DOCSLIB.ORG

Ep 2336315 A2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ep 2336315 A2 (19) TZZ ¥¥¥_ T (11) EP 2 336 315 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 22.06.2011 Bulletin 2011/25 C12N 15/10 (2006.01) C12Q 1/68 (2006.01) C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 10192717.6 (22) Date of filing: 01.12.2006 (84) Designated Contracting States: • Husemoen, Birgitte Nystrup AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 2500 Valby (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Dolberg, Johannes SK TR 1674 Copenhagen V (DK) Designated Extension States: • Jensen, Kim Birkebæk AL BA HR MK RS 2610 Rødovre (DK) • Petersen, Lene (30) Priority: 01.12.2005 DK 200501704 2100 Copenhagen Ø (DK) 02.12.2005 US 741490 P • Nørregaard-Madsen, Mads 3460 Birkerød (DK) (62) Document number(s) of the earlier application(s) in • Godskesen, Michael Anders accordance with Art. 76 EPC: 2950 Vedbæk (DK) 06818144.5 / 1 957 644 • Glad, Sanne Schrøder 2750 Ballerup (DK) (71) Applicant: Nuevolution A/S • Neve, Søren 2100 Copenhagen (DK) 2800 Lyngby (DK) • Thisted, Thomas (72) Inventors: 3600 Frederikssund (DK) • Franch, Thomas • Kronberg, Tine Titilola Akinleminu 3070 Snekkersten (DK) 3500 Værløse (DK) • Lundorf, Mikkel Dybro • Sams, Christian 4000 Roskilde (DK) 3500 Værløse (DK) • Jakobsen, Soren Nyboe • Felding, Jakob 2000 Frederiksberg (DK) 2920 Charlottenlund (DK) • Olsen, Eva Kampmann • Freskgård, Per-Ola 2730 Herlev (DK) 603 79 Norrkörping (SE) • Andersen, Anne Lee • Gouliaev, Alex Haahr 4100 Ringsted (DK) 3670 Veksø Sjælland (DK) • Holtmann, Anette • Pedersen, Henrik 2750 Ballerup (DK) 3540 Lynge (DK) • Hansen, Anders Holm 2400 Copenhagen NV (DK) (74) Representative: Aamand, Jesper L. et al • Sørensen, Anders Malling Hjerrild & Levin ApS 2860 Søborg (DK) Tuborg Boulevard 12 • Goldbech, Anne 2900 Hellerup (DK) 2200 Copenhagen N (DK) • De Leon, Daen Remarks: 2300 Copenhagen S (DK) •This application was filed on 26-11-2010 as a • Kaldor, Ditte Kivsmose divisional application to the application mentioned 2880 Bagsvaerd (DK) under INID code 62. • Sløk, Frank Abildgaard •Claims filed after the date of filing of the 3450 Allerød (DK) application/after the date of receipt of the divisional application (Rule 68(4) EPC). (54) Enzymatic encoding methods for efficient synthesis of large libraries (57) Disclosed is a method for obtaining a bifunction- al complex comprising a molecule linked to a single EP 2 336 315 A2 Printed by Jouve, 75001 PARIS (FR) (Cont. next page) EP 2 336 315 A2 stranded identifier oligonucleotide, wherein a nascent bi- reacted at the chemical reaction site with one or more functional complex comprising a chemical reaction site reactants, and b) reacted enzymatically at the priming and a priming site for enzymatic addition of a tag is a) site with one or more tag(s) identifying the reactant(s). 2 EP 2 336 315 A2 Description [0001] This application is a non-provisional of U.S. provisional application Serial No. 60/741,490 filed on December 2, 2005, which is hereby incorporated by reference in its entirety. All patent and non-patent references cited in U.S. 5 provisional application Serial No. 60/741,490, or in the present application, are also hereby incorporated by reference in their entirety. Technical Field of the Invention 10 [0002] The present invention relates to bifunctional complexes and methods for synthesising such complexes, as well as to methods for split-and-mix synthesis of different molecules each linked to a single stranded identifier oligonucleotide comprising a plurality of tags identifying the molecule and/or the chemical entities having participated in the synthesis of the molecule. The invention also relates to a method for generating a library of different bifunctional complexes and methods for selecting molecules and/or identifying molecules having a desirable property, such as affinity for a target 15 compound. Background of the Invention [0003] Synthesis methods known as split-and-mix, or split-and-recombine, are known and have been used for the 20 synthesis of different molecules. Split-and-mix methods for synthesising polypeptides and other biochemical polymers have been disclosed e.g. in US 5,723,598 directed to the generation of a library of bifunctional complexes comprising a polypeptide and an identifier oligonucleotide comprising tags in the form of a sequence of nucleotides identifying the amino acids which participated in the formation of the polypeptide. The methods are directed to chemical linkage of tags and do not disclose enzymatic linkage, such as ligation, of the nucleotide tags making up the identifier oligonucleotide. 25 [0004] WO 00/23458 discloses a split-and-mix method in which nucleic acid tags are involved in both molecule syn- thesis and molecule identification. [0005] WO 2004/039825 and WO 2005/058479 disclose split-and-mix methods wherein tags in the form of identifier oligonucleotides are linked enzymatically. The prior art methods do not disclose ligation of a double-stranded oligonu- cleotide substrate comprising a plurality of tags and complementary anti-tags at least partly hybridised to each other, 30 wherein said ligation results in the formation of an identifier oligonucleotide comprising a plurality of consecutive nucle- otides in the form of covalently linked tags, whereas the anti-tags of the double-stranded oligonucleotide substrate are not affected by the action of the ligase, i.e. no anti-tags become covalently linked as a result of the enzymatic ligation of the tag part of the double-stranded oligonucleotide substrate. [0006] Reference is also made to WO2006/053571 disclosing methods for molecule synthesis. 35 Summary of the Invention [0007] There is a need for improved methods for split-and-mix synthesis of libraries of small molecules for e.g. phar- maceutical and other purposes. The small molecules can initially be synthesised as part of a bifunctional complex further 40 comprising an identifier oligonucleotide identifying the reactants which have participated in the synthesis of the small molecule. [0008] The methods of the present invention employs a ligation step wherein the substrate for the ligase is in a double stranded form and wherein the substrate comprises a plurality of tags and at least one or more anti-tags wherein tags and anti-tag(s) is/are at least partly hybridised to each other. The tags are covalently linked as a result of the action of 45 an enzyme comprising a ligase activity on the double stranded substrate, but no anti-tags are covalently linked as a result of said ligase action. [0009] The method facilitates separation of ligated tags and discrete, non-ligated anti-tags because of the size and molecular weight difference between (i) the afore-mentioned single stranded identifier oligonucleotide comprising a plurality of covalently linked tags and (ii) discrete, non-ligated anti-tags. The identifier oligonucleotide comprising the 50 ligated tags will typically have a length at least about 3 times the length of the individual anti-tags. [0010] In one embodiment, the tags comprise a 5’ phosphate, or a variant ligatable reactive group, whereas anti-tags do not. Therefore, the growing bifunctional complex will comprise a covalently linked "top"- strand to which a number, such as one or more, of shorter and non-ligated anti-tag(s) is/are hybridised/annealed. This enables removal of anti-tag(s), e.g. after all tag additions have been performed (Fig. 1) or after each tag addition has been performed (Fig. 6). 55 [0011] Removal of anti-tags generally increases fidelity and allows extension after purification of the single-stranded oligonucleotide identifier comprising a plurality of ligated tags. Said extension makes possible the use of selection-specific sequences, which improves robustness towards contamination, which is a well-known phenomena when e.g. PCR amplifications are performed. Also, diversification-sequences can be used which diversifies otherwise undistinguishable 3 EP 2 336 315 A2 tag combinations. This makes it possible to identify tag combination sequences which may arise during PCR from a single tag combination. It is advantageous to identify such sequences as they may otherwise be interpreted as arising from several molecular entities containing the same tag combination, thus indicating that the specific tag combination corresponds to a small molecule with relatively high ability to be retained during subsequent selection procedures. 5 [0012] Also, because of the design of the tags, cross-hybridization between single stranded tags can be reduced or essentially eliminated. This greatly improves the purification process of the bifunctional complexes comprising single stranded identifier oligonucleotides following the synthesis reactions. One problem associated with purification of bi- functional complexes comprising double stranded identifier oligonucleotides is that such identifiers are prone to illegiti- mate hybridization when renaturing conditions are resumed following a purification process under denaturing conditions. 10 [0013] In order to achieve a minimum degree of cross-hybridization between tags in an identifier oligonucleotide, the tags can be designed using a computer algorithm to maximize or optimize the number of mismatches between any oligo pair, e.g. resulting in a minimum of seven mismatches between any two tag tags. This maximizes or optimize fidelity of hybridization and enables use of sorting methods, such as the ones disclosed e.g. in WO 00/23458 (Harbury). Moreover, it increases robustness of decoding by sequencing, e.g. the tag information can be decoded even if sequencing errors 15 occur. [0014] It is also possible to perform a quenching reaction with the reactants and tags. After reactant reactions resulting in the synthesis of the molecule, excess reactants are rendered unreactive, e.g., by adding a quencher in the form e.g. of a reactant which reacts with excess reactants, e.g. by raising pH, etc, or by removal of a reactant which is critical for the reaction, etc.
Load more

Recommended publications
  • Datasheet Blank Template
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . DIP2A (L-16): sc-67555 BACKGROUND APPLICATIONS DIP2A (Disco-interacting protein 2 homolog A), also known as DIP2, is a 1,571 DIP2A (L-16) is recommended for detection of DIP2A of human origin by amino acid nuclear protein. It is one of three human homologs (DIP2A, DIP2B Western Blotting (starting dilution 1:200, dilution range 1:100-1:1000), and DIP2C) of the Drosophila dip2 (disconnected-interacting protein 2) protein. immunoprecipitation [1-2 µg per 100-500 µg of total protein (1 ml of cell In Drosophila , dip2 interacts with disco, a protein required for neuronal con - lysate)], immunofluorescence (starting dilution 1:50, dilution range 1:50- nections in the visual systems of larvae and adults. The closest vertebrate 1:500) and solid phase ELISA (starting dilution 1:30, dilution range 1:30- homologs to disco are the basonuclin genes. In mice, DIP2 homologs show 1:3000). restricted expression to the brain. This suggests that, similar to the function DIP2A (L-16) is also recommended for detection of DIP2A, also designated of Drosphila dip2, vertebrate DIP2 homologs may play a role in the develop - Disco-interacting protein 2 homolog A, in additional species, including ment of the nervous system. Expressed ubiquitously with highest expression canine. in the brain, DIP2A is thought to function in signaling throughout the central nervous system by providing positional clues for axon patterning and pathfind - Suitable for use as control antibody for DIP2A siRNA (h): sc-62212, DIP2A ing . Four isoforms of DIP2A exist due to alternative splicing events.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • CRISPR Screening of Porcine Sgrna Library Identifies Host Factors
    ARTICLE https://doi.org/10.1038/s41467-020-18936-1 OPEN CRISPR screening of porcine sgRNA library identifies host factors associated with Japanese encephalitis virus replication Changzhi Zhao1,5, Hailong Liu1,5, Tianhe Xiao1,5, Zichang Wang1, Xiongwei Nie1, Xinyun Li1,2, Ping Qian2,3, Liuxing Qin3, Xiaosong Han1, Jinfu Zhang1, Jinxue Ruan1, Mengjin Zhu1,2, Yi-Liang Miao 1,2, Bo Zuo1,2, ✉ ✉ Kui Yang4, Shengsong Xie 1,2 & Shuhong Zhao 1,2 1234567890():,; Japanese encephalitis virus (JEV) is a mosquito-borne zoonotic flavivirus that causes ence- phalitis and reproductive disorders in mammalian species. However, the host factors critical for its entry, replication, and assembly are poorly understood. Here, we design a porcine genome-scale CRISPR/Cas9 knockout (PigGeCKO) library containing 85,674 single guide RNAs targeting 17,743 protein-coding genes, 11,053 long ncRNAs, and 551 microRNAs. Subsequently, we use the PigGeCKO library to identify key host factors facilitating JEV infection in porcine cells. Several previously unreported genes required for JEV infection are highly enriched post-JEV selection. We conduct follow-up studies to verify the dependency of JEV on these genes, and identify functional contributions for six of the many candidate JEV- related host genes, including EMC3 and CALR. Additionally, we identify that four genes associated with heparan sulfate proteoglycans (HSPGs) metabolism, specifically those responsible for HSPGs sulfurylation, facilitate JEV entry into porcine cells. Thus, beyond our development of the largest CRISPR-based functional genomic screening platform for pig research to date, this study identifies multiple potentially vulnerable targets for the devel- opment of medical and breeding technologies to treat and prevent diseases caused by JEV.
    [Show full text]
  • List of Genes Used in Cell Type Enrichment Analysis
    List of genes used in cell type enrichment analysis Metagene Cell type Immunity ADAM28 Activated B cell Adaptive CD180 Activated B cell Adaptive CD79B Activated B cell Adaptive BLK Activated B cell Adaptive CD19 Activated B cell Adaptive MS4A1 Activated B cell Adaptive TNFRSF17 Activated B cell Adaptive IGHM Activated B cell Adaptive GNG7 Activated B cell Adaptive MICAL3 Activated B cell Adaptive SPIB Activated B cell Adaptive HLA-DOB Activated B cell Adaptive IGKC Activated B cell Adaptive PNOC Activated B cell Adaptive FCRL2 Activated B cell Adaptive BACH2 Activated B cell Adaptive CR2 Activated B cell Adaptive TCL1A Activated B cell Adaptive AKNA Activated B cell Adaptive ARHGAP25 Activated B cell Adaptive CCL21 Activated B cell Adaptive CD27 Activated B cell Adaptive CD38 Activated B cell Adaptive CLEC17A Activated B cell Adaptive CLEC9A Activated B cell Adaptive CLECL1 Activated B cell Adaptive AIM2 Activated CD4 T cell Adaptive BIRC3 Activated CD4 T cell Adaptive BRIP1 Activated CD4 T cell Adaptive CCL20 Activated CD4 T cell Adaptive CCL4 Activated CD4 T cell Adaptive CCL5 Activated CD4 T cell Adaptive CCNB1 Activated CD4 T cell Adaptive CCR7 Activated CD4 T cell Adaptive DUSP2 Activated CD4 T cell Adaptive ESCO2 Activated CD4 T cell Adaptive ETS1 Activated CD4 T cell Adaptive EXO1 Activated CD4 T cell Adaptive EXOC6 Activated CD4 T cell Adaptive IARS Activated CD4 T cell Adaptive ITK Activated CD4 T cell Adaptive KIF11 Activated CD4 T cell Adaptive KNTC1 Activated CD4 T cell Adaptive NUF2 Activated CD4 T cell Adaptive PRC1 Activated
    [Show full text]
  • Markers of T Cell Senescence in Humans
    International Journal of Molecular Sciences Review Markers of T Cell Senescence in Humans Weili Xu 1,2 and Anis Larbi 1,2,3,4,5,* 1 Biology of Aging Program and Immunomonitoring Platform, Singapore Immunology Network (SIgN), Agency for Science Technology and Research (A*STAR), Immunos Building, Biopolis, Singapore 138648, Singapore; [email protected] 2 School of Biological Sciences, Nanyang Technological University, Singapore 637551, Singapore 3 Department of Microbiology, National University of Singapore, Singapore 117597, Singapore 4 Department of Geriatrics, Faculty of Medicine, University of Sherbrooke, Sherbrooke, QC J1K 2R1, Canada 5 Faculty of Sciences, University ElManar, Tunis 1068, Tunisia * Correspondence: [email protected]; Tel.: +65-6407-0412 Received: 31 May 2017; Accepted: 26 July 2017; Published: 10 August 2017 Abstract: Many countries are facing the aging of their population, and many more will face a similar obstacle in the near future, which could be a burden to many healthcare systems. Increased susceptibility to infections, cardiovascular and neurodegenerative disease, cancer as well as reduced efficacy of vaccination are important matters for researchers in the field of aging. As older adults show higher prevalence for a variety of diseases, this also implies higher risk of complications, including nosocomial infections, slower recovery and sequels that may reduce the autonomy and overall quality of life of older adults. The age-related effects on the immune system termed as “immunosenescence” can be exemplified by the reported hypo-responsiveness to influenza vaccination of the elderly. T cells, which belong to the adaptive arm of the immune system, have been extensively studied and the knowledge gathered enables a better understanding of how the immune system may be affected after acute/chronic infections and how this matters in the long run.
    [Show full text]
  • Enzymatic Encoding Methods for Efficient Synthesis Of
    (19) TZZ__T (11) EP 1 957 644 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/10 (2006.01) C12Q 1/68 (2006.01) 01.12.2010 Bulletin 2010/48 C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 06818144.5 (86) International application number: PCT/DK2006/000685 (22) Date of filing: 01.12.2006 (87) International publication number: WO 2007/062664 (07.06.2007 Gazette 2007/23) (54) ENZYMATIC ENCODING METHODS FOR EFFICIENT SYNTHESIS OF LARGE LIBRARIES ENZYMVERMITTELNDE KODIERUNGSMETHODEN FÜR EINE EFFIZIENTE SYNTHESE VON GROSSEN BIBLIOTHEKEN PROCEDES DE CODAGE ENZYMATIQUE DESTINES A LA SYNTHESE EFFICACE DE BIBLIOTHEQUES IMPORTANTES (84) Designated Contracting States: • GOLDBECH, Anne AT BE BG CH CY CZ DE DK EE ES FI FR GB GR DK-2200 Copenhagen N (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • DE LEON, Daen SK TR DK-2300 Copenhagen S (DK) Designated Extension States: • KALDOR, Ditte Kievsmose AL BA HR MK RS DK-2880 Bagsvaerd (DK) • SLØK, Frank Abilgaard (30) Priority: 01.12.2005 DK 200501704 DK-3450 Allerød (DK) 02.12.2005 US 741490 P • HUSEMOEN, Birgitte Nystrup DK-2500 Valby (DK) (43) Date of publication of application: • DOLBERG, Johannes 20.08.2008 Bulletin 2008/34 DK-1674 Copenhagen V (DK) • JENSEN, Kim Birkebæk (73) Proprietor: Nuevolution A/S DK-2610 Rødovre (DK) 2100 Copenhagen 0 (DK) • PETERSEN, Lene DK-2100 Copenhagen Ø (DK) (72) Inventors: • NØRREGAARD-MADSEN, Mads • FRANCH, Thomas DK-3460 Birkerød (DK) DK-3070 Snekkersten (DK) • GODSKESEN,
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • A Systematic Review on the Implications of O-Linked Glycan Branching and Truncating Enzymes on Cancer Progression and Metastasis
    cells Review A Systematic Review on the Implications of O-linked Glycan Branching and Truncating Enzymes on Cancer Progression and Metastasis 1, 1, 1 1,2,3, Rohitesh Gupta y, Frank Leon y, Sanchita Rauth , Surinder K. Batra * and Moorthy P. Ponnusamy 1,2,* 1 Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68105, USA; [email protected] (R.G.); [email protected] (F.L.); [email protected] (S.R.) 2 Fred and Pamela Buffett Cancer Center, Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, NE 681980-5900, USA 3 Department of Pathology and Microbiology, UNMC, Omaha, NE 68198-5900, USA * Correspondence: [email protected] (S.K.B.); [email protected] (M.P.P.); Tel.: +402-559-5455 (S.K.B.); +402-559-1170 (M.P.P.); Fax: +402-559-6650 (S.K.B. & M.P.P.) Equal contribution. y Received: 21 January 2020; Accepted: 12 February 2020; Published: 14 February 2020 Abstract: Glycosylation is the most commonly occurring post-translational modifications, and is believed to modify over 50% of all proteins. The process of glycan modification is directed by different glycosyltransferases, depending on the cell in which it is expressed. These small carbohydrate molecules consist of multiple glycan families that facilitate cell–cell interactions, protein interactions, and downstream signaling. An alteration of several types of O-glycan core structures have been implicated in multiple cancers, largely due to differential glycosyltransferase expression or activity. Consequently, aberrant O-linked glycosylation has been extensively demonstrated to affect biological function and protein integrity that directly result in cancer growth and progression of several diseases.
    [Show full text]
  • Oral Ambroxol Increases Brain Glucocerebrosidase Activity in a Nonhuman Primate
    Received: 17 November 2016 | Revised: 24 January 2017 | Accepted: 12 February 2017 DOI 10.1002/syn.21967 SHORT COMMUNICATION Oral ambroxol increases brain glucocerebrosidase activity in a nonhuman primate Anna Migdalska-Richards1 | Wai Kin D. Ko2 | Qin Li2,3 | Erwan Bezard2,3,4,5 | Anthony H. V. Schapira1 1Department of Clinical Neurosciences, Institute of Neurology, University College Abstract London, NW3 2PF, United Kingdom Mutations in the glucocerebrosidase 1 (GBA1) gene are related to both Parkinson disease (PD) and 2Motac Neuroscience, Manchester, United Gaucher disease (GD). In both cases, the condition is associated with deficiency of glucocerebrosi- Kingdom dase (GCase), the enzyme encoded by GBA1. Ambroxol is a small molecule chaperone that has 3 Institute of Laboratory Animal Sciences, been shown in mice to cross the blood-brain barrier, increase GCase activity and reduce alpha- China Academy of Medical Sciences, Beijing synuclein protein levels. In this study, we analyze the effect of ambroxol treatment on GCase City, People’s Republic of China activity in healthy nonhuman primates. We show that daily administration of ambroxol results in 4University de Bordeaux, Institut des Maladies Neurodeg en eratives, UMR 5293, increased brain GCase activity. Our work further indicates that ambroxol should be investigated as Bordeaux F-33000, France a novel therapy for both PD and neuronopathic GD in humans. 5CNRS, Institut des Maladies Neurodeg en eratives, UMR 5293, Bordeaux F-33000, France KEYWORDS Correspondence ambroxol, glucocerebrosidase,
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Characterization of Nudix Hydrolases: a Utilitarian
    CHARACTERIZATION OF NUDIX HYDROLASES: A UTILITARIAN SUPERFAMILY OF ENZYMES By Andres Hernandez de la Peña A dissertation submitted to the Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland August, 2015 Abstract The present work details the structural and enzymatic characterization of Nudix hydrolases from three different organisms – Bdellovibrio bacteriovorus, Mycobacterium tuberculosis, and Tetrahymena thermophila. Each of these Nudix enzymes presents unique questions about their physiological function within their organism which are answered with a combination of structural biology, genetic manipulation, enzyme kinetics, and a wide range of protein assays. We demonstrate that RenU, from M. tuberculosis, is part of Redox Homeostasis Control System (RHOCS), which senses and regulates NADH concentrations. This control systems involves two other proteins, the serine/threonine protein kinase G (pknG) and the L13 ribosomal subunits, without which the bacterium fails to evade lysosomal delivery and falls prey to the oxidative arsenal of the macrophage host. Bd-NDPSase, a Nudix enzyme encoded by the B. bacteriovorus gene BD3179, localizes to the periplasmic space of the bacterium and hydrolyses at least four nucleoside diphosphate sugars in vitro. Through atomic-resolution models from X-ray diffraction, we identified a motif that differentiates this hydrolase from the similar, but more substrate specific, ADP- ribose hydrolase from E. coli. Lastly, we show that Nud1p from T. thermophila is a member of the Ezl1p complex, the histone methyltransferase Polycomb Group homologue of this protozoan. With the use of in vitro enzymatic assays we show, in addition, that Nu1dp hydrolyses CoA preferentially over acetyl-CoA and other nucleoside derivatives.
    [Show full text]