinducer required for expression of Pseudomonas aeruginosa virulence genes. Proc. Natl. Acad. Sci. U.S.A. 91:197–201. 463. Yates EA, Philipp B, Buckley C, Atkinson S, Chhabra SR, Sockett RE, Goldner M, Dessaux Y, Cámara M, Smith H, Williams P. 2002. N- acylhomoserine lactones undergo lactonolysis in a pH-, temperature-, and acyl chain length-dependent manner during growth of Yersinia pseudotuberculosis and Pseudomonas aeruginosa. Infect. Immun. 70:5635–5646. 464. Fallingborg J. 1999. Intraluminal pH of the human gastrointestinal tract. Dan Med Bull 46:183–196. 465. Lin Y-H, Xu J-L, Hu J, Wang L-H, Ong SL, Leadbetter JR, Zhang L-H. 2003. Acyl-homoserine lactone acylase from Ralstonia strain XJ12B represents a novel and potent class of quorum-quenching enzymes. Mol. Microbiol. 47:849–860. 466. Elias M, Tawfik DS. 2012. Divergence and convergence in enzyme evolution: parallel evolution of paraoxonases from quorum-quenching lactonases. J. Biol. Chem. 287:11–20. 467. Decho AW, Frey RL, Ferry JL. 2011. Chemical challenges to bacterial AHL signaling in the environment. Chem. Rev. 111:86–99. 468. Fast W, Tipton PA. 2012. The enzymes of bacterial census and censorship. Trends Biochem. Sci. 37:7–14. 469. Hong K-W, Koh C-L, Sam C-K, Yin W-F, Chan K-G. 2012. Quorum quenching revisited--from signal decays to signalling confusion. Sensors (Basel) 12:4661–4696. 470. Uroz S, Chhabra SR, Cámara M, Williams P, Oger P, Dessaux Y. 2005. N-Acylhomoserine lactone quorum-sensing molecules are modified and degraded by Rhodococcus erythropolis W2 by both amidolytic and

156 novel oxidoreductase activities. Microbiology (Reading, Engl.) 151:3313– 3322. 471. Hartmann A, Schikora A. 2012. Quorum sensing of bacteria and trans- kingdom interactions of N-acyl homoserine lactones with eukaryotes. J. Chem. Ecol. 38:704–713. 472. Teplitski M, Mathesius U, Rumbaugh KP. 2011. Perception and degradation of N-acyl homoserine lactone quorum sensing signals by mammalian and plant cells. Chem. Rev. 111:100–116. 473. Mackness B, Beltran-Debon R, Aragones G, Joven J, Camps J, Mackness M. 2010. Human tissue distribution of paraoxonases 1 and 2 mRNA. IUBMB Life 62:480–482. 474. Yang F, Wang L-H, Wang J, Dong Y-H, Hu JY, Zhang L-H. 2005. Quorum quenching enzyme activity is widely conserved in the sera of mammalian species. FEBS Lett. 579:3713–3717. 475. Draganov DI, Teiber JF, Speelman A, Osawa Y, Sunahara R, La Du BN. 2005. Human paraoxonases (PON1, PON2, and PON3) are lactonases with overlapping and distinct substrate specificities. J. Lipid Res. 46:1239–1247. 476. Xu F, Byun T, Deussen H-J, Duke KR, Dussen H-J. 2003. Degradation of N-acylhomoserine lactones, the bacterial quorum-sensing molecules, by acylase. J. Biotechnol. 101:89–96. 477. Rajilić-Stojanović M, Smidt H, de Vos WM. 2007. Diversity of the human gastrointestinal tract microbiota revisited. Environ. Microbiol. 9:2125–2136. 478. Geske GD, Wezeman RJ, Siegel AP, Blackwell HE. 2005. Small molecule inhibitors of bacterial quorum sensing and biofilm formation. J. Am. Chem. Soc. 127:12762–12763. 479. Jangid K, Parameswaran PS, Shouche YS. 2012. A variant quorum sensing system in Aeromonas veronii MTCC 3249. Sensors (Basel) 12:3814–3830. 480. Borlee BR, Geske GD, Robinson CJ, Blackwell HE, Handelsman J. 2008. Quorum-sensing signals in the microbial community of the cabbage white butterfly larval midgut. ISME J 2:1101–1111. 481. Pontes MH, Babst M, Lochhead R, Oakeson K, Smith K, Dale C. 2008. Quorum sensing primes the oxidative stress response in the insect endosymbiont, Sodalis glossinidius. PLoS ONE 3:e3541. 482. Ortori CA, Atkinson S, Chhabra SR, Cámara M, Williams P, Barrett DA. 2007. Comprehensive profiling of N-acylhomoserine lactones produced by Yersinia pseudotuberculosis using liquid chromatography coupled to hybrid quadrupole-linear ion trap mass spectrometry. Anal Bioanal Chem 387:497–511. 483. Cataldi TRI, Bianco G, Palazzo L, Quaranta V. 2007. Occurrence of N- acyl-L-homoserine lactones in extracts of some Gram-negative bacteria evaluated by gas chromatography-mass spectrometry. Anal. Biochem. 361:226–235.

157 484. Liu X, Jia J, Popat R, Ortori CA, Li J, Diggle SP, Gao K, Cámara M. 2011. Characterisation of two quorum sensing systems in the endophytic Serratia plymuthica strain G3: differential control of motility and biofilm formation according to life-style. BMC Microbiol. 11:26. 485. González JE, Marketon MM. 2003. Quorum sensing in nitrogen-fixing rhizobia. Microbiol. Mol. Biol. Rev. 67:574–592. 486. Chan K-G, Atkinson S, Mathee K, Sam C-K, Chhabra SR, Cámara M, Koh C-L, Williams P. 2011. Characterization of N-acylhomoserine lactone-degrading bacteria associated with the Zingiber officinale (ginger) rhizosphere: co-existence of quorum quenching and quorum sensing in Acinetobacter and Burkholderia. BMC Microbiol. 11:51. 487. Bruhn JB, Christensen AB, Flodgaard LR, Nielsen KF, Larsen TO, Givskov M, Gram L. 2004. Presence of acylated homoserine lactones (AHLs) and AHL-producing bacteria in meat and potential role of AHL in spoilage of meat. Appl. Environ. Microbiol. 70:4293–4302. 488. Morohoshi T, Inaba T, Kato N, Kanai K, Ikeda T. 2004. Identification of quorum-sensing signal molecules and the LuxRI homologs in fish pathogen Edwardsiella tarda. J. Biosci. Bioeng. 98:274–281. 489. Flavier AB, Ganova-Raeva LM, Schell MA, Denny TP. 1997. Hierarchical autoinduction in Ralstonia solanacearum: control of acylhomoserine lactone production by a novel autoregulatory system responsive to 3-hydroxypalmitic acid methyl ester. J. Bacteriol. 179:7089– 7097. 490. Kuhle V, Hensel M. 2004. Cellular microbiology of intracellular Salmonella enterica: functions of the type III secretion system encoded by Salmonella pathogenicity island 2. Cell. Mol. Life Sci. 61:2812–2826. 491. García-del Portillo F, Núñez-Hernández C, Eisman B, Ramos-Vivas J. 2008. Growth control in the Salmonella-containing vacuole. Curr. Opin. Microbiol. 11:46–52. 492. Bakowski MA, Braun V, Brumell JH. 2008. Salmonella-containing vacuoles: directing traffic and nesting to grow. Traffic 9:2022–2031. 493. Stecher B, Paesold G, Barthel M, Kremer M, Jantsch J, Stallmach T, Heikenwalder M, Hardt W-D. 2006. Chronic Salmonella enterica serovar Typhimurium-induced colitis and cholangitis in streptomycin-pretreated Nramp1+/+ mice. Infect. Immun. 74:5047–5057. 494. Ochman H, Wilson AC. 1987. Evolution in bacteria: evidence for a universal substitution rate in cellular genomes. J. Mol. Evol. 26:74–86.

158