MRPL39 Antibody (C-Term) Blocking Peptide Synthetic Peptide Catalog # Bp16957b
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Ferret MRPL39 ORF Mammalian Expression Plasmid, N-Flag Tag
Ferret MRPL39 ORF mammalian expression plasmid, N-Flag tag Catalog Number: FG60159-NF General Information Plasmid Resuspension protocol Gene : mitochondrial ribosomal protein L39 1. Centrifuge at 5,000×g for 5 min. Official Symbol : MRPL39 2. Carefully open the tube and add 100 l of sterile water to Synonym : MRPL39 dissolve the DNA. Source : Ferret 3. Close the tube and incubate for 10 minutes at room cDNA Size: 1008bp temperature. RefSeq : XM_004757437.1 4. Briefly vortex the tube and then do a quick spin to Description concentrate the liquid at the bottom. Speed is less than Lot : Please refer to the label on the tube 5000×g. Vector : pCMV3-N-FLAG 5. Store the plasmid at -20 ℃. Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. The plasmid is ready for: Storage : • Restriction enzyme digestion The lyophilized plasmid can be stored at ambient temperature for three months. • PCR amplification Quality control : • E. coli transformation The plasmid is confirmed by full-length sequencing with primers • DNA sequencing in the sequencing primer list. Sequencing primer list : E.coli strains for transformation (recommended but not limited) pCMV3-F: 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R : 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 : 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH : 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com Ferret MRPL39 ORF mammalian expression plasmid, N-Flag tag Catalog Number: FG60159-NF Vector Information All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. -
Transcriptomic and Proteomic Landscape of Mitochondrial
TOOLS AND RESOURCES Transcriptomic and proteomic landscape of mitochondrial dysfunction reveals secondary coenzyme Q deficiency in mammals Inge Ku¨ hl1,2†*, Maria Miranda1†, Ilian Atanassov3, Irina Kuznetsova4,5, Yvonne Hinze3, Arnaud Mourier6, Aleksandra Filipovska4,5, Nils-Go¨ ran Larsson1,7* 1Department of Mitochondrial Biology, Max Planck Institute for Biology of Ageing, Cologne, Germany; 2Department of Cell Biology, Institute of Integrative Biology of the Cell (I2BC) UMR9198, CEA, CNRS, Univ. Paris-Sud, Universite´ Paris-Saclay, Gif- sur-Yvette, France; 3Proteomics Core Facility, Max Planck Institute for Biology of Ageing, Cologne, Germany; 4Harry Perkins Institute of Medical Research, The University of Western Australia, Nedlands, Australia; 5School of Molecular Sciences, The University of Western Australia, Crawley, Australia; 6The Centre National de la Recherche Scientifique, Institut de Biochimie et Ge´ne´tique Cellulaires, Universite´ de Bordeaux, Bordeaux, France; 7Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden Abstract Dysfunction of the oxidative phosphorylation (OXPHOS) system is a major cause of human disease and the cellular consequences are highly complex. Here, we present comparative *For correspondence: analyses of mitochondrial proteomes, cellular transcriptomes and targeted metabolomics of five [email protected] knockout mouse strains deficient in essential factors required for mitochondrial DNA gene (IKu¨ ); expression, leading to OXPHOS dysfunction. Moreover, -
Using the Ts65dn Mouse Model of Down Syndrome to Understand the Genetics of Congenital Heart Defects
USING THE TS65DN MOUSE MODEL OF DOWN SYNDROME TO UNDERSTAND THE GENETICS OF CONGENITAL HEART DEFECTS by Renita Polk A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland March, 2014 © 2014 Renita Polk All Rights Reserved Abstract Down syndrome (DS) is the most common chromosomal abnormality in humans, caused by having three copies of human chromosome 21 (Hsa21). It is associated with a variety of features affecting almost every organ system, including the heart. There is an especially high incidence of congenital heart defect (CHD) in DS, where 40 – 50% of affected individuals have a CHD. CHD is the most common congenital defect in live births. The fact that half of those with DS have a normal heart suggests that additional genetic and environmental factors interact with trisomy 21 to cause CHD. Thus, people with trisomy 21 are sensitized to CHD. The Ts65Dn mouse model of DS was used as an analogous sensitized population to study the role of the Tbx5 gene in CHD. Tbx5 is a modifier of CHD known to play a role in chamber formation and septation of the heart. A Tbx5 null allele was introduced to Ts65Dn mice, and newborn pups were sacrificed and examined for CHDs. There is a significant difference between trisomic and euploid pups in the frequency of overriding aorta (OA). About 58% of the trisomic Tbx5+/- mice present with OA and a ventricular septal defect (VSD), while only 18% of the euploid pups have this defect. These results suggest that there is an interaction between Tbx5 and trisomy to increase the frequency of specific defects, and suggests a role for Tbx5 in development of the aorta. -
Gene Expression Variation in Down's Syndrome Mice Allows Prioritization of Candidate Genes
Open Access Research2007SultanetVolume al. 8, Issue 5, Article R91 Gene expression variation in Down's syndrome mice allows comment prioritization of candidate genes Marc Sultan*, Ilaria Piccini*, Daniela Balzereit*, Ralf Herwig*, Nidhi G Saran†, Hans Lehrach*, Roger H Reeves†‡ and Marie-Laure Yaspo* Addresses: *Max Planck Institute for Molecular Genetics, Ihnestr.63/73, 14195, Berlin, Germany. †Department of Physiology, Johns Hopkins University School of Medicine, 725 N. Wolfe St., Baltimore, Maryland 21205, USA. ‡McKusick-Nathans Institute of Genetic Medicine, 733 Nth. Broadway, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA. reviews Correspondence: Marc Sultan. Email: [email protected] Published: 25 May 2007 Received: 18 July 2006 Revised: 23 February 2007 Genome Biology 2007, 8:R91 (doi:10.1186/gb-2007-8-5-r91) Accepted: 25 May 2007 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2007/8/5/R91 reports © 2007 Sultan et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Variation<p>RNAindividual fromin gene Down eight expression syndrome Ts65Dn levels micegenes as (a a model function of Downof trisomy.</p> syndrome) and eight euploid mice were analysed by real-time PCR to examine inter- deposited research Abstract Background: Down's syndrome (DS), or trisomy 21, is a complex developmental disorder that exhibits many clinical signs that vary in occurrence and severity among patients. -
Cardiomyopathy Is Associated with Ribosomal Protein Gene Haploinsufficiency In
Genetics: Published Articles Ahead of Print, published on September 2, 2011 as 10.1534/genetics.111.131482 Cardiomyopathy is associated with ribosomal protein gene haploinsufficiency in Drosophila melanogaster Michelle E. Casad*, Dennis Abraham§, Il-Man Kim§, Stephan Frangakis*, Brian Dong*, Na Lin§1, Matthew J. Wolf§, and Howard A. Rockman*§** Department of *Cell Biology, §Medicine, and **Molecular Genetics and Microbiology, Duke University Medical Center, Durham, NC 27710 1Current Address: Institute of Molecular Medicine, Peking University, Beijing, China, 100871 1 Copyright 2011. Running Title: Cardiomyopathy in Minute Drosophila Key Words: Drosophila Minute syndrome Cardiomyopathy Address for correspondence: Howard A. Rockman, M.D. Department of Medicine Duke University Medical Center, DUMC 3104 226 CARL Building, Research Drive Durham, NC, 27710 Tel: (919) 668-2520 FAX: (919) 668-2524 Email: [email protected] 2 ABSTRACT The Minute syndrome in Drosophila melanogaster is characterized by delayed development, poor fertility, and short slender bristles. Many Minute loci correspond to disruptions of genes for cytoplasmic ribosomal proteins, and therefore the phenotype has been attributed to alterations in translational processes. Although protein translation is crucial for all cells in an organism, it is unclear why Minute mutations cause effects in specific tissues. To determine whether the heart is sensitive to haploinsufficiency of genes encoding ribosomal proteins, we measured heart function of Minute mutants using optical coherence tomography. We found that cardiomyopathy is associated with the Minute syndrome caused by haploinsufficiency of genes encoding cytoplasmic ribosomal proteins. While mutations of genes encoding non-Minute cytoplasmic ribosomal proteins are homozygous lethal, heterozygous deficiencies spanning these non-Minute genes did not cause a change in cardiac function. -
DERIVED HUMAN MESENCHYMAL STEM CELLS Patricia Janicki, Stephane Boeuf, Eric Steck, Marcus Egermann, Philip Kasten§ and Wiltrud Richter*
PEuropean Janicki et Cells al. and Materials Vol. 21 2011 (pages 488-507) DOI: 10.22203/eCM.v021a37 Prediction of bone formation ISSNof human 1473-2262 MSC PREDICTION OF IN VIVO BONE FORMING POTENCY OF BONE MARROW- DERIVED HUMAN MESENCHYMAL STEM CELLS Patricia Janicki, Stephane Boeuf, Eric Steck, Marcus Egermann, Philip Kasten§ and Wiltrud Richter* Research Centre for Experimental O rthopaedics, Orthopaedic University Hospital Heidelberg, Heidelberg, Germany §Current address: Department of Orthopaedic Surgery, University of Dresden, Dresden, Germany A bstract Introduction Human mesenchymal stem cells (MSC) have attracted Mesenchymal stem cells (MSC) support the homeostasis much attention for tissue regeneration including repair of of mesenchymal tissues and their trophic and mesengenic non-healing bone defects. Heterogeneity of MSC cultures activities bear a high therapeutic potential for tissue and considerable donor variability however, still preclude regeneration. Refl ecting the complexity of the stromal standardised production of MSC and point on functional system in bone marrow, MSC populations expanded defi cits for some human MSC populations. We aimed to from marrow aspirates are heterogeneous in nature with identify functional correlates of donor-dependency of bone the exact composition depending on the donor (Rickard formation in order to develop a potency assay predicting et al., 1996; Majors et al., 1997; Muschler et al., 2001), the therapeutic capacity of human MSC before clinical the individual aspirate (Lazarus et al., 1997; Muschler transplantation. MSC from 29 donors were characterised in et al., 1997; Phinney et al., 1999; Muschler et al., 2001; vitro and results were correlated to bone formation potency Hernigou et al., 2006), applied isolation methods and in a beta-tricalcium-phosphate (β-TCP)-scaffold after expansion conditions, the latter of which differ largely subcutaneous implantation into immunocompromised mice. -
Mitochondrial Ribosomal Proteins: Candidate Genes for Mitochondrial Disease James E
March/April 2004 ⅐ Vol. 6 ⅐ No. 2 review Mitochondrial ribosomal proteins: Candidate genes for mitochondrial disease James E. Sylvester, PhD1, Nathan Fischel-Ghodsian, MD2, Edward B. Mougey, PhD1, and Thomas W. O’Brien, PhD3 Most of the energy requirement for cell growth, differentiation, and development is met by the mitochondria in the form of ATP produced by the process of oxidative phosphorylation. Human mitochondrial DNA encodes a total of 13 proteins, all of which are essential for oxidative phosphorylation. The mRNAs for these proteins are translated on mitochondrial ribosomes. Recently, the genes for human mitochondrial ribosomal proteins (MRPs) have been identified. In this review, we summarize their refined chromosomal location. It is well known that mutations in the mitochondrial translation system, i.e., ribosomal RNA and transfer RNA cause various pathologies. In this review, we suggest possible associations between clinical conditions and MRPs based on coincidence of genetic map data and chromosomal location. These MRPs may be candidate genes for the clinical condition or may act as modifiers of existing known gene mutations (mt-tRNA, mt-rRNA, etc.). Genet Med 2004:6(2):73–80. Key Words: mitochondrial, ribosomal proteins, oxidative phosphorylation, candidate genes, translation Most of the energy requirements for cell growth, differenti- THE MITORIBOSOME ation, and development are met by the mitochondrial ATP Human cells contain two genomes and two protein synthe- produced by the process of oxidative phosphorylation. Mito- sizing (translation) systems. The first is the nuclear genome of chondrial DNA encodes 13 essential proteins of this oxidative 3 ϫ 109 bp that has 30,000 to 40,000 genes coding a much phosphorylation system. -
Proteins Identified by Proteomics
Supplementary table 1: Proteins identified by proteomics Protein Accession Gene Symbol Ratio Protein Name mitogen-activated protein kinase-activated protein kinase 2 gi|32481209 MAPKAPK2 0.04 isoform 2 gi114155133 DNAH9 0.05 dynein, axonemal, heavy chain 9 isoform 2 gi|4506145 PRSS1 0.09 protease, serine, 1 preproprotein gi|4507823 UGT2B11 0.10 UDP glucuronosyltransferase 2 family, polypeptide B11 gi|31377593 RANBP3L 0.10 RAN binding protein 3-like gi|45827809 MAP3K6 0.10 mitogen-activated protein kinase kinase kinase 6 gi|31795544 ORC1L 0.19 origin recognition complex, subunit 1 gi|4504191 MSH6 0.23 mutS homolog 6 gi|4503971 GDI1 0.26 GDP dissociation inhibitor 1 gi|4502197 TRIM23 0.27 ADP-ribosylation factor domain protein 1 isoform alpha gi|30410794 PSME3 0.28 proteasome activator subunit 3 isoform 1 gi|4506703 RPS24 0.29 ribosomal protein S24 isoform c gi|8923415 MARCH5 0.30 membrane-associated ring finger (C3HC4) 5 gi|39725634 LARP1 0.30 la related protein isoform 1 RBM14/RBM4 NP_002887 fusion 0.31 Transcriptional coactivator CoAZ gi|4506891 SET 0.33 SET translocation (myeloid leukemia-associated) gi|57863257 TCP1 0.33 T-complex protein 1 isoform a gi|25777612 PSMD3 0.35 proteasome 26S non-ATPase subunit 3 gi|22748937 XPO5 0.35 exportin 5 gi68303565 PSMA8 0.36 proteasome alpha 8 subunit isoform 3 gi|29789090 RCC2 0.37 regulator of chromosome condensation 2 gi113412226 LOC642098 0.38 similar to ribosomal protein L31 gi|4506189 PSMA7 0.38 proteasome alpha 7 subunit gi|38201619 EIF4G1 0.38 eukaryotic translation initiation factor 4 gamma, -
Transcriptomic Profiles of Aging in Purified Human Immune Cells
ADDITIONAL FILE 1 FOR Transcriptomic Profiles of Aging in Purified Human Immune Cells Lindsay M. Reynolds1, Jingzhong Ding2, Jackson R. Taylor3, Kurt Lohman1, Nicola Soranzo4, Alberto de la Fuente5, Tie Fu Liu2, Craig Johnson6, R. Graham Barr7, Thomas C. Register8, Kathleen M. Donohue7, Monica V. Talor9, Daniela Cihakova9, Charles Gu10, Jasmin Divers1, David Siscovick11, Gregory Burke1, Wendy Post9, Steven Shea7, David R. Jacobs, Jr.12, Ina Hoeschele13, Charles E. McCall2,14, Stephen B. Kritchevsky2,3, David Herrington2, Russell P. Tracy15, Yongmei Liu1* Table of Contents (page 1 – 2) Supplementary Figures in Additional File 1: Figure S1. Age-associations with the monocyte transcriptome (page 3) Figure S2. Correlation between co-expression network modules (page 4) Figure S3. Scatterplot of gene expression and age for genes in the ‘black’ co-expression network module (page 5) Figure S4. Correlation between MCL1 expression measured by microarray and RNA- sequencing (page 6) Figure S5. MCL1 expression measured using Western Blot (page 7) Figure S6. MRPS12 expression measured using Western Blot (page 8) Figure S7. Comparison of the effect of age on gene expression in 1,264 monocyte samples compared to results from a subset of 423 samples (page 9) Supplementary Tables in Additional File 1: Table S1. Population characteristics (page 10) Table S3. Gene set enrichment analysis for age-associated genes in monocytes from 1,264 MESA participants (page 11) 1 Table S4. Co-expression network modules associated with age (page 12) Table S14. Gene set enrichment analysis for age-associated genes in CD4+ T cells and CD14+ monocytes from 423 MESA participants (page 13) Supplementary Methods in Additional File 1: mRNA quantification using RNA seq (page 14 – 15) Supplementary References (page 16) 2 a of total Percent p-value b Figure S1. -
Table 1 the Statistical Metrics for Key Differentially Expressed Genes (Degs)
Table 1 The statistical metrics for key differentially expressed genes (DEGs) Illumina Id Gene Symbol logFC p Value FDR t value Regulation Gene name ILMN_1757497 VGF 4.848711 1.27E-13 6.11E-09 48.36804 UP VGF nerve growth factor inducible ILMN_2193706 HRK 3.058491 2.89E-10 3.47E-06 22.91096 UP harakiri, BCL2 interacting protein ILMN_2182198 MRPL58 1.8013 5.14E-10 3.64E-06 21.65441 UP mitochondrial ribosomal protein L58 ILMN_1699772 RRAGD 2.331637 6.56E-10 3.64E-06 21.14388 UP Ras related GTP binding D ILMN_1695969 TMPRSS15 2.158671 6.81E-10 3.64E-06 21.06686 UP transmembrane protease, serine 15 ILMN_1754002 IL36B 4.161387 3.21E-09 1.10E-05 18.09187 UP interleukin 36, beta ILMN_1656134 CNOT7 1.387716 4.97E-09 1.49E-05 17.32692 UP CCR4-NOT transcription complex subunit 7 ILMN_1658499 SYT13 1.653015 6.80E-09 1.59E-05 16.79842 UP synaptotagmin 13 ILMN_1684836 AKAP12 1.291595 8.20E-09 1.68E-05 16.48925 UP A-kinase anchoring protein 12 ILMN_1799519 IL36B 4.299495 9.58E-09 1.68E-05 16.23691 UP interleukin 36, beta ILMN_1678757 BCYRN1 3.056229 9.58E-09 1.68E-05 16.23661 UP brain cytoplasmic RNA 1 ILMN_1726743 MRPS30 1.302467 1.08E-08 1.73E-05 16.04765 UP mitochondrial ribosomal protein S30 ILMN_1777976 SLC25A26 1.609861 1.37E-08 2.06E-05 15.66752 UP solute carrier family 25 member 26 mitochondrially encoded ILMN_3308961 MT-ND6 3.019664 1.61E-08 2.15E-05 15.41788 UP NADH:ubiquinoneoxidoreductase core subunit 6 ILMN_2380999 RECQL 1.437639 2.36E-08 2.72E-05 14.83968 UP RecQ like helicase ILMN_3233229 SNHG7 1.202524 2.50E-08 2.72E-05 14.7569 UP small -
Open Min-Joon-Upload-Final.Pdf
The Pennsylvania State University The Graduate School Eberly College of Science MAMMALIAN MITOCHONDRIAL RIBOSOMAL PROTEINS : A MATTER OF LIFE AND DEATH A Dissertation in Biochemistry, Microbiology and Molecular Biology by Min-Joon Han © 2010 Min-Joon Han Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2010 The dissertation of Min-Joon Han was reviewed and approved* by the following: Emine C. Koc Assistant Professor of Biochemistry and Molecular Biology Dissertation Co-Advisor Co-Chair of Committee Hasan Koc Research Assistant Professor of Biochemistry and Molecular Biology Dissertation Co-Advisor Co-Chair of Committee Craig E. Cameron Paul Berg Professor of Biochemistry and Molecular Biology Wendy Hanna-Rose Associate Professor of Biochemistry and Molecular Biology Teh-hui Kao Professor of Biochemistry and Molecular Biology Seogchan Kang Professor of Plant pathology Scott B. Selleck Professor of Biochemistry and Molecular Biology Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School ii ABSTRACT Human mitochondria are essential for cell survival while playing key roles in programmed cell death also called apoptosis. First of all, mitochondria are the main source of energy for the eukaryotic cell. Mitochondria produce more than 90% of the energy used by mammalian cells in a process referred to as oxidative phosphorylation. This demanding mechanism requires a lot of proteins, which are nucleus-encoded, synthesized in cytoplasm, and imported into mitochondria. However, it also requires 13 mitochondrial-encoded proteins. Mitochondria have their own 16.5 kb circular genome (mtDNA) and ribosome to translate these 13 proteins. -
The TOR Signaling Cascade Regulates Gene Expression in Response to Nutrients
Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press The TOR signaling cascade regulates gene expression in response to nutrients Maria E. Cardenas,1,7 N. Shane Cutler,1 Michael C. Lorenz,1 Charles J. Di Como,6 and Joseph Heitman1–5 1Departments of Genetics, 2Pharmacology and Cancer Biology, 3Microbiology, and 4Medicine, 5the Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina 27710 USA; 6Department of Biological Sciences, Sherman Fairchild Center, Columbia University, New York, New York 10027 USA Rapamycin inhibits the TOR kinases, which regulate cell proliferation and mRNA translation and are conserved from yeast to man. The TOR kinases also regulate responses to nutrients, including sporulation, autophagy, mating, and ribosome biogenesis. We have analyzed gene expression in yeast cells exposed to rapamycin using arrays representing the whole yeast genome. TOR inhibition by rapamycin induces expression of nitrogen source utilization genes controlled by the Ure2 repressor and the transcriptional regulator Gln3, and globally represses ribosomal protein expression. gln3 mutations were found to confer rapamycin resistance, whereas ure2 mutations confer rapamycin hypersensitivity, even in cells expressing dominant rapamycin-resistant TOR mutants. We find that Ure2 is a phosphoprotein in vivo that is rapidly dephosphorylated in response to rapamycin or nitrogen limitation. In summary, our results reveal that the TOR cascade plays a prominent role in regulating transcription in response to nutrients in addition to its known roles in regulating translation, ribosome biogenesis, and amino acid permease stability. [Key Words: Rapamycin; TOR kinase; signal transduction] Received September 3, 1999; revised version accepted October 26, 1999.