Roles of the Origin Binding Domain in Polyoma Large T Function
A thesis
submitted by
Pubali Banerjee
In partial fulfillment of the requirements for the degree of
Doctor of Philosophy in Molecular Biology and Microbiology
TUFTS UNIVERSITY Sackler School of Biomedical Sciences
August, 2011
Adviser: Brian Schaffhausen, Ph.D. ii
Abstract
Polyoma Large T (LT) is a multifunctional protein. It directly participates in the initiation of viral DNA replication and in integration, incision and excision of the viral genome in transformation. It regulates a variety of host cell processes including immortalization, differentiation and programmed cell death. LT can be separated into domains that retain independent function. The N-terminal domain (1-259), for example, can immortalize cells and promote cell cycle progression. LT also contains a DNA-binding domain
(OBD; ~residues 264-420) that binds the viral origin of replication. The purpose of my thesis was to study this OBD.
Even before my work started, it was clear that the OBD was itself multifunctional.
In addition to origin binding, it could bind DNA in a non-site specific manner and activate transcription at CREB sites. This work was originally intended to map sequences on OBD required for transcriptional activation and to use gene arrays to identify genes so regulated. Cell lines expressing OBD inducibly were constructed and mRNA was analyzed before and after induction. A variety of point mutants were made throughout OBD to extend previous analysis. These mutants were analyzed for their ability to support viral replication and to activate transcription from E2F or CREB containing promoters. In addition, a new activity, the ability to bind single-stranded binding protein RPA was demonstrated. Some of the new mutants, such as K308E and
E320A provide important leads into OBD function. For example, E320A failed to bind
RPA but was wild type for viral DNA replication. This challenges the long standing paradigm for viral replication that says LT binds RPA to cover ssDNA created around the replication fork. The major focus of this thesis is on the connection between OBD and iii cell response to DNA damage. LT sensitized cells to DNA damage by as much as 100 fold. This activity was mapped to OBD. There are dramatic and immediate increases in
DNA damage as measured by comet assays and markers of DNA damage such as
γ -H2AX. Data for UV exposure indicate that this damage results from a failure to repair
rather than increasing the formation of UV photoproducts. Stress proteins JNK and p38,
along with Poly ADP-Ribose Polymerase (PARP), were activated in an apoptotic death
response. Inhibitors of PARP protected the cells from this apoptotic death. There is an
increase in death proteins such as BAD as well as decrease in survival proteins such as
Bcl-XL. One unexpected aspect of the cell death is that Bim underwent a mobility shift
and localizes to the nucleus. However, knockdown of Bim did not prevent the
sensitization.
Genetic analysis of OBD showed that neither DNA binding nor transcriptional
activity was required for sensitization. Such mutants retained the ability to bind RPA.
However, a mutant defective in RPA binding was unable to sensitize cells. Furthermore,
overexpression of RPA protected cells expressing wild type OBD from damage caused
either by etoposide or UV irradiation. These results implicated RPA as the target through
which LT sensitizes cells to DNA damage. This is a satisfying result because RPA is
involved in different kinds of DNA repair. Overall, the genetics raise a larger question
about the role of RPA binding to LT, namely does the enhancement of damage resulting
in increased damage signaling directly benefit the virus or is it a cost of doing business.
iv
Acknowledgements
I would like to express my sincere gratitude to Dr. Brian Schaffhausen, my thesis adviser for giving me the opportunity to pursue a PhD program. His continued support and encouragement for this research project has been instrumental in bringing this work to fruition. As my mentor, he has instilled in me a deep love and respect for scientific research and taught me to think like a scientist.
I would like to express my appreciation for all the members of the lab who have made it such a great workplace. Jennifer Choe’s support in tying the loose ends of this project has been very helpful. Thanks to both Tao Jiang and Justin Hwang who were such big help in troubleshooting experiments. Justin has always helped a great deal with his constructive suggestions and ideas. Many thanks to all previous members of the lab including Shaida Andrabi, Tara Love, Yanni Zhu and Rowena De Jesus for their support in addition to the new members, Cecile Rouleau and Sudeshna Mukherjee. I am grateful for Lakshmi Dommeti’s help with the mutagenesis studies. Thanks to all the members of
Feig and Yee Lab for the brainstorming floor meets and for generously sharing lab stuff.
A special thanks to Gail Sonenshein’s Lab and Peter Bullock’s Lab for help with siRNA experiments and GST-pull down experiments, respectively. Many thanks to members of
Andrew Bohm’s and Peter Bullock’s Lab for their advice and insights into my project. I am grateful to Dr. Kathryn Huber for her help with the Gamma radiation experiments.
I would also like to acknowledge my thesis committee members: Dr. Linc
Sonenshein, Dr. Carol Kumamoto and Dr. Claire Moore for their steady guidance and critical analysis of my project through the years that helped me stay focused on the v ultimate goal. I would like to take this opportunity to thank Dr. James DeCaprio, for kindly serving as my outside examiner.
The completion of this dissertation would not have been possible without the unstinting support of several individuals in my life. My husband, Subhojit Banerjee, has been with me every step of this journey in more ways than one. Encouraging with an unerring sense of humor and a practical perspective, he has always bolstered my spirits.
My son, Rajdeep Banerjee has been my driving force. The most precious gift from God, he fills me up with pride and joy and reminds me everyday of what life is all about. I want to thank them both for making this day possible.
My family in India has been very supportive throughout the years. My parents and my in-laws deserve special recognition. I am eternally grateful to my brother, Partha
Pratim Goswami, for always believing in me and my father, Prithwis Kumar Goswami, for always being so interested in my progress.
Finally, I dedicate this thesis to my mother, Kamala Goswami, who taught me the value of education and hard work. I am deeply indebted to her for her unwavering support over the years. Without her, I could have never made it this far.
vi
Table of Contents
Abstract ...... ii
Acknowledgments ...... iv
List of Tables ...... ix
List of Figures ...... x
List of Abbreviations ...... xv
Introduction ...... 1
Polyomaviruses ...... 1
Pathogenesis in Humans…………………………………………………………………..1
Murine Polyomavirus...... 4
Infection…………………………………………………………………………………...5
T-Antigens………………………………………………………………………………...7
Polyoma Small T Antigen...... 10
Polyoma Middle T Antigen ...... 14
Polyoma Large T Antigen...... 17
Polyoma Large T protein...... …….……………….18
The domain structure of Polyma large T…………………………………..21
LT Functions…………………………………………….…………….…...26
Manipulation of Viral DNA…………………………….…… ..26
LT and Viral DNA Replication……………………….…… …27
Effect on Host Cell Phenotype………………………….…….. 30
Mechanisms of cellular DNA damage response and DNA repair:………………………33
LT orchestrates DNA damage as well as DNA damage response signaling…………….35 vii
Replication Protein A……………………………………….…..37
Materials and Methods ...... 41
Plasmids ...... 41
E. coli. strains...... 41
Oligonucleotides ...... 41
Cell Lines...... 46
Standard Cloning Procedures...... 46
Mutagenesis ...... 46
Transient Transfections ...... 47
Luciferase Reporter Assays ...... 47
SDS Polyacrylamide Gel Electrophoresis ...... 48
Western Blotting ...... 49
Large T Immunoprecipitation...... 49
Immunofluorescence……………………………………………………………………..50
Lentivirus-mediated Bim shRNA stable knockdown………………………………..…..50
GST-Fusion Protein Preparation...... 51
GST Pulldown Assays ...... 52
DNA Laddering...... 53
Inhibitor Treatment………………………………………………………….…………...53
Propidium Iodide (PI) Staining for FACS Analysis ...... 54
FACS Analysis ...... ………… 54
Comet Assay……………………………………………………………….…………….55
Flow cytometry based determination of the formation of CPD and 64PP-UV viii photo lesions……………………………………………………………….…………….56
Chapter 1: Functional Characterization of Different Regions of the Origin Binding
Domain of Polyoma Large T……………………………………………..…………….58
Introduction...... 58
Results...... 60
Discussion...... 112
Chapter 2: The Origin Binding Domain of Large T Enhances DNA Damage
Response By Targeting Replication Protein A………………………..……………..121
Introduction...... 121
Results...... 125
Discussion...... 214
Conclusions ...... 219
Bibliography ...... 224 ix
List of Tables
Table 1 Summary of the Polyoma Virus Family………………………………...... 2
Table 2 List of Oligonucleotides…………………………………………….. …………42
Table 3 List of Plasmids…………………………………………………………………45
Table 4 Summary of mutants that were destabilized in the OBD background or in the
LT background…………………………………………………….…………………..…66
Table 5 Summary of results from replication assays……………………………………76
Table 6 Summary of results from RPA binding assays…………………………………83
Table 7 Summary of all results from CREB transactivation assays…………………….88
Table 8 Summary of results from mutant E2F cyclin A (-37/-33) promoter activation assays……………………………………………………………………………….……92
Table 9 Results from duplicate microarrays summarizing gene clustering results in the
TGF-β signaling pathway………………………………………………………………103
Table 10 Results from duplicate microarrays summarizing gene clustering in the MAPK signaling cascade…………………………………………………………………….…108
Table 11 Characterization summary of all mutants made in this study…………..……116
Table 12 Characterization summary of all mutants made prior to or outside this study………………………………………………………………………….…………117
x
List of Figures
Figure 1 The circular genome of the A3 strain of polyomavirus……………………..….8
Figure 2 The polyomavirus T antigens are three splice variants…………………………9
Figure 3 Comparison of structure of polyoma and SV40 small T antigen……………...13
Figure 4 Schematic of middle T antigen………………………………………………..16
Figure 5 The domains and properties of Py large T antigen…………………………....19
Figure 6 Ribbon diagram of the tertiary structure of SV40 T-ag-OBD 131-260 ………24
Figure 7 Structure of the SV40 origin of replication…………………………………...25
Figure 8 Polyoma and SV40 LT activate CREB transcription ………………………...62.
Figure 9 Mutated residues in the polyoma origin binding domain……………………..64
Figure 10 K381E is destabilized in the OBD background……………………………...67
Figure 11 K308E and S306P/V358A are defective for replication while E320A,
K381E, P402R/G403D and E343K/E344K are replication positive……………………74
Figure 12 LT/OBD binds RPA………………………………………………………….79
Figure 13 Mutants P402R/G403D,E343K/E344K and K381E were defective in CREB synergy…………………………………………………………………………………...86
Figure 14 Mutants P402R/G403D,E343K/E344K and K381E were defective in E2F transactivation……………………………………………………………………………90
Figure 15 CREB defective mutants P402R/G403D, E343K/E344K and K381E are dominant negative over wild type polyoma large T in CREB transactivation…………..94
Figure 16 Large T did not synergize with BRG1 to activate transcription of CREB- responsive promoter……………………………………………………………….…….99
Figure 17 Conditional expression of OBD using the tet-off system…………………..102 xi
Figure 18 OBD expression induces upregulation of TGF-β pathway components……105
Figure 19 LT and OBD transcriptionally activates downstream components of the MAPK cascade:…………………………………………………………………………………110
Figure 20 OBD expression induces upregulation of MAPK pathway components…...111
Figure 21 SV40 TBD structure pointing out mutated residues in the origin binding
Domain…………………………………………………………………………………115
Figure 22 Polyoma Large T/OBD Sensitizes Cells to DNA Damaging
Agents………………………………………………………………………….…….…127
Figure 23 Cellular stress responses to DNA damage in the presence of LT or OBD…132
Figure 24 Polyoma LT and OBD synergizes with components of the MAPK cascade………………………………………………………………………………….138
Figure 25 OBD induces morphological changes of the nucleus after UV/etoposide treatment………………………………………………………………………..………140
Figure 26 OBD enhances DNA laddering: and PARP activation in response to
UV/etoposide……………………………………………………………………………142
Figure 27 LT Enhances PARP Activation and PARylation after UV treatment………144
Figure 28 Pretreatment with TiQA abolishes PARP activation and cell death after UV treatment……………………………………………………………………..…………145
Figure 29 OBD affects localization of AIF and Cytochrome C after UV treatmnent………………………………………………………………………….…...149 xii
Figure 30 Effect of LT on death/survival proteins after UV exposure………………..153
Figure 31 OBD affects localization of Bim after UV exposure………………….……154
Figure 32 Lentivirus mediated Bim shRNA knockdown in MEFs inducibly expressing
OBD………………………………………………………………………………….…155
Figure 33 Bim shRNA knockdown does not inhibit sensitization of cells to UV…….156
Figure 34 OBD reduces the effect of serum starvation………………...………………158
Figure 35 LT and OBD inhibit PARP activation, PARylation after serum starvation……………………………………………………………………………….159
Figure 36 OBD affects localization of Cytochrome C after serum starvation…………160
Figure 37 OBD enhances DNA damage………………………………………….……162
Figure 38 Quantification of DNA damage by OBD after UV treatment………………163
Figure 39 Quantification of DNA damage by OBD after etoposide treatment……..…164
Figure 40 TiQA, the PARP inhibitor does not block the mobility shift in Bim but blocks
PARP activation…………………………………………………………………………167
Figure 41 FACS analysis to show that LT does not affect formation of photolesions……………………………………………………………..………………171
Figure 42 Image Stream analysis to show LT does not affect formation of photolesions………………………………………………………………….…………172
Figure 43 OBD upregulates components of the DNA damage response
(DDR)…………………………………………………………….…….………………174
Figure 44 Pretreatment with Caffeine does not block cell death observed after UV treatment………………………………………………………….….…………………176
Figure 45 Conditional expression of the DNA binding mutants S306P, S306P/V358A xiii
Using the pBI-G tet off system…………………………………………………………180
Figure 46 DNA binding function does not regulate the ability of LT to sensitize cells after
DNA damage by etoposide………………………………………………..……………183
Figure 47 LT mutants defective in CREB transactivation…………………..…………187
Figure 48 LT mutants defective in CREB transactivation sensitizes cells to DNA damage
by UV…………………………………………………………………………..………189
Figure 49 Sequence homology between SV40 OBD and Polyoma OBD highlighting
regions that can potentially bind RPA in polyoma and GST-RPA pulldown
assay…………………………………………………….………………………………192
Figure 50 Immunoprecipitation assays to show LT and OBD binds RPA but K308E LT
does not………………………………………………………………..……………..…193
Figure 51 RPA binding mutant K308E does not sensitize cells to DNA damage by
UV………………………………………………………………………………………196
Figure 52 K308E does not enhance DNA damage by UV……………………….……197
Figure 53 K308E does not upregulate stress responses after UV treatment…………..198
Figure 54 RPA binding defective mutant E320A does not enhance DNA damage by
UV………………………………………………………………………………….…..200
Figure 55 Quantification of the DNA damage seen in E320A after UV
treatment…………………………………………………………………………..……201
Figure 56 K308E does not induce G2/M arrest………………………………..………206
Figure 57 Overexpression of RPA in OBD inducible cell lines…………………….…208
Figure 58 RPA overexpression protects cells against DNA damage by UV……….…209 xiv
Figure 59 Quantification of DNA damage with RPA overexpression after UV treatment……………………………………………………………………..…………210
Figure 60 RPA overexpression abrogates cellular stress responses to DNA damage by
UV………………………………………………………………………………………211
Figure 61 RPA overexpression protects cells against DNA damage by etoposide…………………………………………………..……………………………212.
Figure 62 Quantification of DNA damage with RPA overexpression after etoposide treatment………………………………………………………………..………………213.
xv
List of Abbreviations
AA amino acids ATF activating transcription factor ATM ataxia telangiectasia mutated BBS BES buffered saline BES N, N-bis(2-hydroethyl)-2-aminoethane sulfonic acid BME β-mercaptoethanol CAT chloramphenicol acetyl transferase CHK Chk kinase CMV cytomegalovirus CON control CREB cyclic AMP response element binding protein CS calf serum CT C-terminal domain of polyoma large T DMEM Dulbecco’s modified Eagle’s medium DMSO dimethyl sulfoxide DTT dithiothreitol FCS fetal calf serum GST glutathione S-transferase HBS HEPES buffered saline Hr-t host range non-transforming IP immunoprecipitation kDa kilodalton LT large T mAB monoclonal antibody MEF mouse embryo fibroblast MT middle T NT N-terminal domain of polyoma large T OBD Origin binding domain PBS phosphate buffered saline PCR polyomerase chain reaction PKA protein kinase A PTK src-family protein tyrosine kinases Py polyoma Rb retinoblastoma SDS sodium-dodecyl sulfate S.E.M. standard error of the mean SH2 src-homology 2 ST small T TBD SV40 T antigen DNA binding domain Tris Tris (hydroxymethyl) aminomethane WT wild type 1
Roles of the Origin Binding Domain in Polyoma Large T function
Introduction
Polyomaviruses
Polyomaviruses are non-enveloped, double-stranded, icosahedral DNA viruses.
Originally isolated from leukemic mice for its tumor forming potential, murine polyomavirus was first discovered by Ludwig Gross in 1953 (Gross, 1953). The name polyoma refers to the virus' ability to produce multiple (poly-) tumors (-oma).
Subsequently polyomaviruses have been found in many species (Table 1). Commonly they are widely distributed in their natural hosts. For example, antibodies to human polyomaviruses, BKV and JCV are found in up to 97% and 75% of the human population respectively (Knowles et al., 2003; Yogo et al 2004; Antonsson et al, 2010).
Pathogenesis in Humans
Initial infections are generally not noticed, although novel human polyomaviruses KI and
WU were isolated from respiratory secretions of children with acute respiratory symptoms (Allander et al, 2007; Gaynor et al, 2007). The viruses may cause problems in immunosuppressed hosts. BK virus infection may affect kidney transplant patients (de
Bruyn et al., 2004). JC virus causes demyelinating disease PML (Safak et al., 2003) in the brain, which is often associated with HIV infections. Although ubiquitous and potentially oncogenic in nature, the incidence of tumors is low, both for murine and human polyomaviruses. Merkel Cell polyomavirus (MCV) has been identified as the likely causative agent of a rare but aggressive form of skin cancer of neuroendocrine 2
Table 1: Summary of the Polyoma Virus Family
Virus Host Genome Length (bp)
JV virus (JCV) Human 5130
BK virus (BKV) Human 5133
KI virus (KIPyV) Human 5040
WU virus (WUPyV) Human 5229
Merkel Cell virus (MKV) Human 5387
Simian virus (SV40) Rhesus Monkey 5243
Lymphotropic polyomavirus (LPV) African Green Monkey 5270
Bovine polyoma virus (BPV) Cattle 4967
Hamster polyomavirus Hamster 5366
Polyoma virus (Py) Mouse 5392
Kirsten virus (KV) Mouse 4754
Rabbit polyoma virus (RKV) Rabbit Not Reported
Rat polyoma virus (RPV) Rat Not Reported
Simian Agent 12 (SA12) Baboon Not Reported
Budgerigar fledgling disease virus (BFDV) Parakeet 4980
Goose Hemorrhagic polyoma virus (GHPV) Geese 5256 3 origin named Merkel cell carcinoma (Feng et al, 2008). Most often, it occurs in immunodeficient people (Williams et al, 1998). There is considerable controversy over whether or how SV40 plays a role in human carcinogenesis (for reviews, see Butel, 2000;
Ali and DeCaprio, 2001; Sullivan and Pipas, 2002; Vilchez et al., 2003). Early work in the field suggested mechanistic links between SV40 and human cancers (Barbanti-
Brodano et al., 2004). SV40 was found to be associated with mesotheliomas (Carbone et al.,1994; Cristaudo et al., 1995; Strickler et al., 1996;Griffiths et al., 1998; Testa et al.,
1998; Rizzo et al., 2001), brain tumors (Geissler, 1990; Bergsagel et al., 1992; Martini et al., 1996; Huang et al., 1999; Carbone et al., 2003) and bone tumors (Carbone et al.,
1996; Mendoza et al., 1998; Martini et al., 2002).
If the importance of polyomaviruses to pathogenesis is rather limited, their value as laboratory models for eukaryotic cell functions has been very great. Owing to their small genome size (~5000 base pair), and therefore limited coding capacity, polyomaviruses heavily exploit host gene products. Cellular machinery is used for transcription, replication and even, in the case of histones, as part of the viral particle. In vitro studies of SV40 viral DNA replication have allowed identification and characterization of cellular components like, pol-α/primase(Bullock et al., 1989., 1991;
Matsumoto et al., 1990; Murakami et al., 1992), RPA (Yuzhakov et al. 1999 ). , RFC,
PCNA (Waga & Stillman 1994, Stillman 1994; Tsurimoto & Stillman 1989; Tsurimoto et
al., 1990; Lee et al., 1991b, Tsurimoto & Stillman 1991; Wang 1991), Fen1, RNAase H1
and DNA ligase that are critical for DNA replication (For review see Waga and Stillman
1998).
Polyomaviruses also provide an excellent platform for studying growth 4 regulation and tumorigenesis. The murine virus causes a wide variety of tumors in susceptible animals (Eddy et al., 1958; Dawe et al, 1987; Fluck et al., 1996; Eddy, 1969).
The roles of individual oncoproteins and signaling pathways (Freund et al., 1992;
Bronson et al., 1997; Yi et al., 1997; Cullere et al., 1998) can be demonstrated in this way.
Alternatively, transgenic expression of the middle T (MT) antigen of polyoma (Bautch et al., 1987; Rassoulzadegan et al., 1990; Guy et al., 1992) can be sufficient to generate tumors in a wide variety of tissues. It is generally assumed that tumor induction is related to the stimulation of the cell cycle (Dulbecco et al., 1965; Weil et al., 1967) that supports virus replication.
Murine polyomavirus, in addition, grows readily in culture. Consequently, tissue culture studies have been an invaluable method to investigate signal transduction pathways. Work on polyomaviruses and SV40 led to the discovery of tyrosine phosphorylation by c-src (Courtneidge and Smith, 1983; Horak et al., 1989., Kornbluth et al., 1987) and identification of PI3 kinase (Whitman et al., 1985) and the p53 tumor suppressor (Lane and Crawford., 1979). The following is a brief introduction to the murine polyomavirus, the genome structure of murine polyoma, and its early gene products: tiny, small, middle and large T antigens.
Murine Polyomavirus
The polyomaviruses are non-enveloped, icosahedrally symmetrical particles with circular double-stranded DNA genomes of about 5300 bp and a diameter of about 450 nm
(Wildy et al., 1960; Klug et al., 1965; Vinograd et al 1965; Fried and Griffin et al 1977;
Soeda and Griffin 1978; Friedmann 1979). There are three viral-coded proteins that make up the capsid of polyomavirus. There is a major protein VP1 and two minor proteins, 5
VP2 and VP3. VP1 forms a pentamer with 72 copies of the pentamer in the capsid
(Liddington, Yan et al 1991; Stehle, Yan et al 1994). The viral DNA is associated with four core histones (Frearson et al., 1972; Murakami & Schaffhausen, 1972; Schaffhausen et al., 1976).
Infection
During viral infection and uptake, specific gangliosides serve as plasma membrane receptors (Tsai et al., 2003). When a cell is infected with polyomavirus, there are several possible outcomes in the host: lytic infection, abortive transformation, and stable transformation. For permissive mouse cells, the major outcome is cytolysis and release of virions. Non-permissive cells like hamster or rat cells undergo abortive transformation or non-productive infection, wherein cells have a transiently transformed phenotype upon infection, but loss of the viral genome due to lack of integration restores the normal phenotype (Stoker, 1968; Stoker et al., 1969). Rarely, permissive and non- permissive cells become stably transformed. Here, viral genome integration and expression of viral genes mediate a permanent change in the phenotype of the infected cell.
After uncoating, transcription of the viral genome begins. Transcriptionally, the viral genome is divided into early and late regions based on the time of expression relative to viral DNA replication (Fig 1). Prior to DNA replication, the early region is transcribed and expressed preferentially over the late region, and continues to be expressed at later times, after infection (Suarez et al., 1981; Tooze et al., 1981; Cereghini et al., 1983). Early transcripts are differentially spliced to produce large T (LT), middle
T (MT) and small T (ST). The three proteins share an identical N-terminus of 79 amino 6 acids that is homologous to the DnaJ family of proteins. The J-domain can functionally replace the E.coli DnaJ J domain necessary for cochaperone function in vivo (Genevaux et al., 2003).While J-domain interactions with cellular heat shock proteins is important for large T functions, their role in middle T or small T signaling does not seem to be as critical. Mutations in the HPD motif has no effect on middle T or small T functions.
Middle T and small T antigens share an additional 114 amino acids. Each T antigen has a distinct C-terminus (Fig 2). These three T antigens, LT, MT and ST, are important for productive viral infection (Benjamin, 1965; Fried, 1965; Eckhart, 1977), transformation in vitro (Benjamin, 1965; Eckhart, 1977; Benjamin et al., 1979), and tumorigenesis in vivo (Siegler et al., 1975; Israel et al., 1980). Tiny T, a fourth splicing product of 17 kDa was recently characterized. It is basically a functional J domain with an additional six unique amino acids (Riley, Yoo et al., 1997). The role of tiny T in viral function is as yet unknown. After about 12 hours, replication of viral DNA is initiated at a single origin and proceeds bidirectionally along the viral genome (Magnusson et al.,
1979; Buckler-White et al., 1982; Hendrickson et al., 1987). After this onset of DNA replication, the late region is preferentially transcribed (Hyde-DeRuyScher and
Carmichael 1988). This region is also differentially spliced to produce the capsid proteins. The late genes are comprised of the viral capsid proteins: VP1, VP2, and VP3.
T antigens
The three early gene products, LT, MT and ST all function in transformation. LT can transform primary cells in combination with MT or ras oncogene ( Land et al., 1983;
Ruley et al., 1983). MT antigen plays a central role during polyoma transformation and tumorigenesis. It is able to transform established cell cultures alone (Treisman et al., 7
1981) and causes tumors in a wide variety of tissues when expressed as a transgene
(Fluck, 2009). Polyoma ST complements middle T for transformation (Asselin, Vass-
Marengo et al 1986) and tumor formation (Asselin, Gelinas et al 1984). For polyoma, effects on the host cell are compounded by the concerted action of each of the three T antigens. Before I talk about large T, the topic of this thesis, I will briefly describe middle
T and small T and their individual roles in the regulation of growth and survival. 8
Fig. 1:Schematic diagram of murine polyoma viral genome. Arrows indicate the direction of transcription of the early (LT, MT, ST) and late (VP1, VP2, VP3) genes.
9
T antigens of Polyoma virus
1 79 19 81 82 785
LT
421 MT
195 ST
85
tT
D1 D2 A1 A2
Fi g. 2: The early genes of murine polyomavirus are produced from the same primary
transcript which results in their identical N -terminal domain called the J domain. Due to the
splicing, each T antigen has a unique C -terminal domain. D1 and D2 represent the donor
while A1 and A2 the acceptor sites for the splicing of T antigens.
10
Polyoma small T antigen
The small T antigen (ST) has been the most elusive of the three T antigens. Studies on SV40ST showing that it was able to contribute to the transformation of human cells
(Yu et al., 2001; Hahn et al., 2002) stimulated new interest in ST.
There is ample evidence for a role of ST in viral DNA replication (Turler and
Salomon, 1985; Berger and Wintersberger, 1986; Martens et al., 1989). ST can cooperate with large T in the enhancement of DNA replication (Berger and
Wintersberger 1986), and has the ability to induce S-phase in serum starved cells (Ogris,
Mudrak et al., 1992). It is also important for the regulation of viral gene expression
(Chen, 2006). In addition, its activity leads to transactivation of several genes that promote S-phase entry (Mullane et al., 1998). Viral mutants that are defective in SV40
ST expression form much smaller plaques (Shenk et al., 1976; Tooze, 1980; Topp, 1980).
Although there is one report that transgenic SV40 ST can mediate mammary gland tumorigenesis (Goetz et al., 2001), ST, whether polyoma or SV40, is not generally thought to be sufficient to transform cells. A variety of polyoma mutants make this clear
(Carmichael et al., 1982; Templeton et al., 1982; Liang et al., 1984). As mentioned before, it can complement middle T for transformation (Asselin, Vass-Marengo et al
1986; Lomax, 2001; Moule, 2004) and tumor formation (Asselin, Gelinas et al 1984). ST can affect cell phenotypes in ways typical of transformation. Small T expressing cell lines have higher densities than control cells (Cherington, Morgan et al 1986; Noda,
Satake et al 1986). ST induces lectin agglutinability (Liang et al., 1984) as well as cytoskeletal properties of epithelial cells, both of which are characteristic of transformed state. These phenotypic changes induced by SV40 small T include by deregulation of 11
Rho GTPases, F-actin, and intracellular adhesion (Nunbhakdi-Craig et al., 2003).
ST can regulate apoptosis either to enhance or inhibit cell death. It inhibits p53-
induced cell cycle arrest and apoptosis (Wang, Q et al., 2000 ) and also reverses middle
T-dependent tumor necrosis factor alpha-induced apoptosis (Bergqvist, A. et al 1997).
Consistent with these effects on apoptosis, SV40 ST inhibited SV40 large T-induced
apoptosis (Kolzau, T. et al., 1999). ST can also inhibit Fas-mediated apoptosis in
hepatocytes (Gillet et al., 2001). ST mediated induction of Akt activation may
contribute to these anti-apoptotic effects (Gillet et al., 2001; Yuan et al., 2002). On the
other hand, there is abundant evidence that both polyoma small T (Andrabi et al., 2007;
Yen et al., 2001) and SV40 small T (Gjoerup et al., 2001) can induce apoptosis in
specific cell types. This death also seems to be mediated by Akt (Andrabi et al., 2007).
The ability of small T to differentially affect cell death underscores the importance of
cell context as well as the versatility of small T effects on the host cell.
Small T is a zinc-binding (Turk et al., 1993) protein of 195 amino acids (Fig 3). It appears freely distributed between the nucleus (Zhu et al., 1984; Noda et al., 1986) and cytoplasm (Silver et al., 1978), since it does not have a specific nuclear localization signal. It has an N-terminal J-domain that stimulates ATPase activity of hsc70
(Srinivasan et al., 1997).
Both SV40 and polyoma ST specifically interacts with protein phosphatase 2A
(PP2A) (Pallas et al., 1996; Walter et al., 1990). PP2A comprises of a family of serine/ threonine phosphatases that accounts for a large fraction of eukaryotic phosphatase activity (Millward, Zolnierowicz et al., 1999). PP2A is a heterotrimer consisting of a catalytic subunit C, regulatory subunit A and scaffolding subunit A. Small T can bind the 12
A and C subunits of the enzyme (Pallas et al., 1990). It alters PP2A function by directly interacting with the scaffolding A subunit and displacing regulatory B subunits from the
A subunit (Pallas et al., 1990, Sontag et al., 1993, Mumby, 1995). There is evidence that effects on specific PP2A populations may be important. For example, the transforming activity of SV40ST is largely dependent on displacement of a single type of PP2A regulatory subunit (B56 γ) from PP2A complexes (Chen et al., 2004). 13
Fig. 3: Comparison of the structures of polyoma and SV40 small T antigens (S.Andrabi, PhD thesis): The N-terminal portions show the J domain, which have the conserved HPDKGG motif. This is followed by PP2A binding sites, and zinc binding motifs. Polyoma small T has a tail of four aminoacids that are added after splicing out the intron in the primary transcript.
14
Polyoma Middle T antigen
A highly effective oncogene, MT is the major transforming protein of polyomavirus. Biochemical and genetic studies have shown that MT is necessary for viral transformation and tumorigenesis (Griffin, 1980; Carmichael, 1982; Carmichael,
1984 ;Templeton, 1982;Freund, 1992; Freund, 1992). In many situations MT is sufficient to transform cells (Treisman, 1981). In others, such as primary cells, complementation with another oncogene such as polyoma large T, adenovirus E1A, or c-myc
(Rassoulzadegan et al., 1982; Land et al., 1983; Ruley 1983) is needed. Expressed as a transgene MT is oncogenic in a variety of different tissues (Bautch et al., 1987;
Rassoulzadegan et al., 1990; Guy et al., 1992).
Polyoma middle T (MT) antigen is a 421 amino acid phosphoprotein. MT localizes to both cytoplasmic and plasma membranes (Ito, 1979; Schaffhausen et al.,
1982; Dilworth et al., 1986). Membrane association is required for MT transformation
(Carmichael, 1982). MT has no known activity, but rather functions as an adaptor by recruiting cellular signaling components (Fig 4). Like ST, MT binds PP2A A and C subunits (Pallas et al., 1990; Walter et al., 1990). Binding of PP2A allows MT binding of members of the src tyrosine kinase family. All MT mutants with disrupted PP2A binding exhibit a complete loss of transforming activity because of failure to associate with src family members. Interestingly, PP2A catalytic activity is not essential for complex formation between MT and c-src (Ogris et al., 1999). The ability of MT to transform cells and induce tumors correlates well with its ability to associate with and activate members of the Src family of tyrosine kinases (Eckhart, 1979; Smith, 1979;
Schaffhausen, 1979; Carmichael, et al., 1982; Courtneidge, et al 1983; Kornbluth, 1987). 15
c-Src, for example, is essential for MT induced mammary tumorigenesis as shown by
transgenic mice that express the MT antigen (Guy et al., 1992). As a result of
interactions with src family members, MT is phosphorylated on several tyrosine residues
(Schaffhausen, 1981;Harvey, 1984; Hunter, 1984) which act as binding sites for the
cellular proteins. PI 3-kinase binds to phosphorylated tyrosine at amino acid position 315
(Whitman, 1985;Talmage et al., 1989; Kaplan et al., 1986), Shc binds to phosphorylated
tyrosine at amino acid position 250 (Campbell et al., 1994; Dilworth et al., 1994), and
PLC- γ binds to phosphorylated tyrosine at amino acid position 322 (Su et al., 1995).
There are other MT-protein associations as well. The N-terminus of MT interacts with hsc-70 when PP2A is absent (Schaffhausen et al., 1987; Pallas et al., 1989). Hsc binding seems not to be important for transformation because deletion of the HPDKGG sequence responsible for binding hsc70 does not affect MT induced foci formation
(Campbell et al., 1995; Glenn et al., 1995). TAZ also binds in the extreme N-terminus of the J domain (Tian et al., 2004). Finally, the 14-3-3 families of ligand proteins bind to phosphorylated serine 257 (Pallas et al., 1994; Cullere et al., 1998). Mutation of S257 does not affect transformation of cells in culture but causes defects in salivary gland tumors in mice infected with a mutant virus, suggesting that this residue is important for regulation only in specific cell types (Cullere et al, 1998).
16
Fig. 4: Schematic diagram of polyoma middle T and the associated proteins (Hong, PhD thesis): Numbers show the amino acid residue number that binds a specific protein as shown. The N-terminus part (colored) represents the J domain. The hatched part at the C-terminus shows the membrane anchor that contains 22 hydrophobic aminoacids. Protein X (shown as the jigsaw puzzle) is an unidentified protein that is may bind at residue 315.
17
Polyoma large T antigen
The primary focus of this thesis is the polyoma large T antigen (LT) and the examination of some specific mechanisms by which LT regulates host cell phenotype.
LT has many distinct functions. Murine PyLT is directly involved in the initiation of viral DNA replication (Francke et al., 1973) and can promote recombination (St-onge et al., 1993; St.-Onge et al., 1990). By analogy to SV40, PyLT may also regulate the elongation stages in DNA synthesis during viral infection (Dean, F 1987; Stahl H., 1985;
Weikowski et al., 1987). LT can cooperate with MT or Ras to transform primary cells
(Land et al., 1983; Ruley et al., 1983) and induces tumorigeniesis in animal models by complementation of middle T (Asselin et al., 1983). The N-terminal portion of LT is sufficient in such complementation assays (Novak et al., 1980, Rassoulzadegan et al.,
1981, Land et al., 1983) to cause transformation.
Fig 5 is a schematic representation of the different regions of LT and their corresponding functions. LT also participates in the integration (Della Valle et al., 1981), amplification
(Colantuoni, 1980) and excision (Basilico et al., 1980) of the viral genome during transformation. LT is capable of triggering striking effects on the host cell phenotype.
LT expression forces cell cycle progression (Weil et al., 1967; Schegel et al., 1978;
Gjoerup et al., 1994), blocks differentiation (Cherington et al., 1986; Maione et al., 1992), causes primary cell immortalization (Rassoulzadegan et al., 1983; Holman er al., 1994) and stimulates (Fimia et al., 1998; Sheng et al., 2000) or inhibits (Zheng et al., 1994;
Rodier et al., 2000) apoptosis. These biological changes depend upon the ability of LT to regulate cellular RNA synthesis. LT is an activator of a diverse array of cellular genes
(Kellems et al., 1979; Kingston et al., 1986; Ogris et al., 1993; Mudrak et al., 1994; 18
Klucky et al., 2004). The following sections will describe how LT exerts its biological effects in more detail.
Many important clues about Py LT have come from studies in simian virus 40
(SV40) LT owing to the homology between the two proteins. SV40 LT, unlike PyLT is the major transforming protein in that virus. This difference arises mainly from the association of SV40 large T with p53 (Lane et al., 1979; Linzer et al., 1979). In contrast, the polyoma large T antigen interacts in a limited way with p53 phosphorylated on serine
18 (Dey et al., 2002). Although tumors developed somewhat faster in comparison to wild type, there was a marked absence of any effect on tumor number or tissue profile in p53-/- mice (Dey et al., 2000). Cell lines from polyoma tumors also retain a normal p53 response to DNA damage (Dey et al., 2000). Hence, the connection of p53 T polyoma LT is very different from that seen with SV40 LT.
Large T protein
LT is comprised of ~780 amino acids with slight strain differences in size (Tooze et al., 1980). A diagram of LT structure is shown in Fig 5. PyLT is localized to the nucleus (Oxman et al., 1972) by two nuclear localization signals (NLSs). PyLT NLS1 spans residues VSRK-192RPR, and NLS2 spans residues PKK-282ARED. 19
N J Domain 1-79
Fig 5: Structural features of Polyoma Large T antigen. Numbers represent the amino acid residues of large T. NT: N-terminal, and CT: C-terminal domain of large T.
20
(Richardson et al., 1986). Either one of these signals, without the other, is capable of
localizing LT to the nucleus (Richardson et al., 1986; Howes et al., 1996). As a result, LT
is cytoplasmic only upon deletion of both nuclear localization signals (Howes et al.,
1996).
LT is highly phosphorylated. There is a major cluster of sites (267,271,274 and
278) (Chatterjee et al., 1997). Phosphorylation of residue T278 is critical for viral DNA
replication (Chatterjee et al., 1997; Li et al., 1997). The comparable site in SV40 LT
(T124) is necessary for T antigen mediated DNA unwinding and replication (Mc Vey et
al., 1993; Weisshart et al., 1999). The loss of activity may be due to a failure of LT to
oligomerize (Barbaro et al., 2000). Cyclin/cdk complexes carry out this phosphorylation
for both SV40 and PyLT, providing a link to the cell cycle status of the host. Additional
PyLT phosphorylation sites near T278 may serve to inhibit DNA replication (Chatterjee
et al., 1997). These sites which include S267, S271 and S274 may be important for
mediating cross-talks between domains.They are located at the NT-CT domain boundary
and their mutation has different effects in full-length and truncated LT backgrounds
(Chatterjee et al., 1997). In SV40, translocation of LT from the cytoplasm to the nucleus
is dependent upon phosphorylation of specific sites that are adjacent to T124 and the NLS
(Addison et al., 1990; Jans et al., 1991; David et al., 1993; Jin et al., 1993; Moll et al.,
1992; Ramachandra et al., 1993; Rihs et al., 1991; Rihs et al., 1989). Whether this is true
for polyoma is unclear.
For PyLT there is a series of more N-terminal phosphorylation sites (Hassauer et al., 1986; Bockus et al., 1987; Wang et al., 1993), including 81, 129 (T. Love, Thesis) 21 and 187 (Hassauer, 1986). Their functions are largely uncharacterized, although it is known that these phopshorylated sites can bind Pin-1 in vitro (Tara Love, Ph.D. Thesis).
The domain structure of polyoma large T
Proteolysis can separate the polyoma large T protein into two structurally as well as functionally distinct domains (Holman et al., 1994). Large T can be readily cleaved with protease between residues 260 and 280, suggestive of a hinge region (Holman et al.,
1994). The amino-terminal portion spans residues 1-260 and the carboxy-terminal portion comprises of residues 264-785, termed as NT and CT respectively. Both NT and CT can exist independently as stable polypeptides. Each contains one of the two nuclear localization signals. Further, as discussed below, each domain includes sub-domains that can also be expressed independently.
NT comprises residues 1-259. Within it, there is a DnaJ domain that comprises approximately the first seventy amino acids. In addition, there is an LXCXE (amino acids 142-146) motif that is required for binding members of the retinoblastoma tumor suppressor family (Larose, 1991; Maione, 1994). It is worth noting that the polyoma NT has about 150 more residues than the comparable region for SV40.
CT harbors all the functional motifs required for viral DNA replication in growing fibroblasts (Gjorup et al., 1994). Specifically, it contains a region involved in binding the origin of replication of viral DNA, referred to as the DNA-binding domain (Sunstrom et al., 1991). It also comprises of additional sub-domains that possess ATP-binding
(Gaudray et al., 1980) and helicase activities (Seki et al., 1980). Tryptic peptide mapping and binding to ATP analogs led to the identification of the consensus ATP binding motif of SV40 LT antigen (amino acids 418 and 528) and for polyoma LT antigen residues 22
(565-675) (Gaudray et al., 1980; Clertant and Cuzin, 1982; Clertant et al. , 1984; Bradley
et al., 1984; Bradley, 1990). Furthermore, LT contains a zinc-finger domain that
functions to promote oligomerization (Rose et al., 1995). All of these activities are
directly involved in viral DNA replication.
A particularly well-characterized domain of LT is the one for specific binding to the origin of viral DNA (Paucha et al., 1986; Simmons et al., 1986; Simmons et al., 1990;
Strauss et al., 1987; Wun-Kim et al., 1990; Joo, 1997). Referred to as the origin binding domain (OBD), it is critical for the positioning of the LT antigen on the origin during initiation of DNA synthesis. The SV40 OBD (residues 131-259) has been well- characterized from both a structural and genetic point of view. Structural analysis has been carried out by both NMR (Luo, 1996; Bradshaw, 2004; Reese, 2006) and X-ray diffraction (Meinke, 2006;Meinke, 2011;Meinke, 2007). The structure of OBD (Luo et al., 1996, Fig 6) as revealed by NMR spectroscopic studies consists of a five stranded antiparallel β-sheet that is flanked on one side by two α-helices and one α-helix and one
β10 –helix on the other.
Genetic analysis of OBD has identified five important components necessary for specific functions related to DNA binding and DNA replication (Simmons et al., 1990;
Simmons et al., 1993; Wun-kim et al., 1993). Elements A1 (residues 147-159) and B2
(residues 203-207) are important for sequence specific recognition of the GAGGC pentanucleotide repeats in the SV40 origin (Simmons et al., 1990; Bradshaw et al., 2004).
These two elements are folded to form structural loops that contact origin DNA. Non- specific DNA binding has lower affinity (Kd values = 0.1 M) than specific 23
DNA recognition (REF). Deletion analysis has provided insights into the regions of OBD required for non-specific DNA binding activity. Elements B1 and B4 (residues 183-187 and 226-227 respectively), as well as regions in A1 and B2 (Ala-149, Phe-159; and His-
203) participate primarily in nonspecific DNA binding (Simmons et al., 1990; Simmons et al., 1993; Wun-kim et al., 1993). These regions are involved in the recognition of general structural features of the sugar-phosphate backbone of the DNA (Simmons et al.,
1990; Simmons et al., 1993). Nonspecific double-stranded DNA binding has been implicated previously in structural distortion of the origin (DeLucia et al., 1983).
Additional scrutiny has provided evidence that the regions important for non-specific
DNA binding functions are also required for helicase activity of LT. Element B3 binds to site II, but not site I, in the origin; and is required for DNA unwinding, while being non- essential for sequence specific contact functions (Simmons et al., 1990). In contrast, those motifs that are involved in sequence specific DNA binding are not important for helicase functions (Simmons et al., 1990). 24
B 2 Element A1 Loop
Fig 6: X-Ray structure of SV40 T-ag-OBD 131-260 (Luo et al, 1996).The strands are yellow, the helices are magenta/pink, and the coils are grey. The A1 loop and the B2 element are indicated by arrows. 25
Fig 7: Structure of the SV40 origin of replication. Black boxes represent a pentanucleotide sequence 5’GAGGC3’ with orientation denoted by arrows. The auxiliary elements, α and β, contain sequences which enhance viral DNA replication 26
There are additional exposed residues that are believed to be necessary for functions independent of DNA replication. The two lysines at 173 and 174 were found to be important for SV40 LT transactivation (Johnston et al., 1996). A TKEK motif at residue 164 is important for induction of a less stringent specificity for origin binding
(Margolskee et al., 1984). The region between 181-205 is responsible for binding TBP and cause cell cycle stimulation (Dickmanns et al., 1994; Berger et al., 1996; Hsu et al.,
1996).
Much less information is available for the polyoma OBD. The DNA binding function has been mapped to the C-terminus covering residues 282-398 (Sunstrom et al.,
1991). A carboxy- terminal DNA fragment that extends through residue 421 has the most specific activity, indicating that the construct to 398 may not be completely stable.
Large T Functions
What we now know as LT was originally characterized as the ts-a gene (Eckhart,
1969; Fried, 1965; Fried, 1970). It was shown to be required for both virus growth and transformation. For virus replication LT was found to be necessary for initiation of viral
DNA replication (Francke, 1973). With regard to transformation, it was necessary for integration (Della Valle, 1981). It was not immediately obvious that LT could affect cell phenotype, because ts-a mutants were wild type for abortive transformation (Stoker,
1969). As discussed below, LT has a considerable effect on the host cells.
Manipulations of viral DNA
Before focusing on viral DNA replication, it is important to note that LT has a variety of effects on viral DNA besides initiating replication. As noted, LT participates in the integration (Della Valle et al., 1981), but also in amplification (Colantuoni, 1980) 27 and excision (Basilico et al., 1980) of the viral genome during transformation. LT can also promote recombination (St-onge et al., 1993; St.-Onge et al., 1990). A transformed cell expressing full-length LT is therefore genetically unstable. This is the likely explanation for why most transformants lose the full-length protein.
LT and viral DNA replication
The demonstration that SV40 DNA replication could be performed in vitro (Li,
1984) opened the door to understanding the components required for DNA replication in a eukaryotic system ( see (Waga, 1994;Waga, 1998;Bullock, 1997; Simmons, 2000) for reviews. This remains the most developed system for studying eukaryotic DNA replication. Relatively few experiments have been done with polyoma LT, so I will describe some of the basic features of SV40 replication.
The SV40 replication origin as shown in Fig 7 is made up of multiple elements: a
64 base pair (bp) core region as well as auxiliary enhancer elements that can be deleted without loss of basal functioning LT binds GAGGC repeats. Two specific T antigen binding regions, site I and site II, within the SV40 genome mediate binding to viral origin of replication(Tijan., 1978; McKay, 1981; Pomerantz et al., 1984; Pomerantz et al., 1983).
Site I is located on the early region side and presumably regulates transcription of early genes (Reed et al., 1976; Alwine et al., 1977; McKay et al., 1981; Myers et al., 1981). It comprises of two GAGGC sequences that are oriented away from the core origin, separated by an A/T-rich sequence. The 17 base pairs in Site I are sufficient and required for recognition of large T (Jones et al., 1984). Site II is a palindrome of two pairs of 5'-
GAGGC-3'/5'-GCCTC-3' pentanucleotide repeats, oriented head to head. Within the core origin, two additional regions are the early palindrome (EP) and the A/T rich region, both 28
of which flank the GAGGC pentanucleotides (Fig 7). The EP is the melting site and the
A/T is the untwisting site during replication. The arrangement of the polyoma origin is
generally similar. The two pairs of pentanucleotides equivalent to site II are closer to
each other than in SV40. Experiments on Merkel cell virus suggest the altered spacing
may affect the binding of LT (Harrison, 2011). In contrast to SV40, the polyomavirus
enhancer sequences are much more important for polyoma replication (Veldman, 1985).
Although each core site II pentanucleotide can bind the T antigen independently
(Tijan , 1978; Tijan et al., 1978; DeLucia et al., 1983) , binding to all four is a requisite
event for initiation of DNA synthesis (Shortle et al., 1979; Di Maio et al., 1980; Myers et
al., 1981; Deb et al., 1987). The initiation event is triggered by the binding of OBD to
GAGGC pentanucleotide sequences in the central region (site II) of the viral origin of
replication (Pomerantz et al., 1983; Cowie et al., 1984; Scheller et al., 1985; Cowie et al.,
1986). In vitro biochemical analysis showed that addition of ATP to LT leads to the
assembly of T antigen monomers into larger oligomers. These were demonstrated to be
hexamers, with a pair of large T antigen hexamers (double hexamer) binding to the SV40
core origin (Dean et al ., 1987; Mastrangelo et al ., 1989; Parsons and Tegtmeyer, 1991:
Wessel et al., 1992; Reynisdottir and Prives, 1993; Dean et al., 1992). The activity of the large T antigen in double hexamer formation is regulated by its phosphorylation state
(Mastrangelo et al., 1989). Origin recognition leads to the formation of the large T antigen double hexamer at the origin. Inside each hexamer, the origin recognizing A1 and B2 elements in the OBD presumably assume a specific conformation that prevents
DNA binding activity (Meinke et al., 2007). 29
In the presence of ATP, T antigen assembles into a double-hexamer structure
spanning the entire core origin of replication (Borowiec et al., 1988; Deb et al., 1987;
Mastrangelo et al., 1989; Parsons et al., 1991). This triggers alterations in origin DNA
that result in the formation of a replication bubble (Borowiec et al., 1988; Dean et al.,
1987; Parsons et al., 1990). Release from specific recognition sequences in the origin
induces T antigen to act as a helicase for the extension of the primary replication bubble
in both directions (Dodson et al., 1987; Parsons et al., 1990; Wessel et al., 1992).
Investigation of hexameric structures of the LT antigen revealed that conformational
changes of the hexamer cause expansion and contraction of the central channel of the
hexamer in a process that is propelled by the coupling of the energy of ATP binding and
hydrolysis to DNA translocation and unwinding at the replication fork (Li et al., 2003;
Gai et al., 2004). T antigen binding to the origin results in unwinding (Deb and
Tegtmeyer, 1987: Borowiec and Hurwitz, 1988a, 1989; Parsons et al ., 1990; Borowiec et
d., 1991). The DNA helicase activity of LT that catalyzes its ability to unwind the origin
also requires the hydrolysis of ATP (Goetz et al., 1988; Wiekowski et al. , 1988;
Scheffner et al., 1989). Presumably, LT undergoes conformational changes as a result of
its interaction with ATP. After unwinding has begun, LT acts in conjunction with an
initiation complex comprised of topoisomerase I (topo I), RPA, and DNA polymerase
α/primase (pol α/prim) (Dornreiter et al., 1993; Matsumoto et al., 1990; Murakami et al.,
1986; Murakami et al., 1993). Topo I functions to nick and religate DNA in order to relax origin DNA before the replication fork. It is required for origin unwinding (Roberts et al.,
1989). Large T antigen and topo I act cooperatively to relax and unwind DNA in a tightly regulated fashion (Halmer et al., 1998; Simmons et al., 1998; Gai et al., 2000., Seinsoth 30
et al., 2003). Replication Protein A (RPA) is a single stranded DNA binding protein that
coats and protects exposed single stranded regions of DNA at replication forks. Moreover,
RPA also activates pol α/prim to bring in RNA primers (Michael et al., 2000). SV40 large
T binds RPA through residues 164-249. (Collins et al., 1993; Weisshart et al., 1998; Jiang
et al., 2006). This interaction is thought to allow LT to cover ssDNA generated at the
replication fork. LT interaction with pol α/prim triggers DNA synthesis on the unwound
origin (Murakami et al., 1986; Smale et al., 1986; Dornreiter et al., 1990; Gannon et al.,
1990; Pistillo et al., 1991). It is believed that this interaction determines the host range of
the virus (Murakami et al., 1986; Bennet et al., 1989; Dornreiter et al., 1990; Pistillo et al.,
1991; Stadlbauer et al., 1994).
Effects on Host Cell Phenotype
A wide variety of signaling changes triggered in the infected cell can be attributed to the functions of the large T antigen. It has been known since the 1960s that PyLT is capable of inducing cellular DNA synthesis (Weil et al., 1967; Schlegel et al., 1978;
Gjorup et al., 1994). Polyomavirus large T immortalizes primary cells (Asselin et al.,
1985; Rassoulzadegan et al., 1983). In concurrence with its role in S phase induction,
polyoma large T inhibits differentiation of both myoblasts (Maione et al., 1992) and
preadipocytes (Cherington et al., 1986). It can induce dramatic apoptosis (Fimia et al.,
1998; Sheng et al., 2000).
Many of these effects occur as a result of the interaction of LT with members of
the retinoblastoma susceptibility gene family. The amino-terminal portion of the LT
antigen has an Rb-binding LXCXE motif that is responsible for binding pRb, p107 and
p130 (Sheng et al.,1997). This association with Rb family members is important for 31 immortalization (Larose, 1991), for blocking differentiation of myoblasts (Maione, 1992) and for promoting apoptosis (Fimia, 1998; Sheng, 2000). The sequestration of pRb by LT primes infected, permissive cells for viral DNA replication due to S-phase induction and the replication factors and enzymes that go along with that (Mudrak, 1994;Nemethova,
2004; Sheng, 1997;Sheng, 2000). A functional J-domain sequence HPD (amino acids 42 to 44) is required for the ability of LT to regulate Rb-associated functions such as cell cycle progression and activation E2F containing promoters (Sheng, 1997). However, J domain function is not required for the ability of LT to use Rb binding to cause apoptosis
(Sheng, 2000). Interestingly, cytoplasmic LT is deficient in pRb-independent transactivation of cellular promoters (Howes et al., 1996; Love et al., 2005), even though cytoplasmic SV40LT retains functions that relate to the cell cycle stimulation like immortalization (Vass-Margengo et al., 1986), transformation (Tedesco et al., 1993) and transactivation (Kalderon et al., 1984; Lanford et al., 1985; Pannuti et al., 1987).
LT can also activate transcription through non-Rb mechanisms. CT is involved in transcriptional activation of cellular promoters that contain CREB/ATF sites (Sheng,
2000; Love, 2005). In fact, LT was shown to bind CREB. Further, this activation required ability of LT to bind DNA at least non-specifically.
Regulation of transcription by LT is thought to involve interactions with transcriptional coactivators. It interacts through the C-terminal domain with the coactivator proteins such as CBP (CREB binding protein) (Cho et al., 2001) and p300
(Nemethova et al..1999). The interaction with CBP maps to the C-terminal residue P671 on LT. This interaction inhibits the coactivation function of CBP/p300 in CREB (cyclic 32
AMP responsive element binding protein) mediated transactivation (Nemethova et al.,
1999; Cho et al., 2001) of cellular genes.
Based on studies on SV40 LT, it is likely that PyLT may have additional
functions that contribute to driving the cell cycle. Four separate functions that contribute
to the induction of cellular DNA synthesis by SV40 LT have been identified (Wang et al.,
1991; Dickmanns et al., 1994; Hermeking et al., 1994; Quartin et al., 1994; Sompayrac et
al., 1994). These functions can be genetically mapped to the J domain and to binding sites
for pRb, p53 and TEF-1. Complementation experiments with polyoma large T also argue
for multiple functions linked to cell cycle induction (Gjorup et al., 1994).
The ability of LT to delicately modulate the interplay between death and survival
signals in the host cell was demonstrated when LT protected cells from apoptosis induced
by serum starvation in rat embryo cells (Zheng et al., 1994). This highlights the
importance of cellular context as well as the complexity of LT regulation. Interaction of
LT with caspase 8 and FADD protected cells from Fas-induced, taxol-induced and TNF-
α induced apoptosis (Rodier et al., 2000). Interestingly, induction of apoptosis by LT in differentiating myoblasts is dependent upon Rb-binding.In this apoptosis, the J domain function is dispensable (Sheng et al., 2000). Additionally, activation of the cyclin A promoter upon serum withdrawal requires Rb-binding but is mostly J-domain independent. This function is probably connected to LT’s ability to transactivate the E2F responsive cyclin A promoter (Schulze et al., 1995; Sheng et al., 2000).
Mechanisms of cellular DNA damage response and DNA repair: 33
Eukaryotic cells mount a multifaceted response to counteract the potentially deleterious effects of DNA damage. Genomic integrity is necessary for the proper functioning and survival of all organisms. Endogenous and exogenous genotoxic agents, nucleotide misincorporation during DNA replication, and the intrinsic biochemical instability of the
DNA itself pose a constant threat to the integrity of DNA (Lindahl T., 1993). Failure to repair DNA anomalies may result in inhibition of transcription and replication, mutagenesis, and/or cellular cytotoxicity (Friedberg et al., 1995). In humans, DNA damage induces a variety of genetically inherited disorders, in aging (Finkel,T., 2000), and in carcinogenesis (Hoejikmakers, JH., 2001; Peltomaki et al., 2001). Upon sensing
DNA damage or stalls in replication, cell cycle checkpoints are activated to arrest cell cycle progression to allow time for repair before the damage is passed on to daughter cells. In addition to checkpoint activation, the DNA damage response leads to induction of transcriptional programs, enhancement of DNA repair pathways, and when the level of damage is severe, to initiation of apoptosis (Zhou et al., 2000). Careful co-ordination of these processes ensures that the genomic material is faithfully maintained, duplicated, and segregated within the cell.
There are a variety of different repair pathways to deal with different kinds of genetic damage. One of the most basic of the eukaryotic DNA repair pathways involve the direct reversal of the highly mutagenic alkylation lesion O 6-methylguanine (O 6-mG) by the product of the MGMT gene (O 6-methylguanine DNA methyltransferase)
(Margison et al., 2002). Currently, chemotherapeutic agents that attack the O 6 position of guanine have been developed and many of them are in clinical use. Base excision repair
(BER) is a multi-step process that corrects non-bulky damage to bases resulting from 34 oxidation, methylation, deamination, or spontaneous loss of the DNA base itself
(Memisoglu, A. & L. Samson (2000 ). Nucleotide excision repair (NER) corrects a diverse array of bulky DNA lesions including those caused by UV exposure and environmental chemical carcinogens (Friedberg., 2006; Gillet and Scharer., 2006; For review,see Sinha, 2002). The most important of these lesions are pyrimidine dimers
(cyclobutane pyrimidine dimers and 6-4 photoproducts) caused by the UV component of sunlight. Other NER substrates include bulky chemical adducts, DNA intra-strand crosslinks, and some forms of oxidative damage. The DNA mismatch repair (MMR) pathway repairs replication errors such as base-base mismatches and insertion/deletion loops (IDLs) that result from DNA polymerase misincorporation of nucleotides and template slippage, respectively. Mutations in several human MMR genes cause a predisposition to hereditary nonpolyposis colorectal carcinoma (HNPCC), as well as a variety of sporadic tumors that display MSI (Peltomaki et al., 2001). Double-strand breaks (DSBs) are potentially the most severe form of DNA damage because they disrupt transcription, replication, and chromosome segregation. Cells employ two distinct pathways of DSB repair (D’Amours et al., 2002) homologous recombination (HR) and non-homologous end joining (NHEJ). The stage of cell cycle at the time of damage acquisition regulates the kind of repair (Takata et al., 1998). HR-directed repair corrects
DSB defects in an error-free manner using a mechanism that retrieves genetic information from a homologous, undamaged DNA molecule (Chi & Lodish et al.., 2000).
The majority of HR-based repair takes place in late S- and G2-phases of the cell cycle when an undamaged sister chromatid is available for use as repair template. NHEJ does 35 not require a homologous template for DSB repair and usually results in the correction of the break in an error-prone manner (For review, see Weterings, 2008).
LT orchestrates DNA damage as well as DNA damage response signaling:
Polyomavirus LT antigens have been reported to induce chromosomal aberrations
especially dicentric chromosomes as well as aneuploidy in human cells (Ray et al., 1990;
Woods et al., 1994; Stewart et al., 1991; Chang et al., 1997). The SV40 large T antigen is
intrinsically clastogenic (Ray et al., 1990). Diploid Chinese hamster cells replicated their
DNA more than once, without an intervening mitosis, immediately after infection with
SV40 virus (Lehman et al., 1974). Aneuploidogenic and clastogenic properties of T
antigen in lineages containing integrated T antigen sequences showed that generation of
new aberrant chromosomes, and the formation of cells with new chromosome numbers is
an ongoing process throughout neoplastic evolution of these lineages, actually appearing
even before the onset of neoplastic transformation (Ray et al., 1992).
Recent studies have shown that viruses specifically target the DNA damage
response (DDR) (reviewed in Chaurushiya et al., 2009; Lilley et al., 2007). In support,
earlier studies had shown that pretreatment with UV light affects the outcome of the viral
infection (Gentil et al., 1985). DDR comprises two major branches according to the
lesions that are sensed. Double-strand breaks (DSBs) activate the ATM (ataxia-
telangiectasia mutated) kinase, which in turn triggers cell cycle checkpoints to halt the
cell cycle and promote DNA repair. Lesions with single-stranded DNA (ssDNA), for
example arising from replication stress, trigger ATR (ataxia-telangiectasia and Rad3-
related) kinase activation. DNA damage activates cell cycle checkpoints through ATR (-
ATRIP), ATM, and Rad9-Rad1-Hus1/Rad17-Rfc2–5 signaling pathways in mammalian 36 cells. Both ATM and ATR proteins are the members of phosphatidylinositol 3-kinase-like kinase (PIKK) family, whereas Rad9-Rad1-Hus1 and Rad17-Rfc2–5 are counterparts of
PCNA (Proliferating Cell Nuclear Antigen) and RFC (Replication Factor C), respectively
(Burtelow et al., 2001; Caspari et al., 2000; Parrilla-Castellar et al., 2004; Venclovas and
Thelen, 2000). The ATM kinase recognizes DNA DSBs via Mre11/Rad50/Nbs1 complex
(MRN) (Chan et al.,1998; Gately et al., 1998; Lee and Paull, 2004; Lee and Paull, 2005;
Paull and Lee, 2005), whereas ATR kinase participates in cellular responses to a variety of DNA damages like DSB. Activation of these protein kinases leads to phosphorylation and regulation of downstream factors in DNA damage responses, for example, Chk1 and
Chk2 (Abraham, 2001; Lukas & Bartek et al., 2004). Nbs1 plays an essential role in the enactment of the intra-S checkpoint (Shiloh 1997; Carney et al. 1998; Varon et al. 1998).
Nbs1 is phosphorylated by ATM at several serine residues after S-phase ionizing radiation, and these ATM-mediated phosphorylation events are needed for activating the intra-S-phase checkpoint in response to DNA damage (Gatei et al. 2000; Lim et al. 2000;
Wu et al. 2000; Zhao et al. 2000). Nbs1 forms a tight complex with two repair proteins,
Mre11 and Rad50 (Carney et al. 1998). This complex forms nuclear foci at sites of DNA damage and disappears from these sites after damage is repaired, suggesting a role for this complex in sensing DNA damage and/or in its repair (Carney et al. 1998; Nelms et al.
1998). It was found that the MRN complex is recruited to viral replication centers together with LT, and RPA. In fact, SV40 LT antigen interacts with Nbs1 to disrupt cellular DNA replication (Wu et al., 1994). In addition, several reports conclude that both
SV40 and murine polyomavirus utilize the DDR for their own advantage (Dahl et al.,
2005; Hein et al., 2009; Shi et al., 2005; Zhao et al., 2008).The results presented in this 37
thesis will examine other mechanisms by which LT sensitizes cells to extraneous signals
thereby regulating apoptosis induction in the host cell (Chapter 2).
Replication Protein A
A major aspect of this work concerns the interaction of LT with Replication protein A (RPA), a heterotrimeric protein complex composed of three tightly associated subunits of ~70, 32, and 14 kDa (referred as to RPA70, RPA32, and RPA14, respectively). RPA binds ssDNA in a sequential binding manner with a 5’ to 3’ polarity
(Bochkarev and Bochkareva, 2004; Iftode et al., 1999; Wold, 1997). It has six OB
(oligosaccharide/oligonucleotide binding)-folds, each of which consists of five β-strands arranged in a β-barrel, a structure common among ssDNA binding proteins (Bochkarev and Bochkareva, 2004; Gomes et al., 1996). The RPA70 subunit contains four OB-folds denoted DBD-A (DNA binding domain A), DBD-B, DBD-C, and DBD-F, while the
RPA32 subunit contains DBD-D and RPA14 has DBD-E. The major ssDNA binding affinity comes from the tandem DBD-A and DBD-B of RPA70. The binding is initiated by an interaction of DBD-A and DBD-B with a length of 8–10 nucleotides (nt) at the 5’- side of ssDNA (Bochkarev et al., 1997). A more stable intermediate binding of 13–22 nt mode occurs with the additional involvement of DBD-C (Brill and Bastin-Shanower,
1998; Iftode et al., 1999). Finally, the cooperative binding of all four RPA DBDs (A–D) occupies a size of ~30 nt of ssDNA (Bastin-Shanower and Brill, 2001; Blackwell et al.,
1996; Kim et al., 1992). The association constant of the binding ranges from 10 8 to 10 11
M−1 depending on the sequence and length of the substrate (Kim et al., 1994; Kim and
Wold, 1995; Liu et al., 2005b). The DBD-F has a low affinity for ssDNA and participates primarily in interactions with other DNA metabolism proteins. RPA14 is only required 38 for the stable heterotrimer formation (Iftode et al., 1999; Wold, 1997). In addition to the
OB-fold and the C-terminal α-helix domain for many protein interactions (Mer et al.,
2000), RPA32 also contains an unstructured N-terminal phosphorylation domain.
Hyperphosphorylated RPA is relatively more employed in SV40 DNA replication than native RPA (Carty et al., 1994; Iftode et al., 1999; Liu et al., 2000; Patrick et al., 2005;
Wang et al., 1999). Recent identification of the damage-induced phosphorylation sites on
RPA70 suggests a potential involvement of these sites in modulation of RPA functions
(Nuss et al., 2005).
RPA is involved in DNA replication initiation and elongation (Fairman and
Stillman, 1988; Wobbe et al., 1987; Wold and Kelly, 1988). It is known to interact with
SV40 LT in the DNA binding domain (Weisshart, 1998; Jiang, 2006). This been viewed as a way to make sure that single-stranded DNA binding protein is available to cover single-stranded sequences produced by the LT helicase.
There is ample evidence to prove the involvement of RPA in cellular checkpoint activation after DNA damage. RPA bound-ssDNA facilitates assembly of two separate checkpoint apparatuses, 9-1-1/Rad17-Rfc2–5 and ATR-ATRIP complexes, at the sites of
DNA damage (Zou and Elledge, 2003; Zou et al., 2003). Chromatin association and nuclear foci formation of ATR after exposure to genotoxic agents require RPA (Dart et al., 2004; Zou and Elledge, 2003). Moreover, RPA is required for localization of ATR to
DNA damage sites and may be essential for activation of ATR-mediated phosphorylation of Chk1 and Rad17, presumably through the recognition of ATRIP, the interacting partner of ATR, in the RPA-ssDNA complex (Zhou and Elledge, 2003). RPA-coated ssDNA is a structure recognized by the Rad17-Rfc2–5 complex, that promotes the 39
assembly of the 9-1-1 complex to the distorted DNA structures (Zou et al., 2003). Human
RPA interacts with 9-1-1 complex, mediated by its binding to Rad9 (Wu et al., 2005a).
The cellular interaction and nuclear co-localization of these two complexes are
significantly stimulated by DNA damage implying that RPA and 9-1-1 complexes work
cooperatively to activate checkpoint signaling (Wu et al., 2005a). Consistently,
knockdown of the RPA expression by small interfering RNA (siRNA) inhibits the DNA
damage-dependent chromatin association of 9-1-1 (Wu et al., 2005a). These results
suggest that RPA may be an upstream regulator for the activity of the 9-1-1 complex in
the cellular checkpoint network.
RPA is required for all of the four important DNA repair pathways: nucleotide excision repair (NER), base excision repair (BER), DNA mismatch repair (MMR), and
DNA double strand break (DSB) repair (Wold, 1997). In NER, RPA is believed to play a role in DNA damage recognition (Burns et al., 1996; Costa et al., 2003; He et al., 1995;
Sancar et al., 2004; Thoma and Vasquez, 2003) and in recruiting and positioning of XPG and ERCC1-XPF endonucleases to the lesion site for incision (DeLaat et al., 1998;
(Matsunaga et al., 1995). In the final steps of NER, RPA performs gap-filling reaction, along with PCNA, RFC, and DNA polymerase δ or ε (Aboussekhra et al., 1995). RPA was thought to be involved in BER via interaction with human uracil-DNA glycosylase
(UNG2) and its stimulatory effect in long-patch BER (DeMott et al., 1998; Nagelhus et al., 1997). Recent advances discovered RPA’s participation in the MMR process (Ramilo et al., 2002). During homologous recombinational repair of DSBs, RPA interacts with and regulates two members of the RAD52 epistasis group proteins, Rad51 and Rad52
(Park et al., 1996; Raderschall et al., 1999; Stauffer and Chazin, 2004; Sugiyama et al., 40
1998; Van Komen et al., 2002). It was shown that Rad52 recognizes RPA-bound ssDNA,
(Sugiyama and Kowalczykowski, 2002; Sung et al., 2003). In addition, it was reported that human RPA interacts with breast cancer susceptibility proteins, BRCA1 and BRCA2, two recombination mediators, as well as tumor suppressor p53 (Bochkareva et al., 2005;
Choudhary and Li, 2002; Wong et al., 2003).
The goal of this thesis was to understand the molecular mechanisms by which the origin binding domain of the large T antigen of polyoma regulates host cell phenotype. A dual approach was adopted for this study. In one approach, the origin binding domain was genetically analyzed to match its identified functions to its structure. This is described in Chapter 1 of the thesis. In the second approach, the ability of the origin binding domain to regulate cellular responses to DNA damage were investigated. Results from these experiments have been reported in Chapter 2.
41
Materials and Methods
Plasmids
Table 2 lists the plasmids used in the studies presented in this thesis. Both information about the vectors as well as a description of the inserts is included.
E. coli. strains
Two E. coli. strains were used for the work outlined in this thesis. For routine
cloning, plasmid preparation, and site-directed mutagenesis, the XL-1 blue strain
(Stratagene) was used. For preparation of GST-fusion proteins, the BL21+ strain was
used.
Oligonucleotides
Oligonucleotides used for PCR and DNA sequencing experiments were synthesized by the Tufts University Core Facility on Applied Biosystem synthesizers.
This table includes all sequences of oligonucleotides used in the studies outlined in this thesis.
42
Table 2:List Of Oligonucleotides
Primer Direction Oligonucleotide 5'-3' Purpose LT PCR primer, coding, for S294A S294AF CCT AGT GAC TTT CCT GCC AGC CTT ACT GGG point mutation LT PCR primer, non-coding, for S294A S294AR CCC AGT AAG GCT GGC AGG AAA GTC ACT AGG point mutation LT PCR primer, coding, for S306P S306PF GTC TCA TGC TAT TTA TCC TAA TAA AAC GTT CCC point mutation LT PCR primer, non-coding, for S306P point S306PR CGG GAA CGT TTT ATT AGG ATA AAT AGC ATG AGA C mutation LT PCR primer, coding, for K308E K308EF GCT ATT TAT TCT AAT GAA ACG TTC CCG point mutation LT PCR primer, non-coding, for K308ER CGGGAACGTTTCATTAGAATAAATAGC K308E point mutation LT PCR primer, coding, for E335K E335KF GGG AAG TTC AGG CCC AAA TTC AAA TGC C point mutation LT PCR primer, non-coding, for E335K point E335KR GGC ATT TGA ATT TGG GCC TGA ACT TCC C mutation LT PCR primer, coding, for E343A E343AF GCC TGG TCC ATT ATG CGG AGG GGG GC point mutation LT PCR primer, non-coding, for E343A point E343AR GCC CCC CTC CGC ATA ATG GAC CAG GC mutation LT PCR primer, coding, for E343K/E44K double point E343K/E344KF GCC TGG TCC ATT ATA AGA AGG GGG GCA TG mutations LT PCR primer, non-coding, for
E343K/E344K E343K/E344KR CAT GCC CCC CTT CTT ATA ATG GAC CAG GC double point mutations 43
LT PCR primer, coding, for M353L M353LF GCT GTT CTT TCT AAC TCT GAC TAA GCA CAG G point mutation LT PCR primer, non-coding, for M353L point M353LR CCT GTG CTT AGT CAG AGT TAG AAA GAA CAG C mutation LT PCR primer, coding, for V358A V358AF GAC TAA GCA CAG GGC TTC AGC AGT TAA G point mutation LT PCR primer, non-coding, for V358A point V358AR CTT AAC TGC TGA AGC CCT GTG CTT AGT C mutation LT PCR primer, coding, for S366A S366AF GCA GTT AAG AAT TAT TGC GCT AAG CTT TGC AGC G point mutation LT PCR primer, non-coding, for S366A point S366AR CGG TGC AAA GCT TAG CGC AAT AAT TCT TAA CTG C mutation LT PCR primer, coding, for K367E K367EF GTT AAG AAT TAT TGC TCT GAG CTT TGC AGC GTC AGC point mutation LT PCR primer, non-coding, for K367E point K367ER GCT GAC GCT GCA AAG CTC AGA GCA ATA ATT CTT AAC mutation LT PCR primer, coding, for S370A S370AF GCT CTA AGC TTT GCG CCG TCA GCT TCC point mutation LT PCR primer, non-coding, for S370A point S370AR GGA AGC TGA CGG CGC AAA GCT TAG AGC mutation LT PCR primer, coding, for L374K L374KF GCG TCA GCT TCA AAA TGT GTA AGG C point mutation LT PCR primer, non-coding, for L374K point L374KR GCC TTA CAC ATT TTG AAG CTG ACG C mutation LT PCR primer, coding, for K381E K381EF GGC AGT CAC CGA GCC TAT GGA ATG C point mutation K381ER GCA TTC CAT AGG CTC GGT GAC TGC C LT PCR primer, non-coding, for K381E point 44
Mutation
LT PCR primer, coding, for P402R/G403D double point
P402R/G403DF CAGTTAATAACAGAAAATAAGCGAGACCTCCACCAATTCG3’ mutations LT PCR primer, non-coding, for P402R/G403D double point P402R/G403DR CGAATTGGTGGAGGTCTCGCTTATTTTCTGTTATTAACTG mutations LT PCR primer, coding, for H405D H405DF GCC AGG CCT CGA CCA ATT CGA GTT TAC AGA CGA GCC point mutation LT PCR primer, non-coding, for H405D point H405DR GGC TCG TCT GTA AAC TCG AAT TGG TCG AGG CCT GGC mutation LT PCR primer, coding, for Q406K Q406KF GCC AGG CCT CCA CAA ATT CGA GTT TAC AGA CG point mutation LT PCR primer, non-coding, for Q406K point Q406KR CGT CTG TAA ACT CGA ATT TGT GGA GGC CTG GC mutation
LT PCR primer, coding, for E414K E414KF CGA GTT TAC AGA CGA GCC AAA AGA ACA GAA AGC point mutation LT PCR primer, non-coding, for E414K point E414KR GCT TTC TGT TCT TTT GGC TCG TCT GTA AAC TCG mutation LT PCR primer, coding, for D420H D420HF CAG AAA GCA GTA CAC TGG ATT ATG G point mutation LT PCR primer, non-coding, for D420H point D420HR CCA TAA TCC AGT GTA CTG CTT TCT G mutation 45
Table 3: Plasmid List
Vector Insert Description Vendor
Mammalian Expression Vectors pCMV- Neo LT Full length large T (P.Rose) Bam NT large T residues 1-259 (P.Holman) HANLS OBD large T residues 264-420 with N-terminal HA-tag and nuclear localization signal of SV40LT (T.Love) HA-CT large T residues 264-785 with N-terminal HA tag (O.Gjoerup) HA-Chk1 Full-length Chk1 with an N-terminal HA-tag (R.Knox) pGEX RPA1 Human RPA1 with GST-tag (Peter Bullock)
BD pBI-G LT Full-length LT downstream of a tet-responsive promoter, for use in Biosciences Tet-on or Tet-off cells HANLSOBD Origin binding domain downstream of a tet-responsive promoter, for use in Tet-on or Tet-off cells with an N-terminal HA-tag and nuclear localization signal of SV40LT pEGFP RPA1 GFP-fused to N-terminal of RPA1 (M.Wold) GFP-F Farnesylated enhanced green fluorescent protein pUC ORI Polyoma origin of replication and enhancer (bp 5024-163) (B.Bockus)
Reporter Vectors
Gal4TK- luc Luciferase reporter containing 5 copies of the Gal4 binding site upstream of of the TK thymidine kinase promoter
E2F-luc Luciferase reporter with 3E2F sites upstream of the E1B TATA (A.Yee)
CycA-Luc Luciferase reporter with -89/+11 region of the cyclin A promoter pFLORI40 Polyoma ori Luciferase reporter with Polyoma Origin (Jacques Archambault)
46
Cell lines: NIH 3T3 cell lines originally obtained from American Type Culture Collection
(ATCC) were grown in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10% calf serum (CS, Invitrogen). Tet-off regulated mouse embryonic fibroblasts
(MEF) that contain the pBI-G Tet-off vector (Clontech) expressing LT antigen and its mutants and the OBD were obtained by cotransfection of fibroblasts with a vector for puromycin resistance and the relevant pCMV LT construct at a ratio of 1:10. At 2 days posttransfection, the cells were placed in selection medium of DMEM containing 10% calf serum and puromycin at 5 g/ml to select for puromycin-resistant clones. Clones
were amplified and checked for protein expression to obtain specific lines.
Standard Cloning Procedures: New constructs were cloned as outlined in Molecular
Cloning: A Laboratory Manual (Sambrook et al., 1989). DNA fragments were purified either by using the Qiagen PCR Purification Kit or by gel extraction using the Qiaquick
Gel Extraction Kit. Mini-preps were done using the Qiagen Miniprep DNA Purification
Kit. DNA sequencing was carried out either by using the Tufts University Core Facility,
which uses ABI 3100 DNA Sequencers.
Mutagenesis Mutagenesis was carried out using PCR-based strategies based on Pfu polymerase (Promega). The techniques are outlined in PCR Protocols: A Guide to
Methods and Applications (Innis et al., 1990). For mutagenesis using Pfu, the reaction was carried out with a final volume of 50ul. Each reaction used 50-100ng template
DNA, 125ng of each primer, 0.2mM dNTP mix, and 2.5 units Pfu enzyme. The following PCR cycles were used: 1 cycle at 95° C for 30 seconds, 15 cycles at 95° C 30 seconds, 37-45°C 1 minute, 68°C for 2 minutes/kb plasmid. Following PCR, the reaction was digested with 20 units DpnI for 1 hour at 37° C. 4 l of the mixture was then 47
transformed into competent XL-1 blue cells. All mutants were verified by sequencing
(Sanger, F 1977). Mutations have been listed in Table 2.
Transient transfection : Transient transfections using N,N -bis[2-hydroxyethyl]-2-
aminoethanesulfonic acid (BES) buffered saline were done (Chen, C.,1988). NIH 3T3 cells
were split 1 day before the transfection so that they were 30-40% confluent. For a plate of
cells in a 100mm (diameter) dish, a total of 10 g of DNAwas added to a 5ml tube (Falcon
2054) of dH 2O to a volume of 450ul. 500ul of 2XBBS (0.05M Bes (Na salt) pH 6.95,
0.28M NaCl, 0.0015M Na 2HPO 4) was added and the mixture vortexed. 50ul of 2.5M CaCl 2 was added dropwise, mixing between drops. The precipitate formed for 10 minutes at room temperature, with vortexing periodically. This cloudy mixture was added drop-wise to plates containing 10 ml fresh medium. These were incubated in 3% CO 2 and 35°C from
five hours to over night. Plates were then washed with PBS+ two times, resupplied with
fresh medium, and incubated at 37° C, 5% CO 2.
Luciferase Reporter Assays: NIH3T3 cells on 60mm (diameter) plates were transfected with 1-2 ug reporter plasmid and various amounts of CMV-based LT constructs or Gal4- based constructs. In all cases the total amount of DNA was kept constant by balancing with empty vector. For a 60-mm plate, 1 g of the TK-Gal4 luciferase reporter was cotransfected with 1 g of control vector or Large T and its mutants, 500 ng of pCMV β- galactosidase, and 1 g of Gal4-Creb. The calcium phosphate method was used for
transfection, and the precipitate was left on the cells overnight in a 3% CO 2 incubator at
35°C . Medium was changed the next day and cells moved back to a 5% CO 2 incubator at
37°C. 48 hours post transfection; the cells were washed twice with cold PBS+ and scraped with cold PBS+. Cells were harvested by three rounds of freeze-thawing in 48
250mM Tris-HCl (pH 7.5), 1mM EDTA, 150 mM NaCl and 5 l from a 100 l extract
used for luciferase activity determination [Braiser, A 1989]. Cells were pelleted at 12,000
rpm in a microcentrifuge and resuspended in 100 l of CAT-Tris buffer (250mM Tris-
HCl pH 7.5, 1mM EDTA). Cells were frozen in a dry ice-ethanol bath for five minutes, and then thawed at 37° C, for five minutes. This freeze-thaw procedure was repeated two more times. The extracts were then spun at 14,000 rpm in a micro-centrifuge. The supernatant was assayed for activity. 5ul of supernatant was mixed with a substrate assay buffer (20mM Tricine, 1.07mM Mg[CO 3]•Mg[OH 2] •5H 2O, 2.07mM MgSO 4, 0.1mM
EDTA, 33.3mM DTT, 270uM Coenzyme A Li salt, 470uM Luciferin, 530uM ATP) and relative light units were measured using a luminometer (Optocomp I). Luciferase activity was assayed according to published guidelines (Brasier et al., 1989). β-Galactosidase
assays done on the same samples were used to normalize the luciferase values.
SDS Polyacrylamide Gel Electrophoresis
SDS-PAGE (Laemmli, 1970) was utilized routinely throughout the research outlined in this thesis. A 1.5mm x 20cm x 20cm slab gel was used and consisted of a resolving gel and a stacking gel. The resolving gel was prepared using a ratio of acrylamide to bis acrylamide of 30:0.88 in all cases. For a resolving gel with a desired acrylamide percentage of ‘X’, the following recipe was used: X% [w/v] acrylamide,
0.0293(X)% [w/v] methylene-bisacrylamide, 375mM Tris-HCl pH 8.8, 0.1% [w/v]SDS,
0.068% [v/v] TEMED, 0.027% [w/v] ammonium persulfate. A 3% stacking gel was applied to the top of the resolving gel. This consisted of 3% [w/v] acrylamide, 0.088
[w/v] methylene-bisacrylamide, 125mM Tris-HCl pH 6.8, 0.1% [w/v] SDS, 0.173% [v/v] 49
TEMED, and 0.067% [w/v] ammonium persulfate. Prior to loading, cell extracts were
boiled in an equal volume of 2X Dissociation Buffer (62.5mM Tris-HCl pH 6.8, 5%
[w/v] SDS, 25% [v/v] glycerol, 0.0075% [w/v] bromophenol blue; 50ul of concentrated
BME was added to 1ml just prior to use) for 3-5 minutes. The samples were loaded and
electrophoresed at 30-50V for 16 hours.
Western Blotting. Cells were washed with cold PBS, harvested and resuspended in lysis
Buffer (20mM Tris, pH7.5; 150mM Nacl,1mM EGTA, 1mM EDTA,1 % Triton X-100,
2.5mM sodium pyrophosphate, 1mM β-glycerolphosphate, 1mM Na 3VO 4, in the presence of protease inhibitors (1 g/ml leupeptin, pepstatin, and aprotinin) and phosphatase inhibitors I and II (1:100;Sigma) for 30 min. Extracts were boiled in were boiled for 5 min in dissociation buffer (62.5 mM Tris-Cl [pH 6.8], 5% [wt/vol] sodium dodecyl sulfate, 25%
[vol/vol] glycerol, 0.00075% [wt/vol] bromophenol blue, 50 l of β-mercaptoethanol per
ml) and subjected to Sodium dodecyl sulfate-polyacrylamide gel electrophoresis. After
electrophoresis, samples were blotted onto nitrocellulose and analyzed by immunobloting
[Towbin, 1979].Antibodies against p38, phospho p38, JNK, phospho JNK, γH2AX, H2AX,
PARP, BAD, BclXL, Bim were from Cell Signaling Technology. Anti- polyADP polymerase (PAR) was from Trevigen. For polyoma Large T and its mutants, anti-HA11 from Covance to detect HA-tagged OBD, anti-GFP from Sigma, PN116 monoclonal antibody that recognizes the N-terminal domain was used. FIT-C and TRIT-C antibody and secondary antibodies were from Jackson Immunochemicals.
LT Immunoprecipitations. HEK 293T cells were transfected with 4 g of WT or mutant pCMV LT and GFP-tagged RPA70 construct in 100-mm-diameter plates.
Immunoprecipitates were prepared by washing monolayers in phosphate-buffered saline 50
containing 1mM CaCl 2 and 0.5mM MgCl 2 and lysing the cells in T extraction buffer
(137mM NaCl,10mM Tris-Cl {pH7.5},1mM MgCl 2, 10% [vol/vol] glycerol, 1%[vol/vol]
Nonidet P-40) for 30 min, at 4 oC. Cleared extracts were incubated with 5 g of PN116 (to detect LT or its mutants and HA11 (Covance) to detect HA-tagged OBD. antibody and protein G Sepharose beads (Amersham) for 4 h, with rocking, at 4 oC. Extracts were then washed three times in phosphate buffered saline followed by a wash in 0.5M Lithium
Chloride. Immunoprecipitates were boiled for 5 min in dissociation buffer (62.5 mM Tris-
Cl [pH 6.8], 5% [wt/vol] sodium dodecyl sulfate, 25% [vol/vol] glycerol, 0.00075%
[wt/vol] bromophenol blue, 50 l of β-mercaptoethanol per ml) and subjected to
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis. After electrophoresis, samples were blotted onto nitrocellulose and analyzed by immunobloting (Towbin, H 1979).
Antibodies used in blotting include anti-GFP (Sigma) and anti-RPA (Cell Signaling).
Immunofluorescence. Cells were seeded on glass coverslips, washed once with PBS, and fixed with cold methanol (-20 oC) for 20 min at room temperature and washed again three times for 5 min each with TBS (50mM Tris-HCl, pH 7.4, 150mM NaCl). Cells were quenched in fresh 0.1% sodium borohydride in TBS for 5 min, washed three times for 5 min each, and blocked with blocking buffer (10% goat serum, 1% BSA, 0.02% NaN 3, in
TBS) for 1 hr at room temperature. Cells were washed again three times for 5 min each and
mounted on glass slides with Vectashield (Vector Laboratories) that stains the nuclei. Cells
were observed by fluorescence microscopy.
Lentivirus-mediated Bim shRNA stabe knockdown
MISSION shRNA clones from Sigma-Aldrich that are sequence-verified shRNA lentiviral plasmids (pLKO.1-puro) and provided as frozen bacterial glycerol stocks (Luria 51
Broth, carbenicillin at 100 µg/ml and 10% glycerol) in Escherichia coli for propagation
and downstream purification of the shRNA clones were tested for maximum gene
silencing effects. pLKO1-puro that contains the puromycin selection marker for stable
transfection was used. In addition, the plasmids were used to generate lentiviral particles in packaging cell lines .Self-inactivating replication incompetent viral particles were produced in packaging cells (HEK293T) by co-transfection with compatible packaging plasmids. Here, the target sequences for Bim were selected and were synthesized by
Sigma-Aldrich (Cat # NM_009754). The targeting sequence for Bim that achieved maximum knockdown as measured by immunoblot analysis was:
CCGGCCCGGAGATACGGATTGCACACTCGAGTGTGCAATCCGTATCTCCGGG
TTTTT (Sigma Aldrich:TRCN0000009694). Second, Bim shRNA vectors were transfected along with accessory plasmids pVSVG into HEK293T cells. Medium was replaced after 24 hrs and conditioned medium containing viral particles was collected 48 hrs later. Viral particle supernatant was filtered through a 0.45 µm filter. Third, target cells were transduced with these lentiviral particles in the presence of polybrene [10
µg/ml] (Sigma) for 24 hrs. Medium was replaced and cells expressing the insert were selected with 5 µg/ml puromycin. Level of knockdown of Bim protein was confirmed by immunoblot analysis.
GST-Fusion Protein Preparation
GST-fusion proteins were prepared from E.coli BL21+ cells. Typically, an overnight culture of 10ml was grown and subcultured 1:10 into 100ml LB-Amp the next day. After one hour of shaking, IPTG (American Bioanalytical) was added at a final concentration of 0.5mM. This was allowed to grow for another 3-4 hours. The cells were then 52
harvested and spun in a tabletop centrifuge at 3000 rpm for 10 minutes. The pellet was
resuspended in 2ml ice cold 50mM Tris-HCl pH 7.5, 300mM NaCl . Lysis buffers were
supplemented with protease inhibitors (aprotinin at 2ug/ml; leupeptin at 2ug/ml; PMSF at
100ug/ml; pepstatin A at 1ug/ml). At this point, three freeze-thaw rounds in dry-
ice/ethanol and 37 o C warm baths respectively were carried out. The samples were spun
in a tabletop centrifuge for 15 minutes at 3500 rpm. A 50% slurry of 300ul Glutathione
Agarose beads (Sigma) in 1xPBS was incubated with the supernatant for 60 minutes with
constant mixing at 4°C. Beads were washed with 1xPBS four times. At this point
pulldown experiments were done (see below).
GST Pull-down Assays
For pulldown assays, 293T cells were typically transfected with pCMV-LT or various LT mutants. To harvest, cells were washed two times with ice-cold PBS+, spun down at 4°C 1200 rpm (Beckman tabletop centrifuge), and extracted for 20 minutes on ice with TEB buffer (0.137M NaCl, 0.01M Tris-HCl pH 9.0, 0.001M MgCl2, 0.001M
CaCl2, 10% [v/v] glycerol, 0.1% [v/v] NP40) supplemented with protease inhibitors,
(aprotinin at 2ug/ml; leupeptin at 2ug/ml; PMSF at 100ug/ml; pepstatin A at 1ug/ml).
Extracts were then spun at full speed in a microcentrifuge for 10 minutes at 4°C. To monitor input levels, a portion of the supernatant amounting to about 10% of a p100 plate of cells was taken out before proceeding with the pulldown assay. 50ul of the GST-fusion
RPA(on beads) was then incubated with 500-750ul cell extract for 1 hour at 4°C with constant mixing. For a negative control, extract was incubated with GST alone. Beads were then washed 3 times with 10 ml of 1xPBS and 5 ml of Lithium chloride, boiled in
DB for 5 minutes. The samples were loaded and electrophoresed at 30-50V for 16 hours. 53
DNA laddering.
DNA isolation for chromosomal fragmentation was performed as described by Chen et al,
2003.MEF cells were grown in 100mm plates, chilled on ice for 15 min, collected by scraping and centrifugation, washed once with cold PBS, and lysed in 0.4ml of lysis buffer (10mM Tris, pH7.4, 25mM EDTA , PEG 5000 2.5%, 1M NaCl and 0.25%
Triton X-100) on ice for 30 min, This was followed by centrifugation at 13,800 x g for 15 min, and the supernatant was treated with RNase A (200 g/ml) at 37 oC for 1-2h, followed
by incubation with Proteinase K (100 g/ml) at 56 oC overnight. The mixture was then
purified sequentially with phenol-chloroform and chloroform and then precipitated with
0.1 volume of 5M NaCl and 2 volumes of ethanol at -20 oC overnight. After resuspension,
equal amounts of the DNA ( determined by spectrometry at 260/280nm) were loaded on a
2% agarose gel (50 volts for 2 h), stained with ethidium bromide (1 mg/ml), and observed
by UV illuminator.
Inhibitor Treatment .
Mouse embryonic fibroblasts were split 1 day before treatment so that they were 60-70%
confluent into media with doxycycline antibiotic and into antibiotic-free media. Cells were
fed with fresh medium on day 2 and supplemented with TiQA (poly(ADP-ribose)
polymerase-1 (PARP-1) inhibitor , 30 M final concentration) or Caffeine (a known
ATM/ATR inhibitor) (50 M final concentration) for 16-24 h. Cells were then harvested
for Western blotting, Comet assay or immunofluorescence as mentioned previously
following UV irradiation or etoposide treatment. PARP-1 inhibitor-TiQA and Caffeine was
from SantaCruz Biotechnology.
54
Propidium Iodide (PI) Staining
NIH3T3 cells were cotransfected with 3 g pCMV-LT or OBD or LT mutants, 3ug
HAChk1, and 1ug farnesylated GFP and cell cycle status determined after 48h. Cells
were harvested by incubating for 10 minutes at 37°C in 1.5ml PBS-,0.1% EDTA. Using a
Pasteur pipet equipped with a yellow bulb, cells were carefully blown off the plate and
spun in a microfuge at 2600 rpm for 5 minutes at 4°C. The supernatant was aspirated
carefully and the pellet was washed once with 1ml PBS, 1% FCS. The washed pellet was
resuspended in 200ul cold PBS-to permeabilize the cells.To this mixture, 800ul 100%
ethanol was added dropwise while vortexing at a low speed. This was stored at 4°C
overnight. Samples could be stored for weeks at this point.
Permeablized samples were spun in a microfuge at 2600 rpm for 5 minutes at 4°C. The
ethanol solution was carefully aspirated off and the pellet was washed once with 1ml
PBS,1% FCS. PI staining solution was made fresh to contain 50mg/ml PI (dissolved
in 0.038M sodium citrate pH 7.0 and stored at 4°C), 10mM Tris pH 7.5, 5mM
MgCl 2, and 10mg/ml RNase A. PI staining solution was added to the cell pellets (with
pipetting up and down) at a volume of 1-2mls, depending on the density of the mixture.
(It is extremely important to not have an overconcentrated sample, which can cause cell
clumping and clog the FACS apparatus.) Cells were incubated for 30 minutes at 37°C,
vortexing on low every 10 minutes.
FACS Analysis
For FACS analysis, the PI/cell mixture was transferred to 5ml tubes (Falcon
2054). At this point it is important to keep the samples wrapped in foil since PI is light sensitive. For optimal results, samples should be analyzed within 24 hours; however, 55
they can be stored for weeks at 4° and still give a viable FACS reading.
The cytometer used in these experiments is a FACSCalibur which operates using
CellQuest software. A dot plot was created to have forward scatter (FSC) and side scatter
(SSC) on each of the axes. FSC measures cell size and SSC measures cell density. Cell
debris and non-cell particles are filtered out by gating appropriately on this plot. Next, a
histogram plot was created to read the FL1 channel, which scores GFP. To assay PI
staining, the FL3 channel was used. There are different types of FL3 channels which
measure different aspects of the peak, such as area (FL3-A), width (FL3-W), and height
(FL3-H). FL3-A was plotted against FL-3 W to gate out cells which were aggregated.
Therefore, the final histogram showing the PI channel was gated on the non-aggregated
cells. In addition, this channel was also gated on the GFP-positive cells from the FL1
histogram. This set-up allowed for analysis of only the transfected cells and for PI stained
cells. Typically about 50,000 total events were acquired with 2000-3000 events
being the relevant gated events. These results were analyzed using Modfit 3.0 software,
which quantitated the peaks and used various algorithms to calculate the percentage of
cells in G 0/G 1, S, and G 2/M phases.
Comet Assay
DNA damage in mouse embryonic fibroblast lines were determined under alkaline conditions using the CometAssay kit from Trevigen(Gaithersburg,
MD). Briefly, the cells were trypsinized, washed in ice-cold PBS, combined with molten agarose, and pipetted onto a comet slide. After solidification at 4 oC for 20 min, the slides were immersed in lysis solution. For alkaline single cell electrophoresis (detects single 56
and double strand DNA breaks, DNA cross-links, and base damage ), the slides were
placed in alkaline buffer and electrophoresed at 20 volts for 20 min at 4 oC. Slides were
then washed 2 times consecutively for 10 min each with dH 20 followed by 70% ethanol for 5 min. Air-dried slides were then stained with SYBR green I and analyzed using a fluorescence microscope. Cells with damaged DNA display streaming of DNA fragments from nucleus in the form of a comet tail, whereas undamaged DNA appears in the form of a nucleus). Comet images were analyzed using CASP software (Comet Assay Software
Project 1.2.2). At least a100 comets were analyzed for each sample. Comet assays were performed three times, each time in duplicate.
Flow cytometry based determination of the formation of CPD and 64PP-UV
photo lesions.
Stable MEF cells expressing LT or OBD under inducible conditions for 48h after splitting were allowed to grow to 95% confluence till the day of harvest prior to UV treatment. Cell monolayers were washed twice with 2ml PBS and irradiated with 40J/m 2
UV using a UV Stratalinker 2400(Stratagene). At various times post-UV, cells were washed with PBS plus 50mM EDTA, trypsinized, resuspended in 1ml of PBS plus 50mM
EDTA, and fixed by the addition of 3ml of ice-cold 100% ethanol added dropwise.1X10 6 fixed cells were then washed with PBS plus 50mM EDTA, resuspended in either 0.5%
Triton X-100 plus 0.1N HCl (for 6-4 photoproduct (6-4PP) detection) or 0.5% Triton-X
100 plus 2N HCl (for CPD detection), and incubated for 20 min at 22 oC. Cells were washed
with 0.1M Na 2B4O7 (pH 9.0) and then with PBS and resuspended in 300 l of RNase
(100 g/ml in PBS) for 1h at 37 oC followed by washing with PBS-TB (1% bovine serum albumin plus 0.25% Tween 20 in PBS). Cells were resuspended in PBS-TB containing a 57 primary monoclonal antibody against either CPD or 6-4PP (1:500 dilution) (Kamiya
Biomedical Company) for 1 h at room temperature. Pellets were washed twice with PBS-
TB and resuspended in 300 l of flourescein isothiocyanate-conjugated rabbit anti-mouse secondary antibody for 45 min at room temperature. Pellets were washed twice with PBS-
TB. Samples were then subjected to flow cytometry and analyzed by WinList 3D.
58
Chapter 1: Functional Characterization of Different Regions of the Origin Binding
Domain of Polyoma Large T
Introduction
As discussed in the Introduction, PyLT is a multifunctional protein broadly involved in manipulation of DNA and in regulation of host cell phenotype. It is composed of multiple domains. Ample evidence exists that these domains can exhibit individual functions. For example, NT can immortalize cells (Holman, 1994) and the J domain can activate the ATPase activity of hsc70 (Riley et al., 1997). This Chapter reports functional and genetic analysis of the polyoma origin binding domain (OBD).
The polyoma DNA binding function has been mapped to the C-terminus covering residues 282-398 (Sunstrom et al., 1991). This sequence is similar to the SV40 OBD
(residues 131-259), which has been well characterized. However, a carboxy- terminal
DNA fragment that extends through residue 421 had the highest specific activity, indicating that the construct to 398 that has lower specific activity may not be completely stable. For my studies in mammalian cells we therefore have used a construct extending to 421. It seems likely that this includes some “extra” residues at the end. Recent work suggests that a construct expressing residues 290 through 405 is sufficient to bind DNA with high affinity (Harrison et al., unpub.) To be sure that regulatory sequences, including the cyclin/cdk site at T278 and earlier phosphorylation sites at 267,271, and
274 were included, we used a construct starting at 264. These regulatory sequences are of course N-terminal to the core DNA binding domain. In addition, when 264-421 was expressed it was unexpectedly found to be cytoplasmic. For some reason NLS2 alone is 59
not active in this context. Therefore, both PyNLS2 and SV40 NLS and an HA-tag were
added at the N-terminus (Love et al., 2005).
As discussed in the Introduction, we know a good deal about the SV40 OBD.
Many of the detailed interactions with DNA have been mapped both structurally (Luo et al., 1996; Bradshaw et al., 2004; Reese et al., 2006; Meinke et al., 2006; Meinke et al.,
2011; Meinke, 2007) and genetically (Simmons et al., 1990; Simmons et al.,1993; Wun- kim et al., 1993, Johnston et al., 1996 , Margolskee et al. 1984, Dickmanns et al., 1994;
Berger et al., 1996; Hsu et al., 1996, Weisshart et al., 1998; Jiang et al., 2006). In addition to binding double-stranded DNA both non-specifically and at GAGGC sequences, it interacts with single-stranded DNA. It interacts with the single-stranded
DNA-binding protein RPA (Weisshart et al., 1998; Jiang et al., 2006) and NBS-1 (Wu, et al., 2004). Besides its role in viral DNA replication there is a site that can function to drive cell cycle (Dickmanns et al., 1994) as well as sites involved in regulation of transcription through transcription factors such as TEF-1 (Gruda et al., 1993) or basal elements such as TBP (Johnston et al., 1996, Berger et al., 1996; Hsu et al., 1996).
Much less is known about the polyoma OBD. Genetic analysis shows that it is required for viral DNA replication. Unsurprisingly, it is involved in both GAGGC mediated and non-specific interactions with double-stranded DNA (Love et al., 2005).
Clearly it has a role in transactivation at CREB/ATF sites as shown in reporter assays
(Love et al., 2005). This transactivation includes the ability to bind CREB. Large T has also been reported to bind jun and fos (Guo et al., 1996), although whether this is through the DNA binding domain is unclear. As shown here, the OBD interacts with RPA and that interaction is critical for sensitizing cells to DNA damage. 60
My initial goal here was to examine the role of OBD in transcriptional activation.
This included a mutant analysis to look for residues required for transcriptional activation.
These studies were an extension of beginning work done previously in the lab. A second
approach was microarray mRNA analysis of cells that expressed OBD conditionally. As
my work progressed, and DNA damage became my major focus, assays for RPA binding
were developed, and additional mutants were made to try to identify RPA interaction
sites. In collaboration with Jacques Archambalt’s group, we developed a simple assay
for polyoma virus DNA replication. All of this put us in a good position to get an overall
picture of the OBD. Additional mutants were made to try to cover the surface of the
OBD based on a structure homology model with SV40. The total genetic analysis
involved efforts of many people (Tara Love, Jennifer Choe, Lakshmi Dommeti) as well
as my own. The tables indicate the source of different mutants. All of the representative
experiments shown in this Chapter are my own, but the data in the final summary are a
composite of all our work.
Results
Construction of Mutants
Mutagenesis studies were originally designed to identify specific regions in polyoma OBD that were defective for transactivation of CREB-responsive promoters.
Point mutants were generally made by site-directed oligonucleotide based mutagenesis representing a change or lack of charge. Mutations were made based on several criteria.
First, past studies had identified specific residues in SV40 OBD that were important for transcriptional activation. We mutated these regions for genetic analysis. Second, we found that SV40 OBD could transactivate CREB-responsive promoters similar to 61 polyoma OBD as seen in luciferase reporter assays that tested for CREB synergy (Fig 8).
Based on this, additional mutants were constructed for residues in regions that are conserved between SV40OBD and PyOBD. For instance, PG402, 403RD that was chosen on this basis, was in a region (PG249/250) previously suggested to possibly be involved in SV40 LT transactivation. Third, some mutations like S306P for example, were originally identified in a random, non-selective mutagenesis screening carried by
Qing Sheng (PhD. Thesis) that identified mutations that rendered large T defective for
DNA binding. We included these mutants in our genetic analysis. Finally, mutants such as those at residues 302 and 384 as well as others were made to complete coverage of the
OBD surface as modeled from the SV40 X-ray diffraction structure. Figure 9 shows the protein sequence of polyoma OBD (264-420) with the residues that were mutated marked in red as well as two 180 o views of the modeled OBD with all mutants in red.
62
180 160 140 120 100 80 60 40 FoldActivation 20 0 Gal4CREB - + + + + PyLT - - + - - SV40LT - - - + - OBD - - - - + TKGal4Luc
Fig 8: Both Polyoma Large T and SV40 LT synergized with CREB family members to stimulate transcription : Cells were cotransfected with 1.0 g of Gal4TK-Luc reporter and 1.0 g Gal4 DNAbinding domain (Control), Gal4- CREB and 1.0 g pCMV PyLT or HANLSOBD or SV40LT were also transfected as indicated. Cells were harvested 48 hours post transfection and assayed for luciferase activity. Fold activation above control levels is represented. Error bars represent S.E.M. n=6. 63
Because the 264-421 construct was shown to have independent function, my initial mutagenesis was done in that background. An unexpectedly large number of mutations in the origin binding domain compromised the stability of the structure, disrupting protein expression. This sort of behavior has been seen before in the analysis of the DnaJ domain (Whalen et al., 2005). There, the same mutation that was destabilizing in the LT background was not destabilizing in the MT background and vice versa. Here, the mutant, K381E, which retained protein stability in the full-length LT background, was destabilized in the origin binding domain background. Interestingly, K381E was more stable in the CT background than in the 1-420 background (Fig 10). This result suggests that OBD may contact the rest of CT. Other residues that also showed this destabilizing effect in the OBD background have been listed in Table 4.Owing to these effects; we subsequently constructed the desired mutants in the full-length LT background. 64
264 ESYSQSCSQSSFNATPP K KAREDP APSDF P S S LTG YL S 301 K 2 8 1 N S 2 9 4 A
L 29 6P
3 0 2 H AI YS N K TF P AF LV YS T KE K CKQLYD T IG KF R P E FK C L VH Y E E GGM LFF LT M TK H R V S A 3 6 0 Y 305D KE E3 19RM D327A E 335K E 343K/E 344K M 353L S 3 0 6 P E 3 2 0 M D T 3 2 7 A A HY341 NA E 343A H356Q /L/N
N 3 0 7 S E3 2 0 A K F3 3 1 E S V 3 5 8 A
K 3 0 8 E K 3 2 1 E
3 61 V KN YC S K LS R -S F LM CKA VT K PM ECYQVVTAAPFQL IT ENK P G -LH Q FE FT-D P EEEQKA 418 S3 6 6 A L3 7 4 K K 3 8 1 E P4 0 2 R / E4 1 4 K
K 3 6 7 E G 4 0 3 D
S3 6 9 A H 4 0 5 D
Q40 6 K
41 9 V D D 4 2 0 H 65
Fig 9: Polyoma sequences in the origin binding domain (264-420 a.a.): A: Residues in red were mutated in the Py large T and OBD background. Point mutations were made by site-directed mutagenesis representing a change/lack of charge. Mutants used in this study are listed below the OBD sequence in red. B. Two 180 o views of polyoma sequences modeled on the SV40 OBD structure with the position of mutants highlighted in red. 66
Mutants Expression in OBD background Expression in LT background SD291GA No No S294A No WT/2 Y305D No No K308E No Yes E335K Yes Yes E343A Yes Yes E343K/E344K Yes Yes S366A Yes Yes M353L Yes Yes K367E Yes Yes S369A No WT/2 L374K No Yes E377K No No K381E No Yes P402R/G403D No Yes H405D Yes Yes E414K Yes Yes
Table 4: Summary of mutants that were destabilized in the OBD background or in the LT background. 67
K381E(OBD) K381E (LT) WTLT WT OBD WT HA (GSK3) PN116 (LT)
PN116 (1-420) HA (OBD) 1-420 (WT) WT HACT K381 (HACT) K381E (1-420)
PN116 (1-420) HA (CT)
PN116 (NT) HA (GSK3)
Fig 10: K381E is destabilized in the OBD backgr ound: NIH 3T3 cells were cotransfected with 1 g pCMV HA-NLSOBD or K381E(OBD) and 1 g HAGSK3 (Control); or 1 g of pCMV HACT or K381E(CT) and 1 g HAGSK3(Control); Or 1 g pCMV LT or K381E(LT)and 1 g 1-420 (Control); or 1 g pCMV 1-420 or K381E(1-420) and 1 g NT (Control). 48 hours post transfection, cells were harvested, extracts were blotted with HA antibody that recognizes HA-tagged OBD or HA-tagged CT (C-terminal of LT) or PN116 that recognizes full-length LT or 1-420 or the NT (N -terminal of LT) construct of LT via binding to the J domain. 68
The DNA binding function of OBD is required for DNA replication
At the start, we attempted to characterize the replication competency of all the mutants.
Before going any further, a few relevant aspects of the viral DNA replication need to be reviewed. Replication of the polyoma genome is inititated by the binding of LT to the viral origin (Francke et al., 1973). Subsequently, assembling as a set of two hexamers, LT facilitates the melting of DNA (Borowiec et al., 1990). Concurrent studies in SV40 reveal that in the presence of the single stranded DNA binding protein, RPA, SV40 LT unwinds origin containing DNA ( See reviews, Bullock, 1997; Fanning et al., 1992; Simmons et al., 1986; Simmons et al., 1990). Py LT, unlike SV40 LT, (Weisshart et al., 1996), in growing cells, does not require its N-terminus for viral DNA replication (Gjørup et al.,
1994).
Binding to origin DNA is, therefore, the first key event in the process of viral
DNA replication. The origin of replication is made up of a core region as well as auxiliary enhancer elements, as shown in the Introduction in Figure 7.The alpha core subdomain within the enhancer is the most important enhancer domain (Mueller et al.,
1988; Tang et al., 1987) with transcriptional functions. Recognition of GAGGC consensus sequences in the viral “core” origin of DNA replication occurs via OBD of large T. OBD simultaneously contacts double-stranded DNA (dsDNA) and ssDNA in a non–sequence-specific manner (See {review, Bullock, 1997}).
Extensive mutagenesis of SV40 OBD has identified several important functional elements (Simmons et al., 1990; Simmons et al., 1990; Simmons et al., 1993; Wun-Kim et al., 1993) essential for initiation of replication. Elements A1 and B2 (residues 147-159,
203-207 respectively), are necessary for sequence-specific binding to the GAGGC 69 pentanucleotide in the SV40 origin (Simmons et al., 1990; Bradshaw et al., 2004). These two elements are positioned as two loops, which define a continuous surface, contacting origin DNA (Fig 6). Element B3 (residues 213-220) binds to site II in the core origin
(Fig 7), but not site I, in the origin; it functions in unwinding but not site-specific DNA binding (Simmons et al., 1990). All of these regions (A1, B2, and B3) are conserved between polyoma and SV40. Furthermore, elements B1 and B4 (residues 183-187 and
226-227 respectively), as well as residues in elements A1 and B2 (Ala-149, Phe-159, and
His-203), are involved in binding to DNA nonspecifically (Simmons et al., 1990;
Simmons et al., 1990; Simmons et al., 1993; Wun-Kim et al., 1993).
LT functions as a helicase during viral DNA replication (Stahl et al., 1986;
Weikowski et al., 1988). By associating with single-stranded DNA during unwinding, LT forms a double hexamer. Each strand of DNA passes through the central channel of one hexamer and wraps around the other hexamer (Falaschi et al., 2000; Sengupta et al.,
1992; Sengupta et al., 1994; Smelkova et al., 1998).With ATP hydrolysis, the closed- structure of the double hexamer changes to an open form (. After one strand of DNA is displaced and bound by RPA, LT switches back to a closed form to function as a helicase, with each hexamer encircling one strand of DNA. In SV40, residues between 301 and
500 in the carboxy terminal of large T were originally identified to be important for single stranded DNA binding activity (Wu et al., 2000). The SV40 OBD is primarily monomeric in solution and does not assemble into hexamers. The crystal structure of
SV40 OBD showed that this domain forms a left-handed spiral in the crystal with six monomers per turn (Meinke et al., 2006). A single turn of the helical filament termed as the open-ring or lock-washer structure may be biologically relevant (Meinke et al., 2007). 70
Additionally, it would be expected to form after recognition of GAGGC sequences in the central origin of replication by the OBD (Meinke et al., 2007).
Past analysis of replication of an origin-containing plasmid (ori-plasmid) by LT in transiently transfected cells have been performed using Southern blotting or PCR (Del
Vecchio et al., 1992; Taylor and Morgan, 2003; Lu et al., 1993; Le Moal et al., 1994).
Plasmid replication used to be detected from either total or low molecular weight DNA
(Hirt-extracted DNA) that had been Dpn1 digested to remove transfected, unreplicated ori-plasmid DNA that had bacterial methylation patterns. In contrast to this complex detection method, in this study, we used a new fast, quantitative assay that is ideal for screening a large number of mutations due to high throughput dual luciferase readout to measure the amount of replicated origin DNA directly from transiently transfected cells
(Fradet-Turcotte et al., 2010). This assay was designed based on a previous study that LT could increase the copy number of plasmids expressing firefly luciferase present in cis of the SV40 origin (De chasseval and de Villartay, 1992). The increase in copy number could increase the luciferase readout. With help from Jacques Archambault, we adapted this assay by placing a polyoma origin sequence 3’ to CMV luc. Fig 11B (Top Panel
Left) shows that replication competent LT increases luciferase expression at least 50-60 fold. A particular issue with polyoma is that the transcriptional enhancer sequences are quite important for replication (deVilliers, 1984). Studies done previously have shown that all middle T-/small T-deficient hr-t naturally occurring mutants have evolved to contain alpha-core subdomain enhancer duplications that encompass the binding sites for transcriptional activators PEA1/AP1 and PEA3/c-ets, partially restoring their replication defect (Amalfitano et al., 1992 ). In addition, it was also shown that the replication of a 71 plasmid that contains the minimal polyomavirus origin is stimulated by overexpression of the c-jun and c-fos proto-oncogenes when the origin is downstream of AP1 sites
(Murakami et al., 1991). These studies demonstrated a substantial correlation between polyoma-virus enhancer sequences required for transcription and those required for DNA replication (Muller et al., 1988; Tang et al., 1987; Tyndall et al., 1981; Veldman et al.,
1985; De Villiers et al., 1984).
To study whether any contribution of transcriptional activation from this enhancer domain in the pFLORI40 plasmid by LT might skew quantification of the newly replicated ori-plasmid firefly luciferase readout, a mutant of the pFLORI40 origin- containing plasmid (Fradet-Turcotte et al., 2010) that contained mutated LT binding site in the “core” tetramer of GAGGCs was generated. This plasmid will not replicate, but if
LT uses its downstream sites to transactivate, it will still be susceptible to activation of transcription. In control assays, this mutant-ori Fluc reporter construct was only activated by ~2 fold when replication competent LT was expressed (Fig 11B, Top Panel Right).
Therefore, as previously shown for SV40 (Fradet-Turcotte et al., 2010), this is a valid assay for polyoma DNA replication.
We used this plasmid system to measure DNA replication competency of our collection of mutants. In this assay, the luciferase activity is expected to be proportional to the copy number of the plasmid containing the polyoma origin. We identified regions in the origin binding domain required for replication. For instance, sites P402/G403 and
E343/E344 in large T were not required for replication. In contrast, mutants S306P and
S306P/V358A mutations that are important for DNA binding functions (Sheng et al.,
2000; Love et al., 2005) were replication negative. A representative experiment has been 72 shown in Fig 11B (Bottom Panel).A comprehensive summary of replication assay results have been presented in Table 5.The top Panel in Table 5 summarizes the replication data of mutants generated in this study. The bottom panel summarizes the same for the mutants made outside of my study. 73
Po lyo ma Ori
Fig 11A: Schematic representation of the pFLORI40 plasmid used in the replication assay (Modified from Fradet-Turcotte et al., 2010): The location of the polyoma origin of replication is represented by a black box with the position of the core (grey) and 21 bp-repeat regions (black) enlarged above. The nucleotide (nt) sequence boundaries of the origin are indicated. The location of the CMV promoter is indicated by grey box. The coding regions of firefly luciferase as well as those of LT are indicated by white box. Amino acid boundaries of each protein are indicated below each box. 74
1200
1000
800
600
Luc Values 400
200
0
WT FLucORI40 Mut FLucORI40 WTLT
120
100
80
60 FoldActivation 40
20
0 WTLT E343K/ E320A K308E S306P/ K381E P402R/ E344K V358A G403D WT FLORI40 75
Fig11B:K308E and S306P/V358A are defective for replication while E320A, K381E, P402R/G403D and E343K/E344K are replication positive : Top Panel: Cells were cotransfected with 50ng of WT pFLORI40 or mutant pFLORI40, and 111ng, 37ng and 12.5ng of pCMV LT in decreasing concentrations as indicated. After 48 h, cells were processed as mentioned before and luciferase activity was measured. pCMV β -Gal (500ng) was used as an internal control for transfection efficiency. Normalization was performed by calculating the ratio of firefly luciferase over β –Gal values. Fold activation above control levels is represented. Error bars represent S.E.M. n=6. Bottom Panel: Cells were cotransfected with 111ng of WT pFLORI40 reporter, and 1 g of the mutants as indicated. After 48 h, cells were processed as mentioned before and luciferase activity was measured. β -Gal (500ng) was used as internal control for transfection efficiency. Normalization was done as mentioned previously. Fold activation above control levels is represented. Error bars represent S.E.M. n=6.
76
Mutation Source Expression Replication (Mutant/WT) S294A PB WT/2 0.78 L296P* TML WT 0.04 Y305D PB WT 1.16 S306P TML WT 0.01 N307S* CR WT 0.08 K308E PB WT 0.02 E320M* TML WT 1.61 E320A TML WT 1.68 K321E* CR WT 0.024 D327A* TML WT 2.27 DT327AA* TML WT/5 1.16 K331E* CR WT 1.4 E335K PB WT 0.41 HY341NA* TML WT/6 1.9 Y342A* TML WT 0.645 E343A PB WT 2.19 EE343,344KK PB WT 2.02 M353L PB WT 1.67 H356Q* TML WT 0.05 V358A QS WT 1.08 S306P/V358A QS WT 0.014 S366A PB WT 1.19 K367E PB WT 0.87 S369A PB WT/2 2.88 L374K PB WT 1.35 K381E PB WT 2.22 H405D PB WT/6 0.92 Q406K PB WT 2.9 E414K PB WT 1.57 D420H PB WT 1.53
Table 5 : Summary of all mutants in this study listing source of mutant construct: PB (Pubali Banerjee), TML (Tara Love), CR (Cecile Rouleau), QS (Qing Sheng). The asterisk sign * denotes those mutants that were done by others.The results from dual luciferase reporter assays that tested for replication activity and protein expression using western blots with anti-T antibody (PN116) identified mutants like K308E, S306P and S306P/V358A as replication incompetent while K381E, E320A, P402R/G403D, E343K/E344K were found to be replication competent. 77
Large T and OBD binds Replication protein A
Replication protein A interacts with SV40 large T antigen (Mellendy and Stillman., 1993;
Collins et al., 1993; Weisshart et al., 1998; Jiang et al., 2006) and has been reported to play a role in the initiation of DNA replication (Collins et al., 1991;Dornreiter er al.,
1992;Kenny et al., 1989;Kenny et al., 1990; Melendy and Stillman., 1993) possibly by stimulating RPA-dependent unwinding of origin DNA by T antigen (He et al., 1993).
Mindful of these reports, we next examined the ability of polyoma large T and the mutants to bind RPA70.
Two different sorts of binding experiments were used. Figure 12A shows GST- pull down assays performed for detection of interactions between GST-tagged RPA70 and LT/OBD and mutants K308E, S306P/V358A, P402R/G403D and S306P. In the pull- down assay, cells were transfected with pCMV-LT/OBD or mutants. 48h post- transfection, extracts were incubated with either GST or GST-RPA70 linked to glutathione agarose beads. The beads were subsequently washed and run for SDS PAGE.
Wild type large T, OBD or mutant protein were detected by blotting and staining with LT specific or OBD specific antibody. Both LT and OBD bound to GST-RPA70. Among the
LT mutants tested in the pull-down assay, K308E was the only one which failed to interact with GST-RPA70. The K308 residue in polyoma OBD aligns with Arginine 154 of SV40 OBD which is known to be important for RPA binding (Jiang et al., 2006).
Furthermore, immunoprecipitation experiments were performed in which GFP-tagged
RPA70 was first cotransfected with either LT or OBD or its mutants, immunoprecipitated with anti-T serum and then tested for binding with RPA using anti-GFP antibodies in western blots following SDS PAGE. Mutation, E320A abrograted the ability of LT to 78 bind RPA (Fig 12B). Mutations such as K308E, K321E and K381E, strikingly, rendered large T defective in binding RPA (Table 6). As alluded to previously, both E320A and
K381E mutations were identified to be replication positive in our experiments. A complete summary of the RPA binding results are presented in Table 6. 79
1.5% INPUT PULL DOWN GST+LT GST-RPA+LT GST+OBD GST-RPA+OBD GST+K308E GST-RPA+K308E GST+S306P GST-RPA+S306P GST+S306P/V358A GST-RPA+S306P/V358A GST+PGRD GST-RPA+PGRD GST+LT GST-RPA+LT GST+OBD GST-RPA+OBD GST+K308E GST-RPA+K308E GST+S306P GST-RPA+S306P GST+S306P/V358A GST-RPA+S306P/V358A GST+PGR D GST-RPA+PGRD
LT
OBD
Fig 12A: GST -Pull down assay for binding of LT/OBD to RPA :HEK 293T cells were transfected with 4 g pCMV-LT/OBD and mutants.48h post-transfection, extracts were incubated with either GST or GST-RPA1 linked to glutathione agarose. The beads were washed and loaded onto a 12.5%. SDS polyacrylamide gel. Input represents 1.5% the total used for pulldown. Wild type Large T or mutant protein were detected by blotting and staining with LT specific antibody. OBD was detected by blotting and staining with HA specific antibody. 80
WCL (1.5% INPUT) IP LT LT E320A K367E S294A Q406K S369A E335K E343A GFP-RPA E320A K367E S294A Q406K S369A E335K E343A GFP-RPA
LT
GFP
WCL (1.5% INPUT) IP GFP-RPA LT GFP-RPA Y305D M353L S366A L374K H405D E414K LT Y305D M353L S366A L374K H405D E414K
GFP
LT 81
Fig 1 2B : Immunoprecipitation assay to show LT bind s RPA. A: HEK 293T cells were cotransfected with 4 g of GFP-RPA and 4 g of LT or the mutants as indicated. 48h post-transfection, cells were harvested and extracts were immunoprecipitated using anti-T antibody. Binding of mutants to GFP-RPA was detected using western blots using anti-GFP antibody to blot for RPA. B:All these mutants bound RPA. Coimmuno-precipitation experiments was done in HEK293T cells exactly as in A. 82
Mutation Source Expression RPA Binding
S294A PB WT/2 Yes
L296P* TML WT Yes
Y305D PB WT Yes
S306P TML WT Yes
N307S* CR WT Yes
K308E PB WT No
E320M* TML WT No
E320A TML WT No
K321E CR WT No
D327A* TML WT Yes
DT327AA* TML WT/5 Yes
K331E CR WT No
E335K PB WT Yes
HY341NA* TML WT/5 Yes
Y342A* TML WT Yes
E343A PB WT Yes
EE343,344KK PB WT Yes
M353L PB WT Yes
H356Q* TML WT Yes
V358A* QS WT Yes
S306P/V358A QS WT Yes
S366A PB WT Yes
K367E PB WT Yes
S369A PB WT/2 Yes
L374K PB WT Yes
K381E PB WT No
H405D PB WT/5 Yes
Q406K PB WT Yes
E414K PB WT Yes
D420H PB WT Yes 83
Table 6: Summary of results from RPA binding assays. This table summarizes results from the immunoprecipitation assays that test for GFP_tagged RPA binding to LT or the mutant constructs . The asterisk sign * denotes mutants that were tested by others. 84
Identification of regions in OBD that regulate Rb-independent CREB transcription
In the next portion of this chapter, I will present the results of our examination of transcriptional activation. As discussed in the Introduction, LT has two different mechanisms for activation. The first causes activation at E2F sites and requires the association of LT with Rb family members. Data generated by Tara Love (2005) suggested that there could be a C-terminal contribution, probably from oligomerization.
The second mechanism seems to be more direct, acting at ATF/CREB sites. It involves
OBD and its ability to interact with DNA and also with CREB. It operates in an Rb- independent manner.
We took two general approaches. The first involved reporter assays. We used both Gal4-CREB and TK-Gal4 luciferase reporter, in addition to a -37/-33 cyclin A luciferase reporter. The Gal4TK luciferase reporter plasmid has five Gal4-binding sites upstream of the thymidine kinase promoter. The Gal4 CREB construct has CREB fused to a Gal4 DNA binding domain that allows transcriptional activation when it binds to
Gal4 binding sites in the Gal4-TK luciferase promoter. The wild type cyclin A promoter has a key regulatory E2F site that acts as a site of repression (Schulze et al., 1995). LT can disrupt this E2F repressor activity (Sheng et al., 2000). The Cyclin A promoter also has an ATF/CREB site that allows LT to transactivate independent of Rb-binding (Love et al., 2005). It was shown that E2F regulation could be abrogated by mutation at -37/-33
(Schulze et al., 1995). In the -37/-33 mutant, the E2F site is lost, so the ATF/CREB site can be tested directly. Because CT contributes to the strength of E2F activation, we also tested our mutants using E2F promoters. 85
Results from luciferase reporter assays led us to identify three separate regions inside the origin binding domain that were required for CREB synergy. P402R/G403D,
E343K/E344K and K381E were all found to be defective in CREB transactivation, while being well expressed. Results from these assays are shown in Fig 13 and Table 7 is a summary of all CREB synergy data. The top panel lists the results for mutants generated in this study and the bottom shows the same for mutants made by others outside of my work. When tested for their ability to transactivate E2F sites (Fig 14), none of the
CREB-defective mutants were able to substantially activate E2F sites. Neither
P402R/G403D nor E343K/E344K, for instance, could substantially transactivate. Table 8 lists the results of mutant E2F cyclin A promoter activation assays for all the mutants tested. . When the CREB defective mutants were tested for their ability to activate the mutant E2F cyclin A promoter, neither P402R/G403D nor E343K/E344K, for instance, could substantially transacrivate. This confirmed our previous results for CREB synergy,
Table 8 lists the results of mutant E2F cyclin A promoter activation assays for all the mutants tested.
86
300
250
200
150
Luc Values 100
50
0 WTLT P402R/ E343K/ K381E G403D E344K TKGal4Luc
Gal4CREB
Fig 13: Mutants P402R/G403D, E343K/E344K and K381E were defective in CREB synergy : Cells were cotransfected with 1.0 g of Gal4TK-Luc reporter and 1.0 g Gal4 DNAbinding domain (Control), Gal4-CREB and 1.0 g pCMV LT or the mutants as shown. β-Gal (500ng) was used as internal control. Cells were harvested 48 hours post transfection and assayed for luciferase activity. Fold activation above control levels is represented. Error bars represent S.E.M. n=6. 87
Mutation Source Expression Creb Synergy
S294A PB WT/2 0.25
L296P* TML WT 0.075
Y305D PB WT 1.1
S306P TML WT 0.21
N307S* CR WT 0.23
K308E PB WT 0.41
E320M* TML WT 1.28
E320A TML WT 1.34
K321E CR WT 0.87
D327A* TML WT 0.66
DT327AA* TML WT/5 1.45
K331E CR WT 0.71
E335K PB WT 1.34
HY341NA* TML WT/5 0.29
Y342A* TML WT 0.34
E343A PB WT 0.33
EE343,344KK PB WT 0.31
M353L PB WT 1.02
H356Q* TML WT 0.11
V358A* QS WT 0.41
S306P/V358A QS WT 0.18
S366A PB WT 1.28
K367E PB WT 1.47
S369A PB WT/2 1.01
L374K PB WT 1.22
K381E PB WT 0.27
H405D PB WT/5 0.87
Q406K PB WT 1.87
E414K PB WT 0.78
D420H PB WT 0.65 88
Table 7 : Summary of all mutants in this study listing the results from luciferase reporter assay that tested for CREB synergy and protein expression studies using western blots with anti-T antibody (PN116).Asterisk sign * denotes assays that were done by others.Mutants P402R/G403D and E343K/E344K and K381E were defective in transactivation of CREB. Mutants L296P (Tara Love, PhD thesis), N307S (C.Rouleau), K321 (C.Rouleau), H356 mutants (Tara Love, PhD thesis), V358A (Tara Love, PhD thesis), DT327 mutant (Tara Love, PhD thesis) were all defective in CREB synergy. 89
450 400 350 A. 300 250 200 150 Luc Values Luc 100 50 0 CON WT LT P402R/ E343K / G403D E344K E2Fluc
B.
400 350 300 250 200 150 100 50 Fold Activation Fold 0 CON WT D420H S294A L374K S366A M353L K308E Q406K E335K LT E2Fluc 90
C.
400
350 300 250 200
150 100 Fold Activation Fold 50 0 WT D420H S294A L374K S366A M353L K308E Q406K E335K K381E S369A K367E E343A H405D Y305D E414K LT E2Fluc
Exp ression less than WT
Exp ression similar to WT
Fig 14: A: Mutants P402R/G403D, E343K/E344K, K308E and K381E were defective in E2F transactivation : Cells were cotransfected with 1.0 g of E2F-Luc reporter and 1.0 g Gal4 DNAbinding domain (Control), and 1.0 g pCMV LT or the mutants as shown. β-Gal (500ng) was used as internal control for transfection efficiency. Normalization was done as described previously.. Cells were harvested 48 hours post transfection and assayed for luciferase activity. Fold activation above control levels is represented. Error bars represent S.E.M. n=6. B: Mutant K308E is defective in E2F transactivation: Cells were cotransfected with 1.0 g of E2F-Luc reporter and 1.0 g Gal4 DNAbinding domain (Control),and 1.0 g pCMV LT or the mutants as shown. β-Gal (500ng) was used as internal control for transfection efficiency. Normalization was done as described previously. Cells were harvested 48 hours post transfection and assayed for luciferase activity. Fold activation above control levels is represented. Error bars represent S.E.M. n=6. C: Mutants K308E, E343A and K381E were defective in transcactivation of E2F-promoter while being well expressed: Cells were cotransfected with 1.0 g of E2F-Luc reporter and 1.0 g Gal4 DNAbinding domain (Control), and 1.0 g pCMV LT or the mutants as shown. β-Gal (500ng) was used as internal control for transfection efficiency. Normalization was done as described previously.. Cells were harvested 48 hours post transfection and assayed for luciferase activity. Fold activation above control levels is represented. Error bars represent S.E.M. n=6
91
Mutation Source Expression mE2F(-37/-33)Cyclin A Activation
S294A PB WT/2 0.68
L296P* TML WT 0.12
Y305D PB WT 1.32
S306P* TML WT 0.33
N307S* CR WT 0.26
K308E PB WT 0.4
E320M* TML WT 1.52
E320A TML WT 1.35
K321E* CR WT 0.78
D327A* TML WT 0.4
DT327AA* TML WT/5 1.59
K331E* CR WT 0.64
E335K PB WT 1.7
HY341NA* TML WT/5 0.02
Y342A* TML WT 0.21
E343A PB WT 0.3
EE343,344KK PB WT 0.34
M353L PB WT 1.2
H356Q* TML WT 0.02
V358A* QS WT 0.46
S306P/V358A* QS WT 0.18
S366A PB WT 1.25
K367E PB WT 1.43
S369A PB WT/2 1.02
L374K PB WT 1.2
K381E PB WT 0.43
H405D PB WT/5 0.89
Q406K PB WT 1.9
E414K PB WT 0.73
D420H PB WT 0.64 92
Table 8 : Summary of results of mutant E2F cyclin A (-37/-33) promoter activation in the presence of LT or its mutants.Asterisk sign * denotes assays that were done by others. Mutants P402R/G403D and E343K/E344K, K381E were defective in mE2F cyclin A promoter transactivation. Mutants L296P (Tara Love, PhD thesis), N307S (C.Rouleau), K321 (C.Rouleau), H356 mutants (Tara Love, PhD thesis), V358A (Tara Love, PhD thesis), DT327 mutants (Tara Love, PhD thesis) were all defective in mE2F cyclin A promoter activation.
93
It is important to point out that in all our experiments, none of these three mutants were completely dead in transactivation of the ATF site-containing promoters. An unexpected observation lent further credence to the idea that these three mutants retained some function required for transcriptional activation. In luciferase reporter assays, when
PyOBD was cotransfected with either of these three CREB defective mutants and
Gal4CREB and thymidine kinase reporter luciferase construct, all the mutants were dominant negative over wild type large T and completely repressed ATF site activation
(Fig 15). In subsequent transactivation assays, suppression in the presence of both WT
OBD and each of the dominant negative transactivation defective mutants was observed, but did not reduce the luciferase values below that of fold activation seen only in the presence of these transactivation defective mutants by themselves. Both results suggested that they could interfere by carrying out one or more functions of wild type.
94
350
300 250
200
150
100 Luc Values 50
0 TKGal4luc Gal4CREB DBD + + + + P402R/G403D + + E343K/E344K + + K381E + +
Fig 15:CREB defective mutants P402R/G403D, E343K/E344K and K381E are dominant negative over wild type polyoma large T in CREB transactivation : Cells were cotransfected with 1.0 g of TKGal4-Luc reporter and 1.0 g Gal4 DNA binding domain (Control), and 1.0 g of Gal4CREB and 1.0 g pCMV LT or the mutants as shown. β-Gal (500ng) was used as an internal control for transfection efficiency. Normalization was performed as mentioned previously. Cells were harvested 48 hours post transfection and assayed for luciferase activity. Fold activation above control levels is represented. Error bars represent S.E.M. n=6 95
Next, in order to identify the unknown regulatory entities that modulate large T’s ability to synergize with CREB/ATF sites, I studied SWI/SNF complex regulation by large T. A transcriptional activator like large T may recruit chromatin modifying complexes in addition to coactivators that allow ATF promoters to adopt an open configuration capable of binding RNA Polymerase II promoting transcription initiation. Mammalian SWI/SNF is a highly conserved, 2 MDa multi subunit chromatin remodeling complex, involved in transcriptional control (For review see, Roberts & Orkin., 2004; Martens., 2003).
Preferentially associating with specific DNA binding proteins, they are targeted to specific promoters (Medina., 2004).
These complexes can use Brahma-related genes 1 (Brg1) as a catalytic subunit to remodel nuclesomes for transcriptional regulation (For review see, Wong et al., 2000). It is possible that the functional diversity of polyoma LT results from differential gene targeting due to transcription factor interactions with individual SWI/SNF subunits at
ATF promoters. Large T does not activate all promoters with ATF sites. The cyclin D1 promoter, for example, has a functional CREB/ATF site (Watanabe et al., 1996) that is not affected by large T (Love et al., 2005).
To analyze the basis of ATF site-containing promoter selectivity of large T, reporter assays with cotransfected BRG1 and coactivators like p300 were performed. Our experiments indicated that target gene promoters like thymidine kinase and E2F mutated cyclin A (-37/-33) were not synergistically transactivated by largeT and Brg1 (Fig 16 A,
B). This suggested that regulation of CREB activity by large T does not occur via Brg1.
However, promoters with AP1 sites such as 3TPlux, responsive to TGFbeta signaling were synergistically transactivated in the presence of large T and Brg1. This effect was 96 seen to be independent of the Rb binding ability of LT and the putative coactivator p300 binding (Fig 16C). Preliminary immunoprecipitation assays with BRG1 to examine interaction with LT were negative (Not shown). 97
A.
40
35
30
25
20
RLU 15 10
5
0 TKGal4luc + + + + + Gal4CREB - + + - + Brg1 - - - + + PyLT - - + - +
B. 50 45 40 35 30 25
RLU 20 15 10 5 0 Cyclin A(-37/-33)luc + + + + + LT - + - + - Brg1 - - + + + Rb -LT - - - - + 98
C.
300
250
200
150 RLU
100
50
0 3TPLux + + + + + + + + + PyLT - + - - - + - - + Rb -LT - - + - - - + - - p300 - - - - + - - + + Brg1 - - - + - + + + + 99
Fig 16 A:Large T did not synergize with BRG1 to activate transcription of CREB-responsive promoter: Cells were cotransfected with 1.0 g of TKGal4-Luc reporter and 1.0 g Gal4 DNAbinding domain (Control), 1.0 g of Gal4CREB, 1.0 g of BRG1 and 1.0 g pCMV LT or Rb -LT as shown. Renilla (500ng) was used as internal control for transfection efficiency. Normalization was done by calculating the ration of firefly luciferase over Renilla values. Cells were harvested 48 hours post transfection and assayed for luciferase activity. Fold activation above control levels is represented. Error bars represent S.E.M. n=6. B: Large T did not synergize with BRG1 to activate transcription of CREB-responsive promoter: Cells were cotransfected with 1.0 g of cyclin A (-37/-33)-Luc reporter and 1.0 g Gal4 DNAbinding domain (Control), 1.0 g of Gal4CREB, 1.0 g of BRG1 and 1.0 g pCMV LT or Rb -LT as shown. Renilla (500ng) was used as internal control for transfection efficiency.Normalization was done as mentioned previously. Cells were harvested 48 hours post transfection and assayed for luciferase activity. Fold activation above control levels is represented. Error bars represent S.E.M. n=6. C: Large T synergized with BRG1 to activate the 3TP-lux promoter with AP1 sites responsive to TGF-β signaling; Both p300 coactivator and Rb -LT had no effect: Cells were cotransfected with 1.0 g of TKGal4-Luc reporter and 1.0 g Gal4 DNAbinding domain (Control), 1.0 g of Gal4CREB, 1.0 g of BRG1, 1.0 g of p300 and 1.0 g pCMV LT or Rb -LT as shown. Renilla (500ng) was used as internal control for transfection efficiency. Normalization was done as mentioned previously. Cells were harvested 48 hours post transfection and assayed for luciferase activity. Fold activation above control levels is represented. Error bars represent S.E.M. n=6.
100
The Origin Binding Domain of Large T Regulates Genes in the TGF-β Signaling
Pathway and the MAPK Signaling Cascade
My second approach examining OBD function involved RNA analysis using gene arrays.
To examine which host genes are affected by the functions of the DNA binding domain, a conditional cell line was constructed that expresses the origin binding domain with an N- terminal HA tag and an SV40 nuclear localization signal termed as HA-NLS-OBD
(OBD). Fig 17A outlines the bicistronic structure of the pBI-G vector that allows for rapid screening of tetracycline regulated cell lines via lac Z production. OBD expression after withdrawal of doxycycline is shown in Fig 17B. By this approach it became possible to regulate the timing and extent of OBD expression. RNA was isolated from these stable mouse embryonic fibroblast (MEF) cell lines in the presence and absence of
OBD expression and subjected to gene array analysis. This RNA was used to probe a chip containing 15,000 murine genes (NIA 15K chip). Tables 9 and 10 summarize the common gene clustering observed in the duplicate microarrays.
Very few genes known to be regulated by CREB/ATF were affected. For example, genes like OPA3, OTOF, NDUFA10, NR4A2, Cyclin D1, CDC37, were not upregulated.
However, Panther software screening of the duplicate microarray data indicated regulation of common target genes of the TGF-β signaling and the mitogen activated
protein kinase cascade (MAPK). Determination of protein expression by western blots
indicated that induction of large T upregulates expression of Smurf2, Smad 4 and Smad 7
levels (Fig 18A).The TGF β are a superfamily of ligands that are involved in embryogenesis, cell differentiation, cell proliferation, apoptosis, specification of developmental fate and can trigger cell-cycle arrest. SMADS are evolutionarily 101 conserved proteins identified as mediators of transcriptional activation by members of the
TGF-β superfamily of cytokines (See review Massague J.,2000; Shi, Y., 2003., Leask,A
2004). The most frequent mutations in this signaling pathway associated with cancer
involve Smads. In conjunction with results from transient transfection luciferase reporter
assays using TGF-β responsive reporter constructs that show that large T as well as the origin binding domain can activate TGF-β binding site containing promoters (Fig 18B)
and previous results that showed synergistic regulation of BRG1 by large T in the
modulation of TGF- β signaling, it will be interesting to answer how large T regulates the
TGF-β pathway. 102
A.
B. CON INDUCED UNINDUCED
OBD
Fig 17: Conditional expression of OBD using the tet-off system. A. Schematic of the regulatory region of the pBI-G vector. HA-tagged NLS-OBD cDNA was cloned into the Not-Sal cloning site. Transcription is controlled by the tet responsive element and occurs in a bidirectional fashion with Lac Z production used to score regulation. B. Mouse embryo fibroblasts stably carrying a tetracycline repressor expressing plasmid (tet-off MEFs; Clontech) were transfected with pBI-G HA-tagged-NLS- OBD and a puromycin selection vector at a 10:1 ratio.Clones were selected and tested for regulation by βGAL staining. Extracts were made 48 hours after withdrawal from doxycycline and blotted with anti-HA antibody to detect OBD protein. 103
540826 Smurf 2 2.9 3.2
17131 Smad 7 3.78 3.78
22057 Tob1 3.37 3.18
1281 Col3A1 -3.7 -4.56
1291 Col6A1 -2.9 -2.68
50554 Smad 4 4.9 4.18
388 R hoB 3.37 3.5
14313 Foll istatin 3.53 5.88
13179 Decorin 4.6 3.45
Table 9 : Res ults from duplicate microarrays: Summary showing gene clustering in the TGF-β signaling pathway as analyzed by Panther Microarray Analysis Software. Fold Change represents the ratio of transcripts in the presence of OBD to the absence of OBD. 104
A.
Smurf2
Smad 7
Smad 4
OBD
p38
UNINDUCED INDUCED
B . 1400
1200
1000
800
600 400
Fold activation 200
0
LT OBD 3TPLUX 105
Fig 18. : A. OBD expression induces upregulation of TGF-β pathway components: Control MEFs and those expressing OBD were harvested 48h after removal of doxycycline. Extracts were blotted with Smurf2, Smad 7 and Smad 4 antibodies. Western blots were performed thrice for each experiment. B. OBD expression transcriptionally activates TGF-β signaling: NIH 3T3 cells were cotransfected with 1 g of 3TP-lux reporter, a construct that contains AP1 binding sites responsive to TGF-β signaling , and 1 g of pCMV LT or OBD at increasing concentration (500ng, 1 g , 2 g , 3 g as indicated. After 48 h, cells were processed as mentioned before and luciferase activity was measured. . β-Gal (500ng) was used as internal control for transfection efficiency. Normalization was done as described previously. Fold activation above control levels is represented. Error bars represent S.E.M. n=6. Assays were performed thrice to confirm results.
106
MAPK are utilized in response to stimulation by growth factors, cytokines and environmental stress ( For review, See Obata et al., 200; Davis et al., 2000). Upon activation, these kinases translocate from the cytoplasm to the nucleus where they modify cellular responses by phosphorylating transcription factors. Both JNK and p38 pathway components were shown to be upregulated in the microarray results. JNK also known as stress activated protein kinase and the p38 pathway are both subfamilies of the mitogen activated protein kinase superfamily. JNK has two ubiquitously expressed forms JNK1 and JNK2 and a tisuue specific form, JNK3.
JNK has been implicated in regulation of many cellular activities from gene expression and cell survival to programmed cell death. The function of JNK generally depends upon the cell type, nature of apoptotic stimulus, duration of its activation and activity of other signaling pathways. Since JNK regulates the activity of several downstream transcription factors like c-Jun, c-fos, ATF2 and c-myc, I studied the transcriptional regulation of JNK and p38 MAPK cascade via large T and OBD.
Luciferase reporter assays suggested that both large T and the origin binding domain significantly activated c-jun and c-fos luciferase reporter constructs in transient transfections and synergized with a Gal4ATF2 construct to activate transcription of thymidine kinase reporter construct (Fig 19). In addition, both ATF2 and c-myc levels were upregulated upon induction of OBD (Fig 20). To address the importance of the regulation of JNK and p38 signaling pathways by OBD as revealed by the duplicate gene arrays and knowing that both these stress activated signals are triggered by environmental stress such as UV irradiation and/or exposure to chemotherapeutic drugs, I subsequently examined the biological effects of UV irradiation and chemotherapeutic drugs like 107 etoposide upon OBD induction. This phenomenon was studied in detail and is discussed subsequently in Chapter two of this thesis. 108
Table 10 : Results from dup licate microarrays have been summarized to show gene clustering in the MAPK signaling cascade as analyzed by Panther Microarray Analysis Software. Fold Change represents the ratio of transcripts in the presence of OBD to absence of OBD.
109
A. 300
250
200
150
RLU 100
50
0 TKGal4luc Gal4ATF2 PyLT - - - + OBD - - + -
60
B. 50
40
30 RLU 20
10
0 cJunLuc PyLT - + - OBD - - + 110
C.
3000 2500
2000 1500
RLU 1000
500 0 Fosluc PyLT - + - OBD - - +
Fig 19: LT and OBD transcriptionally activates downstream components of the MAPK cascade . A:NIH 3T3 cells were cotransfected with 1 g of TKGal4luc reporter that contains five Gal4-binding sites upstream of the thymidine kinase promoter, 1 g of Gal4ATF2 that contains ATF2 fused to a Gal4 DNA binding domain that allows transcriptional activation when it binds to Gal4 sites of TKGal4luc, 1 g of pCMV LT or OBD as indicated. After 48 h, cells were processed as mentioned before and luciferase activity was measured. β-Gal (500ng) was used as internal control for transfection efficiency. Normalization was done as described previously. Fold activation above control levels is represented. Error bars represent S.E.M. n=6. B: NIH 3T3 cells were cotransfected with 1 g of cJun-luc reporter, and 1 g of pCMV LT or OBD as indicated. After 48 h, cells were processed as mentioned before and luciferase activity was measured. . β-Gal (500ng) was used as internal control for transfection efficiency. Normalization was done as described previously. Fold activation above control levels is represented. Error bars represent S.E.M. n=6. C: NIH 3T3 cells were cotransfected with 1 g of Fos-luc reporter, and 1 g of pCMV LT or OBD as indicated. After 48 h, cells were processed as mentioned before and luciferase activity was measured. β-Gal (500ng) was used as internal control for transfection efficiency. Normalization was done as described previously. Fold activation above control levels is represented. Error bars represent S.E.M. n=6.
111
cJun
cMyc
OBD
p38
UNINDUCED INDUCED
Fig 20 : OBD expression induces upregulation of MAPK pathway components : Control MEFs and those expressing OBD were harvested 48h after removal of doxycycline . Extracts were blotted with c-Jun and c-Myc antibodies.
112
Discussion
We have analyzed a range of mutants in the origin binding domain for a variety of functions in this chapter. The positions of some of the residues are indicated in Fig 21. A comprehensive summary of the results of our examination of all the mutants are presented in Table 11 and Table 12.
The genetic analysis identified some important regions that were required for various OBD functions. The most striking results concerned the interaction with RPA.
Based on sequence homology with SV40 T-antigen OBD, we identified residue K308E of polyoma OBD that aligns with Arginine 154 in SV40 origin binding domain, which was shown to be required for binding to RPA. We also found mutations of other residues,
E320, 321` and K381, that abolished RPA binding. K381 is relatively close in the structure to K308. E320 is somewhat surprising because it is entirely on the other side of the OBD structure as modeled from SV40 (Fig 21D). It is possible that the RPA hetero- trimer is large enough to envelop OBD. It is also possible that mutation of E320 causes a conformational change that alters the binding site. Until there is a structure for polyoma
OBD we cannot rule out the possibility that the structural model from SV40 is misleading.
A key conclusion is that the different OBD mutants have different phenotypes.
K308E is defective in transcriptional activation and replication assays. We found that
K308 is important for association with RPA, replication and transcriptional activation.
However, K381E and E320A are active in both assays. This leads us to suspect that
K308E is likely to have multiple defects. This residue is proximal to the sequences that make sequence specific and non-specific contacts with origin DNA. Perhaps, K308 mutation renders the site ineffective for DNA binding, a function that is highly likely to 113
A
PG402,403
K381
K308
EE343,344
Y305
B . 114
C .
D.
K331
H356
E320 V358
K308 N307 S306 Y305 K381
E343,4 115
Fig 21: SV40 TBD structure pointing out mutated residues in the origin binding domain: A: Residues PG402,3., K381., EE343,4 important for CREB synergy; K308 important for RPA binding and transactivation., S306 important for sequence specific DNA binding; E320 important for RPA binding but not for replication ., Y305 with no known function., L296 is in close proximity to the nuclear localization signal in CT. B: Q405 with no known function., K367 important for protein stability., K321important for RPA binding, transactivation and replication, K319 part of the “TKEK” motif, which is important for origin-binding specificity. C: S366, with no known function., N307, important for DNA binding and transactivation as well as replication., V358 important for DNA binding and transactivation., L374K, with no known function. D: K331, important for RPA binding, transactivation and replication.
116
E2F
Replication RPA Creb mE2F(-37/-33) Promoter
Mutation Source Expression (Mutant/WT) Binding Synergy Cyclin A Activation Activation
S294A PB WT/2 0.78 Yes 0.25 0.68 0.11
L296P TML WT 0.04 Yes 0.075 0.12 0.19
Y305D PB WT 1.16 Yes 1.1 1.32 0.87
S306P TML WT 0.01 Yes 0.21 0.33 0.18
N307S CR WT 0.08 Yes 0.23 0.26 0.13
K308E PB WT 0.02 No 0.41 0.4 0.18
E320M TML WT 1.61 No 1.28 1.52 0.77
E320A TML WT 1.68 No 1.34 1.35 0.8
K321E CR WT 0.024 No 0.87 0.78 0.64
D327A TML WT 2.27 Yes 0.66 0.4 0.875
K331E CR WT 1.4 No 0.71 0.64 0.01
E335K PB WT 0.41 Yes 1.34 1.7 0.78
HY341NA TML WT/5 1.9 Yes 0.29 0.02 0.175
Y342A TML WT 0.645 Yes 0.34 0.21 2.03
E343A PB WT 2.19 Yes 0.33 0.3 0.51
EE343,344KK PB WT 2.02 Yes 0.31 0.34 0.56
M353L PB WT 1.67 Yes 1.02 1.2 1.5
H356Q TML WT 0.05 Yes 0.11 0.02 0.78
V358A QS WT 1.08 Yes 0.41 0.46 0.46
S306P/V358A QS WT 0.014 Yes 0.18 0.18 0.1
S366A PB WT 1.19 Yes 1.28 1.25 1.4
K367E PB WT 0.87 Yes 1.47 1.43 1.28
S369A PB WT/2 2.88 Yes 1.01 1.02 0.5
L374K PB WT 1.35 Yes 1.22 1.2 2.1
K381E PB WT 2.22 No 0.27 0.43 0.22
H405D PB WT/5 0.92 Yes 0.87 0.89 1.3
Q406K PB WT 2.9 Yes 1.87 1.9 1.4
E414K PB WT 1.57 Yes 0.78 0.73 0.75
D420H PB WT 1.53 Yes 0.65 0.64 0.86 117
Table 12 : Characterization summary of all mutants : List of the results from luciferase reporter assays that tested for replication activity, transactivation of E2F, cyclin A (-37/-33), CREB-site containing promoters and RPA binding activity; protein expression studies using western blots with anti-T antibody (PN116) as well as RPA binding assays.
118
be required for the functions assayed. A residue that is in very close proximity in the
TKEK motif at residue 164 in SV40 OBD, K321, when mutated (C.Rouleau, unpublished data) was similar to K308: defective for transactivation as well as replication and unable to bind RPA.
The replication results with K381E and E320A directly confront the standard paradigm for viral DNA replication. In vitro reconstitution assays make it clear that RPA is required for viral DNA replication. It has been widely assumed that the RPA binding site on LT is required to ensure that RPA is loaded on to single-stranded DNA created by
LT helicase activity. My results raised the question of whether direct interaction with
RPA may be necessary for large T to initiate viral DNA replication. Given that RPA binding seems to affect the response to DNA damage (See in Chapter 2), it is plausible that there may be a connection to aspects of activated DNA damage and viral DNA replication. The results of Dahl (2005) clearly show enhanced replication in response to
ATM activation. Perhaps, RPA can create a positive feed back to enhance such activation.
With respect to viral DNA replication we really did not uncover any major surprises. Mutation of the A1 and B2 loop residues affected the ability of LT to replicate.
For SV40, as outlined in the Introduction, other residues contribute to DNA replication.
With the exception of residue 321 (and 296), we found our mutants to be active in replication. Interestingly, K321 by sequence comparison to SV40 OBD, is part of the
TKEK motif at residue 164, that confers a relaxed origin specificity when mutated
(Margolskee et al.,1984). L296 is likely to be buried in structure. Its mutation may produce a general structural alteration. 119
Analysis of the ability of OBD to stimulate transcription generated at least two significant surprises. The first is that the ability of LT to activate E2F sites tracked genetically with the ability of LT or OBD to activate cellular promoters with CREB/ATF sites. Despite the fact that LT binds CREB, whose activity is enhanced by OBD, we did not uncover any mutant only defective in CREB/ATF binding. There is no question that
E2F transactivation does not require OBD, because NT is able to transactivate. E2F transactivation does require interaction with Rb family members. What could OBD be contributing to E2F transactivation? Previously published work (Love et al., 2005) indicated that oligomerization of LT could contribute to E2F transactivation. Although
LT oligomerization requires the zinc finger (Rose et al., 1995), at least for SV40, OBD itself is able to form a lockwasher oligomer (Meinke et al., 2011). Perhaps PyOBD also contributes to oligomerization. A second possibility, since non-specific DNA binding is required for cyclinA transactivation, is that OBD contributes to E2F transactivation via its ability to bind DNA.
The second major surprise came in our microarray analysis in cell lines where
OBD could be induced. In the OBD inducible cell lines, there was only a very limited indication of activation of CREB/ATF sites. There are a number of possible explanations for this result. One is that the cells even in the presence of DOX had adapted to the presence of OBD during the process of selection. Another possibility is that CREB/ATF activation requires a level of expression of OBD that we do not achieve in the inducible cell line.
There were some interesting aspects to the transcriptional activation studies.
P402R/G403D and E343K/E344K were both defective in transactivation even though 120 they were in different locations in the structure. It is tempting to speculate that they may act by different mechanisms. The fact that they are dominant negative in CREB transactivation assays clearly indicates that each affects a critical function that is used in
LT signaling. It also suggested that the mutants may compete for critical transcriptional elements in the presence of wild type large T.
121
Chapter 2: The Origin Binding Domain of Large T Enhances DNA Damage
Response By Targeting Replication Protein A
Introduction
The integrity and stability of DNA is essential to life. The DNA, however, is subject to
constant assaults from the environment (Jackson, S. P., and J. Bartek . 2009). A failure to repair DNA lesions may result in inhibition of transcription and replication, mutagenesis and/ or cellular cytotoxicity. In humans, DNA damage has been shown to be involved in carcinogenesis. Estimates suggest that there are from 1,000 to 100,000 somatic mutations in common adult cancers (Stratton., 2011). Eukaryotic cells have evolved complex repair response mechanisms that counteract the potentially deleterious effects of DNA damage by removing DNA lesions. Cell cycle arrest (Cazzalini et al., 2010; Rastogi et al., 2010) and cell death (Bitomsky et al., 2009) are processes that protect cells by carefully maintaining genomic fidelity.
DNA is repaired by several different mechanisms besides proofreading by replication enzymes. These include homologous recombination (HR), non-homologous end joining (NHEJ), base excision repair (BER), nucleotide Excision Repair (NER) and mismatch Repair (MMR). Some proteins are important for specific kinds of repair. Ku, for example is involved in NHEJ (Mladenov, E., and G. Iliakis. 2011); the MRN complex is involved in double-strand break (DSB) repair (Lamarche, B. J., N. I. Orazio, and M. D.
Weitzman . 2010); MSH2/MSH6 is involved in MMR (Mazurek. et al., 2009). However, the repair pathways may contain common elements. XPC and single-stranded binding protein RPA, both of which function in NER, seem to be important for DSB repair as well (Zhang et al., 2009). In particular, RPA has been shown to be involved in repair of 122 both UV damage (Reardon, J. T., and A. Sancar . 2003) and MRN complex recruitment to
DSBs induced by etoposide (Robison et al., 2007). Defects in the repair pathways have been associated with cancer. It has been known for a long time that defects in MMR systems are carcinogenic (Eshleman, et al., 1996). Genetic defects in the NER pathway give rise to a variety of diseases including skin cancer (Cleaver et al., 2009). Mutations in NBS1 of the MRN complex link DSB-repair to cancer (Dzikiewicz-Krawczyk, A .,
2008).
Viruses have evolved a variety of mechanisms to interact with the host DNA repair apparatus. ATM is activated at double-strand breaks (DSBs) while ATR senses single- strand lesions (Cimprich, K. A., and D. Cortez., 2008; Petrini, J. H., and T. H. Stracker .
2003). Activation of ATM and downstream signaling components is associated with
recruitment of ATM and repair proteins to sites of replication in viruses like SV40 (Hein et
al., 2009) murine polyomavirus (Py) (Dahl et al., 2005), Herpes simplex virus-1 and -2
(HSV-1 and HSV-2) (Lilley et al., 2005; Shirata et al., 2005), human cytomegalovirus
(HCMV) (Luo et al., 2007), and EBV (Kudoh et al., 2005). ATM phosphorylation of SV40
LT antigen is important for viral DNA synthesis (Shi et al., 2005). A decrease in ATM
function reduces SV40 DNA synthesis postponing both the formation of viral replication
centers and recruitment of DNA repair proteins at these sites (Zhao et al., 2008). Activation
of ATM and MRN regulates HSV-1 replication (Lilley et al., 2005). DNA damage
signaling in HCMV infection promotes efficient viral replication via activation of ATM
(Castillo et al., 2005). On the other hand, ICP0, the immediate early protein of HSV-1,
inhibits assembly of activated repair proteins at sites of DNA damage (Lilley et al., 2005).
In addition, the Adenovirus (Ad) E4 protein specifically inactivates the MRN complex by 123 either mislocalization or degradation at the infection onset to promote Ad DNA replication
(Stracker et al., 2002). ATR activation may inhibit Ad infection and is therefore disrupted to promote viral infection (Carson et al., 2009). ATR activation occurs during infection by
HCMV, UV-treated adeno-associated virus and E4 deleted Ad (Cimprich, K. A., and D.
Cortez. 2008). ATR and its cofactors ATRIP, TopBP1 and RPA assemble at Ad replication centers (Carson et al., 2009). HSV-1 activates ATM signaling while inhibiting ATR and exemplifies the complex viral regulation of the advantageous versus the disadvantageous aspects of DDR signaling (Mordes et al., 2008). All these data indicate that viruses exploit the host DNA repair system to facilitate their own amplification.
This work examines the connection between DNA damage and murine polyomavirus large T antigen (LT). LT plays critical roles in the viral life cycle. In a productive infection, it initiates viral DNA replication (Francke, B., and W. Eckhart et al., 1973) and promotes origin unwinding (Guo et al., 1996). Its DNA replication functions are important in other contexts as well. In transformation, it is responsible for integration (Della Valle et al.,
1981), amplification (Colantuoni et al., 1980) and excision (Basilico et al., 1980) of the viral genome, and can also promote recombination (St-Onge, L., and M. Bastin. 1993; St-
Onge, et al., 1990). LT has functions consistent with its role in replication: helicase activity (Seki, et al., 1990), ATPase activity (Gaudray, et al., 1980) and the ability to associate with pol α-primase (Kautz et al., 2001).
LT antigens can trigger dramatic changes in the host cell phenotype. Although, unlike SV40 LT, it cannot transform by itself, polyoma LT complements other oncogenes such as middle T or ras during transformation of primary cells and during tumorigenesis
(Land, H., 1983). LT immortalizes primary cells (Rassoulzadegan et al., 1983) in a 124 manner dependent on the binding site for the retinoblastoma susceptibility (pRb), p107 and p130 gene products (Freund et al., 1992; Howes et al., 1996; Larose et al., 1991). LT prevents differentiation, either of myoblasts (Maione et al., 1992; Maione et al., 1994) or preadipocytes (Cherington et al., 1986). LT can also induce dramatic apoptosis (Fimia et al., 1998; Sheng et al., 2000). All of these effects depend on binding the Rb family of tumor suppressors. By interacting with the Rb family, LT activates transcription of many genes via E2F sites (Kellems et al., 1979; Mudrak et al., 1994; Ogris et al., 1993;
Schuchner et al., 2001; Sheng et al., 200). The ability of LT to activate these E2F responsive genes depends upon an intact N-terminal J domain that binds heat shock 70
(Sheng et al., 1997). However, LT has other effects on transcription as well. It activates cyclin A (Fimia et al., 1998; Love et al., 2005; Schuchner et al., 2001; Sheng et al., 2000) through the ATF/CREB (CRE) site.
LT can be divided into two major domains that exhibit independent function
(Gjorup et al., 1994; Holamn et al., 1994). The N-terminal domain (~ residues 1-159)
primarily functions to stimulate the host cell, while the C-terminal domain is sufficient for
viral DNA replication in growing cells. There are additional subdomains. The J-domain
(~1-79) is responsible for binding Hsc70 (Sheng et al., 1997) to support E2F regulation.
The DNA binding domain (~ 280-420) (Love et al., 2005; Sunstrom et al., 1991) allows
LT to bind to DNA in both site-specific (GAGGC) and non-site specific manner (Cowie
et al., 1986; Cowie et al., 1984; Pomerantz et al., 1983; Scheller et al., 1985).The DNA
binding domain also has the independent ability to activate transcription (Love et al.,
2005). 125
This work will describe how LT sensitizes host cells to DNA damage by as much as 100-fold. The same result is obtained with UV irradiation or etoposide exposure.
Since these agents cause different kinds of lesions this indicates that multiple repair systems are affected. Mapping indicates that the origin-binding domain (OBD) of LT is sufficient to sensitize cells. Genetic analysis of the OBD suggests that DNA-binding and the ability to transactivate are not required for this effect. However, RPA binding by
OBD is critical. Furthermore, cells overexpressing RPA are protected. This work therefore identifies an underlying mechanism by which polyomavirus LT regulates DDR responses.
Results
Polyoma Large T Uses Its Origin Binding Domain to Sensitize Cells to Apoptotic Cell
Death In Response to DNA Damaging Agents.
To study how polyoma LT affects the response to DNA damage, mouse embryonic fibroblasts (MEF) were prepared that conditionally express full length LT or its origin binding domain (OBD, LT residues 264-420). This construct includes the “core” OBD regulatory sequences including T278. In addition, it also has an SV40NLS as polyoma
NLS2 does not function in rhe origin binding domain context. To do this, the Tet-off
pBI-G vector (Clontech) was used so that the removal of doxycycline would induce LT or the OBD. The regulation of LT and OBD expression achieved in this way is shown in
Figure 22A and 22B respectively.
Cells were passed and allowed to grow to near confluence in 48 hours. Cells were then treated with UV irradiation (40J/m 2) or 100µM etoposide was added. Etoposide is a chemotherapeutic drug that induces strand breaks in cellular DNA by inhibiting 126 topoisomerase II, while UV light primarily causes photoproducts such as pyrimidine dimers.
When examined 16 hours later, MEFs expressing LT showed a dramatic change in phenotype in a phase contrast microscope (Fig 22A). LT expressing cells looked rounded, refractile and displayed a loss of cell-to-cell contact. Uninduced cells that did not express
LT or had not been exposed to UV-irradiation or etoposide treatment did not show these morphological changes. Stable, inducible expression of the OBD of LT induces a similar dramatic change in phenotype following UV-irradiation or etoposide treatment (Fig 22B).
Incidentally, similar results were obtained for MEFs expressing LT in the presence of gamma irradiation. Whereas a dose of 10 Gy was able to induce a dramatic induction of apoptosis in LT expressing cells, uninduced cells that did not express LT were not affected to a similar degree (Fig 22C). Lower doses of gamma irradiation did not enhance DNA damage significantly in LT expressing cells or non-expressing cells. For the phenotype discussed in this work, the effects described here for LT can be demonstrated with the OBD alone. Genetic evidence presented below will show that not only is OBD sufficient for these effects, but it is necessary in the context of full-length LT. The sensitization to DNA damage therefore maps to the OBD. 127
A.
UNINDUCE D +ETOP OSIDE +UV
LT LT INDUCED LT + ETOPOSIDE LT + UV
ß Actin
UNINDUCED INDUCED
Figure 22A: Polyoma Large T Sensitizes Cells to DNA Damaging Agents. A: Left panel : Expression of LT in pBI-G LT MEFs grown in the presence (left) or absence (right) of doxycycline. Right panel : Morphology of cells as seen by phase contrast (40X). Mouse embryonic fibroblasts uninduced or expressing LT under inducible conditions were untreated, exposed to UV light (40 J/m2) or etoposide ( 100µΜ ) and examined six hours later (Pictures were taken by Rowena De Jesus). 128
B.
UNINDUCE D +Eto +UV
OBD OBD INDUCED OBD+E to OBD+UV ß-Actin
UNINDUCED INDUCED
Fig 22 B: Left panel : Expression of OBD in pBI-G LT MEFs grown in the presence (left) or absence (right) of doxycycline. Inducible expression of the origin binding domain of LT by removal of doxycycline . Right panel : Phase co ntrast (40X) pictures of mouse embryonic fibroblasts uninduced or expressing OBD under inducible conditions were untreated, exposed to UV light (40 J/m 2) or etoposide ( 100µΜ ) and examined six hours later.
129
GAMMA GAMMA RADIATION-10 Gy RADIATION-10 GAMMA GAMMA RADIATION-2Gy NO GAMMA NO RADIATION
UNINDUCED INDUCED
Fig 22C : Phase contrast (40X) pictures of mouse embryonic fibroblasts uninduced or expressing OBD under inducible conditions were untreated, exposed to gamma radiation (0, 2 and 10 Gy) and examined six hours later. Experiments were perfomed with help from Dr.Kathryn Huber (Boston Gamma Knife Center).
130
MAPKs (Mitogen-Activated Protein Kinases) are Serine-threonine protein
Kinases that are activated in response to a variety of extracellular stimuli and mediate signal transduction from the cell surface to the nucleus. Three major MAPKs include
ERKs (Extracellular signal-Regulated Kinases), JNKs (c-Jun NH(2)-terminal protein
Kinases), and p38 Kinases . Different forms of stress have been shown to mediate p38 and
JNK activation via various cellular pathways . ERK activation regulates proliferation, differentiation, cell cycle processes, and survival. Several lines of evidence suggested that the LT expressing cells were showing enhanced stress from DNA damage and were dying from apoptosis. Fig 23A shows that LT-expressing cells treated with UV showed enhanced activation of JNK1 and 2 as well as p38 as determined by activation-specific phosphoantibodies with even as little as 4 J/m 2. In uninduced cells, 400 J/m 2 UV was
required to produce the same activation as LT-expressing cells treated with 1/100 the
dose. Fig 23B confirms that the OBD is sufficient to cause the stress response in response
to DNA damage by UV and etoposide. JNK and p38 activation in response to UV
irradiation and etoposide is mediated by upstream signaling components like Mkk3/6 in concert with nuclear DNA lesions. Fig 23C shows that OBD expressing cells show increased phosphorylation of Mkk3/6. The activated JNK/SAPKs or p38 translocate to the nucleus where they upregulate substrates like MAPKAP2 or phosphorylate transcription factors such as c-Jun, ATF2 (activating transcription factor 2). Fig 23D shows upregulation of phosphorylated ATF2 in OBD expressing cells in response to UV exposure. In addition, MAPKAP2, which is downstream of p38 and involved in cell
cycle arrest after DNA damage is upregulated after UV or etoposide treatment in OBD
expressing cells (Fig 23E and Fig 23F). Under stress conditions, FOX04 which belongs 131 to the forkhead superfamily of transcription factors that play major roles in control of cellular proliferation and apoptosis, can be phosphorylated via cjun N-terminal kinase
(JNK) leading to increased transcriptional activation of Fox04. Fig 23G shows increased
phosphorylation of Fox04 at Thr28 and Ser 128 in OBD expressing cells that are UV
irradiated. In addition, to test if LT or OBD can synergize with components of the JNK
and p38 MAPK pathway, luciferase reporter assays were performed. Fig 24A and B
shows that both LT and OBD can synergize with MKK3 or MKK6 (upstream component
of p38 pathway) or MLK3 and Mkk7 (upstream component of JNK pathway) to increase
transactivation by Gal4-ATF2 or cJun-luc respectively.
Moreover, various stress factors can induce phosphorylation of the alpha ( α) subunit of eukaryotic translation initiation factor eIF2 at serine 51 (S51) that results in the downregulation of the overall rate of protein synthesis (for review, see Wek et al., 2006;
Kaufman et al., 2004). Fig 24C shows increased phosphorylation of eif2 α at Ser51
suggesting global inhibition of protein synthesis in OBD expressing cells after UV
induced DNA damage.
All of these stress responses are a prelude to apoptotic cell death. DAPI staining
(Fig 25A, B) shows condensed and fragmented nuclei after either UV or etoposide
treatment.
132
treatmentA.
Phospho JNK1/2 Total JNK1/2 Phospho p38 Total p38 LT
UV4 UV40 UV400 UV4 UV40 - UV - UV
Figure 23: Cellular Responses to DNA Damage in the Presence of LT or DBD. A: Polyoma large T enhances stress responses to UV: Uninduced MEFs or those expressing LT after removal of doxycycline were exposed to UV light (4, 40, or 400 J/m 2) or untreated. After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against phospho JNK, Total JNK, phospho p38, p38 or LT.
133
. B.
- UV UV40 -Eto Eto Phospho JNK1/2 Phospho JNK1/JNK2 Total JNK1/2 Total JNK2/JNK1 Phospho p38 Phospho p38 Total p38 Total p38 OBD OBD
B: OBD enhances stress responses to UV: Uninduced MEFs and those expressing OBD were exposed to UV light (40 J/m 2) or left untreated. Samples were prepared and treated as in A. C. OBD enhances stress responses to etoposide: Uninduced MEFs and those expressing OBD were exposed to UV light (40 J/m 2) or left untreated. Samples were prepared and treated as in A. 134
a- C. -UV UV40 D. -UV UV40 C. Phospho- hn MKK3/MKK6 Phospho-ATF2 nnnjjjjjjjjjjjjjjjjjjjjjjjjOBD Total ATF2 ß-actin OBD
ß-actin
E.
-Eto Eto F MAPKAP2 . -UV UV40 Phospho ATF2 MAPKAPK-2 Total ATF2 Total p38 OBD OBD ß-actin
G . -UV UV40
Phospho Foxo4 Thr 28
Phospho Foxo4 Ser 193
ß-actin OBD 135
Fig 23: Polyoma large T upregulates MAPK signaling to UV: C: Uninduced MEFs or those expressing OBD after removal of doxycycline were exposed to UV light (40 J/m 2) or untreated. After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against phospho MKK3/MKK6, β-actin and OBD. D. Cells were processed exactly as above and blotted with with antibodies against phospho ATF2, Total ATF2, β-actin and OBD. E.Polyoma large T upregulates MAPKAPK-2 signal to etoposide: Uninduced MEFs or those expressing OBD after removal of doxycycline were exposed to etoposide (100 M) or untreated. After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against MAPKAPK-2, β-actin and OBD. F. Polyoma large T upregulates MAPKAPK-2 signal to UV: Uninduced MEFs or those expressing OBD after removal of doxycycline was exposed to UV light (40 J/m 2) or untreated. After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against MAPKAPK-2, β-actin and OBD. G: Polyoma large T increases phosphorylation of Fox04 in response to UV: Uninduced MEFs or those expressing OBD after removal of doxycycline was exposed to UV light (40 J/m 2) or untreated. After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against phospho Fox04 Thr 28/ Ser 193, β-actin and OBD.
136
A.
180 160 140 120 100 80
Luc Values 60 40 20 0 OBD - + - - - + - + - LT - - + - - - + - + MKK6 - - - + - + + - - MKK7 - - - - + - - + + TKGal4Luc Gal4ATF2 137
B.
200 180 160 140 120 100 80 Luc values 60 40 20 0
OBD - - + - - + + - - LT - + - - - - - + + MLK3 - - - + - - + - + MKK3 - - - - + + - + - cJunLuc
138
Fig 24 : Polyoma LT and OBD synergizes with components of the MAPK cascade (Mkk6/Mkk7): A. NIH 3T3 cells were cotransfected with TKGal4luc (1 g), Gal4ATF2 (1 g), Mkk6 or Mkk7 (1 g), LT or OBD (1 g). Cells were harvested after 48 h and luciferase values were read. β-Gal (500ng) were used as internal control. B. Luciferase reporter assays to show that Polyoma LT and OBD synergizes with components of the MAPK cascade (MLK3): NIH 3T3 cells were cotransfected with cJun-luc (1 g), Gal4ATF2 (1 g), MLK3 (1 g), LT or OBD (1 g).Cells were harvested after 48 h and luciferase values were read. β-Gal (500ng) were used as internal control.
139
C.
-UV UV40
Phospho eif2a Ser 51
Total eif2 a
ß-actin
OBD
Fig 24C:Polyoma large T upregulates phosphoryation of eif2 α-signal in response to UV: A: Uninduced MEFs or those expressing OBD after removal of doxycycline were exposed to etoposide (40J/m 2) or untreated. After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against phospho eif2 α, Total eif2 α, β- actin and OBD.
140
A. UNINDUCED +UV
OBD INDUCED OBD+UV
B.
3 HOURS 6 HOURS -ETO 9 HOURS AFTER ETO AFTER ETO AFTER ETO UNINDUCED INDUCED
Fig 25: OBD induces morphological changes of the nucleus after UV/etoposide treatment: A: Nuclear morphology in uninduced or OBD-expressing cells seen by DAPI staining and fluorescence microscopy (200X) without UV or after UV exposure (40 J/m 2). B: Nuclear morphology in uninduced or OBD-expressing cells seen by DAPI staining and fluorescence microscopy (200X) without etoposide or after etoposide (100 M) exposure. 141
Experiments to test for DNA fragmentation, a characteristic marker of apoptosis showed appearance of DNA laddering in the cells that express OBD post-UV irradiation or etoposide treatment (Fig 26A). Another marker for apoptosis is the activation and cleavage of PARP-1 (Poly ADP Ribosyl polymerase-1 (Lazebnik et al., 1994). PARP-1 is a multifunctional protein that plays an important role in transcription, DNA repair, DNA stability, and chromatin modifications (Los, Mozoluk et al. 2002, Hong et al., 2004). LT or OBD enhanced the activation of poly ADP ribose polymerase (PARP) as seen by its cleavage and ADP ribosylation of cellular proteins.The activation of PARP-1 could be confirmed by blotting for ADP-ribosylated products (PAR) (Fig 26B,C). It took 100 times as much UV to generate the same amount of PARP cleavage in uninduced cells as in LT expressing cells (Fig 27). The activation of PARP was important for the apoptosis, because when cells were pretreated overnight with 30 M of TiQA (an inhibitor of PARP-
1) prior to UV exposure, PARP-1 activation, ADP-ribosylation and nuclear fragmentation were abrogated (Fig 28A, B).
142
UV ETO OBD - + - + C M A
Fig 26:OBD enhances DNA laddering: A: Low molecular weight DNA was extracted from uninduced or OBD expressing cells after 40 J/m 2 UV or 100 µM etoposide treatment. Serum starved NIH 3T3 positive controls. Serum starved uninduced cells (C) cells exhibit DNA laddering. Lane M represent DNA size markers.
143
B C. NO UV UV 40 NO UV UV 40
PARP-1 116 Kda 89 Kda OBD PAR
ß-Actin OBD ß-Actin
B: OBD enhances PARP cleavage and PARylation: MEFs expressing OBD or uninduced cells were exposed to UV (40 J/m 2) or untreated. Cell extracts harvested one hour later were resolved by SDS PAGE and tested by western blotting for PARP-1, OBD or β-actin as a loading control . C . MEFs expressing OBD or uninduced cells were exposed to UV ( 40J/m 2) or untreated. Cell extracts harvested one hour later were resolved by SDS PAGE and tested by western blotting for polyADP ribose (parylation), OBD or β-actin as a loading control.
144
.
PARP-1 Total p38
LT
UV4 UV40 UV400 UV4 UV40 - UV - UV
Fig 27: LT Enhances PARP Activation and PARylation after UV. MEFs expressing LT or uninduced cells were exposed to UV light (4, 40,or 400 J/m 2) or untreated. Cell extracts harvested 1h post treatment were resolved by SDS PAGE and tested by western blotting for PARP-1, p38 as a loading control and LT. 145
A.
NO UV UV40
TiQA - - + + - - + +
PARP-1
PAR
OBD ß-Actin
1 2 3 4 5 6 7 8
Fig 28:Pretreatment of MEFs with PARP Inhibitor, TiQA: A.MEFs expressing OBD or uninduced cells were pretreated overnight with TiQA and exposed to UV (40 J/m 2) or untreated. Cell extracts harvested one hour later were resolved by SDS PAGE and tested by western blotting for PARP-1, poly ADP ribose polymerase, OBD or β-actin as a loading control . 146
B.
NO UV UV40 UV40 +TiQA UNINDUCED OBD INDUCED
B.Ti QA protects against cell death: Nuclear morphology in uninduced or OBD- expressing cells seen by DAPI staining and fluorescence microscopy (200X) without UV or after UV exposure (40 J/m 2) following pretreatment overnight with TiQA (100 M). 147
PARP-1 catalyzes ADP-ribose transfer from NAD + to specific acceptor proteins in response to DNA damage (Lazebnik et al., 1994) . Excess NADH consumption results in
depletion of cellular energy resources, which is sensed by mitochondria. This triggers the
release of apoptosis initiation factor (AIF) from the mitochondria which then translocates
into the nucleus (Hong et al., 2004). Using anti-AIF antibodies in immunofluoresence, we
observed that there was AIF translocation into the nucleus in OBD expressing cells after
UV irradiation that was absent in uninduced cells (Fig 29A). Apoptotic stimuli also can
cause cytochrome c release from mitochondria due to loss of integrity of the mitochondrial
membrane. Cytochrome c induces apoptosis when released into the cytosol. Fig 29B shows
diffused cytochrome c immunofluorescence staining of OBD expressing cells after UV
irradiation that was not observed in uninduced cells.
148
UNINDUCED
UV40
FITC LABELLEDAIF DAPI MERGED IMAGE
UV40
INDUCED
UNINDUCED
NO UV
FITC LABELLEDAIF DAPI MERGED IMAGE
NO UV
INDUCED 149
Fig 29 A: OBD affects localization of AIF after UV exposure: MEFs expressing OBD or uninduced cells were exposed to UV (40 J/m 2) or untreated. Cells were fixed one hour later and processed for immunofluorescence detection of AIF localization using primary antibody to AIF and FITC labeled secondary antibody. DAPI staining was used to stain for nuclear chromatin.
150
UNINDUCE D
UV 40
TRITC LABELLED DAPI MERGED IMAGE CY T C
UV40
INDUCED
UNINDUCED
NO UV
TRITC LABELLED CYTC DAPI MERGED IMAGE
NO UV
INDUCED 151
Fig 29B: OBD affects localization of CytC after UV exposure: MEFs expressing OBD or uninduced cells were exposed to UV (40 J/m 2) or untreated. Cells were fixed one hour later and processed for immunofluorescence detection of Cyt C localization using primary antibody to Cyt C and TritC labeled secondary antibody. DAPI staining was used to stain for nuclear chromatin.
152
Changes in death proteins are expected in cells undergoing apoptosis (Tsujimoto., 2002).
As shown in Fig 30, the pro-death protein BAD is upregulated in cells expressing LT treated with 40J/m 2 UV, while that upregulation is seen in uninduced cells treated with 100 times the dose of UV. In parallel, the pro-survival protein BclXL is down regulated in LT expressing cells and uninduced cells treated with high levels of UV. There is one unexpected difference between LT expressing cells and uninduced cells. The BH3 protein
BIM disappears after UV treatment even at low UV dose in uninduced cells while it is shifted in mobility, but not degraded in LT cells (Fig 30 ). Intriguingly, after UV treatment in OBD-cells, Bim unexpectedly translocates to the nucleus (Fig 31).The significance of this effect is not clear. Using lentiviral shRNA to target and silence Bim, cells were isolated which had lost almost all Bim expression (Clone 5) (Fig 32). However, an efficient knockdown of Bim did not protect cells from enhanced damage caused by OBD (Fig 33). 153
BclXl
Bim BAD Total p38
LT UV4 UV40 UV400 UV4 UV40 NO UV NO UV
Fig 3 0: Effect of LT on Death/Survival Proteins After UV Exposure .A: MEF uninduced controls that were not expressing LT and LT-expressing MEFs were unexposed or exposed to increasing amounts of UV (4, 40 or 400 J/m 2). After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against BAD, BclXl, Bim, p38 as a loading control and LT.
154
BIM DAPI MERGED
+ OBD NO UV
- OBD NO UV
+ OBD UV40
- OBD UV40
Fig 31: OBD affects localization of Bim after UV exposure . MEFs not expressing or expressing OBD were untreated or exposed to 40 J/m2 UV irradiation. After one hour, they were stained (TRITC) with antibody to Bim and DAPI. Individual fluorescence images and the merged images are shown.
155
CON 1 2 3 4 5
Bim
ß-actin
OBD
Fig 32: Lentivirus mediated Bim shRNA knockdown in MEFs inducibly expressing OBD: Bim shRNAs were to used to knockdown Bim in MEFs inducibly expressing OBD by lentivirus infections. Clone 5 as indicated in the western blot showest highest knockdown and were used for subsequent assays. 156
Bim K/D +UV40
WT+UV40
WT-UV
UNINDUCED INDUCED
Fig 33: Bim shRNA knockdown (Clone 5) does not inhibit sensitization of cells to UV . MEFs inducibly expressing OBD and cells with Bim knockdown were untreated or exposed to UV light (40 J/m 2). Morphology of cells is shown 16 h after stress treatment.
157
OBD Reduces Apoptotic Effect of Serum Starvation
As noted in the introduction, large T has been reported to be not only proapoptotic but
antiapoptotic as well. The same is true of OBD. Serum starvation or the restriction of the
supply of nutrients induces apoptosis in healthy cells. Strikingly, expression of OBD
suppresses apoptosis in cells after serum starvation. Fig 34A shows DAPI staining of
serum starved cells that express OBD. OBD protects cells against effects of serum
starvation while uninduced cells undergo cell death characterized by nuclear
condensation and disintegration. OBD protects cells against DNA fragmentation as seen
by the absence of DNA laddering under serum starvation conditions as seen in Fig 34B.
Additionally, Fig 35 shows that OBD also inhibits PARP-1 cleavage and activation as
well as PARylation under serum starvation conditions. Moreover, Fig 36 shows diffused
cytochrome C immuno-fluorescence staining only in the absence of OBD indicative of
apoptosis induction after overnight serum starvation. All of these results point to a
prosurvival OBD phenotype, emphasizing again the conditional nature of signaling. 158
-SS +SS
SS M C - + OBD UNINDUCED INDUCED
Fig 34: OBD reduces the apoptotic effect of serum starvation: A: Nuclear morphology in uninduced or OBD-expressing cells as seen by DAPI staining and fluorescence microscopy (200X) after serum starvation overnight. B: OBD prevents DNA laddering under serum starvation conditions: Low molecular weight DNA was extracted from uninduced or OBD expressing cells after serum starvation overnight. NIH 3T3 in normal growth medium as negative controls (C) cells that do not exhibit DNA laddering. Lane M represents DNA size markers.
159
CON SS CON UV40 SS PAR PARP-1
OBD
ß-Actin ß-actin
OBD
Fig 35: LT and OBD inhibit PARP activation and PARylation after serum starvation overnight : MEFs expressing OBD or uninduced cells were serum starved or untreated. Cell extracts harvested 1h post treatment were resolved by SDS PAGE and tested by western blotting for PARP-1, polyADP ribose (parylation), β-actin as a loading control and OBD.
160
UNINDUCED
Serum Starved
TRITC LABELLED DAPI MERGED IMAGE CYT C
Serum Starved
INDUCED
UN IND UCED
N O S TARV ATIO N
TRITC LABELLED D AP I MERGED IM AGE C YT C
N O S TARV ATIO N
INDUCE D
Fi g 36: OBD affects localization of Cytochrome C after serum starvation .: MEFs not expressing or expressing OBD were untreated or serum starved overnight. After this, they were stained (TRITC-labelled) with antibody to Cyt C and DAPI. Individual fluorescence images and the merged images are shown.
161
Polyoma LT/OBD Enhances DNA Damage From UV Irradiation and Etoposide
Treatment.
Although in principle the effects of survival just discussed could arise from LT modulating survival pathways, it seemed more likely that LT was enhancing DNA damage caused by UV or etoposide. Comet assays can be used to detect single (SSB) or double-strand DNA (DSB) breaks in a single cell by lysis under alkaline conditions followed by electrophoresis of the cells (Garaj-Vrhovac, V., and N. Kopjar . 2003).
Damage is seen as a comet that can be quantified by calculating the olive tail moments
that reflect the relative amount and distribution of DNA in the tail. MEF controls or cells
induced to express OBD were exposed to UV light (40J/m2) or Etoposide (100 M).
Cells were processed immediately after UV irradiation or 1 hour after etoposide was added. Comet tails were observed for OBD expressing cells that had been exposed to
DNA damage. On the other hand, cells that do not express LT or OBD displayed nuclear
DNA without the characteristic streaming that is observed in the presence of DNA damage even after exposure to UV (Fig 37). The average olive tail moments calculated using CASP (Patton et al., 1999) were 25(40J/m 2 UV, OBD) and 2(40J/m 2 UV, No OBD)
both immediately and one hour post stress treatment (Fig 38A). DNA damage mediated
by OBD after UV exposure depends upon UV dose as seen in Fig 38B.. The average
olive tail moments increased with increased UV dose (180 J/ m2 ). Uninduced cells could be treated with UV to produce comets, but it again required much higher doses of UV
(400J/m 2) to produce the effect as LT at 4J/m 2 (Fig 39A) Like UV, etoposide treatment resulted in more DNA strand breaks in OBD expressing cells than in uninduced cells (Fig
39B). 162
Fig 37: OBD enhances DNA damage: Representative images of comets from uninduced MEF cells or OBD expressing cells after UV (40J/m2 ) or etoposide (100 µM).
163
A.
40 35 30 25 20 OTM 15 10 5 0 UV UV4040J/m2 0' 0’ -DBD UV 40J/m2 UV40 0' +DBD0’ UV UV4040J/m2 60' 60’ -DBD UV 40J/m2 UV40 60' 60’+DBD
-OBD +OBD -OBD +OBD
B.
OTM
UV180 0’ UV180 0’ UV180 60’ UV180 60’ -WT +WT -WT +WT
Fig 38:OBD enhances DNA damage after UV exposure: A: CASP calculated tail moments from analysis of alkaline comet assays of uninduced or OBD-expressing cells untreated or after UV 40 J/m 2. Samples were collected either immediately or sixty minutes after treatment. Data are shown for a representative experiment, where at least 100 comets were quantitated for condition. B: DNA damage depends on UV dose: CASP calculated tail mo ments from analysis of alkaline comet assays of uninduced or OBD-expressing cells untreated or after UV 180 J/m 2. Samples were collected either immediately or sixty minutes after treatment. Data are shown for a representative experiment, where at least 100 comets were quantitated for condition. All data are representative of experimeriments performed in triplicates.
164
80 70 60 50
40 OTM 30 20 10 0 No UV UV4 No UV UV40 UV400 +LT +LT -LT -LT -LT
70 60
50
40
OTM 30
20 10
0 - ETO - ETO ETO 45' ETO 45' ETO 60' ETO 60' -OBD +OBD -OBD +OBD -OBD +OBD
Fig 39: OBD enhances DNA damage: CASP calculated tail moments from analysis of alkaline comet assays of uninduced or OBD-expressing cells untreated or after UV 4, 40, 400 J/m 2. Samples were collected sixty minutes after treatment. Data are shown for a representative experiment, where at least 100 comets were quantitated for condition. B: CASP calculated tail moments from analysis of alkaline comet assays of uninduced or OBD-expressing cells untreated or after etoposide treatment (100 M). Samples were collected either 45’ minutes or 60’ after treatment. Data are shown for a representative experiment, where at least 100 comets were quantitated for condition. All data are representative of experiments performed in triplicates. 165
A concern might be whether the DNA breakage seen in the comet assays is a reflection of the apoptosis caused by DNA damage and LT/OBD. Two kinds of observations argue against this.First, the comet tails are observed even when cells are placed at 4 oC and processed immediately after UV treatment (Fig 38A, B). More convincingly, treatment with PARP inhibitor TiQA blocked poly-ADP ribosylation, nuclear fragmentation and induction of the death protein BAD (Fig 40A) but had no effect on the generation of comets immediately after UV treatment (Fig 40C). Both results indicate that the breakage observed is part of the DNA damage/repair process and not apoptosis.
Interestingly, although TiQA protects cells against cell death in LT expressing cells after UV or etoposide exposure (Fig 28B), it does not inhibit JNK or p38 activation
(Fig 40B) or the mobility shift of Bim (Fig 28A). This suggests that perhaps LT directly targets JNK, p38 or Bim at a level upstream of the effect of TiQA. Furthermore, this also indicates that this effect is not a part of the general apoptotic pathway that is blocked by
TiQA.
166
A.
CON UV UV+TiQA
PAR
Bim
BAD
ß-Actin
OBD
B.
CON UV UV+TiQA
PAR
Phospho JNK1/2
Phospho p38 Total p38 OBD 167
Fig 40: TiQA blocks components of the general apoptotic pathway and does not affect the elements directly regulated by OBD : A: TiQA blocks increase in polyADP ribosylation and upregulation of BAD but does not affect the mobility shift of Bim: Uninduced MEFs that were not expressing OBD and OBD-expressing MEFs were unexposed or exposed to UV (40 J/m 2). After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against PAR, BAD, Bim, β-actin as a loading control and LT. B. Pretreatment with TiQA does not block phosphorylation of JNK and p38 in response to UV signal: Uninduced MEFs or those expressing OBD after removal of doxycycline were pretreated with TiQA (30 M) overnight and exposed to UV light (40 J/m 2) or untreated. After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against PAR, phospho-JNK1/2, phospho- p38, Total p38 and OBD.
168
C.
80 70 60 50 40 O TM 30 20 10 0 NO UV NO UV UV40 60' UV40 60' NO UV No UV UV40 60' UV40 60' -OBD -OBD -OBD -OBD +OBD +OBD +OBD +OBD +TiQA +TiQA +TiQA +TiQA
C: Quantification of DNA damage with or without TiQA pretreatment in control or OBD expressing MEFs : CASP calculated tail moments from analysis of alkaline comet assays of uninduced or OBD-expressing cells untreated or after UV 40 J/m 2. Samples were either untreated or pretreated overnight with TiQA (30 M), then either untreated or treated with UV 40 J/m 2, collected either immediately or sixty minutes after UV treatment. Data are shown for a representative experiment, where at least 100 comets were quantitated for condition. All data are representative of experiments performed in triplicates.
169
Polyoma LT Does Not Enhance Formation of Photolesions Following UV-irradiation
The next question to be answered is whether the cells expressing LT are somehow more sensitive to the initial DNA insult, perhaps from something like a change in chromatin structure, or whether the effect is more downstream at the level of DNA repair.
This is most easily tested after UV irradiation. Cyclobutane pyrimidine dimer (CPD) and pyrimidine-pyrimidone (6-4) photoproduct (64PP) are major DNA lesions directly induced by UV light irradiation (Reardon et al., 2003). These lesions can be detected using antibodies that specifically recognize the altered bases. FACS analysis can be used to quantify them. Fig 41A shows that 6-4PP formation increases as the dose of UV increases from 4 J/m 2 to 40 J/m 2 to 400 J/m 2. However, the amount of damage produced when LT is being expressed is no different than in uninduced cells. The same result was obtained for pyrimidine dimer photoproducts asshown in Fig 41B. Similar results were also obtained by immunostaining and Image Stream analysis to quantitate the initial amount of 6-4 PP damage in cells on coverslips (Fig 42A, B). The conclusion from these experiments is that the LT effect is on the repair process and not on the initial formation of damaged DNA. It might be asked whether the LT expressing cells initiate any repair process. Chk1 is activated by UV when OBD is expressed (Fig 43A) and γ-H2AX is
dramatically upregulated by etoposide in the presence of OBD (Fig 43B). Moreover,
γH2AX assembles in nuclear foci after UV irradiation in OBD expressing cells as shown
in Fig 43C. Rad 50, a component of the MRE11-RAD50-NBS1 (MRN) complex that
recognizes DNA damage and is involved in DNA repair is upregulated by etoposide in
presence of OBD (Fig 43D). Furthermore, there is increased phosphorylation of NBS1
after UV exposure (Fig 44B).These results along with the comet data suggest that repair 170 can be initiated but that DNA strand breaks are not repaired. Caffeine, an ATM/ATR inhibitor, does not protect against cell death caused by UV in the presence of OBD as shown in Fig 44A. It decreases the level of CHK1 and γ-H2AX but does not affect the level of phosphorylated NBS1 of the MRN complex as well as the activation and cleavage of PARP-1 suggesting that regulation of ATM/ATR DNA repair pathway by LT may be independent of the regulation of the MRN complex or PARP-1 (Fig 44B). 171
A . UV 400 UV 40
No UV UV 4 LT 64PP CON 64PP Number
FL1H
UV 400 B.
UV 40
NO UV UV 4
LT CPD CON CPD Number
Fig 41: LT does not affect the formation of photolesions: A: MEFs induced to express LT or uninduced cells were exposed to 0, 4, 40 and 400 J/m2 UV irradiation and then stained immediately with anti-64PP antibody to analyze FITC-fluorescence (2 o antibody) by FACS analysis. B: MEFs inducibly expressing LT or uninduced cells were exposed to 0, 4, 40 and 400 J/m2 UV irradiation and then stained immediately with antibody against CPD to analyze FITC-fluorescence (2 o antibody) by FACS analysis.
172
A.
NO UV UV40 NO UV UV40
UNINDUCED -
FITC-LAB FITC-LAB αααCPD ααα 64PP
INDUCED
Fig 42A: LT does not affect the formation of photolesions: MEFs induced to express LT or uninduced cellss were exposed to 0 and 40 J/m2 UV irradiation and then stained immediately with anti-CPD and anti-64PP antibody to analyze FITC-immunofluorescence (2 o antibody).
173
B. 60
40 R ow C ountNO UV
CELL CON, UV 40 Jm -2 NUMBER 20 LT, UV 40 Jm -2
0
0 10000 20000 30000 40000 50000 60000 70000 80000 90000 100000 110000 120000 130000 140000 150000 160000 170000 180000 190000 200000 FITC (Log Variable) [Cell Measurement] [Mean] (red) FLUORESCENCE INTENSITY
100
80 120
100
60 NO UV UV 400 Jm -2 80 40 Jm -2 UV
60 40 R ow C ount CELL Row Count
NUMBER 40
20 20
0 0 0 50000 100000 150000 200000 250000 300000 350000 400000 450000 500000 550000 600000 650000 700000 750000 800000 850000 900000 950000 1000000 0 10000 20000 30000 40000 50000 60000 70000 80000 90000 100000 110000 120000 130000 140000 150000 160000 170000 180000 190000 200000 FITC (Log Variable) [Cell Measurement] [Mean] (red) FITC (Log Variable) [Cell Measurement] [Mean] (red) FLUORESCENCE INTENSITY
Fig 42B: LT does not affect the formation of photolesions: MEFs induced to express LT or uninduced cells were exposed to 0, 4, 40 and 400 J/m2 UV irradiation and then stained immediately with anti-64PP antibody to analyze FITC- fluorescence (2 o antibody) by Image Stream analysis for detection of fluorescence in monolayer (This experiment was done by Rowena DeJesus).
174
NO UV UV40 Phospho Chk1 A.
ß-Actin
OBD
B.
CON UV40 ETO
y-H2AX
H2AX OBD
Fig 43: OBD increases DNA damage responses: A.Uninduced MEFs that were not expressing OBD and OBD-expressing MEFs were unexposed or exposed to UV (40J/m 2). After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against phospho-Chk1 (Ser 345) and OBD. β-actin was used as a loading control. B. Uninduced MEF that were not expressing OBD and OBD-expressing MEFs were unexposed or exposed to UV (40J/m 2). After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against γH2AX, Total H2AX and OBD. β-actin was used as a loading control.
175
C. -OBD-UV OBD-UV -OBD+UV OBD+UV
TRIT C LABELLED
YH2AX
D. -Eto Eto Rad50 OBD ß-Actin
43 C: Polyoma OBD induces γH2AX repair foci formation in response to UV: MEFs not expressing or expressing OBD were untreated or exposed to 40 J/m2 UV irradiation. After 4h, they were stained (TRITC) with antibody to γH2AX. Individual fluorescence images are shown. D. Uninduced MEFs that were not expressing OBD and OBD-expressing MEFs were unexposed or exposed to UV ( 40J/m 2). After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against RAD50, OBD. β-actin was used as a loading control.
176
A. - UV UV40 UV40+Caffeine UNINDUCED OBD INDUCED
CON CON+CA UV40 UV40+CA B. Phospho-NBS1 PARP-1 Phospho CHK1
Y-H2AX ß-actin OBD 177
Fig 44: Caffeine does not block cell death induced by UV irradiation in the presence of OBD: A. Nuclear morphology in uninduced or OBD-expressing cells seen by DAPI staining and fluorescence microscopy (200X) without UV or after UV exposure (40 J/m 2) following pretreatment overnight with Caffeine (50 M). Untreated MEFs are negative controls. B. MEFs either not expressing OBD or inducibly expressing OBD were pretreated overnight with Caffeine (50 M). Cells were UV irradiated (40 J/m 2).After 1h, extracts were harvested and subjected to SDS PAGE, western blots were performed with antibodies against phospho-NBS1, PARP-1, Phospho-Chk1, γ-H2AX, OBD and β-actin as loading control. 178
Genetic Analysis of OBD Function To Determine the Basis for Sensitization to DNA
Damaging Agents
The polyoma OBD is multifunctional. It is responsible for binding DNA in both a site-specific and non-site-specific manner (Cowie, A., and R. Kamen. 1986; Cowie, A., and R. Kamen. 1984; Love et al., 2005; Pomerantz et al., 1983; Scheller et al., 1985). It is able to activate transcription through CREB sites, in part by binding to CREB (51).
Although not previously tested, based on analogy to SV40 LT, the OBD would be expected to bind RPA, the single-stranded DNA binding protein ( Weisshart et al., 1998;
Jiang et al.,2006). Genetic analysis was used to sort out which function(s) is required to sensitize cells to DNA damage.
DNA Binding Is Not Required for Sensitization.
LT specifically binds GAGGC pentanucleotide repeats (Cowie et al., 1986; Cowie et al., 1984; Pomerantz et al., 1983; Scheller et al., 1985). In SV40 LT, A1 and B2 elements in the origin binding domain are required for sequence specific recognition of the 5’GAGGC3’ pentanucleotide repeats within the SV40 origin (Simmons et al., 1990).
Serine 306 in polyoma large T, based on sequence homology with SV40, lies within the
A1 element. V358A of polyoma LT would be in the B2 element. Mutant S306P was previously found to be defective for sequence specific recognition of polyoma origin sequences (Love et al., 2005). In addition, for SV40, the origin binding domain (OBD) is also involved in non-specific DNA binding (Wun-Kim et al., 1993). Previous studies demonstrate that the double mutant S306P/V358A is defective even for non-specific
DNA binding (Love et al., 2005). In order to investigate the connection between DNA binding and sensitization of LT expressing cells to DNA damaging agents, stable MEF 179 cell lines that after induction express S306P and S306P/V358A mutants of large T at similar levels to wild type were obtained (Fig 45A). Dramatic morphological changes indicative of sensitization and induction of apoptosis after UV irradiation in cells that express either S306P LT or the double mutant S306P/V358A LT following exposure to
UV was observed (Fig 45B). Quantification of the DNA damage by comet assay showed that DNA damage induced by either of these mutants following UV irradiation is similar to wild type LT (Fig 45C). Similar results were obtained with etoposide (Fig 46).These results suggested that neither specific nor non-specific DNA binding function of LT contribute to its ability to induce sensitization following exposure to UV light or etoposide treatment.
180
A.
-WT +WT -S306P +S306P
LT
ß-Actin
+WT -WT +S/V -S/V
LT
ß-Actin
Fig 45: DNA binding functions do not regulate the ability of LT to enhance DNA damage. A. Mouse embryonic fibroblasts were obtained that inducibly express the site-specific (S306P) and both site-specific and non-site- specific (S306P,V358A) DNA binding LT mutant at similar levels to full length LT.
181
B. S306P,V358A UV UV S306P UV WT WT UV NO UV NO WT WT WT NO UV NO
UNINDUCED LT INDUCED UNINDUCED LT INDUCED
Fig 45B:DNA binding function does not regulate the ability of LT to sensitize cells to DNA damage: Left Panel: Site-specific (S306P) DNA binding mutant of LT sensitizes cells to UV. MEFs inducibly expressing wild type and S306P T were untreated or exposed to UV light (40 J/m 2).Right: Non-specific (S306P/V358A) DNA binding mutant of LT were untreated or exposed to UV (40 J/m 2). Right Panel : Non-site specific (S306P) DNA binding mutant of LT sensitizes cells to UV: MEFs inducibly expressing wild type and S306P T were untreated or exposed to UV light (40 J/m 2). The non-site specific (S306P/V358A) DNA binding mutant of LT were untreated or exposed to UV (40 J/m 2).
182
C.
80
60
40 OTM 20
0 UV40 UV40 - UV -UV UV40 UV40 -UV -UV -WT +WT -WT +WT -S306P +S306P -S306P +S306P
70 60 50 40 30 OTM 20 10 0 UV40 UV40 -UV -UV UV40 UV40 -UV - UV -WT +WT -WT +WT -S/V +S/V -S/V +S/V
Fig 45C:Quantification of the DNA damage induced by S306P T and S306P/V358A mutans of LT after UV treatment: Top Panel: CASP calculated tail moment from analysis of alkaline comet assays from control wild type or S306P expressing cells that were untreated or treated with UV (40 J/m 2). Data are shown for a representative experiment, where at least 100 comets were quantitated for each cell line. Bottom Panel : CASP calculated tail moment from analysis of alkaline comet assays from control wild type or S306P/V358A expressing cells that were untreated or treated with UV (40 J/m 2). Data are shown for a representative experiment, where at least 100 comets were quantitated for each cell line.
183
S306P, V358A WT No Eto WT +Eto S306P +Eto +Eto UNINDUCED LT INDUCEDLT
Fig 46A:Site-specific (S306P) DNA binding and non-site specific DNA binding mutant of LT (S306P/V358A) sensitizes cells to etoposide . MEFs inducibly expressing wild type and S306P LT or S306P/V358A LT were untreated or exposed to etoposide (100 M) for 6 hrs.
184
45
40
35
30
25 20 OTM 15
10
5
0 - E to - Eto E to E to E to Eto E to E to -WT + WT -WT +W T -S 306P +S 30 6P -S /V +S /V
Fig 46B: Quantification of DNA damage of S306P LT and S306P/V358A (S/V) after DNA damage by etoposide: CASP calculated tail moment from analysis of alkaline comet assays from control wild type or S306P/V358A expressing cells that were untreated or treated with etoposide (100 M) for 4hrs . Data are shown for a representative experiment, where at least 100 comets were quantitated for each cell line.
185
Transcriptional Activation by OBD Is Not Required for Sensitization.
The OBD is also capable of activating transcription at CREB sites (Love et al.,
2005). Both CREB binding and non-specific DNA binding functions were found to be
important for transcriptional activation. Three different mutants demonstrate that
transcriptional activation is not necessary to sensitize cells to DNA damage. Fig 45 and
46 showed that S306P/V358A, which is defective in non-specific DNA binding and
transcriptional activation (Love et al., 2005), nonetheless sensitizes the cells. Mutation
P402R/G403D reduces the transactivation of CREB responsive promoters by polyoma
large T (Fig 47A). This mutation is likely to change the very end of the OBD. Mutant
E343K/E344K, which should be altered in the central portion of the OBD in large T, is
also defective in transactivation (Fig 47B). Stable MEF cell lines expressing
P402R/G403D and EE343, 344KK were obtained. Both P402R/G403D and E343K/
E344K induced sensitization of cells to the effects of UV exposure and etoposide
treatment similar to wild type LT. Comet assays to quantify these results confirmed a
significant increase in DNA damage in MEFs expressing the mutant forms of LT (Fig 48).
That three different transactivation defective mutants still retain the ability to increase
DNA damage argues strongly that transcriptional activation by OBD is not important for
sensitization.
186
450 400 350 300 250 200 RL U 150 100 50 0
- CREB -- +WT +PGRD
450 400 350 300 250 200 RLU 150 100 50 0 - - CREB +WT +E - - 187
Fig 47: LT mutant defective in CREB transactivation: A: NIH 3T3 cells maintained under growing conditions (10% CS) were cotransfected with Gal4TK-Luc reporter and Gal4-CREB (CREB) and WT OBD or mutant P402R/G403D (PGRD).Cells were harvested 48 h post-transfection and assayed for luciferase activity. B. NIH 3T3 cells maintained under growing conditions (10% CS) were cotransfected with Gal4TK-Luc reporter and Gal4-CREB (CREB) and WT OBD or mutant E343K/E344K (E).Cells were harvested 48 h post-transfection and assayed for luciferase activity.
188
7 0 6 0
5 0
4 0 3 0 O T M OTM
2 0
1 0
0 - U V - U V - U V - U V + UV 40 + UV 40 + UV 40 + UV 40 -P G R D +P G R D - W T + W T -P G R D + P G RD - W T + W T
7 0
6 0
5 0
4 0
OTM 3 0 OTM
2 0
1 0
0 -UVNO UV -E NO-UV UV +E NO -UV UV -LT NO -UV UV +LT UV40 UV -E UV40 UV +E UV40 UV -LT UV40 U V +L T -E +E -W T +W T -E + E -W T +W T 189
Fig 48: LT mutant defective in Tranasctivation Through CREB Still Sensitizes Cells to DNA Damage: Top Panel: CASP calculated tail moment from analysis of alkaline comet assays from uninduced wild type (WT)or PGRD LT expressing cells (PGRD) that were untreated or treated with UV (40 J/m 2) and immediately analyzed for comets. Data are shown for a representative experiment, where at least 100 comets were quantitated for each cell line. Bottom Panel: CASP calculated tail moment from analysis of alkaline comet assays from uninduced wild type (WT)or E343K/E344K (E) that were untreated or treated with UV (40 J/m 2) and immediately analyzed for comets. Data are shown for a representative experiment, where at least 100 comets were quantitated for each cell line.
190
RPA Binding Is Critical For Sensitization to DNA Damaging Agents.
Since the OBD sensitizes cells to different kinds of DNA damage, it is plausible that some element common to repair of different kinds of damage is targeted by OBD.
RPA, a hetero-trimeric, single-stranded DNA binding protein, as discussed in the
Introduction, is such protein. Furthermore RPA is an indispensable component of SV40
DNA replication (Wobbe et al., 1987; Wold et al.,1987}. Recent studies have demonstrated that activation of the SV40 pre-replication complex requires recruitment of replication protein A on the emerging single-stranded DNA (Jiang et al., 2006). A physical interaction between the SV40 Tag with the RPA high-affinity ssDNA-binding domains (RPA70AB) was mapped to specific regions in the SV40 OBD (Jiang et al.,
2006). Since RPA is certainly also needed for polyoma DNA replication, the question of its role in DNA damage was tested.
First, the interaction of LT and OBD with RPA was demonstrated. Sequence comparison of polyoma and SV40 OBD showed that sequences identified as critical for
RPA binding were conserved in polyoma. Arginine 154 in SV40 OBD was a residue identified as critical for interaction with RPA (Jiang et al., 2006). The comparable residue, K308, was converted to glutamate (Fig 49). As shown before in Chapter 3,
(Fig 12A), GST-pulldown experiments were initially performed in which GST-RPA70A could bind either LT or OBD, but the mutant K308E failed to bind GST tagged RPA.
Mutants such as S306P, and more importantly S306P/V358A, which is defective in both specific and non-specific DNA as well as transcriptional activation, showed wild type
RPA binding. These interactions were further confirmed by performing immunoprecipitation experiments. Here, after cotransfection of GFP-tagged RPA70A 191
(Binz et al., 2006) and HA-tagged OBD or LT, LT or OBD were first immunoprecipitated with anti-T serum or anti-HA. RPA association was determined by blotting for GFP-tagged RPA using anti-GFP. GFP-tagged RPA70A was immunoprecipitated with LT (Fig 50A) or OBD (Fig 50B).
192
Fig 49: Sequence homology between SV40 OBD (Query) amd Polyoma OBD (Sbjct). Arginine 154 in SV40 OBD (Red arrow) was identified as critical for RPA binding. (Jiang et al., 2006). The comparable residue, K308, was converted to glutamate.Sequences in SV40 OBD (Query) highlighted inside blue box are conserved regions of SV40 OBD (F151-T155; F183-H187; H203-A207). 193
A.
1.5% INPUT IP
- - + + + + + + + - - + + + + + + + GFP-RPA
LT GFP-RPA
LT LT LT LT LT LT CON RPA RPA RPA RPA CON CON PGRD PGRD PGRD PGRD S306P S306P S306P S306P K308E K308E K308E S306P/V358A S306P/V358A S306P/V358A E343K/E344K E343K/E344K
Fig 50A: K308E does not bind RPA: Analysis of LT mutants for RPA binding. 293T
HEK cellswere cotransfected with control CMV vector (-) or CMV vectors expressing wild type LT; S306P; S306P/V358A; PGRD; E343K/E344K; K308E as well GFP- tagged RPA. Cells were harvested 48h post transfection and then immunoprecipitated with anti-T or anti-HA serum. The immunoprecipitate and whole cell extracts were blotted with antibody against GFP, LT.
194
B.
1.5% INPUT IP
LT K308E S306P/V358A OBD E343K/E344K LT K308E S306P/V358A OBD E343K/E344KK GFP-RPA
GFP-RPA
LT
OBD
GFP-RPA
Fig 50B: The Binding of OBD/LT to RPA: Analysis of LT mutants for RPA binding. 293T HEK cells were cotransfected with control CMV vector (-) or CMV vectors expressing wild type LT; S306P/V358A; E343K/E344K; HA-OBD and K308E as well GFP-tagged RPA. Cells were harvested 48h post transfection and then immunoprecipitated with anti-T or anti-HA serum. The immunoprecipitate and whole cell extracts were blotted with antibody against GFP, LT and HA.
195
To examine if LT sensitizes cells to DNA damage by interacting with RPA, we obtained stable MEF cell lines that inducibly express the K308E LT. Following UV or etoposide exposure, K308E LT failed to sensitize cells to the effects of the DNA damaging agents
(Fig 51). Strikingly, cells did not show any drastic morphological changes indicative of induction of cell death or apoptosis unlike wild type cells that were rounded, refractile and condensed. Comet assays to quantify these results confirmed that the RPA binding mutant fails to enhance the DNA damage response (Fig 52), suggesting that abrogation of the interaction of LT with RPA may be able to disrupt LT’s ability to increase DNA damage response in the host cell. Consistent with these observations, K308E mutant of large T did not enhance stress responses or activate PARP following UV irradiation unlike either the transcriptionally defective mutants or mutants defective in DNA binding functions (Fig 53).
196
K308EUV
WTUV
WTUV NO
UNINDUCE D LT I NDUCED
Fig 51: RPA binding defective mutant K308E does not sensitize cells to UV . MEFs inducibly expressing wild type and K308E LT were untreated or exposed to UV light (40 J/m 2). Morphology of cells is shown 16 h after stress treatment.
197
45 40 35 30 25 20 OTM 15 10 5 0 -U V -U V -UV -UV U V40 UV40 UV40 U V40 -WT +WT -K 308E +K308E -WT +WT -K 308E +K 308E
Fig 52: K308E does not enhance DNA damage after UV: CASP calculated tail moments from analysis of alkaline comet assays from uninduced wild type (WT)or K308E LT expressing cells (K) that were untreated or treated with UV (40 J/m 2) and immediately analyzed for comets. Data are shown for a representative experiment, where at least 100 comets were quantitated for each cell line.
198 -PGRD +PGRD -PGRD +PGRD -LT +LT -LT +LT -K308E +K308E -K308E +K308E -S306P/V358A +S306P/V358A -S306P/V358A +S306P/V358A
PhosphoJNK1/2 Phospho p38 Total JNK1/2 Total p38 PARP-1
BIM
BAD BclXL LT
UV - - + + - - + + - - + + - - + +
Fig 53: Comparison of stress responses induced by wild type LT, S306P (site- specific DNA binding defective), S306P/V358A (all DNA binding defective), PGRD (transactivation defective) or RPA-binding mutant K308E after exposure to UV (40 J/m2): Cells were allowed to recover for one hour. Cell extracts were then blotted with antibody against PARP-1, phospho JNK, JNK, phospho p38, p38, BAD, BclXL, Bim and anti-T serum.
199
To confirm these findings, a second mutant defective in RPA binding (E320A) was identified. It gave essentially identical results and did not cause increased DNA damage
(Fig 54 and Fig 55). Taken together, these results implied that the underlying phenomenon by which LT sensitizes cells to effects of DNA damaging agents is by binding or sequestering RPA to block its recruitment to sites of DNA damage. When the sustained DNA damage becomes irreparable, cells undergo apoptosis.
200
WT -LT UV WT LT UV E320A UV
UNINDUCED INDUCED
Fig 54: RPA binding defective mutant E320A does not sensitize cell s to UV. MEFs inducibly expressing wild type and E320A LT were untreated or exposed to UV light (40 J/m 2). Morphology of cells is shown 16 h after stress treatment.
201
45 40 35 30 25 20 OTM 15 10 5 0 -UV -UV -UV -UV UV40 UV40 UV40 UV40 WT WT E320A E320A WT WT E320A E320A UV
Fig 55: Quantification of DNA damage: CASP calculated tail moments from analysis of alk aline comet assays from uninduced wild type (WT) or E320A LT expressing cells that were untreated or treated with UV (40 J/m 2) and immediately analyzed for comets. Data are shown for a representative experiment, where at least 100 comets were quantitated for each cell line.
202
RPA binding mutant does not induce G2/M arrest
Previous studies report that Polyoma Large T induces G2/M arrest when large T is
introduced into cells with plasmids containing the polyoma origin of replication and not
in the absence of origin sequences (T.Love., PhD Thesis). The requirement for origin
sequences suggests that replication may be important for the effect. Mutant S306P LT
that failed to bind the origin fails to induce cell cycle arrest indicating that cells respond
to a signal based on DNA replication, presumably sensing the replication as an
incomplete S-phase or as a DNA damage signal. Consistent with this idea, large T was
found to synergize with Chk1 to drive G2/M arrest. Evidence from experiments with
dominant negative Chk1 or specific inhibitors of known G2 checkpoints such as caffeine
(a known inhibitor of ATM/ATR kinases) indicated that DNA damage signaling
molecules were mediating the LT induced arrest as caffeine successfully blocked LT-
induced G2/M arrest. Here, to test whether the RPA binding mutant of LT can induce a
DNA damage response like wild type LT in the presence of Chk1 and induce
accumulation of cells in G2/M, we examined the ability of K308E to synergize with
Chk1 and induce G2/M arrest in cells. Results from FACS analysis indicate that whereas
wild type LT is able to induce G2/M arrest when cotransfected with Chk1, the K308E
mutant abrogated the ability of LT to induce G2/M arrest (Fig 56). This is in agreement
with our previous data wherein K308E is unable to sensitize cells to DNA damage signals.
This implies that the RPA binding function of LT may be critical for its ability to enhance
DNA damage signals as well as synergize with known G2 checkpoints like Chk1 to
induce G2/M cell cycle arrest. 203
240
CON 180
Number
120
60
0 0 20 40 60 80 100 120 Channels (FL3-A)
200
150 LT Number 100 50 0 0 20 40 60 80 100 120 Channels 204 800
Chk1 600 400 200 0
0 20 40 60 80 100 120 Channels (FL3-A)
120 LT+Chk1 90 Number 60 30 0 0 20 40 60 80 100 120 Channels 205
200 E320A+Chk1 150 Number 100 50 0 0 20 40 60 80 100 120 Channels 206
G1 80 G2
S 70 60
50
40 % Cells % 30
20
10
0 CO N LT Chk1 E320A K308E LT E320A K308E +Chk1 +Chk1 +Chk1
Fig 56: Examining RPA binding mutant of LT (K308E) in ability to induce G2/M arrest. Cells were transfected with 3 g pCMV-LT, S306P, K308E and/or Chk1 and cotransfected with f-GFP DNA in the amount of 0.5 g. Extracts were fixed and subjected to propidium iodide staining and FACS analysis. The cell cycle distribution was analyzed using Modfit software.
207
To confirm the role of RPA in sensitization of cells expressing polyoma LT following exposure to DNA damaging agents, we generated stable MEF cell lines that inducibly expressed wild type OBD and simultaneously overexpressed GFP-tagged
RPA(Fig 57). Overexpression of RPA three times higher than endogenous RPA levels protected cells against DNA damage triggered by UV irradiation or etoposide treatment
(Fig 58). Unlike cells that express OBD alone, cells that overexpress RPA did not show the characteristic increase in tail moments in their DNA even in the presence of OBD after treatment with UV in comet assays (Fig 59). Notably, this protection was also not accompanied by either enhancement of stress responses or activation of PARP and
PARylation (Fig 60). Etoposide treated cells that express LT inducibly behaved similarly upon overexpression of RPA (Fig 61 and Fig 62). In conclusion, these results suggest that overexpression of RPA even in the presence of LT renders the MEFs resistant to
DNA damaging agents.
We do not know the relative stoichiometry of RPA and OBD. RPA is known to be regulated by modifications. The fact that relatively modest overexpression of RPA blocks sensitization by LT indicates that, binding (titration) renders RPA ineffective in DNA repair. If LT were to function by affecting modifications, we would not have expected overexpression to be successful. 208
o [RPA] OBD GFP RPA70 Endogenous OBD
Fig 57: Obtaining Cells that Overexpress RPA: Stable, MEF cell lines that inducibly express OBD were used to obtain cells overexpressing RPA using GFP- tagged RPA70 ([RPA] o). Cell extracts were tested by western blot for endogenous and GFP-RPA.
209
UV40 o
WT UV40 [ NO WTUV RPA]
UNINDUCED OBD INDUCED
Fig 58: RPA overexpression protec ts cells against effects of DNA damage : MEFs inducibly expressing OBD or expressing OBD as well as GFP-RPA were untreated or exposed to UV light (40 J/m 2). Morphology of cells is shown 16 h after stress treatment.
210
7 0 6 0 5 0 4 0 3 0 OTM 2 0 1 0 - 0 UV40 UV40 - UV -UV UV 40 UV 40 -U V -UV - [R PA] o +[R PA] o -[ RPA]o +[ RPA]o - W T +W T - W T + WT
Fig 59: Quantification of DNA damage with RPA overexpression after UV treatment :CASP calculated tail moments from analysis of alkaline comet assays uninduced or OBD-expressing cells with or without exogenous GFP-RPA70 overexpression either without UV treatment or immediately after UV (40 J/m 2 ) . Data are shown for a representative experiment, where at least 100 comets were quantitated for each cell line.
211
UV40 NO UV UV40 NO UV
[RPA] O [RPA] O[RPA] O[RPA] O WT WT WT WT GFP RPA70 Endogenous
PARP-1
Phospho JNK1/2 Phospho p38 Total p38
Total JNK1/2
OBD
Fig 60: Cellular Responses to DNA Damage with RPA Overexpression in the presence of OBD: RPA overexpression blocks enhanced stress responses to UV: Control MEFs that were not expressing GFP-RPA or those MEFs that were expressing GFP-RPA in the presence of OBD after removal of doxycycline or uninduced cells were exposed to UV light (40 J/m 2) or untreated. After one hour, cell extracts were harvested, separated by SDS PAGE, and blotted with antibodies against endogenous and GFP-tagged RPA70, phospho JNK, Total JNK, phospho p38, total p38, PARP-1 or OBD.
212 ETO o WT NO WT ETONO WT ETO [ RPA]
UNINDUCED INDUCED
Fig 6 1: RPA overexpression protects cells against effects of etoposide: MEFs inducibly expressing OBD only or expressing OBD as well as GFP-RPA were untreated or exposed to etoposide (100 M). Morphology of cells is shown 16 h after stress treatment.
213
60
50
40
30 OTM 20
10
0 Eto Eto -Eto -Eto Eto Eto -Eto -Eto -[RPA]o +[RPA]o -[RPA]o +[RPA]o -WT +WT -WT +WT
Fig 62: Quantification of DNA damage with RPA overexpression after etoposide treatment : CASP calculated tail moments from analysis of alkaline comet assays of uninduced or OBD-expressing cells with or without exogenous GFP-RPA70 overexpression either without etoposide treatment or 60’ after etoposide (100 M) . Data are shown for a representative experiment, where at least 100 comets were quantitated for each cell line.
214
Discussion
Our results show that expression of LT sensitizes cells as much as one-hundred fold to DNA damage from UV irradiation. The multifunctional OBD of LT is sufficient for this sensitization.The result is cell death in response to damage where normal cells recover. LT does not modulate the initial DNA damage as measured by the formation of photoproducts after UV exposure, but rather interferes with repair. The result is excessive DNA damage revealed by the comet assays. The DNA breakage that is observed does not come from the apoptotic response, because the PARP inhibitor TiQA blocked apoptosis without affecting the breakage observed in the comet asssays. The effect of LT is reminiscent of past reports of SV40 LT regulated bleomycin-induced spontaneous DNA damage (Pietruska et al., 2007). Unlike Boichuk and colleagues with
SV40 LT (Boichuk et al., 2010), we did not observe DNA damage in the absence of genetic insult. However, this could be a sensitivity issue, since we did find that upon continuous expression, OBD was lost from cells indicating its toxicity. Genetic studies of
LT and biochemical analysis identified the single-stranded DNA binding protein RPA as the target bound by LT to produce sensitivity.
The stress signaling and apoptotic cell death promoted by LT is not unexpected.
Apoptotic cell death in response to UV (Danno et al., 1982) or etoposide (Walker et al.,
1991) has been recognized for a long time. Activation of p38, Jnk, and PARP, along with the loss of survival proteins such as BclXL have been all be shown to result from UV
(Kimura et al., 1998); likewise, etoposide activates p38 and Jnk (Hayalawa et al.,2003),
PARP and upregulates the death protein BAD (Pardo et al., 2002). The only unusual feature is the stabilization of Bim and its translocation to the nucleus by LT. This has 215 been seen before with HHV-8, which uses nuclear translocation of Bim to inhibit its activity (Choi et al., 2010). This would be opposite to our observed phenotype In addition, efficient knockdown of Bim had no obvious effect on phenotype. A Bim contribution remains possible, since other BH3 family members could cover for the absence of Bim.
The LT OBD construct (residues 264-420) is sufficient to provide sensitivity.
OBD has multiple functions that can be genetically separated. It is capable of binding
DNA in a site-specific and non-site specific manner. By analogy to SV40 OBD, both
DNA binding functions can be primarily mapped to the A1 and B2 elements in the OBD of polyomavirus LT. Neither activity is required, since; S306P/V358A, which is defective in both was as active as wild type. This means that LT does not need to recognize DNA to sensitize the cell. OBD is able to activate transcription from CREB/ATF sites (Love et al., 2005). Attention has been focused on the role of structural changes in chromatin accompanying transactivation in diminishing accessibility of DNA repair components to sites of DNA damage (Osley et al., 2007). However, OBD transactivating activity also seems not to be required. EE343KK, PG402RD and S306P/V358A were all able to sensitize cells. This argues against the ability of LT to remodel the chromatin to increase its vulnerability to DNA damage. Based on results from SV40, we expected that the OBD would be involved in binding RPA (Braun et al., 1997; Jiang et al., 2006) This proved true, and the mutant K308E, modeled after a mutant made for SV40 (Jiang et al., 2006), failed to bind RPA. A second mutant at E320A also failed to bind. Neither of these mutants was able to sensitize cells to DNA damage. OBD bound to GST-RPA70 fusions, so that appears to be the important subunit for association. 216
Fluck et al (2003) had originally shown that G2/M arrest in a B2 polyomavirus infection is induced only in the presence of large T. In agreement with this observation, others (T.Love., PhD thesis) have found that the cell cycle arrest phenotype induced by large T is only apparent in the presence of the polyoma origin and a mutant unable to replicate the polyoma origin (S306P) is unable to arrest. Additionally, Py large T could synergize with Chk1 to cause cell cycle arrest. It is thought that the presence of Chk1 is viewed by the host cell as DNA damage. Our data suggest that the induction of G2/M arrest by LT that is mediated through Chk1 could be dependent upon RPA association as
K308E failed to induce cell cycle arrest when Chk1 was cotransfected (Data not shown).
Mutant E320A that fails to bind RPA additionally did not induce G2/M arrest in the presence of Chk1. Chk1 has been found in DNA-PK complexes that regulate DNA repair by binding to single stranded broken ends (Goudelock et al., 2003). It is highly likely that
Chk1, large T and RPA are in close proximity when Chk1 binds to breakpoints associated with viral DNA replication. In concurrence with this idea, Chk1 has been also shown to bind large T and this interaction is replication dependent (T.Love., PhD thesis). One lesson that the virus always teahes is the conditional nature of signaling. For instance, ST can be pro-apoptotic or anti-apoptotic depending upon the environment. Effects of large
T were also conditional. LT could protect serum starved cells from apoptosis. It was unclear if binding of RPA to OBD is important for this phenomenon.
RPA is a protein important for DNA replication and DNA repair. It is known to be required for SV40 DNA replication (Fairman et al., 1988; Wobbe et al., 1987; Wold et al., 1987) and functions for polyoma as well (Kautz et al., 2001). Although different kinds of repair mechanisms, each constituting a complex network of signaling 217 components coordinate responses to different kinds of DNA damage, a common molecular component that responds to most genotoxic insults is RPA. (see (Oakley et al.,) for a recent review). In particular, it acts as a sensor for UV induced DNA damage that recognizes cyclobutane thymine dimers and regulates the efficient removal of the lesion (Jiang et al., 2006). In addition, RPA participates in the formation of repair foci in response to etoposide induced double-stranded DNA breaks (DDSBs) (Robison et al.,
2007). Furthermore, depletion of RPA has been shown to cause spontaneous DNA damage and apoptosis in HeLa cells. In our experiments, overexpression of RPA70 protected cells from sensitization by wild type LT. This suggests that titration of RPA by
LT, pushing in the direction of replicative functions and away from repair functions, is the basis for our effect. This means that DNA damage sites that would normally be occupied by RPA after the DNA insult, lack RPA required to trigger efficient removal of the DNA lesions. This also suggests that the RPA interaction is sufficient to explain our results.
The effect on RPA is not the only connection between large T antigens and DNA repair. SV40 LT deregulates multiple DNA damage pathways (Boichuk et al., 2010). It forms a tight complex with NBS-1, one member of the MRN complex (Wu et al., 2004).
Levels of MRN subunits decline during SV40 infection (Zhao etal., 2008). Infection by
Adenovirus has been found to be accompanied by degradation of the MRN (MRE11,
RAD50 and NBS1 ) complex that upregulates the DDR and allows increased viral accumulation (Karen et al., 2009). ATR and its signaling is affected by SV40 (Boichuk et al., 2010). ATM is activated by SV40 and this appears important for promoting viral replication {Shi et al., 2005;Rohaly et al., 2010; Zhao et al., 2008). For polyoma, 218 replication is ten fold less in ATM (-/-) fibroblasts than in wild type (Dahl et al., 2005).
ATM can regulate the phosphorylation of RPA (Oakley et al., 2001; Wang et al., 2001).
This is an example of cross-talk among the repair proteins and underscores the complexity of DDR regulation.
In summary, our results demonstrate that interaction of LT with RPA is the pivotal contributing factor that sensitizes cells to DNA damaging agents. In the polyomavirus field, Merkel Cell Virus is thought to be responsible for a class of human skin cancers called Merkel Cell Carcinoma (Feng et al., 2008; Gjoerup et al., 2010;
Houben et al., 2009). It would be interesting to investigate whether a pro-mutagenic phenotype promoted by the OBD of large T antigen of MCV can contribute to progression in such cancers.
More broadly, targeting RPA function therefore can be a useful way to regulate cancer cell survival. LT could provide clues about how to make an inhibitor that blocks
RPA function rendering cancer cells sensitive to therapy. One might imagine for example, a peptide mimicking a portion of the LT surface could be used.
219
Conclusions
As the master replication initiator protein of polyoma, the large T antigen encodes
a myriad of activities that enable the virus to amplify efficiently in the host cell. Besides
its capacity to initiate and maintain viral DNA replication during a productive infection, it
also stimulates DNA synthesis and transcription of host genes. Its DNA binding activity
that facilitates contact with the viral replication origin, its ability to act as an ATPase and
DNA helicase, as well as its ability to bind key regulatory proteins such as the
retinoblastoma susceptibility gene product, Rb, all underscore its role as a crucial
regulatory determinant in the viral life cycle. Functions of polyoma large T can be
localized to discrete domains in its structure. The N-terminal, by virtue of its J domain
and Rb-binding motif regulates cell-cycle progression whereas the C-terminal possesses
components required to drive viral DNA replication and transactivation of cellular genes.
In this thesis, we examined the importance of the origin binding domain
(264-420 a.a) in the C-terminal to polyomavirus LT function. The overall observations of
the work presented in here clearly demonstrated that the origin binding domain
contributes critical functions during viral infection.
In Chapter 1, in an attempt to pin down and study OBD’s functions, we used site- directed oligonucleotide mutagenesis to design mutants within the origin binding domain.
Initially, the mutants were constructed to only include the origin binding domain but due to a failure to get stable protein expression for a number of mutations, we resorted to constructing them in the full-length large T background to try and circumvent the stability issues. To think about these mutants, we placed them in the context of their relative positions in the secondary structure of SV40 OBD. In the future, it would 220 obviously be very helpful to have a detailed structure of the polyoma OBD. This would allow a more direct interpretation of our mutagenesis.
With respect to replication, as expected we established that the DNA binding activity of OBD is important for its ability to support replication. In direct contrast, a striking finding that shows that the RPA binding function of LT may not be necessarily connected to replication competency, contradicted the accepted dogma that compulsorily links RPA binding to viral DNA replication based on SV40 studies. It will be imperative to confirm our results using a transcription-based DNA replication assay with Southern blotting or PCR based replication assays for detection of amplified, replicated DNA to ensure there is not some problem with our assay. If the role of RPA binding is not, or is not only, to support viral DNA replication, then it becomes important to understand why the virus does this. The binding could be to block RPA function in DNA repair because the latter stages of DNA repair are deleterious to completion of virus replication or the viral life cycle. It would be interesting to know what RPA oveerexpression might do to virus replication. It would also be of value to see how the RPA-negative/DNA replication viruses behave in tissue culture and in mice.
Our experiments were also directed at understanding the transactivation function of the OBD that had been previously shown to activate at CREB/ATF sites. Our mutagenesis studies identified new regions such as in the PGRD mutant that were required for transactivation. However, our work raised questions that remain unanswered.
Activation of E2F containing promoters is a well-known function of LT that requires LT binding of the Rb family. However, we did not get any genetic separation of E2F transactivation and CREB/ATF transactivation. Mutants in OBD affecting one affected 221 the other. Future work must resolve this paradox. It suggests that OBD may be interacting with the basal transcriptional apparatus in a way needed for activity. An alternative is that there is a common co-activator. However, p300, the only characterized coactivator is thought to interact with sequences C-terminal to OBD. Perhaps, LT acts as a general activator and scaffold that holds transcription complexes together, binding to
DNA and to various transcription factors or the basal transcription apparatus. In addition to CREB, the LT interactions with jun and fos (Guo et al., 1996; Ito et al., 1996) support this idea. Ultimately, in the future, we need to confirm that large T is, in fact, directly tethered to promoters by using chromatin immunoprecipitation assays. An additional puzzle concerning CREB/ATF arose in our gene array analysis. There were very few known CREB-regulated genes that appeared to be activated by OBD. Although this could be a reflection of previously published data that L T does not activate all CREB/ATF sites, it is suprising that more genes were not seen. This most likely means that levels of protein expression in the inducible conditional cell line are not adequate to trigger much
CREB transactivation. It could additionally imply that the activation of CREB responsive genes by OBD is a temporally regulated phenomenon that requires both dose and time sensitive titration of OBD. New potential LT targets were uncovered in the gene array assays and future work will be needed to assess their significance.
Most importantly, our work, identified a novel function of polyoma large T that is connected to the origin binding domain, namely, its ability to enhance DNA damage response that is regulated by a functional interaction between LT and RPA. Effects on
DNA repair pathways have been seen before by Dahl et al (2005) who investigated the increased efficiency of polyomavirus infection in the presence of an ATM DNA damage 222 response. Large T effects extend to include sensitization of the host cell to DNA damage.
This was discussed in Chapter 2 where we took a dual approach to study this phenomenon. In one approach, we induced DNA damage by UV irradiating cells that inducibly express OBD or large T. In the other approach, we studied the ability of large T or OBD to sensitize cells to DNA damage by etoposide- a topoisomerase II inhibitor.
DNA damage induced by UV in the presence of LT or OBD is 100 times higher than in control cells. Evidence suggested that LT does not affect formation of photolesions. This implied that LT interferes with DNA repair after damage induced by UV. Reports in literature have implicated RPA as a key player in DNA repair (Reardon, J. T., and A.
Sancar . 2003, Robison et al., 2007). Based on SV40 studies, RPA also binds large T
(Jiang et al., 2006). Therefore, it was not surprising when we found that in polyoma too, both LT and OBD bound RPA. It was plausible that LT sequesters RPA from sites of
DNA damage, a process that disrupts the normal DNA damage response or repair and makes the sustained DNA damage irreparable, initiating cell death or apoptosis. This predicts that a mutant that fails to bind RPA would also fail to sensitize cells to DNA damage. Our data confirmed that mutations that rendered large T RPA binding defective do not sensitize cells to DNA damage. In addition, over-expression of RPA protected cells against the effects of DNA damage even in the presence of OBD. The fact that relatively limited overexpression protects the cells seems to imply that the effect of LT is simply a binding titration. However, RPA is well-known to be regulated by post translational modifications such as phosphorylations. It would be important to look to see how LT affects those modifications. 223
Given that chemotherapeutic treatments like UV, etoposide or gamma irradiation are able to dramatically intensify sensitization to DNA damage in cells that express OBD/LT by regulating RPA, it would be interesting to test this phenomenon in cancer cell lines to analyze as well as characterize the phenomenon in greater detail and eventually design therapeutic drugs to combat cancer development and chemo- therapeutic resistance.
224
References
1. Aboussekhra, A., and R. D. Wood. 1995. Detection of nucleotide excision repair incisions in human fibroblasts by immunostaining for PCNA. Exp Cell Res 221: 326-32. 2. Abraham, R. T. 2001. Cell cycle checkpoint signaling through the ATM and ATR kinases. Genes Dev 15: 2177-96. 3. Addison, C., J. R. Jenkins, and H. W. Sturzbecher. 1990. The p53 nuclear localisation signal is structurally linked to a p34cdc2 kinase motif. Oncogene 5: 423-6. 4. Allander, T., K. Andreasson, S. Gupta, A. Bjerkner, G. Bogdanovic, M. A. Persson, T. Dalianis, T. Ramqvist, and B. Andersson. 2007. Identification of a third human polyomavirus. J Virol 81: 4130-6. 5. Alwine, J. C., S. I. Reed, and G. R. Stark. 1977. Characterization of the autoregulation of simian virus 40 gene A. J Virol 24: 22-7. 6. Amalfitano, A., L. G. Martin, and M. M. Fluck. 1992. Different roles for two enhancer domains in the organ- and age-specific pattern of polyomavirus replication in the mouse. Mol Cell Biol 12: 3628-35. 7. Andrabi, S., O. V. Gjoerup, J. A. Kean, T. M. Roberts, and B. Schaffhausen. 2007. Protein phosphatase 2A regulates life and death decisions via Akt in a context-dependent manner. Proc Natl Acad Sci U S A 104: 19011-6. 8. Antonsson, A., A. C. Green, K. A. Mallitt, P. K. O'Rourke, M. Pawlita, T. Waterboer, and R. E. Neale. Prevalence and stability of antibodies to the BK and JC polyomaviruses: a long-term longitudinal study of Australians. J Gen Virol 91: 1849-53. 9. Asselin, C., C. Gelinas, P. Branton, and M. Bastin. 1984. Polyoma middle T antigen requires cooperation from another gene to express the malignant phenotype in vivo. Mol. Cell. Biol. 4: 755-760. 10. Asselin, C., J. Vass-Marengo, and M. Bastin. 1986. Mutation in the polyomavirus genome that activates the properties of large T associated with neoplastic transformation. J. Virol 57: 165-172. 11. Bao, Y., K. Konesky, Y. J. Park, S. Rosu, P. N. Dyer, D. Rangasamy, D. J. Tremethick, P. J. Laybourn, and K. Luger. 2004. Nucleosomes containing the histone variant H2A.Bbd organize only 118 base pairs of DNA. EMBO J 23: 3314-24. 12. Barbaro, B. A., K. R. Sreekumar, D. R. Winters, A. E. Prack, and P. A. Bullock. 2000. Phosphorylation of simian virus 40 T antigen on Thr 124 selectively promotes double-hexamer formation on subfragments of the viral core origin. J Virol 74: 8601-13. 13. Basilico, C., D. Zouzias, G. Della Valle, S. Gattoni, V. Colantuoni, R. Fenton, and L. Dailey. 1980. Integration and excision of polyoma virus genomes. Cold Spring Harbor Symp. Quant. Biol. 44: 611-620. 14. Bastin-Shanower, S. A., and S. J. Brill. 2001. Functional analysis of the four DNA binding domains of replication protein A. The role of RPA2 in ssDNA binding. J Biol Chem 276: 36446-53. 225
15. Bautch, V. L., S. Toda, J. A. Hassell, and D. Hanahan. 1987. Endothelial cell tumors develop in transgenic mice carrying polyoma virus middle T oncogene. Cell 51: 529-37. 16. Benbrook, D. M., and N. C. Jones. 1990. Heterodimer formation between CREB and JUN proteins. Oncogene 5: 295-302. 17. Benjamin, T. L. 1972. Physiological and genetic studies of polyoma virus. Curr Top Microbiol Immunol 59: 107-33. 18. Benjamin, T. L. 1965. Relative target sizes for the inactivation of the transforming and reproductive abilities of polyoma virus. Proc. Natl. Acad. Sci. USA 54: 121. 19. Benjamin, T. L., B. S. Schaffhausen, and S. J. E. 1979. Polyoma T (tumor) antigen species in abortively and stably transformed cells. J Supramol Struct. 12: 127-37. 20. Bennett, E. R., M. Naujokas, and J. A. Hassell. 1989. Requirements for species-specific papovavirus DNA replication. J. Virol. 63: 5371-85. 21. Berger, H., and E. Wintersberger. 1986. Polyomavirus small T antigen enhances replication of viral genomes in 3T6 mouse fibroblasts. J. Virol. 60: 768- 770. 22. Berger, L. C., D. B. Smith, I. Davidson, J. J. Hwang, E. Fanning, and A. G. Wildeman. 1996. Interaction between T antigen and TEA domain of the factor TEF-1 derepresses simian virus 40 late promoter in vitro: identification of T- antigen domains important for transcription control. J Virol 70: 1203-12. 23. Bergqvist, A., K. Soderbarg, and G. Magnusson. 1997. Altered susceptibility to tumor necrosis factor alpha-induced apoptosis of mouse cells expressing polyomavirus middle and small T antigens. J. Virol 71: 276-83. 24. Binz, S. K., A. M. Dickson, S. J. Haring, and M. S. Wold. 2006. Functional assays for replication protein A (RPA). Methods in enzymology 409: 11-38. 25. Bitomsky, N., and T. G. Hofmann. 2009. Apoptosis and autophagy: Regulation of apoptosis by DNA damage signalling - roles of p53, p73 and HIPK2. The FEBS journal 276: 6074-83. 26. Blackwell, L. J., J. A. Borowiec, and I. A. Mastrangelo. 1996. Single-stranded- DNA binding alters human replication protein A structure and facilitates interaction with DNA-dependent protein kinase. Mol Cell Biol 16: 4798-807. 27. Bochkarev, A., and E. Bochkareva. 2004. From RPA to BRCA2: lessons from single-stranded DNA binding by the OB-fold. Curr Opin Struct Biol 14: 36-42. 28. Bochkarev, A., R. A. Pfuetzner, A. M. Edwards, and L. Frappier. 1997. Structure of the single-stranded-DNA-binding domain of replication protein A bound to DNA. Nature 385: 176-81. 29. Bochkareva, E., L. Kaustov, A. Ayed, G. S. Yi, Y. Lu, A. Pineda-Lucena, J. C. Liao, A. L. Okorokov, J. Milner, C. H. Arrowsmith, and A. Bochkarev. 2005. Single-stranded DNA mimicry in the p53 transactivation domain interaction with replication protein A. Proc Natl Acad Sci U S A 102: 15412-7. 30. Bochkareva, E., D. Martynowski, A. Seitova, and A. Bochkarev. 2006. Structure of the origin-binding domain of simian virus 40 large T antigen bound to DNA. Embo J 25: 5961-9. 226
31. Bockus, B. J., and B. Schaffhausen. 1987. Localization of the phosphorylations of polyomavirus large T antigen. J. Virol. 61: 1155-63. 32. Bockus, B. J., and B. Schaffhausen. 1987. Phosphorylation of polyomavirus large T antigen: effects of viral mutations and cell growth state. J. Virol. 61: 1147- 54. 33. Boichuk, S., L. Hu, J. Hein, and O. V. Gjoerup. 2010. Multiple DNA damage signaling and repair pathways deregulated by simian virus 40 large T antigen. Journal of virology 84: 8007-20. 34. Borowiec, J. A., F. B. Dean, and J. Hurwitz. 1991. Differential Induction of Structural Changes in the Simian Virus 40 Origin of Replication by T Antigen. J. of Virology 65: 1228-1235. 35. Borowiec, J. A., and J. Hurwitz. 1988. ATP stimulates the binding of simian virus 40 large tumor antigen to the SV40 origin of replication. Proc. Natl. Acad. Sci. USA 85: 64-68. 36. Boulon, S., J. C. Dantonel, V. Binet, A. Vie, J. M. Blanchard, R. A. Hipskind, and A. Philips. 2002. Oct-1 potentiates CREB-driven cyclin D1 promoter activation via a phospho-CREB- and CREB binding protein-independent mechanism. Mol Cell Biol 22: 7769-79. 37. Bradley, M. 1990. Activation of ATPase activity of simian virus 40 large T antigen by the covalent affinity analog of ATP, fluorosulfonylbenzoyl 5'- adenosine. J. Virol. 64: 4939-47. 38. Bradshaw, E. M., D. G. Sanford, X. Luo, J. L. Sudmeier, Z. A. Gurard-Levin, P. A. Bullock, and W. W. Bachovchin. 2004. T antigen origin-binding domain of simian virus 40: determinants of specific DNA binding. Biochemistry 43: 6928- 36. 39. Brasier, A. R., J. E. Tate, and J. F. Habener. 1989. Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. Biotechniques 7: 1116-22. 40. Braun, K. A., Y. Lao, Z. He, C. J. Ingles, and M. S. Wold. 1997. Role of protein-protein interactions in the function of replication protein A (RPA): RPA modulates the activity of DNA polymerase alpha by multiple mechanisms. Biochemistry 36: 8443-54. 41. Brill, S. J., and S. Bastin-Shanower. 1998. Identification and characterization of the fourth single-stranded-DNA binding domain of replication protein A. Mol Cell Biol 18: 7225-34. 42. Bronson, R., C. Dawe, J. Carroll, and T. Benjamin. 1997. Tumor induction by a transformation-defective polyoma virus mutant blocked in signaling through shc. Proc. Nat. Acad. Sci. USA 94: 7954-7958. 43. Buckler-White, A., J., M. R. Krauss, V. Pigiet, and R. M. Benbow. 1982. Asynchronous bidirectional replication of polyoma virus DNA. J Virol 43: 885-95. 44. Bullock, P. 1997. The initiation of simian virus 40 DNA replication in vitro. Crit. Rev. Biochem. Mol. Biol. 32: 503-568. 45. Bullock, P., Y. S. Seo, and J. Hurwitz. 1991. Initiation of simian virus 40 DNA synthesis in vitro. Molecular and Cellular Biology 11: 2350-2361. 227
46. Burns, J. L., S. N. Guzder, P. Sung, S. Prakash, and L. Prakash. 1996. An affinity of human replication protein A for ultraviolet-damaged DNA. J Biol Chem 271: 11607-10. 47. Burtelow, M. A., P. M. Roos-Mattjus, M. Rauen, J. R. Babendure, and L. M. Karnitz. 2001. Reconstitution and molecular analysis of the hRad9-hHus1-hRad1 (9-1-1) DNA damage responsive checkpoint complex. J Biol Chem 276: 25903-9. 48. Campbell, K. S., K. R. Auger, B. A. Hemmings, T. M. Roberts, and D. C. Pallas. 1995. Identification of regions in polyomavirus middle T and small t antigens important for association with protein phosphatase 2A. Journal of Virology 69: 3721-8. 49. Campbell, K. S., E. Ogris, B. Burke, W. Su, K. R. Auger, B. J. Druker, B. S. Schaffhausen, T. M. Roberts, and D. C. Pallas. 1994. Polyoma middle T antigen interacts with SHC via the NPTY motif in middle T. Proc. Natl. Acad. Sci. USA 91: 6344-6348. 50. Carmichael, G., B. Schaffhausen, D. Dorsky, D. Oliver, and T. Benjamin. 1982. The role of the carboxy terminus of middle T antigen of polyoma virus. Proc. Natl. Acad. Sci. USA 79: 3579-3583. 51. Carmichael, G., B. S. Schaffhausen, G. Mandel, T. J. Liang, and T. L. Benjamin. 1984. Transformation by polyoma virus is drastically reduced by substitution of phenylalanine for tyrosine at residue 315 of middle-sized tumor antigen. Proc. Natl. Acad. Sci. USA. 81: 679-83. 52. Carney, J. P., R. S. Maser, H. Olivares, E. M. Davis, M. Le Beau, J. R. Yates, 3rd, L. Hays, W. F. Morgan, and J. H. Petrini. 1998. The hMre11/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response. Cell 93: 477-86. 53. Carson, C. T., N. I. Orazio, D. V. Lee, J. Suh, S. Bekker-Jensen, F. D. Araujo, S. S. Lakdawala, C. E. Lilley, J. Bartek, J. Lukas, and M. D. Weitzman. 2009. Mislocalization of the MRN complex prevents ATR signaling during adenovirus infection. The EMBO journal 28: 652-62. 54. Carty, M. P., M. Zernik-Kobak, S. McGrath, and K. Dixon. 1994. UV light- induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein. EMBO J 13: 2114-23. 55. Caspari, T. 2000. How to activate p53. Curr Biol 10: R315-7. 56. Caspari, T., C. Davies, and A. M. Carr. 2000. Analysis of the fission yeast checkpoint Rad proteins. Cold Spring Harb Symp Quant Biol 65: 451-6. 57. Castillo, J. P., F. M. Frame, H. A. Rogoff, M. T. Pickering, A. D. Yurochko, and T. F. Kowalik. 2005. Human cytomegalovirus IE1-72 activates ataxia telangiectasia mutated kinase and a p53/p21-mediated growth arrest response. Journal of virology 79: 11467-75. 58. Cazzalini, O., A. I. Scovassi, M. Savio, L. A. Stivala, and E. Prosperi. 2010. Multiple roles of the cell cycle inhibitor p21(CDKN1A) in the DNA damage response. Mutation research 704: 12-20. 59. Cereghini, S., P. Herbomel, J. Jouanneau, S. Saragosti, M. Katinka, B. Bourachot, B. de Crombrugghe, and M. Yaniv. 1983. Structure and function of 228
the promoter-enhancer region of polyoma and SV40. Cold Spring Harb Symp Quant Biol 47 Pt 2:935-44. 60. Chan, D. W., D. P. Gately, S. Urban, A. M. Galloway, S. P. Lees-Miller, T. Yen, and J. Allalunis-Turner. 1998. Lack of correlation between ATM protein expression and tumour cell radiosensitivity. Int J Radiat Biol 74: 217-24. 61. Chang, T. H., F. A. Ray, D. A. Thompson, and R. Schlegel. 1997. Disregulation of mitotic checkpoints and regulatory proteins following acute expression of SV40 large T antigen in diploid human cells. Oncogene 14: 2383-93. 62. Chatterjee, A., B. J. Bockus, O. V. Gjorup, and B. S. Schaffhausen. 1997. Phosphorylation sites in polyomavirus large T antigen that regulate its function in viral, but not cellular, DNA synthesis. J. Virol 71: 6472-8. 63. Chaurushiya, M. S., and M. D. Weitzman. 2009. Viral manipulation of DNA repair and cell cycle checkpoints. DNA Repair (Amst) 8: 1166-76. 64. Chen, C. A., and H. Okayama. 1988. Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA. Biotechniques 6: 632-637. 65. Chen, H. H., S. Zhao, and J. G. Song. 2003. TGF-beta1 suppresses apoptosis via differential regulation of MAP kinases and ceramide production. Cell Death Differ 10: 516-27. 66. Chen, K. Y., and S. Cheng. 1988. Polyamine metabolism in an obligately alkalophilic Bacillus alcalophilus that grows at pH 11.0. Biochemical and biophysical research communications 150: 185-91. 67. Chen, L., X. Wang, and M. M. Fluck. 2006. Independent contributions of polyomavirus middle T and small T to the regulation of early and late gene expression and DNA replication. J Virol 80: 7295-307. 68. Chen, Q., D. Liang, L. D. Fromm, and P. A. Overbeek. 2004. Inhibition of lens fiber cell morphogenesis by expression of a mutant SV40 large T antigen that binds CREB-binding protein/p300 but not pRb. J Biol Chem 279: 17667-73. 69. Cherington, V., B. Morgan, M. Spiegelman, and T. M. Roberts. 1986. Recombinant retroviruses that transduce individual polyoma tumor antigens: Effects on growth and differentiation. Proc. Natl. Acad. Sci. USA 83: 4307-4311. 70. Chi, N. W., and H. F. Lodish. 2000. Tankyrase is a golgi-associated mitogen- activated protein kinase substrate that interacts with IRAP in GLUT4 vesicles. J Biol Chem 275: 38437-44. 71. Cho, S., Y. Tian, and T. L. Benjamin. 2001. Binding of p300/CBP co-activators by polyoma large T antigen. J Biol Chem 276: 33533-9. 72. Choi, Y. B., and J. Nicholas. 2010. Bim nuclear translocation and inactivation by viral interferon regulatory factor. PLoS pathogens 6. 73. Choudhary, S. K., and R. Li. 2002. BRCA1 modulates ionizing radiation- induced nuclear focus formation by the replication protein A p34 subunit. J Cell Biochem 84: 666-74. 74. Cimprich, K. A., and D. Cortez. 2008. ATR: an essential regulator of genome integrity. Nat Rev Mol Cell Biol 9: 616-27. 75. Cleaver, J. E., E. T. Lam, and I. Revet. 2009. Disorders of nucleotide excision repair: the genetic and molecular basis of heterogeneity. Nature reviews. Genetics 10: 756-68. 229
76. Clertant, P., and F. Cuzin. 1982. Covalent affinity labeling by periodate oxidized alpha[32P] ATP of the large T proteins of polyoma and SV40 viruses. J. Biol. Chem. 257: 6300-6305. 77. Clertant, P., P. Gaudray, and F. Cuzin. 1984. Salt-stable binding of the large T protein to DNA in polyoma virus chromatin. The Embo Journal 3: 303-307. 78. Clertant, P., P. Gaudray, E. May, and F. Cuzin. 1984. The nucleotide binding site detected by affinity labeling in the Large T proteins of polyoma and SV40 viruses is distinct from their ATPase catalytic site. J. Biol. Chem. 1984: 15196- 15203. 79. Colantuoni, V., L. Dailey, and C. Basilico. 1980. Amplification of integrated viral DNA sequences in polyoma virus-transformed cells. Proc. Natl. Acad. Sci. USA 77: 3850-3854. 80. Collins, K. L., A. A. Russo, B. Y. Tseng, and T. J. Kelly. 1993. The role of the 70 kDa subunit of human DNA polymerase alpha in DNA replication. Embo J 12: 4555-66. 81. Comb, M., N. C. Birnberg, A. Seasholtz, E. Herbert, and H. M. Goodman. 1986. A cyclic AMP- and phorbol ester-inducible DNA element. Nature 323: 353- 6. 82. Costa, R. M., V. Chigancas, S. Galhardo Rda, H. Carvalho, and C. F. Menck. 2003. The eukaryotic nucleotide excision repair pathway. Biochimie 85: 1083-99. 83. Courtneidge, S., and A. E. Smith. 1983. Polyoma virus transforming protein associates with the product of the c-src cellular gene. Nature 303: 435-9. 84. Cowie, A., J. de Villiers, and R. Kamen. 1986. Immortalization of rat embryo fibroblasts by mutant polyomavirus large T antigens defective in DNA binding. Mol. Cell. Biol. 6: 4344-4352. 85. Cowie, A., and R. Kamen. 1986. Guanine nucleotide contacts within viral DNA sequences bound by polyomavirus large T antigen. J. Virol. 57: 505-514. 86. Cowie, A., and R. Kamen. 1984. Multiple binding sites for polyomavirus large T antigen within regulatory sequences of polyomavirus DNA. J. Virol 52: 750-760. 87. Cullere, X., P. Rose, U. Thathamangalam, A. Chatterjee, K. P. Mullane, D. C. Pallas, T. L. Benjamin, T. M. Roberts, and B. S. Schaffhausen. 1998. Serine 257 phosphorylation regulates association of polyomavirus middle T antigen with 14-3-3 proteins. J Virol 72: 558-63. 88. D'Amours, D., and S. P. Jackson. 2002. The Mre11 complex: at the crossroads of dna repair and checkpoint signalling. Nat Rev Mol Cell Biol 3: 317-27. 89. Dahl, J., J. You, and T. L. Benjamin. 2005. Induction and utilization of an ATM signaling pathway by polyomavirus. J Virol 79: 13007-17. 90. Danno, K., and T. Horio. 1982. Formation of UV-induced apoptosis relates to the cell cycle. The British journal of dermatology 107: 423-8. 91. Dart, D. A., K. E. Adams, I. Akerman, and N. D. Lakin. 2004. Recruitment of the cell cycle checkpoint kinase ATR to chromatin during S-phase. J Biol Chem 279: 16433-40. 92. David, M., G. Romero, Z. Y. Zhang, J. E. Dixon, and A. C. Larner. 1993. In vitro activation of the transcription factor ISGF3 by interferon alpha involves a membrane-associated tyrosine phosphatase and tyrosine kinase. J. Biol. Chem 268: 6593-9. 230
93. Davis, S., P. Vanhoutte, C. Pages, J. Caboche, and S. Laroche. 2000. The MAPK/ERK cascade targets both Elk-1 and cAMP response element-binding protein to control long-term potentiation-dependent gene expression in the dentate gyrus in vivo. J Neurosci 20: 4563-72. 94. Dawe, C. J., R. Freund, G. Mandel, K. Ballmer-Hofer, D. A. Talmage, and T. L. Benjamin. 1987. Variations in polyoma virus genotype in relation to tumor induction in mice. Characterization of wild type strains with widely differing tumor profiles. Am J Pathol 127: 243-61. 95. Dawe, C. J., F. R., J. P. Barncastle, T. W. Dubensky, G. Mandel, and T. L. Benjamin. 1987. Necrotizing arterial lesions in mice-bearing tumors induced by polyoma virus. J Exp Pathol 3: 177-201. 96. de Bruyn, G., and A. P. Limaye. 2004. BK virus-associated nephropathy in kidney transplant recipients. Rev Med Virol 14: 193-205. 97. de Chasseval, R., and J. P. de Villartay. 1992. High level transient gene expression in human lymphoid cells by SV40 large T antigen boost. Nucleic Acids Res 20: 245-50. 98. de Laat, W. L., A. M. Sijbers, H. Odijk, N. G. Jaspers, and J. H. Hoeijmakers. 1998. Mapping of interaction domains between human repair proteins ERCC1 and XPF. Nucleic Acids Res 26: 4146-52. 99. de Villiers, J., W. Schaffner, C. Tyndall, S. Lupton, and R. Kamen. 1984. Polyoma virus DNA replication requires an enhancer. Nature 312: 242-6. 100. Dean, F., J. Borowiec, Y. Ishimi, S. Deb, P. Tegtmeyer, and J. Hurwitz. 1987. Simian virus 40 large tumor antigen requires three core replication origin domains for DNA unwinding and replication in vitro. Proceedings of the National Academy of Sciences 84: 8267-8271. 101. Dean, F. B., J. Borowiec, T. Eki, and J. Hurwitz. 1992. The Simian virus 40 T antigen double hexamer assembles around the DNA at the replication origin. J. of Biological Chemistry 267: 14129-14137. 102. Dean, F. B., P. Bullock, Y. Murakami, C. R. Wobbe, L. Weissbach, and J. Hurwitz. 1987. Simian virus 40 (SV40) DNA replication: SV40 large T antigen unwinds DNA containing the SV40 origin of replication. Proc. Natl. Acad. Sci. USA 84: 16-20. 103. Dean, F. B., M. Dodson, H. Echols, and J. Hurwitz. 1987. ATP-dependent formation of a specialized nucleoprotein structure by simian virus 40 (SV40) large tumor antigen at the SV40 origin of replication. Proc. Natl. Acad. Sci. USA 84: 8981-8985. 104. Deb, S., S. Tsui, A. Koff, A. DeLucia, R. Parsons, and P. Tegtmeyer. 1987. The T-antigen-binding domain of the simian virus core origin of replication. J. Virol 61: 2143-2149. 105. Del Vecchio, A. M., H. Romanczuk, P. M. Howley, and C. C. Baker. 1992. Transient replication of human papillomavirus DNAs. J Virol 66: 5949-58. 106. Della Valle, G., R. G. Fenton, and C. Basilico. 1981. Polyoma large T antigen regulates the integration of viral DNA sequences into the genome of transformed cells. Cell 23: 347-355. 231
107. Delucia, A. L., B. A. Lewton, R. Tjian, and P. Tegtmeyer. 1983. Topography of simian virus 40 A protein-DNA complexes: arrangement of pentanucleotide inteaction sites at the origin of replication. J. Virol. 46: 143-150. 108. DeLucia, A. L., B. A. Lewton, R. Tjian, and P. Tegtmeyer. 1983. Topography of simian virus 40 A protein-DNA complexes: arrangement of pentanucleotide interaction sites at the origin of replication. J Virol 46: 143-50. 109. DeMott, M. S., S. Zigman, and R. A. Bambara. 1998. Replication protein A stimulates long patch DNA base excision repair. J Biol Chem 273: 27492-8. 110. Dey, A., J. Ellenberg, A. Farina, A. E. Coleman, T. Maruyama, S. Sciortino, J. Lippincott-Schwartz, and K. Ozato. 2000. A bromodomain protein, MCAP, associates with mitotic chromosomes and affects G(2)-to-M transition. Mol Cell Biol 20: 6537-49. 111. Dey, D., J. Dahl, S. Cho, and T. L. Benjamin. 2002. Induction and bypass of p53 during productive infection by polyomavirus. J Virol 76: 9526-32. 112. Dickmanns, A., A. Zeitvogel, F. Simmersbach, R. Weber, A. Arthur, S. Dehde, A. Wildeman, and E. Fanning. 1994. The kinetics of simian virus 40- induced progression of quiescent cells into S-Phase depend on four independent functions of large T antigen. J. Virol. 68: 5496-5508. 113. Dilworth, S. M., C. E. Brewster, M. D. Jones, L. Lanfrancone, G. Pelicci, and P. G. Pelicci. 1994. Transformation by polyoma virus middle T-antigen involves the binding and tyrosine phosphorylation of Shc. Nature 367: 87-90. 114. Dilworth, S. M., H. A. Hansson, C. Darnfors, G. Bjursell, C. H. Streuli, and B. E. Griffin. 1986. Subcellular localisation of the middle and large T-antigens of polyoma. EMBO J. 5: 491-9. 115. DiMaio, D., and D. Nathans. 1980. Cold-sensitive regulatory mutants of simian virus 40. J Mol Biol 140: 129-42. 116. Dodson, M., F. Dean, P. Bullock, H. Echols, and J. Hurwitz. 1987. Unwinding of duplex DNA from the SV40 origin of replication by T antigen. Science 238: 964-967. 117. Dornreiter, I., W. C. Copeland, and T. S. Wang. 1993. Initiation of simian virus 40 DNA replication requires the interaction of a specific domain of human DNA polymerase alpha with large T antigen. Mol. Cell. Biol. 13: 809-20. 118. Dornreiter, I., A. Hoss, A. K. Arthur, and E. Fanning. 1990. SV40 T antigen binds directly to the large subunit of purified DNA polymerase alpha. EMBO J. 9: 3329-36. 119. Dulbecco, R., L. H. Hartwell, and M. Vogt. 1965. Induction of cellular DNA synthesis by polyoma virus. Proc. Natl. Acad. Sci. USA 53: 403-408. 120. Dzikiewicz-Krawczyk, A. 2008. The importance of making ends meet: mutations in genes and altered expression of proteins of the MRN complex and cancer. Mutation research 659: 262-73. 121. Eckhart, W. 1977. Complementation between temperature-sensitive (ts) host range, non-transforming (hr-t) mutants of polyoma virus. Virology 77: 589 - 597. 122. Eckhart, W., M. A. Hutchinson, and T. Hunter. 1979. An activity phosphorylating tyrosine in polyoma T antigen immunoprecipitates. Cell 18: 925. 123. Eddy, B. 1969. Polyoma Virus. Virology Monograph 7: 1-114. 232
124. Eddy, B. E., S. E. Stewart, and G. E. Grubbs. 1958. Influence of tissue culture passage, storage, temperature and drying on viability of SE polyoma virus. Proc. Soc. Exp. Biol. 99: 289-292. 125. Eshleman, J. R., and S. D. Markowitz. 1996. Mismatch repair defects in human carcinogenesis. Hum Mol Genet 5 Spec No: 1489-94. 126. Fairman, M., G. Prelich, T. Tsurimoto, and B. Stillman. 1988. Identification of cellular components required for SV40 DNA replication in vitro. Biochim Biophys Acta 951: 382-7. 127. Fairman, M. P., and B. Stillman. 1988. Cellular factors required for multiple stages of SV40 DNA replication in vitro. EMBO J 7: 1211-8. 128. Falaschi, A. 2000. Eukaryotic DNA replication: a model for a fixed double replisome. Trends Genet 16: 88-92. 129. Fanning, E., and R. Knippers. 1992. Structure and function of simian virus 40 large tumor antigen. Annu Rev Biochem 61: 55-85. 130. Feng, H., M. Shuda, Y. Chang, and P. S. Moore. 2008. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science 319: 1096-100. 131. Fimia, G. M., D. De Cesare, and P. Sassone-Corsi. 1999. CBP-independent activation of CREM and CREB by the LIM-only protein ACT. Nature 398: 165-9. 132. Fimia, G. M., V. Gottifredi, B. Bellei, M. R. Ricciardi, A. Tafuri, P. Amati, and R. Maione. 1998. The activity of differentiation factors induces apoptosis in polyomavirus large T-expressing myoblasts. Mol Biol Cell 9: 1449-63. 133. Fluck, M. M., and S. Z. Haslam. 1996. Mammary tumors induced by polyomavirus. Breast Cancer Res Treat 39: 45-56. 134. Fluck, M. M., and B. S. Schaffhausen. 2009. Lessons in signaling and tumorigenesis from polyomavirus middle T antigen. Microbiol Mol Biol Rev 73: 542-63, Table of Contents. 135. Fradet-Turcotte, A., G. Morin, M. Lehoux, P. A. Bullock, and J. Archambault. Development of quantitative and high-throughput assays of polyomavirus and papillomavirus DNA replication. Virology 399: 65-76. 136. Francke, B., and W. Eckhart. 1973. Polyoma gene function required for viral DNA synthesis. Virology 55: 127-135. 137. Frearson, P. M., and L. V. Crawford. 1972. Polyoma virus basic proteins. J Gen Virol 14: 141-55. 138. Freund, R., R. T. Bronson, and T. L. Benjamin. 1992. Separation of immortalization from tumor induction with polyoma large T mutants that fail to bind the retinoblastoma gene product. Oncogene 7: 1979-87. 139. Freund, R., C. J. Dawe, J. P. Carroll, and T. L. Benjamin. 1992. Changes in frequency, morphology, and behavior of tumors induced in mice by a polyoma virus mutant with a specifically altered oncogene. Am. J. Pathol. 141: 1409-25. 140. Fried, M. 1965. Cell transforming ability of a temperature-sensitive mutant of polyoma virus. Proc. Natl. Acad. Sci. U.S.A. 53: 486. 141. Fried, M. 1970. Characterization of a temperature-sensitive mutant of polyoma virus. Virology 617: 40,605. 142. Fried, M., and B. E. Griffin. 1977. Organization of the genomes of polyoma virus and SV40. Adv Cancer Res 24: 67-113. 233
143. Friedberg, E. C. 2006. Reversible monoubiquitination of PCNA: A novel slant on regulating translesion DNA synthesis. Mol Cell 22: 150-2. 144. Friedberg, I., I. Belzer, O. Oged-Plesz, and D. Kuebler. 1995. Activation of cell growth inhibitor by ectoprotein kinase-mediated phosphorylation in transformed mouse fibroblasts. J Biol Chem 270: 20560-7. 145. Friedmann, T., A. Esty, P. LaPorte, and P. Deininger. 1979. The nucleotide sequence and genome organization of the polyoma early region: extensive nucleotide and amino acid homology with SV40. Cell 17: 715-24. 146. Gai, D., R. Zhao, D. Li, C. V. Finkielstein, and X. S. Chen. 2004. Mechanisms of conformational change for a replicative hexameric helicase of SV40 large tumor antigen. Cell 119: 47-60. 147. Gannon, J. V., R. Greaves, R. Iggo, and D. P. Lane. 1990. Activating mutations in p53 produce a common conformational effect. A monoclonal antibody specific for the mutant form. Embo Journal 9: 1595-602. 148. Garaj-Vrhovac, V., and N. Kopjar. 2003. The alkaline Comet assay as biomarker in assessment of DNA damage in medical personnel occupationally exposed to ionizing radiation. Mutagenesis 18: 265-71. 149. Gatei, M., S. P. Scott, I. Filippovitch, N. Soronika, M. F. Lavin, B. Weber, and K. K. Khanna. 2000. Role for ATM in DNA damage-induced phosphorylation of BRCA1. Cancer Res 60: 3299-304. 150. Gatei, M., D. Young, K. M. Cerosaletti, A. Desai-Mehta, K. Spring, S. Kozlov, M. F. Lavin, R. A. Gatti, P. Concannon, and K. Khanna. 2000. ATM- dependent phosphorylation of nibrin in response to radiation exposure. Nat Genet 25: 115-9. 151. Gately, D. P., J. C. Hittle, G. K. Chan, and T. J. Yen. 1998. Characterization of ATM expression, localization, and associated DNA-dependent protein kinase activity. Mol Biol Cell 9: 2361-74. 152. Gaudray, P., P. Clertant, and F. Cuzin. 1980. ATP phosphohydrolase (ATPase) activity of a polyoma virus T antigen. J. Biochem. 109: 553-560. 153. Gaynor, A. M., M. D. Nissen, D. M. Whiley, I. M. Mackay, S. B. Lambert, G. Wu, D. C. Brennan, G. A. Storch, T. P. Sloots, and D. Wang. 2007. Identification of a novel polyomavirus from patients with acute respiratory tract infections. PLoS pathogens 3: e64. 154. Genevaux, P., F. Schwager, C. Georgopoulos, and W. L. Kelley. 2001. The djlA gene acts synergistically with dnaJ in promoting Escherichia coli growth. J Bacteriol 183: 5747-50. 155. Gentil, A., L. Daya-Grosjean, A. Margot, and A. Sarasin. 1985. Survival and mutagenesis of ultraviolet irradiated simian virus 40 in foetal human fibroblasts. Biochimie 67: 393-8. 156. Germann, M. W., C. N. Johnson, and A. M. Spring. 2010. Recognition of damaged DNA: structure and dynamic markers. Medicinal research reviews. 157. Gilinger, G., and J. C. Alwine. 1993. Transcriptional activation by simian virus 40 large T antigen: requirements for simple promoter structures containing either TATA or initiator elements with variable upstream factor binding sites. J Virol 67: 6682-8. 234
158. Gillet, R., C. Cavard, G. Grimber, P. Briand, and V. Joulin. 2001. Hepatic expression of SV40 small-T antigen blocks the in vivo CD95-mediated apoptosis. Biochemical and biophysical research communications 284: 369-76. 159. Gillette, T. G., S. Yu, Z. Zhou, R. Waters, S. A. Johnston, and S. H. Reed. 2006. Distinct functions of the ubiquitin-proteasome pathway influence nucleotide excision repair. EMBO J 25: 2529-38. 160. Gjoerup, O., and Y. Chang. 2010. Update on human polyomaviruses and cancer. Advances in cancer research 106: 1-51. 161. Gjoerup, O., D. Zaveri, and T. M. Roberts. 2001. Induction of p53-independent apoptosis by simian virus 40 small t antigen. J Virol 75: 9142-55. 162. Gjorup, O. V., P. E. Rose, P. S. Holman, B. J. Bockus, and B. S. Schaffhausen. 1994. Protein domains connect cell cycle stimulation directly to initiation of DNA replication. Proc Natl Acad Sci U S A 91: 12125-9. 163. Glenn, G. M., and W. Eckhart. 1995. Amino-terminal regions of polyomavirus middle T antigen are required for interactions with protein phosphatase 2A. J. Virol 69: 3729-3736. 164. Goetz, F., Y. J. Tzeng, E. Guhl, J. Merker, M. Graessmann, and A. Graessmann. 2001. The SV40 small t-antigen prevents mammary gland differentiation and induces breast cancer formation in transgenic mice; truncated large T-antigen molecules harboring the intact p53 and pRb binding region do not have this effect. Oncogene 20: 2325-32. 165. Goetz, G. S., F. B. Dean, J. Hurwitz, and S. W. Matson. 1988. The unwinding of duplex regions in DNA by the Simian Virus 40 large tumor antigen-associated helicase activity. The J. Biol. Chem 263: 383-392. 166. Gomes, X. V., L. A. Henricksen, and M. S. Wold. 1996. Proteolytic mapping of human replication protein A: evidence for multiple structural domains and a conformational change upon interaction with single-stranded DNA. Biochemistry 35: 5586-95. 167. Gomes, X. V., and M. S. Wold. 1996. Functional domains of the 70-kilodalton subunit of human replication protein A. Biochemistry 35: 10558-68. 168. Goudelock, D. M., K. Jiang, E. Pereira, B. Russell, and Y. Sanchez. 2003. Regulatory interactions between the checkpoint kinase Chk1 and the proteins of the DNA-dependent protein kinase complex. J Biol Chem 278: 29940-7. 169. Green, C. M., H. Erdjument-Bromage, P. Tempst, and N. F. Lowndes. 2000. A novel Rad24 checkpoint protein complex closely related to replication factor C. Curr Biol 10: 39-42. 170. Griffin, B. E., Y. Ito, U. Novak, N. Spurr, S. Dilworth, N. Smolar, R. Pollack, K. Smith, and D. B. Rifkin. 1980. Early mutants of polyoma virus(dl8 and dl23) with altered transformation properties: Is polyoma virus middle T antigen a transforming gene product? Cold Spring Harbor Symp. Quant. Biol. 44: 271-282. 171. Gross, L. 1953. A filterable agent, recovered from AK leukemic extracts, causing salivary gland carcinomas in C3H mice. Proc. Soc. Exptl. Biol. Med. 83: 414. 172. Gruda, M. C., J. M. Zabolotny, J. H. Xiao, I. Davidson, and J. C. Alwine. 1993. Transcriptional activation by simian virus 40 large T antigen: interactions with multiple components of the transcription complex. Mol. Cell. Biol. 13: 961-9. 235
173. Guo, W., W. J. Tang, X. Bu, V. Bermudez, M. Martin, and W. R. Folk. 1996. AP1 enhances polyomavirus DNA replication by promoting T-antigen-mediated unwinding of DNA. J Virol 70: 4914-8. 174. Guy, C. T., R. D. Cardiff, and W. J. Muller. 1992. Induction of mammary tumors by expression of polyomavirus middle T oncogene: a transgenic mouse model for metastatic disease. Mol. Cell. Biol 12: 954-61. 175. Haaf, T., E. Raderschall, G. Reddy, D. C. Ward, C. M. Radding, and E. I. Golub. 1999. Sequestration of mammalian Rad51-recombination protein into micronuclei. J Cell Biol 144: 11-20. 176. Hahn, W. C., S. K. Dessain, M. W. Brooks, J. E. King, B. Elenbaas, D. M. Sabatini, J. A. DeCaprio, and R. A. Weinberg. 2002. Enumeration of the simian virus 40 early region elements necessary for human cell transformation. Mol Cell Biol 22: 2111-23. 177. Halmer, L., B. Vestner, and C. Gruss. 1998. Involvement of topoisomerases in the initiation of simian virus 40 minichromosome replication. J Biol Chem 273: 34792-8. 178. Harrison, C. J., G. Meinke, H. J. Kwun, H. Rogalin, P. J. Phelan, P. A. Bullock, Y. Chang, P. S. Moore, and A. Bohm. 2011. Asymmetric assembly of merkel cell polyomavirus large T-antigen origin binding domains at the viral origin. Journal of molecular biology 409: 529-42. 179. Harvey, R., G. L. Oostra, G. J. Belsham, P. Gillett, and A. E. Smith. 1984. An antibody to a synthetic peptide recognizes polyoma virus middle T antigen and reveals multiple in vitro tyrosine phosphorylation sites. Mol. Cell. Biol. 4: 1334- 1342. 180. Hassauer, M., K. Scheidtmann, and G. Walter. 1986. Mapping of phosphorylation sites in polyomavirus large T antigen. J. Virol. 58: 805-816. 181. Hayakawa, J., C. Depatie, M. Ohmichi, and D. Mercola. 2003. The activation of c-Jun NH2-terminal kinase (JNK) by DNA-damaging agents serves to promote drug resistance via activating transcription factor 2 (ATF2)-dependent enhanced DNA repair. J Biol Chem 278: 20582-92. 182. He, Z., L. A. Henricksen, M. S. Wold, and C. J. Ingles. 1995. RPA involvement in the damage-recognition and incision steps of nucleotide excision repair. Nature 374: 566-9. 183. Hein, J., S. Boichuk, J. Wu, Y. Cheng, R. Freire, P. S. Jat, T. M. Roberts, and O. V. Gjoerup. 2009. Simian virus 40 large T antigen disrupts genome integrity and activates a DNA damage response via Bub1 binding. J Virol 83: 117-27. 184. Hendrickson, E., C. Fritze, W. Folk, and DePamphilis. 1987. The origin of bidirectional DNA replication in polyoma virus. EMBO J. 6: 2011-2018. 185. Hermeking, H., D. Wolf, F. Kohlhuber, A. Dickmanns, M. Billaud, E. Fanning, and D. Eick. 1994. Role of c-myc in simian virus 40 large tumor antigen-induced DNA synthesis in quiescent 3T3-L1 mouse fibroblasts. Proc. Natl. Acad. Sci. USA 91: 10412-10416. 186. Hoeffler, J. P., T. E. Meyer, Y. Yun, J. L. Jameson, and J. F. Habener. 1988. Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science 242: 1430-3. 236
187. Hoeijmakers, J. H. 2001. DNA repair mechanisms. Maturitas 38: 17-22; discussion 22-3. 188. Hoeijmakers, J. H. 2001. Genome maintenance mechanisms for preventing cancer. Nature 411: 366-74. 189. Holman, P., O. Gjoerup, T. Davin, and B. Schaffhausen. 1994. Characterization of an immortalizing N-terminal domain of polyomavirus large T antigen. J. Virol. 68: 668-673. 190. Hong, S. J., T. M. Dawson, and V. L. Dawson. 2004. Nuclear and mitochondrial conversations in cell death: PARP-1 and AIF signaling. Trends Pharmacol Sci 25: 259-64. 191. Horak, I. D., T. Kawakami, F. Gregory, K. C. Robbins, and J. B. Bolen. 1989. Association of p60fyn with middle tumor antigen in murine polyomavirus- transformed rat cells. J. Virol. 63: 2343-7. 192. Houben, R., D. Schrama, and J. C. Becker. 2009. Molecular pathogenesis of Merkel cell carcinoma. Experimental dermatology 18: 193-8. 193. Houben, R., M. Shuda, R. Weinkam, D. Schrama, H. Feng, Y. Chang, P. S. Moore, and J. C. Becker. Merkel cell polyomavirus-infected merkel cell carcinoma cells require expression of viral T antigens. J Virol 84: 7064-72. 194. Howes, S., B. Bockus, and B. Schaffhausen. 1996. Genetic analysis of polyomavirus large T nuclear localization: nuclear localization is required for productive association with pRb family members. J. Virol. 70: 3581-3588. 195. Hsu, D. K. W., Y. Guo, G. F. Alberts, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, K. A. Peifley, and J. A. Winkles. 1996. Identification of a murine TEF- 1-related gene expressed after mitogenic stimulation of quiescent fibroblasts and during myogenic differentiation. J. Biol. Chem 271: 13786-95. 196. Hunter, T., M. A. Hutchinson, and W. Eckhart. 1984. Polyoma middle-T antigen can be phosphorylated on tyrosine at multiple sites in vitro . EMBO J. 3: 73-80. 197. Hyde-DeRuyscher, R., and G. G. Carmichael. 1988. Polyomavirus early-late switch is not regulated at the level of transcription initiation and is associated with changes in RNA processing. Proc Natl Acad Sci U S A 85: 8993-7. 198. Iftode, C., Y. Daniely, and J. A. Borowiec. 1999. Replication protein A (RPA): the eukaryotic SSB. Crit Rev Biochem Mol Biol 34: 141-80. 199. Innis, M. A., and D. H. Gelfand. 1990. Optimization of PCRs, p. 3-12. In M. A. Innis, D. H. Gelfand, J. J. Sminsky, and T. J. White (ed.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego. 200. Israel, M., M. Martin, T. Miyamura, K. Takemoto, D. Rifkin, and R. Pollack. 1980. Phenotype of polyoma-induced hamster tumor cell lines. J. Virol. 35: 252- 255. 201. Ito, K., M. Asano, P. Hughes, H. Kohzaki, C. Masutani, F. Hanaoka, T. Kerppola, T. Curran, Y. Murakami, and Y. Ito. 1996. c-Jun stimulates origin- dependent DNA unwinding by polyomavirus large Tantigen. EMBO Journal 15: 5636-46. 202. Ito, Y. 1979. Polyoma virus-specific 55K protein isolated from plasma membrane of productively infected cells is virus-coded and important cell transformation. Virology 98: 261-266. 237
203. Jackson, S. P., and J. Bartek. 2009. The DNA-damage response in human biology and disease. Nature 461: 1071-8. 204. Jans, D. A., M. J. Ackermann, J. R. Bischoff, D. H. Beach, and R. Peters. 1991. p34cdc2-mediated phosphorylation at T124 inhibits nuclear import of SV- 40 T antigen proteins. J. Cell Biol. 115: 1203-1212. 205. Jeste, D. V., and S. I. Finkel. 2000. Psychosis of Alzheimer's disease and related dementias. Diagnostic criteria for a distinct syndrome. Am J Geriatr Psychiatry 8: 29-34. 206. Jiang, G., and A. Sancar. 2006. Recruitment of DNA damage checkpoint proteins to damage in transcribed and nontranscribed sequences. Molecular and cellular biology 26: 39-49. 207. Jiang, X., V. Klimovich, A. I. Arunkumar, E. B. Hysinger, Y. Wang, R. D. Ott, G. D. Guler, B. Weiner, W. J. Chazin, and E. Fanning. 2006. Structural mechanism of RPA loading on DNA during activation of a simple pre-replication complex. EMBO J 25: 5516-26. 208. Jin, Y. J., and S. J. Burakoff. 1993. The 25-kDa FK506-binding protein is localized in the nucleus and associates with casein kinase II and nucleolin. Proc Natl Acad Sci U S A 90: 7769-73. 209. Johnston, S. D., X. M. Yu, and J. E. Mertz. 1996. The major transcriptional transactivation domain of simian virus 40 large T antigen associates nonconcurrently with multiple components of the transcriptional preinitiation complex. J. Virol 70: 1191-202. 210. Jones, K., and R. Tjian. 1984. Essential contact residues within SV40 large T antigen binding sites I and II identified by alkylation-interference. Cell 36: 155- 162. 211. Joo, W. S., X. Luo, D. Denis, H. Y. Kim, G. J. Rainey, C. Jones, K. R. Sreekumar, and P. A. Bullock. 1997. Purification of the simian virus 40 (SV40) T antigen DNA-binding domain and characterization of its interactions with the SV40 origin. Journal of virology 71: 3972-85. 212. Kalderon, D., W. D. Richardson, A. F. Markham, and A. E. Smith. 1984. Sequence requirements for nuclear location of simian virus 40 large-T antigen. Nature 311: 33-38. 213. Kalderon, D., B. Roberts, W. Richardson, and A. Smith. 1984. A short amino acid sequence able to specify nuclear location. Cell 39: 499-509. 214. Kalderon, D., and A. E. Smith. 1984. In vitro mutagenesis of a putative DNA binding domain of SV40 large-T. Virology 139: 109-137. 215. Kaplan, D. R., M. Whitman, B. Schaffhausen, L. Raptis, R. L. Garcea, D. Pallas, T. M. Roberts, and L. Cantley. 1986. Phosphatidylinositol metabolism and polyoma-mediated transformation. Proc. Natl. Acad. Sci. USA. 83: 3624-3628. 216. Karen, K. A., P. J. Hoey, C. S. Young, and P. Hearing. 2009. Temporal regulation of the Mre11-Rad50-Nbs1 complex during adenovirus infection. J Virol 83: 4565-73. 217. Kautz, A. R., K. Weisshart, A. Schneider, F. Grosse, and H. P. Nasheuer. 2001. Amino acids 257 to 288 of mouse p48 control the cooperation of polyomavirus large T antigen, replication protein A, and DNA polymerase alpha- primase to synthesize DNA in vitro. J Virol 75: 8569-78. 238
218. Kellems, R., V. Morhenn, R. Pfendt, F. Alt, and R. Schimke. 1979. Polyoma virus and cAMP-mediated control of dihydrofolate reductase mRNA abundance in methotrexate-resistant mouse fibroblasts. J. Biol. Chem. 254: 309-318. 219. Kelly, T. J., M. S. Wold, and J. Li. 1988. Initiation of viral DNA replication. Adv Virus Res 34: 1-42. 220. Kim, B., and J. W. Little. 1992. Dimerization of a specific DNA-binding protein on the DNA. Science 255: 203-6. 221. Kim, C., B. F. Paulus, and M. S. Wold. 1994. Interactions of human replication protein A with oligonucleotides. Biochemistry 33: 14197-206. 222. Kim, C., and M. S. Wold. 1995. Recombinant human replication protein A binds to polynucleotides with low cooperativity. Biochemistry 34: 2058-64. 223. Kimura, C., Q. L. Zhao, T. Kondo, M. Amatsu, and Y. Fujiwara. 1998. Mechanism of UV-induced apoptosis in human leukemia cells: roles of Ca2+/Mg(2+)-dependent endonuclease, caspase-3, and stress-activated protein kinases. Experimental cell research 239: 411-22. 224. Kingston, R. E., A. Cowie, R. I. Morimoto, and K. A. Gwinn. 1986. Binding of polyomavirus large T antigen to the human hsp70 promoter is not required for trans activation. Mol. Cell. Biol. 6: 3180-90. 225. Klug, A. 1965. Structure of Viruses of the Papilloma-Polyoma Type. Ii. Comments on Other Work. J Mol Biol 11: 424-31. 226. Knowles, W. A., P. Pipkin, N. Andrews, A. Vyse, P. Minor, D. W. Brown, and E. Miller. 2003. Population-based study of antibody to the human polyomaviruses BKV and JCV and the simian polyomavirus SV40. J Med Virol 71: 115-23. 227. Kolzau, T., R. S. Hansen, D. Zahra, R. R. Reddel, and A. W. Braithwaite. 1999. Inhibition of SV40 large T antigen induced apoptosis by small T antigen. Oncogene 18: 5598-603. 228. Kornbluth, S., R. Jove, and H. Hanafusa. 1987. Characterization of avian and viral p60src proteins expressed in yeast. Proc. Natl. Acad. Sci. USA 84: 4455- 4459. 229. Kudoh, A., M. Fujita, L. Zhang, N. Shirata, T. Daikoku, Y. Sugaya, H. Isomura, Y. Nishiyama, and T. Tsurumi. 2005. Epstein-Barr virus lytic replication elicits ATM checkpoint signal transduction while providing an S- phase-like cellular environment. J Biol Chem 280: 8156-63. 230. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685. 231. Lamarche, B. J., N. I. Orazio, and M. D. Weitzman. The MRN complex in double-strand break repair and telomere maintenance. FEBS Lett 584: 3682-95. 232. Lamarche, B. J., N. I. Orazio, and M. D. Weitzman. 2010. The MRN complex in double-strand break repair and telomere maintenance. FEBS letters 584: 3682- 95. 233. Land, H., L. F. Parada, and R. A. Weinberg. 1983. Tumorigenic conversion of primary embryo fibroblasts requires at least two cooperating oncogenes. Nature 304: 596-602. 234. Lane, D. P., and L. Crawford. 1979. T antigen is bound to a host of protein in SV40-transformed cells. Nature 278: 261-263. 239
235. Lanford, R., C. Wong, and J. Butel. 1985. Differential ability of a T-antigen transport-defective mutant of simian virus 40 to transform primary and established rodent cells. Mol. Cell. Biol. 5: 1043-1050. 236. Larose, A., N. Dyson, M. Sullivan, E. Harlow, and M. Bastin. 1991. Polyomavirus large T mutants affected in retinoblastoma protein binding are defective in immortalization. J. Virol. 65: 2308-13. 237. Lazebnik, Y. A., S. H. Kaufmann, S. Desnoyers, G. G. Poirier, and W. C. Earnshaw. 1994. Cleavage of poly(ADP-ribose) polymerase by a proteinase with properties like ICE. Nature 371: 346-7. 238. Le Moal, M. A., M. Yaniv, and F. Thierry. 1994. The bovine papillomavirus type 1 (BPV1) replication protein E1 modulates transcriptional activation by interacting with BPV1 E2. J Virol 68: 1085-93. 239. Leask, A., and D. J. Abraham. 2004. TGF-beta signaling and the fibrotic response. FASEB J 18: 816-27. 240. Lee, J. H., and T. T. Paull. 2005. ATM activation by DNA double-strand breaks through the Mre11-Rad50-Nbs1 complex. Science 308: 551-4. 241. Lee, J. H., and T. T. Paull. 2004. Direct activation of the ATM protein kinase by the Mre11/Rad50/Nbs1 complex. Science 304: 93-6. 242. Lee, N. G., J. Yamaguchi, and K. N. Subramanian. 1991. Efficient replication of plasmids containing the SV40 origin in N-myc overexpressing human neuroblastoma cells. Oncogene 6: 1161-9. 243. Lehman, J. M. 1974. Early chromosome changes in diploid Chinese hamster cells after infection with Simian virus 40. Int J Cancer 13: 164-72. 244. Li, D., R. Zhao, W. Lilyestrom, D. Gai, R. Zhang, J. A. DeCaprio, E. Fanning, A. Jochimiak, G. Szakonyi, and X. S. Chen. 2003. Structure of the replicative helicase of the oncoprotein SV40 large tumour antigen. Nature 423: 512-8. 245. Li, J., and T. Kelly. 1984. Simian Virus 40 DNA Replication in vitro. Proc. Natl. Acad. Sci. USA 81: 6973-6977. 246. Li, X., and H. S. Earp. 1997. Paxillin is tyrosine-phosphorylated by and preferentially associates with the calcium-dependent tyrosine kinase in rat liver epithelial cells. J. Biol. Chem 272: 14341-8. 247. Liang, T. J., G. G. Carmichael, and T. L. Benjamin. 1984. A polyoma mutant that encodes small T antigen but not middle T antigen demonstrates uncoupling of cell surface and cytoskeletal changes associated with cell transformation. Mol. Cell Biol. 4: 2774-2783. 248. Liddington, R. C., Y. Yan, J. Moulai, R. Sahli, T. L. Benjamin, and S. C. Harrison. 1991. Structure of simian virus 40 at 3.8-A resolution. Nature 354: 278- 84. 249. Lilley, C. E., C. T. Carson, A. R. Muotri, F. H. Gage, and M. D. Weitzman. 2005. DNA repair proteins affect the lifecycle of herpes simplex virus 1. Proc Natl Acad Sci U S A 102: 5844-9. 250. Lilley, C. E., R. A. Schwartz, and M. D. Weitzman. 2007. Using or abusing: viruses and the cellular DNA damage response. Trends Microbiol 15: 119-26. 251. Lim, D. S., H. Vogel, D. M. Willerford, A. T. Sands, K. A. Platt, and P. Hasty. 2000. Analysis of ku80-mutant mice and cells with deficient levels of p53. Mol Cell Biol 20: 3772-80. 240
252. Lindahl, T. 1993. Instability and decay of the primary structure of DNA. Nature 362: 709-15. 253. Linzer, D. I. H., and A. J. Levine. 1979. Characterization of a 54K Dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected emryonal carcinoma cells. Cell 17: 43-52. 254. Liu, Y., Z. Yang, C. D. Utzat, N. E. Geacintov, A. K. Basu, and Y. Zou. 2005. Interactions of human replication protein A with single-stranded DNA adducts. Biochem J 385: 519-26. 255. Lomax, M., and M. Fried. 2001. Polyoma virus disrupts ARF signaling to p53. Oncogene 20: 4951-60. 256. Los, M., M. Mozoluk, D. Ferrari, A. Stepczynska, C. Stroh, A. Renz, Z. Herceg, Z. Q. Wang, and K. Schulze-Osthoff. 2002. Activation and caspase- mediated inhibition of PARP: a molecular switch between fibroblast necrosis and apoptosis in death receptor signaling. Mol Biol Cell 13: 978-88. 257. Love, T. M., R. de Jesus, J. A. Kean, Q. Sheng, A. Leger, and B. Schaffhausen. 2005. Activation of CREB/ATF sites by polyomavirus large T antigen. J Virol 79: 4180-90. 258. Lowndes, N. F., and J. R. Murguia. 2000. Sensing and responding to DNA damage. Curr Opin Genet Dev 10: 17-25. 259. Lu, J. Z., Y. N. Sun, R. C. Rose, W. Bonnez, and D. J. McCance. 1993. Two E2 binding sites (E2BS) alone or one E2BS plus an A/T-rich region are minimal requirements for the replication of the human papillomavirus type 11 origin. J Virol 67: 7131-9. 260. Lukas, J., and J. Bartek. 2004. Watching the DNA repair ensemble dance. Cell 118: 666-8. 261. Lukas, J., C. Lukas, and J. Bartek. 2004. Mammalian cell cycle checkpoints: signalling pathways and their organization in space and time. DNA Repair (Amst) 3: 997-1007. 262. Luo, M. H., K. Rosenke, K. Czornak, and E. A. Fortunato. 2007. Human cytomegalovirus disrupts both ataxia telangiectasia mutated protein (ATM)- and ATM-Rad3-related kinase-mediated DNA damage responses during lytic infection. J Virol 81: 1934-50. 263. Luo, X., D. Sanford, P. Bullock, and W. Bachovchin. 1996. Solution structure of the origin DNA-binding domain of SV40 T-antigen. Nat. Struct. Biol. 3: 1034- 1039. 264. Magnusson, G., and P. Berg. 1979. Construction and analysis of viable deletion mutants of polyoma virus. J. Virol. 32: 523-529. 265. Maione, R., G. M. Fimia, and P. Amati. 1992. Inhibition of in vitro myogenic differentiation by a polyomavirus early function. Oncogene 7: 85-93. 266. Maione, R., G. M. Fimia, P. Holman, B. Schaffhausen, and P. Amati. 1994. Retinoblastoma antioncogene is involved in the inhibition of myogenesis by polyomavirus large T antigen. Cell Growth and Differentiation 5: 231-237. 267. Margolskee, R. F., and D. Nathans. 1984. Simian virus 40 mutant T antigens with relaxed specificity for the nucleotide sequence at the viral DNA origin of replication. J Virol 49: 386-93. 241
268. Martens, I., S. A. Nilsson, S. Linder, and G. Magnusson. 1989. Mutational analysis of polyomavirus small-T-antigen functions in productive infection and in transformation. J. Virol. 63: 2126-33. 269. Martens, J. A., and F. Winston. 2002. Evidence that Swi/Snf directly represses transcription in S. cerevisiae. Genes Dev 16: 2231-6. 270. Massague, J., and D. Wotton. 2000. Transcriptional control by the TGF- beta/Smad signaling system. EMBO J 19:1745-54. 271. Mastrangelo, I. A., P. V. C. Hough, J. Wall, M. Dodson, F. Dean, and J. Hurwitz. 1989. ATP-dependent assembly of double hexamers of SV40 T antigen at the viral origin of DNA replication. Nature 338: 658-662. 272. Matsumoto, T., T. Eki, and J. Hurwitz. 1990. Studies on the initiation and elongation reactions in the simian virus 40 DNA replication system. Proc Natl Acad Sci U S A 87: 9712-6. 273. Matsunaga, T., D. Mu, C. H. Park, J. T. Reardon, and A. Sancar. 1995. Human DNA repair excision nuclease. Analysis of the roles of the subunits involved in dual incisions by using anti-XPG and anti-ERCC1 antibodies. J Biol Chem 270: 20862-9. 274. Mazurek, A., C. N. Johnson, M. W. Germann, and R. Fishel. 2009. Sequence context effect for hMSH2-hMSH6 mismatch-dependent activation. Proc Natl Acad Sci U S A 106: 4177-82. 275. McKay, R., and D. DiMaio. 1981. Binding of an SV40 T antigen-related protein to the DNA of SV40 regulatory mutants. Nature 289: 810-3. 276. McVey, D., S. Ray, Y. Gluzman, L. Berger, A. Wildeman, D. Marshak, and P. Tegtmeyer. 1993. cdc2 phosphorylation of threoniune 124 activates the origin- unwinding functions of simian virus 40 T antigen. J. Virol 67: 5206-5215. 277. Medina, P. P., J. Carretero, M. F. Fraga, M. Esteller, D. Sidransky, and M. Sanchez-Cespedes. 2004. Genetic and epigenetic screening for gene alterations of the chromatin-remodeling factor, SMARCA4/BRG1, in lung tumors. Genes Chromosomes Cancer 41: 170-7. 278. Meinke, G., P. A. Bullock, and A. Bohm. 2006. Crystal structure of the simian virus 40 large T-antigen origin-binding domain. Journal of virology 80: 4304-12. 279. Meinke, G., P. Phelan, A. Fradet-Turcotte, J. Archambault, and P. A. Bullock. 2011. Structure-based design of a disulfide-linked oligomeric form of the simian virus 40 (SV40) large T antigen DNA-binding domain. Acta crystallographica. Section D, Biological crystallography 67: 560-7. 280. Meinke, G., P. Phelan, S. Moine, E. Bochkareva, A. Bochkarev, P. A. Bullock, and A. Bohm. 2007. The crystal structure of the SV40 T-antigen origin binding domain in complex with DNA. PLoS biology 5: e23. 281. Melendy, T., and B. Stillman. 1993. An interaction between replication protein A and SV40 T antigen appears essential for primosome assembly during SV40 DNA replication. J Biol Chem 268: 3389-95. 282. Memisoglu, A., and L. Samson. 2000. Base excision repair in yeast and mammals. Mutat Res 451: 39-51. 283. Memisoglu, A., and L. Samson. 2000. Contribution of base excision repair, nucleotide excision repair, and DNA recombination to alkylation resistance of the fission yeast Schizosaccharomyces pombe. J Bacteriol 182: 2104-12. 242
284. Mer, G., A. Bochkarev, W. J. Chazin, and A. M. Edwards. 2000. Three- dimensional structure and function of replication protein A. Cold Spring Harb Symp Quant Biol 65: 193-200. 285. Mer, G., A. Bochkarev, R. Gupta, E. Bochkareva, L. Frappier, C. J. Ingles, A. M. Edwards, and W. J. Chazin. 2000. Structural basis for the recognition of DNA repair proteins UNG2, XPA, and RAD52 by replication factor RPA. Cell 103: 449-56. 286. Mer, G., A. M. Edwards, and W. J. Chazin. 2000. 1H, 15N and 13C resonance assignments for the C-terminal protein interaction region of the 32 kDa subunit of human replication protein A. J Biomol NMR 17: 179-80. 287. Michael, W. M., R. Ott, E. Fanning, and J. Newport. 2000. Activation of the DNA replication checkpoint through RNA synthesis by primase. Science 289: 2133-7. 288. Millward, T. A., S. Zolnierowicz, and B. A. Hemmings. 1999. Regulation of protein kinase cascades by protein phosphatase 2A. Trends Biochem Sci 24: 186- 91. 289. Mladenov, E., and G. Iliakis. 2011. Induction and repair of DNA double strand breaks: The increasing spectrum of non-homologous end joining pathways. Mutation research. 290. Moll, J., H. Eibel, F. Botteri, G. Sansig, C. Regnier, van, der, Putten, and H. 1992. Transgenes encoding mutant simian virus 40 large T antigens unmask phenotypic and functional constraints in thymic epithelial cells. Oncogene 7: 2175-87. 291. Mordes, D. A., G. G. Glick, R. Zhao, and D. Cortez. 2008. TopBP1 activates ATR through ATRIP and a PIKK regulatory domain. Genes & development 22: 1478-89. 292. Moule, M. G., C. H. Collins, F. McCormick, and M. Fried. 2004. Role for PP2A in ARF signaling to p53. Proc Natl Acad Sci U S A 101: 14063-6. 293. Mudrak, I., E. Ogris, H. Rotheneder, and E. Wintersberger. 1994. Coordinated trans activation of DNA synthesis- and precursor-producing enzymes by polyomavirus large T antigen through interaction with the retinoblastoma protein. Mol. Cell. Biol. 14: 1886-92. 294. Mullane, K. P., M. Ratnofsky, X. Cullere, and B. Schaffhausen. 1998. Signaling from polyomavirus middle T and small T defines different roles for protein phosphatase 2A. Mol Cell Biol 18: 7556-65. 295. Muller, M. M., T. Gerster, and W. Schaffner. 1988. Enhancer sequences and the regulation of gene transcription. Eur J Biochem 176: 485-95. 296. Muller, M. M., S. Ruppert, W. Schaffner, and P. Matthias. 1988. A cloned octamer transcription factor stimulates transcription from lymphoid-specific promoters in non-B cells. Nature 336: 544-51. 297. Mumby, M. 1995. Regulation by tumour antigens defines a role for PP2A in signal transduction. [Review] [59 refs]. Seminars in Cancer Biology 6: 229-37. 298. Murakami, J., T. Eki, M.-A. Tamada, C. Prives, and J. Hurwitz. 1986. Species specific in vitro synthesis of DNA containing the polyomavirus origin of replication. Proc. Natl. Acad. Sci. USA 83: 6347-6351. 243
299. Murakami, J., T. Eki, M.-A. Yamada, C. Prives, and J. Hurwitz. 1986. Species specific in vitro synthesis of DNA containing the polyomavirus origin of replication. Proc. Nat. Acad. Sci. 83 . 300. Murakami, Y., and J. Hurwitz. 1993. Functional interactions between SV40 T antigen and other replication proteins at the replication fork. J Biol Chem 268: 11008-17. 301. Murakami, Y., M. Satake, Y. Yamaguchi-Iwai, M. Sakai, M. Muramatsu, and Y. Ito. 1991. The nuclear protooncogenes c-jun and c-fos as regulators of DNA replication. Proc Natl Acad Sci U S A 88: 3947-51. 302. Myers, R. M., D. C. Rio, A. K. Robbins, and R. Tjian. 1981. SV40 gene expression is modulated by the cooperative binding of T antigen to DNA. Cell 25: 373-84. 303. Nagelhus, T. A., T. Haug, K. K. Singh, K. F. Keshav, F. Skorpen, M. Otterlei, S. Bharati, T. Lindmo, S. Benichou, R. Benarous, and H. E. Krokan. 1997. A sequence in the N-terminal region of human uracil-DNA glycosylase with homology to XPA interacts with the C-terminal part of the 34-kDa subunit of replication protein A. J Biol Chem 272: 6561-6. 304. Nemethova, M., M. Smutny, and E. Wintersberger. 2004. Transactivation of E2F-regulated genes by polyomavirus large T antigen: evidence for a two-step mechanism. Mol Cell Biol 24: 10986-94. 305. Nemethova, M., and E. Wintersberger. 1999. Polyomavirus large T antigen binds the transcriptional coactivator protein p300. J Virol 73: 1734-1739. 306. Noda, T., M. Satake, T. Robins, and Y. Ito. 1986. Isolation and characterization of NIH 3T3 cells expressing polyomavirus small T antigen. J. Virol. 60: 105-113. 307. Novak, U., S. M. Dilworth, and B. E. Griffin. 1980. Coding capacity of a 35% fragment of the polyoma virus genome is sufficient to initiate and maintain cellular transformation. Proc. Natl. Acad. Sci. USA 77: 3278-3282. 308. Nunbhakdi-Craig, V., L. Craig, T. Machleidt, and E. Sontag. 2003. Simian virus 40 small tumor antigen induces deregulation of the actin cytoskeleton and tight junctions in kidney epithelial cells. J Virol 77: 2807-18. 309. Nuss, J. E., S. M. Patrick, G. G. Oakley, G. M. Alter, J. G. Robison, K. Dixon, and J. J. Turchi. 2005. DNA damage induced hyperphosphorylation of replication protein A. 1. Identification of novel sites of phosphorylation in response to DNA damage. Biochemistry 44: 8428-37. 310. O'Connell, M. J., N. C. Walworth, and A. M. Carr. 2000. The G2-phase DNA- damage checkpoint. Trends Cell Biol 10: 296-303. 311. Oakley, G. G., L. I. Loberg, J. Yao, M. A. Risinger, R. L. Yunker, M. Zernik- Kobak, K. K. Khanna, M. F. Lavin, M. P. Carty, and K. Dixon. 2001. UV- induced hyperphosphorylation of replication protein a depends on DNA replication and expression of ATM protein. Molecular biology of the cell 12: 1199-213. 312. Oakley, G. G., and S. M. Patrick. Replication protein A: directing traffic at the intersection of replication and repair. Front Biosci 15: 883-900. 313. Obata, T., G. E. Brown, and M. B. Yaffe. 2000. MAP kinase pathways activated by stress: the p38 MAPK pathway. Crit Care Med 28: N67-77. 244
314. Ogris, E., I. Mudrak, E. Mak, D. Gibson, and D. C. Pallas. 1999. Catalytically inactive protein phosphatase 2A can bind to polyomavirus middle tumor antigen and support complex formation with pp60(c-src). J Virol 73: 7390-8. 315. Ogris, E., I. Mudrak, and E. Wintersberger. 1992. Polyomavirus large and small T antigens cooperate in induction of the S phase in serum-starved 3T3 mouse fibroblasts. J. Virol. 66: 53-61. 316. Ogris, E., H. Rotheneder, I. Mudrak, A. Pichler, and E. Wintersberger. 1993. A binding site for transcription factor E2F is a target for trans activation of murine thymidine kinase by polyomavirus large T antigen and plays an important role in growth regulation of the gene. J. Virol. 67: 1765-71. 317. Osley, M. A., T. Tsukuda, and J. A. Nickoloff. 2007. ATP-dependent chromatin remodeling factors and DNA damage repair. Mutation research 618: 65-80. 318. Oxman, M. N., K. K. Takemoto, and W. Eckhart. 1972. Polyoma T antigen synthesis by temperature-sensitive mutants of polyoma virus. Virology 49: 675-82. 319. Pallas, D. C., W. Morgan, and T. M. Roberts. 1989. The cellular proteins which can associate specifically with polyomavirus middle T antigen in human 293 cells include the major human 70-kilodalton heat shock proteins. J Virol 63: 4533-9. 320. Pallas, D. C., L. K. Shahrik, B. L. Martin, S. Jaspers, T. B. Miller, D. L. Brautigan, and T. M. Roberts. 1990. Polyoma small and middle T antigens and SV40 small t antigen form stable complexes with protein phosphatase 2A. Cell 60: 167-76. 321. Pannuti, A., M. G. La, and L. Lania. 1987. Regulation of viral and cellular promoter activity by polyomavirus early proteins. Nucleic Acids Res 15: 1595-613. 322. Pannuti, A., A. Pascucci, G. la Mantia, L. Fisher-Fantuzzi, C. Vesco, and L. Lania. 1987. trans-Activation of cellular and viral promoters by a transforming nonkaryophillic simian virus 40 large T antigen. J. Virol 61: 1296-99. 323. Pardo, O. E., A. Arcaro, G. Salerno, S. Raguz, J. Downward, and M. J. Seckl. 2002. Fibroblast growth factor-2 induces translational regulation of Bcl-XL and Bcl-2 via a MEK-dependent pathway: correlation with resistance to etoposide- induced apoptosis. The Journal of biological chemistry 277: 12040-6. 324. Park, M. S., D. L. Ludwig, E. Stigger, and S. H. Lee. 1996. Physical interaction between human RAD52 and RPA is required for homologous recombination in mammalian cells. J Biol Chem 271: 18996-9000. 325. Parsons, R., M. E. Anderson, and P. Tegtmeyer. 1990. Three domains in the simian virus 40 core origin orchestrate the binding, melting, and DNA helicase activities of T antigen. J. Virol 64: 509-18. 326. Parsons, R. E., J. E. Stenger, S. Ray, R. Welker, M. E. Anderson, and P. Tegtmeyer. 1991. Cooperative assembly of simian virus 40 T-antigen hexamers on functional halves of the replication origin. J Virol 65: 2798-806. 327. Patrick, S. M., G. G. Oakley, K. Dixon, and J. J. Turchi. 2005. DNA damage induced hyperphosphorylation of replication protein A. 2. Characterization of DNA binding activity, protein interactions, and activity in DNA replication and repair. Biochemistry 44: 8438-48. 245
328. Patton, W. P., U. Chakravarthy, R. J. Davies, and D. B. Archer. 1999. Comet assay of UV-induced DNA damage in retinal pigment epithelial cells. Invest Ophthalmol Vis Sci 40: 3268-75. 329. Paucha, E., D. Kalderon, R. W. Harvey, and A. E. Smith. 1986. Simian virus 40 origin DNA-binding domain on large T antigen. J. Virol. 57: 50-64. 330. Peltomaki, P., X. Gao, and J. P. Mecklin. 2001. Genotype and phenotype in hereditary nonpolyposis colon cancer: a study of families with different vs. shared predisposing mutations. Fam Cancer 1: 9-15. 331. Petrini, J. H., and T. H. Stracker. 2003. The cellular response to DNA double- strand breaks: defining the sensors and mediators. Trends Cell Biol 13: 458-62. 332. Pietruska, J. R., and A. B. Kane. 2007. SV40 oncoproteins enhance asbestos- induced DNA double-strand breaks and abrogate senescence in murine mesothelial cells. Cancer research 67: 3637-45. 333. Pipas, J. M. 1992. Common and unique features of T antigens encoded by the polyomavirus group. J. Virol. 66: 3979-85. 334. Pistillo, J. M., and J. K. Vishwanatha. 1991. Interaction of simian virus 40 large T-antigen with cellular DNA polymerase alpha: studies with various T-antigen mutants of SV40. Archives of Virology 118: 113-25. 335. Pomerantz, B. J., and J. A. Hassell. 1984. Polyomavirus and simian virus 40 large T antigens bind to common DNA Sequences. J. Virol. 49: 925-937. 336. Pomerantz, B. J., C. R. Mueller, and J. A. Hassell. 1983. Polyomavirus Large T antigen binds independently to multiple, unique regions of the viral genome. J. Virol. 47: 600-610. 337. Quartin, R. S., C. N. Cole, J. M. Pipas, and A. J. Levine. 1994. The amino- terminal functions of the simian virus 40 large T antigen are required to overcome wild-type p53-mediated growth arrest of cells. J. Virol. 68: 1334-1341. 338. Ramachandra, M., and R. Padmanabhan. 1993. Adenovirus DNA polymerase is phosphorylated by a stably associated histone H1 kinase. J Biol Chem 268: 17448-56. 339. Ramilo, C., L. Gu, S. Guo, X. Zhang, S. M. Patrick, J. J. Turchi, and G. M. Li. 2002. Partial reconstitution of human DNA mismatch repair in vitro: characterization of the role of human replication protein A. Mol Cell Biol 22: 2037-46. 340. Rassoulzadegan, M., S. A. Courtneidge, R. Loubiere, B. P. el, and F. Cuzin. 1990. A variety of tumours induced by the middle T antigen of polyoma virus in a transgenic mouse family. Oncogene 5: 1507-10. 341. Rassoulzadegan, M., A. Cowie, A. Carr, N. Glaichenhaus, R. Kamen, and F. Cuzin. 1982. The roles of individual polyoma virus early proteins in oncogenic transformation. Nature 300: 713-718. 342. Rassoulzadegan, M., Z. Naghasfar, A. Cowie, A. Carr, M. Grisoni, R. Kamen, and F. Cuzin. 1983. Expression of the large T protein of polyoma virus promotes the establishment in culture of "normal" rodent fibroblast cell lines. Proc. Natl. Acad. Sci. USA 80: 4354-4358. 343. Rastogi, R. P., Richa, A. Kumar, M. B. Tyagi, and R. P. Sinha. 2010. Molecular mechanisms of ultraviolet radiation-induced DNA damage and repair. Journal of nucleic acids 2010: 592980. 246
344. Ray, F. A., J. Meyne, and P. M. Kraemer. 1992. SV40 T antigen induced chromosomal changes reflect a process that is both clastogenic and aneuploidogenic and is ongoing throughout neoplastic progression of human fibroblasts. Mutat Res 284: 265-73. 345. Ray, F. A., D. S. Peabody, J. L. Cooper, L. S. Cram, and P. M. Kraemer. 1990. SV40 T antigen alone drives karyotype instability that precedes neoplastic transformation of human diploid fibroblasts. J Cell Biochem 42: 13-31. 346. Reardon, J. T., and A. Sancar. 2003. Recognition and repair of the cyclobutane thymine dimer, a major cause of skin cancers, by the human excision nuclease. Genes & development 17: 2539-51. 347. Reed, S. I., G. R. Stark, and J. C. Alwine. 1976. Autoregulation of simian virus 40 gene A by T antigen. Proc Natl Acad Sci U S A 73: 3083-7. 348. Reese, D. K., G. Meinke, A. Kumar, S. Moine, K. Chen, J. L. Sudmeier, W. Bachovchin, A. Bohm, and P. A. Bullock. 2006. Analyses of the interaction between the origin binding domain from simian virus 40 T antigen and single- stranded DNA provide insights into DNA unwinding and initiation of DNA replication. Journal of virology 80: 12248-59. 349. Reynisdottir, I., H. E. Lorimer, P. N. Friedman, E. H. Wang, and C. Prives. 1993. Phosphorylation and active ATP hydrolysis are not required for SV40 T antigen hexamer formation. J. Biol. Chem 268: 24647-24654. 350. Richardson, W. D., B. L. Roberts, and A. E. Smith. 1986. Nuclear location signals in polyoma virus large-T antigen. Cell 44: 77-85. 351. Rihs, H. P., D. A. Jans, H. Fan, and R. Peters. 1991. The rate of nuclear cytoplasmic protein transport is determined by the casein kinase II site flanking the nuclear localization sequence of the SV40 T-antigen. EMBO J 10: 633-9. 352. Rihs, H. P., R. Peters, and G. Hobom. 1991. Nuclear localization of budgerigar fledgling disease virus capsid protein VP2 is conferred by residues 308-317. FEBS Lett 291: 6-8. 353. Riley, M. I., W. Yoo, N. Y. Mda, and W. R. Folk. 1997. Tiny T antigen: an autonomous polyomavirus T antigen amino-terminal domain. J. Virol 71: 6068-74. 354. Roberts, C. W., and S. H. Orkin. 2004. The SWI/SNF complex--chromatin and cancer. Nat Rev Cancer 4: 133-42. 355. Roberts, J. M., and G. D'Urso. 1989. Cellular and viral control of the initiation of DNA replication. J Cell Sci Suppl 12: 171-82. 356. Robison, J. G., J. J. Bissler, and K. Dixon. 2007. Replication protein A is required for etoposide-induced assembly of MRE11/RAD50/NBS1 complex repair foci. Cell Cycle 6: 2408-16. 357. Rodier, F., R. Bertrand, M. Bossolasco, and A. M. Mes-Masson. 2000. Polyomavirus large T-antigen protects mouse cells from Fas-, TNF-alpha- and taxol-induced apoptosis. Oncogene 19: 6261-70. 358. Rohaly, G., K. Korf, S. Dehde, and I. Dornreiter. 2010. Simian virus 40 activates ATR-Delta p53 signaling to override cell cycle and DNA replication control. Journal of virology 84: 10727-47. 359. Rose, P., and Schaffhausen. 1995. Zinc-binding and protein-protein interaction mediated by the polyomavirus large T zinc finger. J. Virol. 69: 2842-9. 247
360. Ruley, H. E. 1983. Adenovirus early region 1A enables viral and cellular transforming genes to transform primary cells in culture. Nature 304: 602-606. 361. Safak, M., and K. Khalili. 2003. An overview: Human polyomavirus JC virus and its associated disorders. J Neurovirol 9 Suppl 1: 3-9. 362. Sambrook, Fritsch, and Maniatis. 1989. Molecular Cloning, A Laboratory Manual, Second ed, vol. 1. Cold Spring Harbor Laboratory Press. 363. Sancar, A., L. A. Lindsey-Boltz, K. Unsal-Kacmaz, and S. Linn. 2004. Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu Rev Biochem 73: 39-85. 364. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74: 5463-5468. 365. Schaffhausen, B. 1982. Transforming genes and gene products of polyoma and SV40. CRC Crit. Rev. Biochem. 13: 215-86. 366. Schaffhausen, B. S., and T. L. Benjamin. 1976. Deficiency in histone acetylation in nontransforming host range mutants of polyoma virus. Proc Natl Acad Sci U S A 73: 1092-6. 367. Schaffhausen, B. S., and T. L. Benjamin. 1979. Phosphorylation of polyoma T antigens. Cell 18: 935-46. 368. Schaffhausen, B. S., and T. L. Benjamin. 1981. Polyoma virus middle T antigen associated protein kinase. In Protein Phosphorylation . Cold Spring Harbor Conf. Cell Proliferation 8: 1281-1300. 369. Schaffhausen, B. S., B. J. Bockus, K. L. Berkner, D. Kaplan, and T. M. Roberts. 1987. Characterization of middle T antigen expressed by using an adenovirus expression system. J Virol 61: 1221-5. 370. Scheffner, M., R. Knippers, and H. Stahl. 1989. RNA unwinding activity of SV40 large T antigen. Cell 57: 955-63. 371. Scheller, A., and C. Prives. 1985. Simian virus 40 and polyomavirus Large Tumor Antigens have different requirements for high-affinity sequence-specific DNA binding. J. Virol. 54: 532-545. 372. Schlegel, R., and T. L. Benjamin. 1978. Cellular alterations dependent upon the polyoma virus hr-t function: separation of mitogenic from transforming capacities. Cell 14: 587-599. 373. Schuchner, S., M. Nemethova, A. Belisova, B. Klucky, W. Holnthoner, and E. Wintersberger. 2001. Transactivation of murine cyclin A by polyomavirus large and small T antigens. J Virol 75: 6498-507. 374. Schulze, A., K. Zerfass, D. Spitkovsky, S. Middendorp, J. Berges, K. Helin, P. Jansen-Durr, and B. Henglein. 1995. Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site. Proc Natl Acad Sci U S A 92: 11264-8. 375. Seinsoth, S., H. Uhlmann-Schiffler, and H. Stahl. 2003. Bidirectional DNA unwinding by a ternary complex of T antigen, nucleolin and topoisomerase I. EMBO Rep 4: 263-8. 376. Seki, M., T. Enomoto, T. Eki, A. Miyajima, Y. Murakami, F. Hanaoka, and M. Ui. 1990. DNA helicase and nucleoside-5'-triphosphatase activities of polyoma virus large tumor antigen. Biochem. 29: 1003-1009. 248
377. SenGupta, D. J., and J. A. Borowiec. 1992. Strand-specific recognition of a synthetic DNA replication fork by the SV40 large tumor antigen. Science 256: 1656-61. 378. SenGupta, D. J., and J. A. Borowiec. 1994. Strand and face: the topography of interactions between the SV40 origin of replication and T-antigen during the initiation of replication. EMBO J 13: 982-92. 379. Sheng, Q., D. Denis, M. Ratnofsky, T. Roberts, J. DeCaprio, and B. Schaffhausen. 1997. The DnaJ domain of polyoma Large T is required to regulate Rb family tumor tuppressor function. J. Virol. 71.: 9410-9416. 380. Sheng, Q., T. M. Love, and B. Schaffhausen. 2000. J domain-independent regulation of the Rb family by polyomavirus large T antigen. J Virol 74: 5280-90. 381. Shenk, T. E., J. Carbon, and P. Berg. 1976. Construction and analysis of viable deletion mutants of simian virus 40. J. Virol. 18: 664-671. 382. Shi, Y., G. E. Dodson, S. Shaikh, K. Rundell, and R. S. Tibbetts. 2005. Ataxia- telangiectasia-mutated (ATM) is a T-antigen kinase that controls SV40 viral replication in vivo. J Biol Chem 280: 40195-200. 383. Shi, Y., and J. Massague. 2003. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113: 685-700. 384. Shiloh, Y. 1997. Ataxia-telangiectasia and the Nijmegen breakage syndrome: related disorders but genes apart. Annu Rev Genet 31: 635-62. 385. Shirata, N., A. Kudoh, T. Daikoku, Y. Tatsumi, M. Fujita, T. Kiyono, Y. Sugaya, H. Isomura, K. Ishizaki, and T. Tsurumi. 2005. Activation of ataxia telangiectasia-mutated DNA damage checkpoint signal transduction elicited by herpes simplex virus infection. J Biol Chem 280: 30336-41. 386. Short, J. M., A. Wynshaw-Boris, H. P. Short, and R. W. Hanson. 1986. Characterization of the phosphoenolpyruvate carboxykinase (GTP) promoter- regulatory region. II. Identification of cAMP and glucocorticoid regulatory domains. J Biol Chem 261: 9721-6. 387. Shortle, D., and D. Nathans. 1979. Mutants of simian virus 40 with base substitutions at the origin of DNA replication. Cold Spring Harb Symp Quant Biol 43 Pt 2: 663-8. 388. Shortle, D., and D. Nathans. 1979. Regulatory mutants of simian virus 40: constructed mutants with base substitutions at the origin of DNA replication. J Mol Biol 131: 801-17. 389. Shuck, S. C., and J. J. Turchi. Targeted inhibition of Replication Protein A reveals cytotoxic activity, synergy with chemotherapeutic DNA-damaging agents, and insight into cellular function. Cancer Res 70: 3189-98. 390. Siegler, R., and T. L. Benjamin. 1975. Oncogenicity of wild-type and nontransforming mutants of polyoma virus. Proceedings of the American Association of Cancer Research 16: 99. 391. Silver, J., B. Schaffhausen, and T. Benjamin. 1978. Tumor antigens induced by nontransforming mutants of polyoma virus. Cell 15: 485-496. 392. Simmons, D. 1986. DNA-binding region of the simian virus 40 tumor antigen. J. Virol. 57: 776-785. 249
393. Simmons, D., W. Kyungok, and W. Young. 1990. Identification of SV40 T antigen residues important for specific and non-specific binding to DNA and for helicase activity. J. Virol. 64 . 394. Sinha, R. P., and D. P. Hader. 2002. UV-induced DNA damage and repair: a review. Photochem Photobiol Sci 1: 225-36. 395. Smale, S., and R. Tjian. 1986. Inhibition of simian virus 40 DNA replication by specific modification of T- antigen with oxidized ATP. J. Biol. Chem. 261: 14369- 14372. 396. Smale, S. T., and R. Tjian. 1986. T antigen-DNA polymerase a complex implicated in SV40 DNA replication. Mol. Cell. Biol. 6: 4077-4087. 397. Smelkova, N. V., and J. A. Borowiec. 1998. Synthetic DNA replication bubbles bound and unwound with twofold symmetry by a simian virus 40 T-antigen double hexamer. J Virol 72: 8676-81. 398. Smith, A. E., R. Smith, B. Griffin, and M. Fried. 1979. Protein kinase activity associated with polyoma virus middle T antigen in vitro. Cell 18: 915-924. 399. Soeda, E., and B. E. Griffin. 1978. Sequences from the genome of a non- transforming mutant of polyoma virus. Nature 276: 294-8. 400. Sompayrac, L., and K. J. Danna. 1994. An amino-terminal fragment of SV40 T antigen induces cellular DNA synthesis in quiescent rat cells. Virology 200:849- 53. 401. Sontag, E., S. Fedorov, C. Kamibayashi, D. Robbins, M. Cobb, and M. Mumby. 1993. The interaction of SV40 small tumor antigen with protein phosphatase 2A stimulates the map kinase pathway and induces cell proliferation. Cell 75: 887-97. 402. Srinivasan, A., A. J. McClellan, J. Vartikar, I. Marks, P. Cantalupo, Y. Li, P. Whyte, K. Rundell, J. L. Brodsky, and J. M. Pipas. 1997. The amino-terminal transforming region of simian virus 40 large T and small t antigens functions as a J domain. Mol. Cell. Biol 17: 4761-73. 403. St-Onge, L., and M. Bastin. 1993. Amplification mediated by polyomavirus large T antigen defective in replication. J. Virol. 67: 5025-29. 404. St-Onge, L., L. Bouchard, S. Laurent, and M. Bastin. 1990. Intrachromosomal recombination mediated by papovavirus large T antigens. J. Virol 64: 2958-66. 405. Stadlbauer, F., A. Brueckner, C. Rehfuess, C. Eckerskorn, F. Lottspeich, V. Forster, B. Tseng, and H. Nasheuer. 1994. DNA replication in vitro by recombinant DNA- polymerase-alpha-primase. Eur. J. Biochem 222: 781-793. 406. Stahl, H., P. Droge, H. Zentgraf, and R. Knippers. 1985. A large tumor antigen specific monoclonal antibody inhibits DNA replication of SV40 minichromosomes in an in vitro elongation system. J. Virol. 54: 473-482. 407. Stauffer, M. E., and W. J. Chazin. 2004. Physical interaction between replication protein A and Rad51 promotes exchange on single-stranded DNA. J Biol Chem 279: 25638-45. 408. Stehle, T., Y. Yan, T. L. Benjamin, and S. C. Harrison. 1994. Structure of murine polyomavirus complexed with an oligosaccharide receptor fragment. Nature 369: 160-3. 250
409. Stewart, N., and S. Bacchetti. 1991. Expression of SV40 large T antigen, but not small t antigen, is required for the induction of chromosomal aberrations in transformed human cells. Virology 180: 49-57. 410. Stoker, M. 1968. Abortive transformation by polyoma virus. Nature 218: 234-8. 411. Stoker, M. G. 1969. Effects of tumour viruses on growth regulation in cultured cells. Lancet 1: 362-5. 412. Stracker, T. H., C. T. Carson, and M. D. Weitzman. 2002. Adenovirus oncoproteins inactivate the Mre11-Rad50-NBS1 DNA repair complex. Nature 418: 348-52. 413. Stratton, M. R. Exploring the genomes of cancer cells: progress and promise. Science 331: 1553-8. 414. Strauss, M., P. Argani, I. Mohr, and Y. Gluzman. 1987. Studies on the origin- specific DNA-binding domain of simian virus 40 large T antigen. J. Virol 61: 3326-3330. 415. Su, W., W. Liu, B. S. Schaffhausen, and T. M. Roberts. 1995. Association of Polyomavirus middle tumor antigen with phospholipase C-gamma 1. J Biol Chem 270: 12331-4. 416. Suarez, H. G., M. Lange, and R. Cassingena. 1981. Enhancement of transcription of the SV40 genome in mouse embryo cells by pretreatment with 5- iodo-2'-deoxyuridine. J Gen Virol 52: 135-9. 417. Sugiyama, T., and S. C. Kowalczykowski. 2002. Rad52 protein associates with replication protein A (RPA)-single-stranded DNA to accelerate Rad51-mediated displacement of RPA and presynaptic complex formation. J Biol Chem 277: 31663-72. 418. Sugiyama, T., J. H. New, and S. C. Kowalczykowski. 1998. DNA annealing by RAD52 protein is stimulated by specific interaction with the complex of replication protein A and single-stranded DNA. Proc Natl Acad Sci U S A 95: 6049-54. 419. Sung, P., L. Krejci, S. Van Komen, and M. G. Sehorn. 2003. Rad51 recombinase and recombination mediators. J Biol Chem 278: 42729-32. 420. Sunstrom, N. A., N. H. Acheson, and J. A. Hassell. 1991. Determination of the origin-specific DNA-binding domain of polyomavirus large T antigen. J. Virol. 65: 6998-7003. 421. Takata, M., M. S. Sasaki, E. Sonoda, C. Morrison, M. Hashimoto, H. Utsumi, Y. Yamaguchi-Iwai, A. Shinohara, and S. Takeda. 1998. Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells. EMBO J 17: 5497-508. 422. Talmage, D. A., R. Freund, A. T. Young, J. Dahl, C. J. Dawe, and T. L. Benjamin. 1989. Phosphorylation of middle T by pp60c-src: a switch for binding of phosphatidylinositol 3-kinase and optimal tumorigenesis. Cell 59: 55-65. 423. Tang, W. J., S. L. Berger, S. J. Triezenberg, and W. R. Folk. 1987. Nucleotides in the polyomavirus enhancer that control viral transcription and DNA replication. Mol Cell Biol 7: 1681-90. 251
424. Taylor, E. R., and I. M. Morgan. 2003. A novel technique with enhanced detection and quantitation of HPV-16 E1- and E2-mediated DNA replication. Virology 315: 103-9. 425. Tedesco, D., F. L. Fischer, and C. Vesco. 1993. Limits of transforming competence of SV40 nuclear and cytoplasmic large T mutants with altered Rb binding sequences. Oncogene 8: 549-57. 426. Templeton, D., and W. Eckhart. 1982. Mutation causing premature termination of of the polyoma virus middle T antigen blocks cell transformation. J Virol 41: 1014-24. 427. Thoma, B. S., and K. M. Vasquez. 2003. Critical DNA damage recognition functions of XPC-hHR23B and XPA-RPA in nucleotide excision repair. Mol Carcinog 38: 1-13. 428. Tian, Y., D. Li, J. Dahl, J. You, and T. Benjamin. 2004. Identification of TAZ as a binding partner of the polyomavirus T antigens. J Virol 78: 12657-64. 429. Titolo, S., E. Welchner, P. W. White, and J. Archambault. 2003. Characterization of the DNA-binding properties of the origin-binding domain of simian virus 40 large T antigen by fluorescence anisotropy. J Virol 77: 5512-8. 430. Tooze, J. E. 1980. DNA Tumor Viruses. The Molecular Biology of Tumor Viruses. DNA Tumor Viruses. The Molecular Biology of Tumor Viruses. 1 and 2: Cold Spring Harbor Press. 431. Topp, W. C. 1980. Variable defectiveness for lytic growth of the dl 54/59 mutants of simian virus 40. J. Virol. 33: 1208-1210. 432. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76: 4350-4354. 433. Treisman, R., U. Novak, J. Favaloro, and R. Kamen. 1981. Transformation of rat cells by an altered polyoma virus genome expressing only the middle T protein. Nature 292: 595-600. 434. Tsai, B., J. M. Gilbert, T. Stehle, W. Lencer, T. L. Benjamin, and T. A. Rapoport. 2003. Gangliosides are receptors for murine polyoma virus and SV40. EMBO J 22: 4346-55. 435. Tsujimoto, Y. 2002. Bcl-2 family of proteins: life-or-death switch in mitochondria. Biosci Rep 22: 47-58. 436. Tsurimoto, T., and B. Stillman. 1991. Replication factors required for SV40 DNA replication in vitro. J. Biol. Chem 266: 1961-1968. 437. Turk, B., A. Porras, M. C. Mumby, and K. Rundell. 1993. Simian virus 40 small-t antigen binds two zinc ions. J. Virol. 67: 3671-3. 438. Turler, H., and C. Salomon. 1985. Small and middle T antigens contribute to lytic and abortive polyomavirus infection. J. Virol 53: 579-586. 439. Tyndall, C., G. La Mantia, C. M. Thacker, J. Favaloro, and R. Kamen. 1981. A region of the polyoma virus genome between the replication origin and late protein coding sequences is required in cis for both early gene expression and viral DNA replication. Nucleic Acids Res 9: 6231-50. 440. Van Komen, S., G. Petukhova, S. Sigurdsson, and P. Sung. 2002. Functional cross-talk among Rad51, Rad54, and replication protein A in heteroduplex DNA joint formation. J Biol Chem 277: 43578-87. 252
441. Varon, R., C. Vissinga, M. Platzer, K. M. Cerosaletti, K. H. Chrzanowska, K. Saar, G. Beckmann, E. Seemanova, P. R. Cooper, N. J. Nowak, M. Stumm, C. M. Weemaes, R. A. Gatti, R. K. Wilson, M. Digweed, A. Rosenthal, K. Sperling, P. Concannon, and A. Reis. 1998. Nibrin, a novel DNA double-strand break repair protein, is mutated in Nijmegen breakage syndrome. Cell 93: 467-76. 442. Vass-Margengo, J., A. Ratiarson, C. Asselin, and M. Bastin. 1986. Ability of a T-antigen transport-defective mutant of simian virus 40 to immortalize primary cells and to complement polyomavirus middle T in tumorigenesis. J. Virol. 59: 655-659. 443. Veldman, G., S. Lupton, and R. Kamen. 1985. Polyomavirus enhancer contains multiple redundant sequence elements that activate both DNA replication and gene expression. Mol. Cell. Biol. 5: 649-658. 444. Venclovas, C., and M. P. Thelen. 2000. Structure-based predictions of Rad1, Rad9, Hus1 and Rad17 participation in sliding clamp and clamp-loading complexes. Nucleic Acids Res 28: 2481-93. 445. Vinograd, J., J. Lebowitz, R. Radloff, R. Watson, and P. Laipis. 1965. The twisted circular form of polyoma viral DNA. Proc Natl Acad Sci U S A 53: 1104- 11. 446. Waga, S., and B. Stillman. 1994. Anatomy of a DNA replication fork revealed by reconstitution of SV40 DNA replication in vitro. Nature 369: 207-212. 447. Waga, S., and B. Stillman. 1998. The DNA replication fork in eukaryotic cells. Annu Rev Biochem 67: 721-51. 448. Walker, P. R., C. Smith, T. Youdale, J. Leblanc, J. F. Whitfield, and M. Sikorska. 1991. Topoisomerase II-reactive chemotherapeutic drugs induce apoptosis in thymocytes. Cancer research 51: 1078-85. 449. Walter, G., R. Ruediger, C. Slaughter, and M. Mumby. 1990. Association of protein phosphatase 2A with polyoma virus medium tumor antigen. Proc Natl Acad Sci U S A 87: 2521-5. 450. Wang, E. H., and C. Prives. 1991. ATP induces the assembly of polyoma large tumor antigen into hexamers. Virology 184: 399-403. 451. Wang, E. H., and C. Prives. 1991. DNA helicase and duplex DNA fragment unwinding activities of polyoma and simian virus 40 large T antigen display similarities and differences. J. Biol. Chem. 266: 12668-75. 452. Wang, H., J. Guan, A. R. Perrault, Y. Wang, and G. Iliakis. 2001. Replication protein A2 phosphorylation after DNA damage by the coordinated action of ataxia telangiectasia-mutated and DNA-dependent protein kinase. Cancer research 61: 8554-63. 453. Wang, H. G., Y. Rikitake, M. C. Carter, P. Yaciuk, S. E. Abraham, B. Zerler, and E. Moran. 1993. Identification of specific adenovirus E1A N-terminal residues critical to the binding of cellular proteins and to the control of cell growth. J. Virol. 67: 476-488. 454. Wang, W., L. Heideman, C. S. Chung, J. C. Pelling, K. J. Koehler, and D. F. Birt. 2000. Cell-cycle arrest at G2/M and growth inhibition by apigenin in human colon carcinoma cell lines. Mol Carcinog 28: 102-10. 253
455. Watanabe, G., A. Howe, R. J. Lee, C. Albanese, I. W. Shu, A. N. Karnezis, L. Zon, J. Kyriakis, K. Rundell, and R. G. Pestell. 1996. Induction of cyclin D1 by simian virus 40 small tumor antigen. Proc Natl Acad Sci U S A 93: 12861-6. 456. Weil, R., G. Petursson, J. Kara, and H. Diggelmann. 1967. The Molecular Biology of Viruses. Colter,J.S., & Paranchych, W.,Eds. New York: Academic Press: p593. 457. Weisshart, K., P. Taneja, and E. Fanning. 1998. The replication protein A binding site in simian virus 40 (SV40) T antigen and its role in the initial steps of SV40 DNA replication. J Virol 72: 9771-81. 458. Weisshart, K., P. Taneja, A. Jenne, U. Herbig, D. T. Simmons, and E. Fanning. 1999. Two regions of simian virus 40 T antigen determine cooperativity of double-hexamer assembly on the viral origin of DNA replication and promote hexamer interactions during bidirectional origin DNA unwinding. J Virol 73: 2201-11. 459. Wek, R. C., H. Y. Jiang, and T. G. Anthony. 2006. Coping with stress: eIF2 kinases and translational control. Biochem Soc Trans 34: 7-11. 460. Wessel, R., U. Ramsperger, H. Stahl, and R. Knippers. 1992. The interaction of SV40 large T antigen with unspecific double-stranded DNA: an electron microscopic study. Virology 189: 293-303. 461. Wessel, R., J. Schweizer, and H. Stahl. 1992. Simian virus 40 T-Antigen DNA Helicase Is a Hexamer Which Forms a Binary Complex during Bidirectional Unwinding from the Viral Origin of DNA Replication. J. of Virology 66: 804-815. 462. Weterings, E., and D. J. Chen. 2008. The endless tale of non-homologous end- joining. Cell Res 18: 114-24. 463. Whitman, M., D. R. Kaplan, B. Schaffhausen, L. Cantley, and T. M. Roberts. 1985. Association of phosphatidylinositol kinase activity with polyoma middle-T competent for transformation. Nature 315: 239-242. 464. Wiekowski, M., P. Droge, and H. Stahl. 1987. Monoclonal antibodies as probes for a function of large T antigen during the elongation process of simian virus 40 DNA replication. J. Virol. 61: 411-418. 465. Wiekowski, M., M. Schwarz, and H. Stahl. 1988. Simian virus 40 large T antigen DNA helicase. J. of Biological Chemistry 263: 436-442. 466. Wildy, P., and R. W. Horne. 1963. Structure of Animal Virus Particles. Prog Med Virol 5: 1-42. 467. Williams, B., and C. Campbell. 1998. Understanding the epidemic of HIV in South Africa. Analysis of the antenatal clinic survey data. S Afr Med J 88: 247-51. 468. Wobbe, C. R., L. Weissbach, J. A. Borowiec, F. B. Dean, Y. Murakami, P. Bullock, and J. Hurwitz. 1987. Replication of simian virus 40 origin-containing DNA in vitro with purified proteins. Proc Natl Acad Sci U S A 84: 1834-8. 469. Wold, M. S. 1997. Replication protein A: a heterotrimeric, single-stranded DNA- binding protein required for eukaryotic DNA metabolism. Annu Rev Biochem 66: 61-92. 470. Wold, M. S., and T. Kelly. 1988. Purification and characterization of replication protein A, a cellular protein required for in vitro replication of simian virus 40 DNA. Proc Natl Acad Sci U S A 85: 2523-7. 254
471. Wold, M. S., J. J. Li, and T. J. Kelly. 1987. Initiation of simian virus 40 DNA replication in vitro: Large-tumor-antigen- and origin-dependent unwinding of the template. Proc. Natl. Acad. Sci. U.S.A. 84: 3643-3647. 472. Wong, A. K., F. Shanahan, Y. Chen, L. Lian, P. Ha, K. Hendricks, S. Ghaffari, D. Iliev, B. Penn, A. M. Woodland, R. Smith, G. Salada, A. Carillo, K. Laity, J. Gupte, B. Swedlund, S. V. Tavtigian, D. H. Teng, and E. Lees. 2000. BRG1, a component of the SWI-SNF complex, is mutated in multiple human tumor cell lines. Cancer Res 60: 6171-7. 473. Wong, J. M., D. Ionescu, and C. J. Ingles. 2003. Interaction between BRCA2 and replication protein A is compromised by a cancer-predisposing mutation in BRCA2. Oncogene 22: 28-33. 474. Woods, C., C. LeFeuvre, N. Stewart, and S. Bacchetti. 1994. Induction of genomic instability in SV40 transformed human cells: sufficiency of the N- terminal 147 amino acids of large T antigen and role of pRB and p53. Oncogene 9: 2943-50. 475. Wu, X., D. Avni, T. Chiba, F. Yan, Q. Zhao, Y. Lin, H. Heng, and D. Livingston. 2004. SV40 T antigen interacts with Nbs1 to disrupt DNA replication control. Genes Dev 18: 1305-16. 476. Wu, X., G. Rathbun, W. S. Lane, D. T. Weaver, and D. M. Livingston. 2000. Interactions of the Nijmegen breakage syndrome protein with ATM and BRCA1. Cold Spring Harb Symp Quant Biol 65: 535-45. 477. Wu, X., S. M. Shell, and Y. Zou. 2005. Interaction and colocalization of Rad9/Rad1/Hus1 checkpoint complex with replication protein A in human cells. Oncogene 24: 4728-35. 478. Wun-Kim, K., and D. Simmons. 1990. Mapping of helicase and helicase substrate-binding domains on simian virus 40 large T antigen. J. of Virology 64: 2014-2020. 479. Wun-Kim, K., R. Upson, W. Young, T. Melendy, B. Stillman, and D. T. Simmons. 1993. The DNA-binding domain of simian virus 40 tumor antigen has multiple functions. Journal of virology 67: 7608-11. 480. Yen, A., L. Placanica, S. Bloom, and S. Varvayanis. 2001. Polyomavirus small t antigen prevents retinoic acid-induced retinoblastoma protein hypophosphorylation and redirects retinoic acid-induced G0 arrest and differentiation to apoptosis. J Virol 75: 5302-14. 481. Yi, X., J. Peterson, and R. Freund. 1997. Transformation and tumorigenic properties of a mutant polyoma virus containing a middle T antigen defective in shc binding. J. Virol. 71: 6279-6286. 482. Yogo, Y., C. Sugimoto, H. Y. Zheng, H. Ikegaya, T. Takasaka, and T. Kitamura. 2004. JC virus genotyping offers a new paradigm in the study of human populations. Rev Med Virol 14: 179-91. 483. Yu, J., A. Boyapati, and K. Rundell. 2001. Critical role for SV40 small-t antigen in human cell transformation. Virology 290: 192-8. 484. Yuan, H., T. Veldman, K. Rundell, and R. Schlegel. 2002. Simian virus 40 small tumor antigen activates AKT and telomerase and induces anchorage- independent growth of human epithelial cells. J Virol 76: 10685-91. 255
485. Zhang, Y., L. H. Rohde, and H. Wu. 2009. Involvement of nucleotide excision and mismatch repair mechanisms in double strand break repair. Current genomics 10: 250-8. 486. Zhao, S., Y. C. Weng, S. S. Yuan, Y. T. Lin, H. C. Hsu, S. C. Lin, E. Gerbino, M. H. Song, M. Z. Zdzienicka, R. A. Gatti, J. W. Shay, Y. Ziv, Y. Shiloh, and E. Y. Lee. 2000. Functional link between ataxia-telangiectasia and Nijmegen breakage syndrome gene products. Nature 405: 473-7. 487. Zhao, X., R. J. Madden-Fuentes, B. X. Lou, J. M. Pipas, J. Gerhardt, C. J. Rigell, and E. Fanning. 2008. Ataxia telangiectasia-mutated damage-signaling kinase- and proteasome-dependent destruction of Mre11-Rad50-Nbs1 subunits in Simian virus 40-infected primate cells. J Virol 82: 5316-28. 488. Zhao, X., R. J. Madden-Fuentes, B. X. Lou, J. M. Pipas, J. Gerhardt, C. J. Rigell, and E. Fanning. 2008. ATM- and proteasome-dependent destruction of Mre11-Rad50-Nbs1 subunits in SV40-infected primate cells. J Virol. 489. Zheng, D., J. Vayssiere, P. Petit, H. LeCoeur, A. Spatz, B. Mignotte, and J. Feunteun. 1994. Apoptosis is antagonized by large T antigens in the pathway to immortalization by polyomaviruses. Oncogene :3345-3351. 490. Zheng, D. Q., J. L. Vayssiere, P. X. Petit, H. LeCoeur, A. Spatz, B. Mignotte, and J. Feunteun. 1994. Apoptosis is antagonized by large T antigens in the pathway to immortalization by polyomaviruses. Oncogene 9: 3345-51. 491. Zhou, B. B., and S. J. Elledge. 2000. The DNA damage response: putting checkpoints in perspective. Nature 408: 433-9. 492. Zhou, J., and C. Prives. 2003. Replication of damaged DNA in vitro is blocked by p53. Nucleic Acids Res 31: 3881-92. 493. Zhou, X., A. Zhao, G. Goping, and P. Hirszel. 2000. Gliotoxin-induced cytotoxicity proceeds via apoptosis and is mediated by caspases and reactive oxygen species in LLC-PK1 cells. Toxicol Sci 54: 194-202. 494. Zhou, X. M., Y. Liu, G. Payne, R. J. Lutz, and T. Chittenden. 2000. Growth factors inactivate the cell death promoter BAD by phosphorylation of its BH3 domain on Ser155. J Biol Chem 275: 25046-51. 495. Zhou, Z., and Y. J. Kang. 2000. Immunocytochemical localization of metallothionein and its relation to doxorubicin toxicity in transgenic mouse heart. Am J Pathol 156: 1653-62. 496. Zhu, Z. Y., G. M. Veldman, A. Cowie, A. Carr, B. Schaffhausen, and R. Kamen. 1984. Construction and functional characterization of polyomavirus genomes that separately encode the three early proteins. J. Virol. 51: 170.