Page 1 of 50 Diabetes
Lipodystrophy Due to Adipose Tissue Specific Insulin Receptor
Knockout Results in Progressive NAFLD
Samir Softic1,2,#, Jeremie Boucher1,3,#, Marie H. Solheim1,4, Shiho Fujisaka1, Max-Felix
Haering1, Erica P. Homan1, Jonathon Winnay1, Antonio R. Perez-Atayde5, and C. Ronald
Kahn1.
1 Section on Integrative Physiology and Metabolism, Joslin Diabetes Center and Department of Medicine, Harvard Medical School, Boston, MA 2 Division of Gastroenterology, Hepatology and Nutrition, Boston Children’s Hospital, Boston, MA 3 Cardiovascular and Metabolic Diseases iMed, AstraZeneca R&D, 431 83 Mölndal, Sweden (current address) 4 KG Jebsen Center for Diabetes Research, Department of Clinical Science, University of Bergen, Bergen, Norway 5 Department of Pathology, Boston Children’s Hospital, and Harvard Medical School, Boston, MA # These authors contributed equally to this work.
Corresponding author:
C. Ronald Kahn, MD Joslin Diabetes Center One Joslin Place Boston, MA 02215 Phone: (617)732-2635 Fax:(617)732-2487 E-mail: [email protected]
Keywords: Insulin receptors, IGF-1 receptors, lipodystrophy, diabetes, dyslipidemia, fatty liver, liver tumor, NAFLD, NASH.
Running title: Lipodystrophic mice develop progressive NAFLD
1
Diabetes Publish Ahead of Print, published online May 10, 2016 Diabetes Page 2 of 50
SUMMARY
Ectopic lipid accumulation in the liver is an almost universal feature of human and rodent models of generalized lipodystrophy and also is a common feature of type 2 diabetes, obesity and metabolic syndrome. Here we explore the progression of fatty liver disease using a mouse model of lipodystrophy created by a fat-specific knockout of the insulin receptor (F-IRKO) or both IR and insulin-like growth factor-1 receptor (F-
IR/IGF1RKO). These mice develop severe lipodystrophy, diabetes, hyperlipidemia and fatty liver disease within the first weeks of life. By 12 weeks of age, liver demonstrated increased ROS, lipid peroxidation, histological evidence of balloon degeneration and elevated serum ALT and AST levels. In these lipodystrophic mice, stored liver lipids can be utilized for energy production as indicated by a marked decrease in liver weight with fasting and increased liver FGF21 expression and intact ketogenesis. By 52 weeks of age, liver accounted for 25% of body weight and showed continued balloon degeneration in addition to inflammation, fibrosis, and highly dysplastic liver nodules. Progression of liver disease was associated with improvement in blood glucose levels with evidence of altered expression of both gluconeogenic and glycolytic enzymes. However, these mice were able to mobilize stored glycogen in response to glucagon. Feeding F-IRKO and F-
IR/IGFRKO mice a HFD for 12 weeks accelerated the liver injury and normalization of blood glucose levels. Thus, severe fatty liver disease develops early in lipodystrophic mice and progresses to advanced NASH with highly dysplastic liver nodules. The liver injury is propagated by lipotoxicity and is associated with improved blood glucose levels.
2 Page 3 of 50 Diabetes
INTRODUCTION
Non-alcoholic fatty liver disease (NAFLD) is a common manifestation of
diabetes, obesity, and metabolic syndrome. NAFLD also occurs in both human and
rodent models of lipodystrophy (1-4). In the context of obesity and metabolic syndrome,
NAFLD may progress to include liver inflammation or non-alcoholic steatohepatitis
(NASH), fibrosis and occasionally hepatocellular carcinoma (5), whereas not much is
known about natural history of liver disease in the context of lipodystrophy.
Metabolic syndrome is present in 80% of patients with lipodystrophy, almost
universally manifesting as severe insulin resistance, profound hypertriglyceridemia, and
ectopic lipid accumulation (6). One major difference between this form of metabolic
syndrome and that associated with obesity is in the amount of adipose tissue, which is
reduced in lipodystrophy, resulting in low levels of leptin (7), whereas obesity is
associated with increased adiposity and high leptin levels. In regards to other metabolic
outcomes, including ectopic fat accumulation in the liver, lipodystrophy resembles an
extreme version of the obesity-associated metabolic syndrome (8). Whether lipid
accumulation in the liver is a sign of a disease or a physiologic response in patients who
have minimal capacity to store lipids in the adipose tissue is unknown. In lipodystrophic
patients the liver fat decreases with leptin treatment (9; 10), suggesting that at least a
portion of stored liver fat may be utilized for ketogenesis (11). It is unknown what
processes mediate ketogenesis in the setting of minimal adipose tissue lipid stores, but it
is interesting to note that serum levels of the ketogenic hormone, FGF21 are elevated
with lipodystrophy in HIV-1 infected patients (12), and that the main source of elevated
serum FGF21 levels in mice with lipodystrophy is the liver (13).
3 Diabetes Page 4 of 50
The liver disease in some patients with generalized lipodystrophy can progress to liver cirrhosis requiring liver transplantation (14). The most characteristic feature of fatty liver disease associated with lipodystrophy is prominent steatosis with hepatocyte balloon degeneration (8; 15), pointing to lipotoxicity as an important pathway of liver injury.
Chronic liver injury resulting in cirrhosis and liver failure can be associated with reduced hepatic glucose production leading to hypoglycemia (16). What effects liver lipotoxicity may have on hepatic glucose homeostasis in the setting of lipodystrophy is unknown.
Here, we show that mice lacking IR or both IR and IGF1R in adipose tissue display a lipodystrophic phenotype associated with severe diabetes and NAFLD. The liver disease in these mice progresses to NASH, fibrosis and highly dysplastic liver nodules. Interestingly, this progressive liver disease is associated with improvement of hyperglycemia in these mice with age, despite the persistent insulin resistance and a normal ability to mobilize stored glycogen in response to glucagon. The liver injury in these lipodystrophic mice is propagated by lipotoxicity, and high fat diet (HFD) feeding accelerates the progression of liver disease, leading to normalization of blood glucose levels.
4 Page 5 of 50 Diabetes
MATERIAL AND METHODS
Animals and diets
All protocols were approved by the IACUC of the Joslin Diabetes Center and
were in accordance with NIH guidelines. Fat-specific IR, IGFR, and IR/IGFR knockout
mice were generated as described (17). Mice were housed at 20-22°C on a 12 h light/dark
cycle with ad libitum access to water, and food. For HFD experiments the mice were fed
chow (Mouse Diet 9F, PharmaServ) diet until 8 weeks of age and then continued on
chow or switched to 60% high fat diet (Research diets, D12492) for an additional 12
weeks.
Glucose tolerance test and glucagon response
Glucose tolerance tests were performed on overnight fasted mice injected with 2
mg/kg of dextrose IP. Glucagon response was assessed in overnight fasted mice injected
with 1U/kg of glucagon (Sigma G2044) with blood glucose measured at 0, 15, 30, 60 and
120 minutes. Glucose levels were measured using a glucose meter (Infinity, US
Diagnostics).
Tissue and serum analyses.
Tissues were stored frozen or fixed in formalin and sections were stained with
Hematoxylin and Eosin (H&E) or Periodic acid-Schiff (PAS). mRNA extraction and
quantification was performed as previously described (18). Serum parameters were
determined by the Joslin’s DRC assay core using commercial kits. Hormones were
assessed by ELISA, adipokines were measured by a multiplex assay and ALT and AST
5 Diabetes Page 6 of 50
were assessed by colorimetric assays. Triglycerides from liver samples were measured
with a triglyceride quantification kit (Abnova) as described by Debosch et al. (19).
Protein extraction and immunoblot analysis
Tissues were homogenized in RIPA buffer (EMD Millipore) with protease and phosphatase inhibitor cocktail (Biotools). Proteins were separated using SDS-PAGE and transferred to PVDF membrane (Millipore). Immunoblotting was performed using the indicated antibodies: phospho-IR/IGFR (#3024) and p-PTEN (#9552) from Cell
Signaling Technologies and IR (#SC-711), PTEN (#SC-9145) and actin (SC-1616) from
Santa Cruz Biotechnology. Quantification of immunoblots was performed using ImageJ.
Immunohistochemistry (IHC) and Immunofluorescence (IF)
IHC was performed on formalin-fixed, and IF on frozen sections. In brief, paraffin embedded, formalin-fixed sections were deparaffinized and rehydrated. Antigen
was recovered by boiling in citrate buffer (Vector Labs, H-3300), incubating in Triton-X
and digested with proteinase K. Sections were blocked in goat serum and incubated
overnight at 4oC for IHC with primary antibodies against beta catenin (Cell Signaling,
D13A1), F4/80 (Abcam ab6640) or 4-HNE (Abcam, ab46545). Subsequently, slides were
incubated with biotinylated secondary antibody, and the reaction was developed using
avidin/streptavidin horseradish peroxidase (Vector Labs, PK-4001). For IF, slides were
incubated overnight with primary antibody against Ki67 (BD, 556003) and PIP3
(Echelon, P-0008) followed by a secondary antibody labeled with Texas Red (Vector
Labs) or Alexa Fluor (Invitrogen) and counterstained with DAPI mounting media (Vector
6 Page 7 of 50 Diabetes
Labs, H-1500). DHE stain was performed on frozen liver sections fixed with 4% PFA
and stained with 1:1500 dilution of DHE (10 ug/ml) dye for 10 min at 37o C. Slides were
washed twice in PBS, coversliped and images were captured using Olympus fluorescence
microscope (Olympus BX60).
In vivo glucose uptake
Following 12 weeks of HFD, control, F-IRKO and F-IR/IGFRKO mice were injected IP
with 2 mg/g of glucose (D20) in combination with 0.33 mCi [14C]2-deoxyglucose/g of
body weight. After 15 min, [14C] levels in the liver and quadriceps muscle were
determined as previously published (20).
Statistical analyses
All data are presented as mean ± SEM and analyzed by unpaired two-tailed
Student’s t-test or analysis of variance (ANOVA) as appropriate. Significant difference
noted with one star (*) represent a p value of <0.05, two stars (**) a p value of <0.01, and
three stars (***) a p value of <0.001 throughout the figures and the paper.
7 Diabetes Page 8 of 50
RESULTS
Lipodystrophic mice develop fatty liver disease and lipotoxicity
Mice with fat-specific knockout of the insulin receptor (IR), the insulin-like
growth factor-1 receptor (IGF1R) or both were generated by breeding mice with IR and
IGF1R floxed alleles (18) and mice carrying a Cre-recombinase transgene driven by the
adiponectin promoter (21). Whereas knockout of the IGF1R had minimal impact on
white and brown fat development, F-IRKO and F-IR/IGFRKO mice displayed virtually
from birth profound reduction in weights of both subcutaneous and visceral WAT depots
(17). Lipodystrophy was associated with hyperglycemia (Figure 1A), and severe diabetes
at 12 weeks of age. At this time, liver weights of both F-IRKO and F-IR/IGFRKO mice
were increased 4- to 5-fold above the control, while the liver weight of F-IGFRKO mice
remained normal (Figure 1B). Hepatomegaly in F-IRKO and F-IR/IGFRKO mice was
associated with a 3- to 5-fold increase in liver triglyceride accumulation (Figure 1C and
D). There was also 2- to 5-fold increases in expression of genes involved in de novo
lipogenesis such as Acc1, Fas and Scd1 (Figure 1E). However, at this age, these mice did not display an increase in expression of Tnf α, and F4/80, although there was some increase in the macrophage marker CD11c (Figure 1F). F-IRKO and F-IR/IGFRKO mice also did not show significant fibrosis as assessed by trichrome, sirius red and reticulin stains (Sup. Fig. 1), and mRNA levels of Tgf β and αSma were not elevated. Col1a1 was increased in F-IR/IGFRKO mice, however, in the absence of other markers of fibrosis, it may be a sign of stellate cell activation (22) (Figure 1G). Histological assessment of liver at 12 weeks of age confirmed that lipodystrophic F-IRKO and F-IR/IGFRKO mice exhibited micro- and macrovesicular steatosis and the presence of balloon degeneration,
8 Page 9 of 50 Diabetes
with no significant inflammation or fibrosis (Table 1). Hepatocyte balloon degeneration
is indicative of lipotoxicity and is associated with a progressive form of NAFLD (23; 24).
By 12 weeks of age, ROS levels and lipid peroxidation, as assessed by dihydroethidium
(DHE) and 4-hydroxynonenal (4-HNE) stains respectively, were also increased in livers
of F-IR/IGFRKO mice (Figure 1H). F-IRKO and F-IR/IGFRKO mice exhibited
decreased expression of one of the rate limiting gluconeogenic enzymes Pepck, while the
expression of Fbp1 and Pc was actually increased in comparison to the controls (Figure
1I). In spite of a decrease in Pepck, it is likely that some gluconeogenic potential was
preserved as these mice were hyperglycemic as compared to the controls. Thus,
lipodystrophic F-IRKO and F-IR/IGFRKO mice had profound hepatic steatosis and
minimal signs of liver injury which was primarily due to lipotoxicity. F-IGFRKO mice,
which did not develop lipodystrophy, did not exhibit any of these changes.
Lipodystrophic F-IRKO and F-IR/IGFRKO mice can mobilize stored liver fat
In addition to marked hepatosteatosis, lipodystrophic F-IRKO and F-IR/IGFRKO
mice at 12 weeks of age exhibited serum dyslipidemia with elevated circulating
triglyceride, cholesterol and free fatty acid levels (17). To determine to what extent these
lipids could be mobilized, F-IRKO mice were subjected to an overnight fasting and an 8-
hour refeeding protocol. Fasting resulted in a decrease in blood glucose levels in all mice,
although the F-IRKO mice remained hyperglycemic compared to the controls (135±13
vs. 87±8 mg/dl), and refeeding resulted in return to the marked hyperglycemic levels
(Figure 2A). Liver weight of F-IRKO mice also decreased by 38% from 4.0±0.4 to
2.5±0.2 grams after fasting and returned to baseline (3.9±0.2g) after refeeding,
9 Diabetes Page 10 of 50
demonstrating the ability of lipodystrophic mice to store and mobilize fat in the liver
(Figure 2B). Liver weight of control mice also decreased by fasting from 1.1±0.1 to
0.84±0.02 grams and increased to 0.94+ 0.07 grams with refeeding. Serum triglyceride levels, which were elevated in random fed F-IRKO mice (230±40 v. 96±10) decreased to levels even lower than control after an overnight fast (56±7 v. 108±21), but then returned to baseline after refeeding (Figure 2C). Free fatty acids (FFA) levels increased with fasting in control mice from 0.7±0.1 to 0.9±0.0 mEq/L, but they paradoxically decreased in F-IRKO mice during fasting (1.2±0.2 to 0.7±0.1), probably reflecting the lack of adipose tissue lipolysis and increased FFA utilization in these mice (Figure 2D). Insulin levels also decreased with fasting in both control mice and F-IRKO mice, indicating normal pancreatic responses to nutrient intake and blood glucose levels (Figure 2E).
Likewise, beta-hydroxybutyrate levels significantly increased with fasting in both control and F-IRKO mice (Figure 2F), suggestive of normal ketogenesis in lipodystrophic mice, despite the almost complete absence of white adipose tissue. Liver FGF21 mRNA was elevated in F-IRKO and F-IR/IGFRKO mice at every age tested (Figure 2G).
F-IRKO and F-IR/IGFRKO mice develop progressive NAFLD with aging.
The profound hepatomegaly present at 12 weeks of age was already evident by
2.5 weeks of age and continued to advance throughout the lifetime. By 52 weeks of age livers in F-IRKO mice were 6.5-times heavier, and those in F-IR/IGFRKO mice were
9.2-times heavier than the controls (Figure 3A). In spite of almost complete reduction of white adipose tissue in F-IRKO and F-IR/IGFRKO mice, and as a result of the massive hepatomegaly, body weight was not significantly different from the controls at up to 3
10 Page 11 of 50 Diabetes
months of age and was actually 20% greater than the controls at 52 weeks of age (Figure
3B). Hepatic triglycerides per milligram of tissue were also increased by 3- to 5-fold in F-
IRKO and F-IR/IGFRKO mice as early as 2.5 weeks of age, compared to controls and
remained elevated at 12 and 52 weeks of age (Figure 3C). In parallel, steatosis was
observed in F-IRKO and F-IR/IGFRKO mice at 2.5 weeks of age, which persisted at 12
and 52 weeks of age (Sup. Fig. 2). This correlated with 2- to 3-fold increases in the
expression of enzymes involved in de novo lipogenesis (Acc1, Fas, and Scd1) in the
lipodystrophic mice compared to controls at 2.5, 12 and 52 weeks of age. (Figure 3D, E
& F). Interestingly, the insulin-activated transcription factor Srebp1c, which regulates
lipogenesis, was not elevated despite massive hyperinsulinemia (Sup. Fig. 3).
Excessive lipid accumulation in the liver was associated with increased serum
alanine aminotransferase (ALT) in 5 and 12 week-old F-IRKO and F-IR/IGFRKO mice
(Figure 3G). Serum aspartate aminotransferase (AST) levels were also elevated in F-
IRKO mice at 5 and 12 weeks of age, and further increased in F-IRKO and F-
IR/IGFRKO mice at 52 weeks of age (Figure 3H). F-IGFRKO mice did not develop
hepatomegaly or increased levels of liver triglycerides, enzymes of de novo lipogenesis
or serum ALT and AST levels.
One year old lipodystrophic mice develop liver inflammation and fibrosis
By one year of age, inflammatory infiltrates were evident in F-IRKO and F-
IGFRKO livers on histological examination (Figure 4A, top panel), and this was
confirmed by increased staining using antibody to the macrophage marker F4/80 (Figure
4A, bottom panel). mRNA expression of F4/80 and other macrophage and inflammatory
11 Diabetes Page 12 of 50
markers including CD11c and Tnf α was also increased 3- to 8-fold in livers of one year old F-IRKO and F-IR/IGFRKO mice (Figure 4B), which was not observed at earlier time points (Sup. Fig. 4). Likewise, mRNA expression of fibrogenic genes aSma, Tgf β and
Col1a1 was increased 2- to 8-fold in one year old F-IRKO and F-IR/IGFRKO mice
(Figure 4C), which again was largely not increased at prior time points (Sup. Fig. 5).
At 52 weeks of age, the livers of all F-IRKO and F-IR/IGFRKO mice contained some hepatocytes showing balloon degeneration and most exhibited many ballooned hepatocytes; ballooning score 2.0 ± 0.0 and 1.3 ± 0.2, respectively (scale of 0-2, Table 1).
At 52 weeks of age, F-IRKO and F-IR/IGFRKO mice showed increased inflammation score of 0.6 ± 0.2 and 1.5 ± 0.2 (scale 0-3, Table 1), respectively. The most striking histological difference between 12 and 52 week old mice was seen in the degree of fibrosis. Fibrosis was not present at 12 weeks of age (Table 1), however, at 52 weeks of age F-IRKO mice showed stage 1 fibrosis, consisting of both interstitial, and periportal fibrosis, while a more severe degree of interstitial fibrosis (stage 3 out of 4) was present in F-IR/IGFRKO mice (Figure 4D, and Table 1). F-IGFRKO mice did not develop liver inflammation or fibrosis at any age.
One year old F-IRKO and F-IR/IGFRKO mice preserve some gluconeogenic potential.
As lipodystrophic mice aged and developed progressive liver disease their blood glucose levels improved (17). We assessed whether impaired hepatic gluconeogenesis due to progressive liver disease could be responsible for the improved glucose levels in older mice. Indeed, mRNA levels of two rate-limiting enzymes of gluconeogenesis,
12 Page 13 of 50 Diabetes
G6Pase and Pepck, were decreased in 1 year-old F-IRKO and F-IR/IGFRKO livers. The
expression of other gluconeogenic enzymes, such as Fbp1 and Pc, on the other hand,
were elevated (Figure 5A). Interestingly, the relative expression of gluconeogenic
enzymes did not change between 12 and 52 weeks of age, except for G6pase which was
elevated in F-IR/IGFRKO mice at 12 weeks but decreased in F-IRKO and F-IR/IGRKO
mice at 52 weeks of age (Figure 5A). While reduction in G6pase and Pepck expression
suggests impaired gluconeogenesis, some gluconeogenic potential was preserved as 52
week old F-IRKO and F-IR/IGFRKO mice did not develop hypoglycemia with fasting
(Figure 5B). In addition, F-IRKO and F-IR/IGFRKO mice were able to mobilize stored
glucose in response to glucagon and even showed an exaggerated response (Figure 5C).
This is consistent with enhanced glycogen stores in the liver of lipodystrophic mice as
assessed by PAS staining (Figure 5D). Improvement in glucose was also not due to
failure of pancreatic alpha-cells, as serum glucagon levels were elevated in 52 week old
F-IRKO and F-IR/IGFRKO mice (Figure 5E).
Liver tumors develop in lipodystrophic mice at one year of age
With aging, livers of both F-IRKO and F-IR/IGFRKO mice developed gross
nodularity (Figure 6A, top); this occurred in the setting of fibrosis (Figure 6A, middle and
Sup. Fig. 6). Histological sections of liver stained for Ki67 showed clusters of
proliferating cells in F-IRKO and discrete proliferative nodules in F-IR/IGFRKO livers
(Figure 6A, bottom). These nodules contained hepatocytes with increased mitotic activity
and large, atypical nuclei, often with multiple, prominent nucleoli, indicative of severe
cellular dysplasia (Sup. Fig. 7A). Livers of F-IR/IGFRKO mice also contained tumor-like
13 Diabetes Page 14 of 50
malformations of bile ducts, segments of bone with bone marrow elements and areas of
extramedullary hematopoiesis (Sup. Fig. 7B, C and D), as well as increased expression of
tumorigenic markers beta-catenin, Afp and cyclin D1 (Sup. Fig 8A, B and C). Expression
of Pkm2, a rate limiting enzyme of glycolysis was also increased in F-IR/IGFRKO livers
(Figure 6B). Pkm2 is normally found in tissues with high glycolytic activity, such as
embryonic stem cells and tumor cells, but not in mature hepatocytes (24).
Whole body oxygen consumption (VO2) was significantly decreased by 30% in 1 year old F-IRKO and F-IR/IGFRKO mice due to, at least in part, reduced activity of the mice (Figure 6C and Sup. Fig. 9). Respiratory exchange ratio (RER) was also lower in these mice as compared to controls at 12 weeks of age, but by 52 weeks of age RER was above 0.9 in F-IRKO and F-IR/IGFRKO mice and actually significantly higher than controls (Figure 6C). The latter finding indicates a shift in favor of greater glucose than lipid utilization in the lipodystrophic mice, which is likely from the increased glycolytic activity associated with development of the dysplastic hepatic nodules. Insulin receptor levels were reduced in the livers of F-IR/IGFRKO mice (Figure 6D), probably as a result of sustained hyperinsulinemia (25). Also, there was increased serine/threonine phosphorylation of PTEN, decreased total levels of PTEN (Figure 6D) and increased staining of PIP3 (Figure 6E), all consistent with development of hepatic neoplasia.
High fat feeding accelerates blood glucose normalization
In order to test to what extent chronic lipotoxicity might be mediating the liver injury and improved glucose levels in aged mice, we placed a cohort of 8-week old control, F-IRKO and F-IR/IGFRKO mice on a high fat diet (60% fat by calories). Control
14 Page 15 of 50 Diabetes
mice gained weight on HFD throughout the 12 week study period, while F-IR/IGFRKO
mice gained body weight initially, but this began to level off after 8 weeks on the diet. F-
IRKO mice also initially gained weight but then started losing body weight after 8 weeks
on the diet (Figure 7A). Likewise, blood glucose levels at 8 weeks on the diet began
trending downward, so that at 12 weeks blood glucose levels of F-IRKO and F-
IR/IGFRKO mice were not different from the control mice (Figure 7B). After 12 weeks
of HFD, glucose tolerance of lipodystrophic mice also improved and was not different
from the control mice (Figure 7C). Liver histology showed marked steatosis and balloon
degeneration in F-IRKO and F-IR/IGFRKO mice, while control mice did not develop
significant steatosis (Figure 7D). Liver weight of F-IRKO and F-IR/IGFRKO mice was
significantly increased as compared to the controls at 12 weeks on HFD (Figure 7E), and
hepatomegaly was as profound as the liver weight of chow fed F-IRKO and F-
IR/IGFRKO mice at 52 weeks of age.
The expression of gluconeogenic enzymes G6Pase and Pepck was again
decreased in F-IRKO and F-IR/IGFRKO mice (Figure 7F), similar to the decreased
expression of these enzymes at 52 weeks of age on chow diet. Conversely, the expression
of Fbp1 was not significantly increased, while the mRNA levels of Pc, Gapdh, Enol1 and
Aldo b were increased in F-IRKO and F-IR/IGFRKO mice (Figure 7F and Sup. Fig. 10),
suggestive of increased glucose flux. When 14C-2-deoxyglucose uptake was assessed in
vivo, uptake in the livers of F-IRKO and F-IR/IGFRKO mice tended to be higher, while
glucose uptake was decreased in the muscle of F-IR/IGFRKO mice at 12 weeks on HFD
(Sup. Fig. 11A). Again, normalization of blood glucose levels on HFD correlated with
increased Pkm2 expression in F-IRKO and F-IR/IGFRKO mice (Figure 7G). Although,
15 Diabetes Page 16 of 50
these livers did not show gross nodularity, the liver parenchyma was heterogeneous in color (Sup. Fig. 11B). FGF21 mRNA levels were also increased in lipodystrophic mice on HFD (Figure 7G), as was the expression of Acc1, Fas and Scd1 (Figure 7H). The
HFD-challenged lipodystrophic mice also developed signs of liver inflammation with elevated expression of F4/80, Tnf α, CD11c (Figure 7I) and signs of liver fibrosis with elevated αSma and Col1a1 mRNA (Figure 7J).
16 Page 17 of 50 Diabetes
DISCUSSION
In the present study we show that adipose-specific deletion of insulin receptor or
combined deletion of IR and IGF1R induces a generalized lipodystrophy phenotype with
profound hepatomegaly, marked steatosis and increased enzymes of de novo lipogenesis.
Early on, this results in increased levels of reactive oxygen species in the liver,
augmented lipid peroxidation and hepatocyte balloon degeneration - all indicative of
lipotoxicity. At this age, these mice are able to mobilize stored liver lipids and utilize
different substrates, such that blood glucose levels and liver weight decrease with fasting.
Furthermore, lipodystrophic F-IRKO and F-IR/IGFRKO mice are able to robustly
increase ketogenesis, perhaps due to increased liver FGF21 expression. Over time,
however, lipotoxic effects accumulate, so that by 52 weeks of age lipodystrophic mice
develop significant hepatic inflammation and fibrosis. Interestingly, blood glucose levels
also normalize at this age, in part due to chronic lipotoxicity with altered expression of
gluconeogenic enzymes and development of highly dysplastic liver nodules, resulting in
greater glucose utilization by liver and a dramatic increase in whole body RER.
Normalization of blood glucose levels can be accelerated by feeding mice HFD for 12
weeks.
The lipodystrophic syndrome observed in F-IRKO and F-IR/IGFRKO mice is
similar to human generalized lipodystrophy in many ways. Both are characterized by low
leptin levels, marked insulin resistance, hyperlipidemia and fatty liver disease (26; 27).
Leptin replacement reduces blood glucose levels and hepatic steatosis in humans with
lipodystrophy (8; 28), and leptin replacement also normalizes blood glucose levels in F-
IRKO and F-IR/IGFRKO mice (17). The effects of leptin are, at least in part, secondary
17 Diabetes Page 18 of 50
to reduced food intake and can be mimicked in our lipodystrophic mice with fasting
alone.
In humans with generalized lipodystrophy, NAFLD often progresses to non- alcoholic steatohepatitis (NASH) and cirrhosis (15), sometimes requiring liver transplantation (14). F-IRKO and F-IR/IGFRKO mice also develop profound and progressive fatty liver disease with massive hepatomegaly (liver weight up to ~25% of body weight) with inflammation, pericellular fibrosis, and an inversion of ALT to AST
ratio. Indeed, by one year of age, the F-IRKO and F-IR/IGFRKO mice develop overt
dysplastic hepatic nodules with severe large-cell dysplasia, frequent mitoses, as well as
elevated tumor markers Apf and β-catenin. This is associated with a decrease in liver
PTEN levels and increased accumulation of PIP3, changes often seen in liver cancer (29).
Thus, the liver injury in our current lipodystrophic model describes a full spectrum of
NAFLD progression including the development of severely dysplastic hepatic nodules.
The liver phenotype in these mice is in contrast to the liver phenotype in our previous
study of fat specific IR and IGF1R deletion driven by aP2- cre promoter, which did not
develop NAFLD unless challenged with HFD (18). The difference likely stems from the
fact that deletion of IR or IR and IGF1R driven by aP2-cre, only results in moderately
reduced adipose tissue mass, leading to improved glucose tolerance and protection from
age-related and hypothalamic lesion-induced obesity (30). Lipodystrophic mice due to
knockout of Srebp1c using aP2-Cre also develop NAFLD with progression to NASH, but
have not been reported to develop tumors or dysplastic hepatic nodules (31). However, patients with lipodystrophy are known to develop liver adenomas (personal
communication Dr. Rebecca Brown and Dr. Philip Gorden) and there is at least one
18 Page 19 of 50 Diabetes
patient with acquired generalized lipodystrophy who developed hepatocellular carcinoma
(32).
Our findings indicate that stored fat in the liver is a dynamic depot.
Lipodystrophic mice lose about 40% of liver weight with fasting and gain 150% above
fasted liver weight, following 8 hours of refeeding. Canonical thinking is that liver fat
accumulation occurs over time and that additive insults lead to chronic liver injury (33).
However, human studies also indicate the dynamic nature of liver fat. As an example,
overfeeding for only 3 weeks can increase liver fat by 27 percent, while total body weight
increases by only 2 percent (34). Furthermore, short-term (2 week) hypocaloric diets are
used to reduce liver volume before bariatric surgery (35). In humans, caloric restriction to
~1,100 kcal/day for 48 hours can also markedly reduce liver triglyceride content,
especially when fed a low carbohydrate diet (36). Stored liver fat in lipodystrophic mice
is utilized for ketogenesis, which occurs in spite of almost complete absence of adipose
tissue. This may be due to elevated liver expression of FGF21, a peptide which has been
shown to regulate lipid metabolism (37) and hepatic ketogenesis (38; 39). Thus, liver can
function as a fat depot, at least in conditions where adipose tissue does not develop.
However, extensively relying on the liver for lipid storage does comes at a cost, as
hepatic lipotoxicity is present even at a young age, and can be accelerated by HFD
feeding.
One of the most unexpected aspects of the F-IRKO and F-IR/IGFRKO phenotype
is the improvement in blood glucose levels with aging. The improvement in blood
glucose is not due to regeneration of adipose tissue nor to a reduction in food intake (17).
It is also not due to return of normal leptin levels or improved insulin sensitivity, as
19 Diabetes Page 20 of 50
insulin levels remained elevated and pancreatic islets continued to hypertrophy. Instead, the improvement parallels the progression of liver disease from NAFLD to NASH with inflammation, fibrosis and severely dysplastic nodules. At least three factors appear to contribute to the improved glycemia. The first is some impairment in gluconeogenesis due to chronic liver disease. Pepck and G6Pase were decreased in one-year old F-IRKO and F-IR/IGFRKO livers. Attempts to directly assess gluconeogenesis with a pyruvate challenge, however, resulted in death of the mice, so the extent of impairment is difficult to quantify. Mice did tolerate overnight fasting without development of hypoglycemia, and liver glycogen stores were increased. A second potential contributory factor could have been either a failure of pancreatic cells to secrete glucagon or a loss of glucagon receptors in the dysplastic liver. However, serum glucagon levels remained elevated with age, and F-IRKO and F-IR/IGFRKO mice showed a brisk glycemic response to glucagon injection.
The third, and perhaps most important, factor that could contribute to glucose normalization may be the chronic lipotoxicity and development of severely dysplastic hepatic nodules. Furthermore, expression of PKM2 in whole liver lysate was increased, contributing to increased glycolysis. This is consistent with the shift from fat to carbohydrate metabolism with aging, as exemplified by the increase in whole-body RER.
Lipotoxicity likely mediates the liver injury as HFD feeding accelerates blood glucose normalization. This occurred even without gross evidence of tumor development, however, the key enzyme of glycolysis, PKM2, is profoundly increased in the lipodystrophic mice after only 12 weeks of HFD feeding. Hyperinsulinemia may directly
20 Page 21 of 50 Diabetes
increase PKM2 levels (40) and thus may lead to glucose normalization in the absence of
highly dysplastic liver nodules.
In summary, F-IRKO and F-IR/IGFRKO mice provide a unique new model to
study the development and progression of fatty liver disease. Using this model, we show
that lipodystrophic mice develop a full spectrum of NAFLD, which progresses to NASH,
fibrosis and ultimately highly dysplastic liver nodules, which is associated with
improvement in blood glucose levels. This liver injury can be accelerated by feeding
mice a HFD. Taken together, these data indicate that lipotoxicity can play a major role in
the development of liver disease. This can then contribute to altered whole-body
metabolism, modifying disease pathogenesis in unexpected ways.
21 Diabetes Page 22 of 50
ACKNOWLEDGMENTS
The authors thank Joslin Diabetes and Endocrinology Research Center core laboratories (P30 DK036836). This work was also supported by NIH grants (R01
DK031036, and R01 DK082659) to C.R.K, and K12 HD000850 to S.S. The Sunstar
Foundation supported S.F. and M.H.S. was supported in part by funds from the U of
Bergen, KG Jebsen Foundation, Norwegian Society of Endocrinology,
Eckbo’s Foundation, T. Wilhelmsen Foundation and the Norwegian Diabetes
Association.
S.S. generated the data and wrote the manuscript. J.B. generated the data and
wrote the manuscript. M.H.S., M.H., S.F., E.H.P., J.W., and A.R.P. generated the data
and reviewed the manuscript. C.R.K. oversaw the project, contributed to discussion, and
helped write the manuscript. C.R.K. is the guarantor of this work and, as such, had full
access to all the data in the study and takes responsibility for the integrity of the data and
the accuracy of the data analysis. There are no potential conflicts of interest relevant to
this article by any of the authors.
22 Page 23 of 50 Diabetes
REFERENCES
1. He W, Barak Y, Hevener A, Olson P, Liao D, Le J, Nelson M, Ong E, Olefsky JM, Evans RM: Adipose-specific peroxisome proliferator-activated receptor gamma knockout causes insulin resistance in fat and liver but not in muscle. Proc Natl.Acad Sci U S.A. 100:15712-15717, 2003 2. Moitra J, Mason MM, Olive M, Krylov D, Gavrilova O, Marcus-Samuels B, Feigenbaum L, Lee E, Aoyama T, Eckhaus M, Reitman ML, Vinson C: Life without white fat: a transgenic mouse. Genes Dev. 12:3168-3181, 1998 3. Pajvani UB, Trujillo ME, Combs TP, Iyengar P, Jelicks L, Roth KA, Kitsis RN, Scherer PE: Fat apoptosis through targeted activation of caspase 8: a new mouse model of inducible and reversible lipoatrophy. Nat.Med 11:797-803, 2005 4. Shimomura I, Hammer RE, Richardson JA, Ikemoto S, Bashmakov Y, Goldstein JL, Brown MS: Insulin resistance and diabetes mellitus in transgenic mice expressing nuclear SREBP-1c in adipose tissue: model for congenital generalized lipodystrophy. Genes Dev. 12:3182-3194, 1998 5. Chalasani N, Younossi Z, Lavine JE, Diehl AM, Brunt EM, Cusi K, Charlton M, Sanyal AJ, American Gastroenterological A, American Association for the Study of Liver D, American College of G: The diagnosis and management of non-alcoholic fatty liver disease: practice guideline by the American Gastroenterological Association, American Association for the Study of Liver Diseases, and American College of Gastroenterology. Gastroenterology 142:1592-1609, 2012 6. Gorden P, Lupsa BC, Chong AY, Lungu AO: Is there a human model for the 'metabolic syndrome' with a defined aetiology? Diabetologia 53:1534-1536, 2010 7. Haque WA, Shimomura I, Matsuzawa Y, Garg A: Serum adiponectin and leptin levels in patients with lipodystrophies. J Clin Endocrinol Metab 87:2395, 2002 8. Safar Zadeh E, Lungu AO, Cochran EK, Brown RJ, Ghany MG, Heller T, Kleiner DE, Gorden P: The liver diseases of lipodystrophy: the long-term effect of leptin treatment. J Hepatol 59:131-137, 2013 9. Simha V, Szczepaniak LS, Wagner AJ, DePaoli AM, Garg A: Effect of leptin replacement on intrahepatic and intramyocellular lipid content in patients with generalized lipodystrophy. Diabetes Care 26:30-35, 2003 10. Petersen KF, Oral EA, Dufour S, Befroy D, Ariyan C, Yu C, Cline GW, DePaoli AM, Taylor SI, Gorden P, Shulman GI: Leptin reverses insulin resistance and hepatic steatosis in patients with severe lipodystrophy. J Clin Invest 109:1345-1350, 2002 11. Robbins DC, Sims EA: Recurrent ketoacidosis in acquired, total lipodystrophy (lipoatrophic diabetes). Diabetes Care 7:381-385, 1984 12. Domingo P, Gallego-Escuredo JM, Domingo JC, Gutierrez Mdel M, Mateo MG, Fernandez I, Vidal F, Giralt M, Villarroya F: Serum FGF21 levels are elevated in association with lipodystrophy, insulin resistance and biomarkers of liver injury in HIV- 1-infected patients. Aids 24:2629-2637, 2010 13. Spolcova A, Holubova M, Mikulaskova B, Nagelova V, Stofkova A, Lacinova Z, Jurcovicova J, Haluzik M, Maletinska L, Zelezna B: Changes in FGF21 serum concentrations and liver mRNA expression in an experimental model of complete lipodystrophy and insulin-resistant diabetes. Physiol Res 63:483-490, 2014
23 Diabetes Page 24 of 50
14. Cauble MS, Gilroy R, Sorrell MF, Mailliard ME, Sudan DL, Anderson JC, Wisecarver JL, Balakrishnan S, Larsen JL: Lipoatrophic diabetes and end-stage liver disease secondary to nonalcoholic steatohepatitis with recurrence after liver transplantation. Transplantation 71:892-895, 2001 15. Javor ED, Ghany MG, Cochran EK, Oral EA, DePaoli AM, Premkumar A, Kleiner DE, Gorden P: Leptin reverses nonalcoholic steatohepatitis in patients with severe lipodystrophy. Hepatology 41:753-760, 2005 16. Schneeweiss B, Pammer J, Ratheiser K, Schneider B, Madl C, Kramer L, Kranz A, Ferenci P, Druml W, Grimm G, et al.: Energy metabolism in acute hepatic failure. Gastroenterology 105:1515-1521, 1993 17. Boucher J: Differential Roles of Insulin and IGF-1 Receptors in Adipose Tissue Development and Function. Diabetes, 2016 18. Boucher J, Mori MA, Lee KY, Smyth G, Liew CW, Macotela Y, Rourk M, Bluher M, Russell SJ, Kahn CR: Impaired thermogenesis and adipose tissue development in mice with fat-specific disruption of insulin and IGF-1 signalling. Nat Commun 3:902, 2012 19. Debosch BJ, Chen Z, Saben JL, Finck BN, Moley KH: Glucose transporter 8 (GLUT8) mediates fructose-induced de novo lipogenesis and macrosteatosis. J Biol Chem 289:10989-10998, 2014 20. O'Neill BT, Lauritzen HP, Hirshman MF, Smyth G, Goodyear LJ, Kahn CR: Differential Role of Insulin/IGF-1 Receptor Signaling in Muscle Growth and Glucose Homeostasis. Cell Rep 11:1220-1235, 2015 21. Eguchi J, Wang X, Yu S, Kershaw EE, Chiu PC, Dushay J, Estall JL, Klein U, Maratos-Flier E, Rosen ED: Transcriptional control of adipose lipid handling by IRF4. Cell Metab 13:249-259, 2011 22. Mannaerts I, Schroyen B, Verhulst S, Van Lommel L, Schuit F, Nyssen M, van Grunsven LA: Gene expression profiling of early hepatic stellate cell activation reveals a role for Igfbp3 in cell migration. PLOS One 8:e84071, 2013 23. Gramlich T, Kleiner DE, McCullough AJ, Matteoni CA, Boparai N, Younossi ZM: Pathologic features associated with fibrosis in nonalcoholic fatty liver disease. Hum Pathol 35:196-199, 2004 24. Carter-Kent C, Brunt EM, Yerian LM, Alkhouri N, Angulo P, Kohli R, Ling SC, Xanthakos SA, Whitington PF, Charatcharoenwitthaya P, Yap J, Lopez R, McCullough AJ, Feldstein AE: Relations of steatosis type, grade, and zonality to histological features in pediatric nonalcoholic fatty liver disease. J Pediatr Gastroenterol Nutr 52:190-197, 2011 25. Soli AH, Kahn CR, Neville DM, Jr., Roth J: Insulin receptor deficiency in genetic and acquired obesity. J Clin Invest 56:769-780, 1975 26. Huang-Doran I, Sleigh A, Rochford JJ, O'Rahilly S, Savage DB: Lipodystrophy: metabolic insights from a rare disorder. J.Endocrinol. 207:245-255, 2010 27. Fiorenza CG, Chou SH, Mantzoros CS: Lipodystrophy: pathophysiology and advances in treatment. Nat.Rev.Endocrinol. 7:137-150, 2011 28. Petersen KF, Oral EA, Dufour S, Befroy D, Ariyan C, Yu C, Cline GW, Depaoli AM, Taylor SI, Gorden P, Shulman GI: Leptin reverses insulin resistance and hepatic steatosis in patients with severe lipodystrophy. J Clin Invest 109:1345-1350, 2002
24 Page 25 of 50 Diabetes
29. Horie Y, Suzuki A, Kataoka E, Sasaki T, Hamada K, Sasaki J, Mizuno K, Hasegawa G, Kishimoto H, Iizuka M, Naito M, Enomoto K, Watanabe S, Mak TW, Nakano T: Hepatocyte-specific Pten deficiency results in steatohepatitis and hepatocellular carcinomas. J Clin Invest 113:1774-1783, 2004 30. Bluher M, Michael MD, Peroni OD, Ueki K, Carter N, Kahn BB, Kahn CR: Adipose tissue selective insulin receptor knockout protects against obesity and obesity-related glucose intolerance. Dev Cell 3:25-38, 2002 31. Nakayama H, Otabe S, Ueno T, Hirota N, Yuan X, Fukutani T, Hashinaga T, Wada N, Yamada K: Transgenic mice expressing nuclear sterol regulatory element-binding protein 1c in adipose tissue exhibit liver histology similar to nonalcoholic steatohepatitis. Metabolism 56:470-475, 2007 32. Misra A, Garg A: Clinical features and metabolic derangements in acquired generalized lipodystrophy: case reports and review of the literature. Medicine (Baltimore) 82:129-146, 2003 33. Day CP, James OF: Steatohepatitis: a tale of two "hits"? Gastroenterology 114:842- 845, 1998 34. Sevastianova K, Santos A, Kotronen A, Hakkarainen A, Makkonen J, Silander K, Peltonen M, Romeo S, Lundbom J, Lundbom N, Olkkonen VM, Gylling H, Fielding BA, Rissanen A, Yki-Jarvinen H: Effect of short-term carbohydrate overfeeding and long- term weight loss on liver fat in overweight humans. Am J Clin Nutr 96:727-734, 2012 35. van Wissen J, Bakker N, Doodeman HJ, Jansma EP, Bonjer HJ, Houdijk AP: Preoperative Methods to Reduce Liver Volume in Bariatric Surgery: a Systematic Review. Obes Surg 26:251-256, 2016 36. Kirk E, Reeds DN, Finck BN, Mayurranjan SM, Patterson BW, Klein S: Dietary fat and carbohydrates differentially alter insulin sensitivity during caloric restriction. Gastroenterology 136:1552-1560, 2009 37. Murata Y, Konishi M, Itoh N: FGF21 as an Endocrine Regulator in Lipid Metabolism: From Molecular Evolution to Physiology and Pathophysiology. J Nutr Metab 2011:981315, 2011 38. Inagaki T, Dutchak P, Zhao G, Ding X, Gautron L, Parameswara V, Li Y, Goetz R, Mohammadi M, Esser V, Elmquist JK, Gerard RD, Burgess SC, Hammer RE, Mangelsdorf DJ, Kliewer SA: Endocrine regulation of the fasting response by PPARalpha-mediated induction of fibroblast growth factor 21. Cell Metab 5:415-425, 2007 39. Badman MK, Pissios P, Kennedy AR, Koukos G, Flier JS, Maratos-Flier E: Hepatic fibroblast growth factor 21 is regulated by PPARalpha and is a key mediator of hepatic lipid metabolism in ketotic states. Cell Metab 5:426-437, 2007 40. Iqbal MA, Siddiqui FA, Gupta V, Chattopadhyay S, Gopinath P, Kumar B, Manvati S, Chaman N, Bamezai RN: Insulin enhances metabolic capacities of cancer cells by dual regulation of glycolytic enzyme pyruvate kinase M2. Mol Cancer 12:72, 2013 41. Kleiner DE, Brunt EM, Van Natta M, Behling C, Contos MJ, Cummings OW, Ferrell LD, Liu YC, Torbenson MS, Unalp-Arida A, Yeh M, McCullough AJ, Sanyal AJ: Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 41:1313-1321, 2005
25 Diabetes Page 26 of 50
FIGURE LEGENDS
Figure 1: Fatty liver disease in 12 week old lipodystrophic mice
A) Blood glucose, B) liver weight and C) liver TG content in 12 week old, random-fed
control, F-IGFRKO, F-IRKO and F-IR/IGFRKO mice. Results are mean ± SEM of 12 to
30 animals per group. D) H&E stained liver sections from the same mice. mRNA
expression of genes involved in E) de novo lipogenesis, F) inflammation and G) fibrosis
in the livers of 12 week old control, F-IGFRKO and F-IRKO mice. H) Dihydroethidium
(DHE) and 4-hydroxynonenal (4-HNE) stained liver sections from control and F-
IR/IGFRKO mice. I) Expression of gluconeogenic/glycolytic enzymes in the livers of
control, F-IGFRKO, F-IRKO and F-IR/IGFRKO mice at 12 weeks of age fed chow diet.
Results are mean ± SEM of 5 to 7 animals per group. *indicates a significant difference
compared to controls (*, p<0.05; **, p<0.01; ***, p<0.001).
Figure 2: Lipodystrophic mice can mobilize stored liver fat.
A) Blood glucose, B) liver weight and C) serum TG livers D) Free Fatty Acids, E) Insulin
and F) beta-hydroxybutyrate levels, in 12 week old random fed or overnight fasted
control and F-IRKO mice. Results are mean ± SEM of 9 to 10 animals per group. G)
FGF21 mRNA levels in the livers from 2.5, 12 and 52 week old control, F-IGFRKO, F-
IRKO and F-IR/IGFRKO mice. Results are mean ± SEM of 5-8 mice per group.
*indicates a significant difference compared to controls (*, p<0.05; **, p<0.01; ***, p<0.001). # indicates a significant difference from fed F-IRKO mice and § indicates a
significant difference between adjacent groups.
26 Page 27 of 50 Diabetes
Figure 3: F-IRKO and F-IR/IGFRKO mice develop progressive NAFLD with age
A) Liver weight and B) body weight of control, F-IGFRKO, F-IRKO and F-IR/IGFRKO
mice at 2.5, 5, 8, 12 and 52 weeks of age. Results are mean ± SEM of 12 to 30 animals
per group. C) TG content was measured in the livers from 2.5, 12 and 52 weeks of age.
D) Acc1, E) Fas and F) Scd1 mRNA expression in control, F-IGFRKO, F-IRKO and F-
IR/IGFRKO mice at 2.5, 12 and 52 weeks of age graphed as a fold change over controls.
Results are mean ± SEM of 5-8 animals per group. G) Serum ALT and H) AST levels
measured in 2.5, 5, 12 and 52 week old chow fed control, F-IGFRKO, F-IRKO and F-
IR/IGFRKO mice. *indicates a significant difference compared to controls (*, p<0.05;
**, p<0.01; ***, p<0.001).
Figure 4: Liver inflammation is apparent at 52 weeks of life.
A) H&E stained liver sections from 52 week old control, F-IGFRKO, F-IRKO and F-
IR/IGFRKO mice, 100x magnification, top panel. IHC for macrophage marker F4/80 in
the same mice, 400 x magnification, bottom panel. One representative section from 3
mice per group is shown. Expression of genes involved in B) inflammation and C)
fibrosis in chow fed control, F-IGFRKO, F-IRKO and F-IR/IGFRKO mice at 52 weeks
of age. Results are mean ± SEM of 4 to 8 animals per group. *indicates a significant
difference compared to controls (*, p<0.05; **, p<0.01; ***, p<0.001). D) Masson’s
trichrome stained liver sections from the same mice at 52 weeks of age, 200x
magnification. One representative section from 4-6 mice per group is shown.
Figure 5: Gluconeogenesis at 52 weeks of age.
27 Diabetes Page 28 of 50
A) mRNA expression of G6pase, Pepck, Fbp1 and Pc in control, F-IGFRKO, F-IRKO
and F-IR/IGFRKO mice at the indicated times from 2.5 to 52 weeks of age graphed as
fold change over controls. Results are mean ± SEM of 5 to 6 animals/group. *indicates a
significant difference compared to controls (*, p<0.05; **, p<0.01; ***, p<0.001) B)
Random fed and overnight fasted blood glucose levels of chow fed control, F-IGFRKO,
F-IRKO and F-IR/IGFRKO mice at 52 weeks of age. C) Blood glucose levels assessed
over 90 minutes after IP glucagon challenge and serum glucagon levels in control, F-
IRKO and F-IR/IGFRKO mice at indicated times. Results are mean ± SEM of 5-6
animals/group. E) Periodic Acid-Schiff stained liver sections from control, F-IGFRKO,
F-IRKO and F-IR/IGFRKO mice at 52 weeks of age. One representative section from 5
mice per group is shown.
Figure 6: Lipodystrophic mice develop liver tumors and increased glycolysis.
A) Representative images of whole liver (upper panel), Masson’s Trichrome stain
(middle panel) and Ki67 staining (lower panel) in 1 year old control, F-IGFRKO, F-
IRKO and F-IR/IGFRKO mice. B) Ki67 and PKM2 mRNA levels in livers from 2.5, 12 and 52 week old mice. Results are mean ± SEM of 5 to 8 animals per group. C) VO2 and
RER measured in metabolic cages with control, F-IRKO and F-IR/IGFRKO mice at 12 and 52 weeks of age. Results are mean ± SEM of 5 to 11 mice per group. D) Western blot analysis and densitometric quantification of insulin signaling molecules from the livers of control, F-IRKO and F-IR/IGFRKO mice at 1 year of age. Results are mean ± SEM of 4 animals per group. E) Representative IHC images of PIP3 in livers of control, F-IRKO
28 Page 29 of 50 Diabetes
and F-IR/IGFRKO mice at 1 year of age *indicates a significant difference compared to
controls (*, p<0.05; **, p<0.01; ***, p<0.001).
Figure 7: HFD accelerates liver injury in lipodystrophic mice
A) Body weight of control, F-IRKO and F-IR/IGFRKO mice assessed during 12 weeks
of HFD feeding. B) Blood glucose levels in the same mice assessed at indicated time
points. C) Glucose tolerance test of control, F-IRKO and F-IR/IGFRKO mice after 12
weeks of HFD. Results are mean ± SEM of 6 to 11 animals per group. D) H&E stained
liver sections form the same mice. One representative section from 6 mice per group is
shown. E) Liver weight from of control, F-IRKO and F-IR/IGFRKO mice after 12 weeks
of HFD. F) mRNA expression of gluconeogenic enzymes and the expression of G) Pkm2
and Fgf21 mRNA after 12 weeks of HFD. mRNA levels of genes involved in H) de novo
lipogenesis, I) inflammation and J) fibrosis after 12 weeks of HFD. Results are mean ±
SEM of 4 to 6 animals per group. *indicates a significant difference compared to
controls (*, p<0.05; **, p<0.01; ***, p<0.001).
29 Diabetes Page 30 of 50
Table 1 Age 12 weeks 52 weeks Genotype WT F-IGFRKO F-IRKO F-IR/IGFRKO WT F-IGFRKO F-IRKO F-IR/IGFRKO
Macrovesicular 0 0 1.7 ± 0.4 2.6 ± 0.2 0.2 ± 0.2 0 2.8 ± 0.2 2.3 ± 0.2 Steatosis, (0-3)
Portal 0 0 0.4 ± 0.2 0 0 1.0±0.0 0.6 ± 0.2 1.5 ± 0.2 Inflammation, (0-3)
Ballooning 0 0 1.9±0.1 1.6 ± 0.2 0 0.2 ± 0.2 2.0±0.0 1.3 ± 0.2 Degeneration, (0-2)
Interstitial Fibrosis, 0 0 0.1 ± 0.1 0 0 0 0.8 ± 0.4 2.7 ± 0.2 Stage (0-4)
Fibrosis Present, 0 0 14 0 0 0 60 100 % total
TABLE LEGEND
Table 1: NAFLD Activity Scores (NAS)
NAFLD activity scores were assessed in 12 and 52 week old mice utilizing H&E and
Trichrome stained liver sections by a practicing clinical pathologist adopting a modified
version of a previously published method (41). Results are mean ± SEM of 4-6 mice per
group.
30 Fold Change 0 1 2 3 4 5
TNFa
CD11c
F4/80 H. D. E. A Figure Figure 1 Fold Change Page 31of50 10 15 Blood glucose, mg/dL 4-HNE DHE 0 5 Blood glucose (mg/dl) 200 400 600 800
0 Control ACC1 Control Control F-IR/IGFRKO F-IRKO F-IGFRKO Control Control Control F-IGFRKO F-IGFRKO * * F-IRKO F-IRKO F-IR/IGFRKO F-IR/IGFRKO Control Control Control Control F-IGFRKO F-IGFRKO IGFRKO IGFRKO F-IR/ F-IRKO F-IRKO
* * F-IGFRKO BG FAS
* * F-IRKO *** * *
F-IR/IGFRKO F-IR/IGFRKO F-IR/IGFRKO SCD1 *** ** *** F-IGFRKO F-IGFRKO F. B
LiverLiver Weight, weight g (g) F-IR/IGFRKO F-IRKO F-IGFRKO Control
FoldFold Change Change 0 2 4 6 0 1 2 3 4 5 Fold Change I. Control 0 1 2 3 TNF Liver weight weeks 12 Liver TNFa F-IGFRKO α Diabetes G6Pase
Control Control F-IGFRKO F-IGFRKO F-IRKO F-IRKO F-IR/IGFRKO F-IR/IGFRKO CD11c CD11c F-IRKO *** * * * * F-IR/IGFRKO F-IRKO F-IRKO F4/80 *** F4/80 PEPCK *** G. G. C
* * TG (nmol/mg liver) FoldFold ChangeChange 200 400 600 F-IR/IGFRKO F-IRKO F-IGFRKO Control 2 4 6 0 0 TGF TGF-b F-IRKO F-IGFRKO Control F-IR/IGFRKO FBP1 β F-IR/IGFRKO F-IR/IGFRKO
* * α *** aSMA SMA * Col1a1 Col1a1 PC **
* * *** * * F-IR/IGFRKO F-IRKO F-IGFRKO Control Figure 2 Diabetes Page 32 of 50 A. B. C. Control §§§ 300 § 700 5 §§§ §§§
§§§ 600 F-IRKO Control 250
/dl) /dl)
) 4 g g 500 g F-IRKO §§§
( 200 t 400 3 ## 150 § eigh § ides (m cose (m 300 r
W 2
ce 100 er
glu 200 ### d iv 1 *
* igly o L 100 ** r 50 T
Blo 0 0 0 Fed Fasted Refed Fed Fasted Refed Fed Fasted Refed
D. § E. F. Cont F-IRKO §
1.5 * 15 ) 1.5 ***
*** nM (
§§§ ed * ed ate t t ed ed r /L) 1
y 1 F
10 F as as t ng /ml) F F u
b *** mEq (
lin ( xy A o F 0.5 5 r 0.5 F * d Insu Hy
β 0 0 *** 0 G. 30 Control *** ***
25 F-IGFRKO
NA 20 F-IRKO ** mR 15 F-IR/IGFRKO
21 * F
G 10 * F 5 0 2.5 weeks 12 weeks 52 weeks FigurePage 33 of 503 Diabetes A. B. 10 Control *** 40 ** 9 F-IGFRKO 35 **
8
) F-IRKO ) 30 g g (
7 (
t F-IR/IGFRKO *** t 6 25 eigh 5 eigh 20 w w
4 y er 15 d iv 3 L Bo 10 2 1 5 0 0 0 3 6 9 12 52 weeks 0 3 6 9 12 52 weeks C. D. * 600 ** ** 4 500
* 400 * 3 * NA /mg liver) ** ** 300 mR * * 2 nmol
200 CC1 A 1 TG ( TG 100
0 0 2.5 week 12 week 52 week 2.5 week 12 week 52 week E. * F. *** 100 ** 4 **
80 NA NA 3 * *** 60 mR mR
* *
S 2
A 40 CD1 F S 1 20
0 0 2.5 week 12 week 52 week 2.5 week 12 week 52 week G. H. 30 45 ** 40 ** 25
Control 35 ** ** U/L 20 F-IGFRKO U/L 30
T T
L F-IRKO 25 S
A 15 F-IR/IGFRKO A 20 * 10 * 15 * 10 5 * 5 0 0 2.5 week 5 week 12 week 52 week 2.5 week 5 week 12 week 52 week Figure 4 Diabetes Page 34 of 50 A.
Control F-IGFRKO F-IRKO F-IR/IGFRKO
5 B. C. Control 10 10 *** 4 F-IGFRKOF-IGFRKO Control Control F-IRKOF-IRKO *** 8 8 F-IGFRKO F-IGFRKO 3 F-IR/IGFRKOF-IR/IGFRKO 6 ** ** F-IRKO F-IRKO 3 * 2 6 *** F-IR/IGFRKO*** F-IR/IGFRKO
Fold ChangeFold ** * 1 4 2 Fold Change Fold Change 0 ** 2 1
TNFa F4/80 CD11c 0 0 TNFα CD11c F4/80 TGFβ αSMA Col1a1 D. FiPagegu 35re of 505 Diabetes Control A. * F-IGFRKO
1.6 F-IRKO NA F-IR/IGFRKO 1.2 mR e 0.8 * as * *
6P 0.4 G 0
1.6
1.2 RNA * m 0.8 *** *** ***
CK ** P 0.4 E P 0
3.0 *
*** 2.5 2.0 ** 1.5 1 mRNA 1.0 BP
F 0.5 0.0 * * 2.0 * *** *
1.6 **
1.2 NA 0.8 mR
C 0.4 P 0 2.5 week old 12 week old 52 week old
B. C. 450 E. 250 500 Control * 400 F-IRKO ** 200 dL ) 400 350 F-IR/IGFRKO 300 /dl) 150 300 250 mg ( * 200 100
se * 200 # 150
Glucose (mg/ Glucose 50 100 (pg/ml)Glucagon luco 100
G 50 0 0 0 Fed Fasted 0 15 30 45 60 75 90min 2.5 12 52 D.
Control F-IGFRKO F-IRKO F-IR/IGFRKO Figure 6 Diabetes Page 36 of 50 A. B.
Control F-IGFRKO F-IRKO F-IR/IGFRKO
C. VO2 (ml/kg/h) RER 12 week 52 week 12 week 52 week 1.00 6000 Light Dark Light Dark Light Dark Light Dark 0.95 5000 ** ** ** ** ** 0.90 4000 ** * ** ** 0.85 * ** 3000 0.80
2000 0.75
D. Control F-IRKO F-IR/IGFRKO E. PIP3 IR Control
p-PTEN
PTEN F-IRKO Actin
IR p-PTEN PTEN 1.5 2.5 1.5 * 2 Control els ** 1 1 F-IRKO 1.5 F-IR/IGFRKO F-IR/IGFRKO ein lev t ** 1 o **
r 0.5 0.5 P *** 0.5 *** 0 0 0 FigurePage 37 of 507 Diabetes Weight Gain Combined Weight Gain
20 A. B. C. 25 Control 600 500 WT WT F-IR/IGF1RKO F-IRKO *** 15 20 F-IRKO 400F-IRKO F-IRKO F-IR/IGFRKO dL )
dL ) F-IR/IGFRKO 400 F-IGF/IRKO WT 15 300 10 * 10 200 200
5 (mg/ Glucose Weight gain (g)Weight gain
Weight (g) Gain Weight gain (g)Weight gain
5 ** (mg/ Glucose 100 Blood glucose, mg/dL glucose, Blood 0 0 0 0 0 1 2 3 4 6 8 10 12 Wks 0 1 2 3 4 6 8 10 12 Wks 0 30 60 90 min 120 Wk 0 Wk 1 Wk 2 Wk 3 Wk 4 Wk 6 Wk 8 Wk 0 Wk 1 Wk 2 Wk 3 Wk 4 Wk 6 Wk 8 Wk 0 Wk 1 Wk 2 Wk 3 Wk 4 Wk 6 Wk 8 D. Wk 10 Wk 12 Wk 10 Wk 12 Wk 10
Control Fed-fast-re F-IRKO E. F-IR/IGFRKO 300 F. G. 15 Control 2.0 ** 15 F-IRKO Control *** *** F-IRKO 200 F-IR/IGFRKO 1.5 10 10 F-IR/IGFRKO *** 1.0 100
Fold ChangeFold ** *** 5 * * 5 *** 0.5 Fold Change
Fold Change Liver Weight,Liver g
Liver WeightLiver (g) * * Blood glucose, mg/dL glucose, Blood 0 0 0.0 0 G6Pase PEPCK FBP1 PC PKM2 FGF21 Fed Fed Fed FastedRefed FastedRefed FastedRefed H. 12 weeks of HFD I. J. Fibros 3 10 *** 8 30 ** Control * *** Legend 25 8 F-IRKO Legend ** 6 ** * F-IR/IGFRKO ** 20 Legend 6 * ** 4 15 3 4 * * 2
2 Fold ChangeFold Fold Change Fold Change Fold Change 2 * * 1 0 0 0 FASFAS ACC1ACC SCD1SCD1 F4/80 TNFa CD11c TGFβ αSMA Col1a1
TGFb aSMA Col1a1 Diabetes Page 38 of 50 Control F-IR/IGFRKO
Reticulin Sirius Red Trichrome
Supplemental Figure 1: Reticulin, sirius red and trichrome stained liver sections from control, and F-IR/IGFRKO mice at 12 weeks of age. One representative section from 5 mice per group is shown. 52 w 12 w 8.5 w 5 w 2.5 w Page 39of50 section section from 5 mice per group shown. is mice the at indicated 2.5 to IR/IGFRKO from 52 weeks times age. representative of One 2: Figure Supplemental Control Control H&E stained stained and H&E F-IRKO F- liver sections from control, F-IGFRKO, F-IGFRKO F-IGFRKO Diabetes F-IRKO F-IRKO F-IR/IGFRKO F-IR/IGFRKO Diabetes Page 40 of 50
e) 2.0
ang 1.6 1.2
SREBP1c ld ch o
f 0.8 (
0.4 NA 0.0 mR
2.5 week old 12 week old 52 week old
Supplemental Figure 3: mRNA expression levels of transcriptional factor SREBP1c regulating de novo lipogenesis in livers from 2.5, 12 and 52-week old control, F-IGFRKO, F-IRKO and F- IR/IGFRKO mice. Results are mean ± SEM of 5-6 animals/group.) Page 41 of 50 Diabetes
e) 1.6
ang 1.2 ld ch
o 0.8
TNFa f ( ** 0.4 ** NA
mR 0.0
e) 10 *** 8 ang ** 6 ld ch
CD11c o f 4 (
2 * NA
mR 0
e) 2.0 *** 1.6 ang * 1.2 ld ch
F4/80 o f 0.8 (
0.4 NA
mR 0.0
e) 2.0 **
ang 1.6 1.2 ** ld ch
CD68 o 0.8 f ( 0.4 NA 0.0 mR
2.5 week old 12 week old 52 week old
Supplemental Figure 4: mRNA expression levels of inflammatory markers in liver from 2.5, 12 and 52-week old control, F-IGFRKO, F-IRKO and F-IR/IGFRKO mice. Results are mean ± SEM of 5-6 animals/group. *indicates a significant difference compared to the Control group (*, p<0.05; **, p<0.01; ***, p<0.001 ) 10 Diabetes Page*** 42 of 50 9 ) 8 7 hange
c 6 ** 5 *** Col1a1 old (f
4 3 RNA 2 m 1 0
3.0 ***
) 2.5
2.0 * hange c TGFβ 1.5 old (f
A 1.0
mRN 0.5
0.0
2.5 ) 2.0 * hange
α-SMA c 1.5 old (f
1.0 A
0.5 mRN
0.0
2.5 week old 12 week old 52 week old Supplemental Figure 5: mRNA expression levels of pro-fibrogenic genes in liver from 2.5, 12 and 52-week old control, F-IGFRKO, F-IRKO and F-IR/IGFRKO mice. Results are mean ± SEM of 5-6 animals/group. *indicates a significant difference compared to the Control group (*, p<0.05; **, p<0.01; ***, p<0.001 ) Page 43 of 50 Control Diabetes F-IGFRKO
F-IRKO F-IR/IGFRKO
Supplemental Figure 6: Representative images of Masson’s Trichrome stained liver sections from control, F-IGFRKO, F-IRKO and F-IR/IGFRKO mice collected at 52 weeks of age. (one representative section from 5 mice per group is shown)
A Diabetes Page 44 of 50
B C D
Supplemental Figure 7: A) H&E stained liver section from F-IR/IGFRKO mouse at 52 weeks of age shows a large tumor compressing surrounding hepatocytes,4X mag. Inserts are 40X magnification, arrowheads show increased mitotic figures, while arrows point to atypical nuclei with condensed granular chromatin. Additional liver findings in 52 week old F-IR/IGFRKO mice show B) sites of extramedulary hematopodsis, arrows. C) Thick arrow points to bone and thin arrow points to bone marrow elements. D) Arrow points to von Meyenburg complex, a tumor like malformation of bile ducts.
APage. 45 of 50 Diabetes Control F-IRKO F-IR/IGFRKO
n i n ate - C β
B. 3.5 **
) 3.0 2.5
Change 2.0
AFP old 1.5 (F
A 1.0
mRN 0.5 0.0
C. 3.0
* ***
e) 2.5
hang 2.0
Cyc D1 C
ld 1.5 Fo (
A 1.0 N
mR 0.5
0.0
Supplemental Figure 8: A) Beta-Catenin stained liver sections from control, F-IRKO and F- IR/IGFRKO mice collected at 1 year of age (one representative section from 3 mice per group is shown). Liver mRNA expression of B) alpha-fetoprotein and C) cyclin D1 from control, F-IGFRKO, F-IRKO and F-IR/IGFRKO mice at 2.5, 12 and 52 weeks of age. Results are mean ± SEM of 5-6 animals/group. *indicates a significant difference compared to the Control group (*, p<0.05; **, p<0.01; ***, p<0.001 )
Diabetes Page 46 of 50 Activity average per h
3M old 1Y old Light Dark Light Dark 700 600 500 400 300 200 100 0 Control F-IRKO F-IR/IGFRKO
Supplemental Figure 9: Average activity measured in 3 month old and one year old control, F- IRKO and F-IR/IGFRKO mice in metabolic cages. Results are mean ± SEM of 5 to 11 mice per group. Data 1 Page 47 of 50 Diabetes 5 4000 Control *** F-IRKO 3000 4 F-IR/IGFRKO
2000 * 3 ** **
Leptin pg/ml Leptin * 1000 ** 2 **
0 Fold ChangeFold
Leptin 5 1 Leptin 12 Leptin 52 * * * * 0
PC FBP1 Enol 1 G6Pase PEPCK GAPDH Aldo B
Supplemental Figure 10: mRNA expression of glucenogenic enzymes after 12 weeks of HFD in the livers of control, F-IRKO and F-IR/IGFRKO mice. Results are mean ± SEM of 4 to 6 mice per group. *indicates a significant difference compared to the Control group (*, p<0.05; **, p<0.01; ***, p<0.001 ) A. Diabetes Page 48 of 50 Liver Muscle 10 15
5 10 Data 1 4000 0 5 *
Control
2DG uptake, 2DG (ng/mg) uptake, 2DG 2DG uptake, (ng/mg) -5 F-IRKO 0 3000 F-IR/IGFRKO
2000 B.
Leptin pg/ml Leptin 1000
0
Leptin 5 Leptin 12 Leptin 52
F-IRKO F-IR/IGFRKO
Supplemental Figure 11: A) Two deoxyglucose uptake in the liver and the muscle of control, F-IR and F-IR/IGFRKO mice. Results are mean ± SEM of 2 to 5 mice per group. . *indicates a significant difference compared to the Control group (*, p<0.05). B) Gross pictures of, F-IRKO and F-IR/IGFRKO mice after 12 weeks on HFD. Arrows point to areas of liver discoloration indicating parenchymal heterogeneity.
Page 49 of 50 Diabetes
Aldo b – Aldolase B For GCTGGGCAATTTCAGAGAGC Rev GAGGACTCTTCCCCTTTGCT Afp - Alpha fetoprotein For CAGCAGCCTGAGAGTCCATA Rev GGCGATGGGTGTTTAGAAAG αSma - alpha smooth muscle actin For GTTCAGTGGTGCCTCTGTCA Rev ACTGGGACGACATGGAAAAG Acc1 - Acetyl-CoA carboxylase 1 For AGCAGATCCGCAGCTTG Rev ACCTCTGCTCGCTGAGTGC CD11c For CACTCAGTGACTGCCCAAAA Rev CCTCAAGACAGGACATCGCT Col1a1 - Collagen, type I, alpha 1 For TTGATCCAGAAGGACCTTGTTTG Rev CCTCAGGGTATTGCTGGACAA cyclin D1 For GGGTGGGTTGGAAATGAAC Rev TCCTCTCCAAAATGCCAGAG Enol1 – Enolase 1 For AGATCGACCTCAACAGTGGG Rev CTTAACGCTCTCCTCGGTGT F4/80 For CTGGGATCCTACAGCTGCTC Rev AGGAGCCTGGTACATTGGTG Fas - Fatty acid synthase For CCTCAGCTTTAAACTCTCGGA Rev CAGACATGCTGTGGATCTGG Fbp1 - Fructose-bisphosphatase 1 For ACTTGATCCCCAGTCACATTG Rev CGATCAAAGCCATCTCGTCT FGF21 - Fibroblast grow th factor 21 For CTCCAGCAGCAGTTCTCTGA Rev CCTGGGTGTCAAAGCCTCTA G6Pase - Glucose 6-phosphatase For GTGTCCAGGACCCACCAATA Rev ACTGTGGGCATCAATCTCCT Pepck - Phosphoenolpyruvate carboxykinase For TGTCTTCACTGAGGTGCCAG Rev CTGGATGAAGTTTGATGCCC Pc - Pyruvate carboxylase For GGGATGCCCACCAGTCACT Rev CATAGGGCGCAATCTTTTTGA Pkm2 - Pyruvate kinase muscle isozyme For TGTGTTCCAGGAAGGTGTCA Rev GCTCTAGGTATCGCAGCAGG Scd1 - Stearoyl-CoA desaturase-1 Diabetes Page 50 of 50
For CAGCCGAGCCTTGTAAGTTC Rev GCTCTACACCTGCCTCTTCG Srebp1c - Sterol regulatory element-binding protein 1 For TGGTTGTTGATGAGCTGGAG Rev GGCTCTGGAACAGACACTGG Tnf-α - Tumor necrosis factor alpha For ACGGCATGGATCTCAAAGAC Rev AGATAGCAAATCGGCTGACG Tgf-β - Transforming grow th factor beta For AAGTTGGCATGGTAGCCCTT Rev GCCCTGGATACCAACTATTGC