DOCSLIB.ORG

Polymorphism in the Circumsporozoite Protein of the Human Malaria Parasite Plasmodium Vivax

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Polymorphism in the Circumsporozoite Protein of the Human Malaria Parasite Plasmodium Vivax Molecular and Biochemical Parasitology, 55 (1992) 105-114 105 © 1992 Elsevier Science Publishers B.V. All rights reserved. / 0166-6851/92/$05.00 MOLBIO 01809 Polymorphism in the circumsporozoite protein of the human malaria parasite Plasmodium vivax Shoukat H. Qari a, Ira F. Goldman a, Marinete M. Povoa b, Sylvia di Santi c, Michael P. Alpers d and Altaf A. Lal a aMalaria Branch, Division of Parasitic Diseases, National Center for Infectious Diseases, Centers for Disease Control, Public Health Services, U.S. Department of Health and Human Services, Atlanta GA, USA, bMalaria Program, lnstituto Evandra Chagas, Belem, Brazil; CMalaria Department, Sucen, S6,'o Paulo, Brazil and dPapua New Guinea Institute of Medical Research, Goroka, Papua New Guinea (Received 8 April 1992; accepted 12 June 1992) The circumsporozoite (CS) protein that covers the surface of infectious sporozoites is a candidate antigen in malaria vaccine development. To determine the extent of B- and T-epitope polymorphism and to understand the mechanisms of antigenic variability, we have characterized the CS protein gene of Plasmodium vivax from field isolates representing geographically distant regions of Papua New Guinea (PNG) and Brazil. In the central repeat region of the CS protein, in addition to variation in the number of repeats, an array of mutations was observed which suggests that point mutations have led to the emergence of the variant CS repeat sequence ANGA(G/D)(N/D)QPG from GDRA(D/A)GQPA. Outside the repeat region of the protein, the nonsilent nucleotide substitutions of independent origin are localized in three domains of the protein that either harbor known T-cell determinants or are analogous to the Plasmodium falciparum immunodominant determinants, Th2R and Th3R. We have found that, with the exception of one CS clone sequence that was shared by one P. vivax isolate each from PNG and Brazil, the P. vivax CS protein types can be grouped into Papuan and Brazilian types. These results suggest that an in-depth study of parasite population dynamics is required before field trials for vaccine formulations based on polymorphic immunodominant determinants are conducted. Key words: Plasmodium vivax; Circumsporozoite protein; Clonal typing; Epitope polymorphism Introduction formulations have been produced [8-16]. Vaccination with specific antigens or epi- In contrast to the progress towards vaccine topes offers the possibility of inducing immu- development against P. falciparum malaria nity against causative organisms of infectious parasite, for which several stage-specific vac- diseases. However, natural polymorphism in cine antigens have been characterized, studies the target determinants of the parasite proteins of P. vivax parasite antigens have been limited, may compromise the efficacy of a subunit partly because of the lack of in vitro culture cap- vaccine. Whether a vaccine is based on a ability. Only two vaccine candidate antigens of critically important antigen present only in a P. vivax have been characterized: the circum- single stage of the parasite or on a combination sporozoite (CS) protein and the blood-stage an- of important antigens present in several tigen, PV 200 [1-7]. Immune responses against different stages, failure to deal with antigenic the CS protein have been studied, and vaccine polymorphism could result in a vaccine that is unable to protect individuals exposed to a Correspondence address: Altaf A. Lal, Malaria Branch, Mail parasite with an antigenic variation. Therefore, Stop F 12, Centers for Disease Control, Atlanta, GA 30333, whether the vaccine is targeted against single USA. Tel: (404) 488 4079, Fax: (404) 488 4427. or multistage proteins, if a portion of a 106 parasite population can escape the effects of a Isolation and characterization of the circum- vaccine because of heritable polymorphism in sporozoite protein genes. As described earlier vaccine target antigens, the natural population [5], blood collected from patients infected with could rapidly evolve 'vaccine resistance' in a P. vivax was passed through a two-layer manner analogous to the development of drug column of acid-washed glass beads and CF resistance in malaria parasites. To ensure the 11 cellulose to remove leukocytes. Parasite efficacy of subunit vaccines based on poly- genomic DNA was isolated from infected morphic determinants, antigenic polymorph- erythrocytes, and 100 ng was used in a ism of malaria parasites must be studied at the polymerase chain reaction (PCR)-mediated population level. CS protein gene amplification. Oligonucleo- Polymorphism in the CS protein of P. tides AL60 (GTCGGAATTCATGAAGAA- falciparum has been shown to be restricted to CTTCATTCTC) and AL61 (CAGCGGA- the T-cell determinants [17-19]. However, TCCTTAATTGAATAATGCTAGG) corre- polymorphism in the CS protein of P. vivax, sponding to the terminal ends of the CS which was originally observed in the repetitive protein were used as amplification primers. B-cell determinant of the protein, has also been The PCR-generated fragments were digested recently found outside the repeat region [5]. with EcoRI and BamHI, cloned in Bluescript Variant P. vivax parasites from Thailand, plasmid, and transformed into Escherichia coli. Papua New Guinea (PNG) and Brazil have The repeat sequence of the recombinant CS the repeat sequence ANGAGNQPG, which clones was identified by DNA:oligonucleotide differs from the repetitive sequence duplex hybridization analysis using oligonu- GDRADGQPA of P. vivax CS proteins of cleotide probes ALl 14 (ATCAACCAGGAG- parasites analyzed earlier [4,5]. We and others CAAATG), and ALl l6 (GGTGATAGA- have subsequently shown that P. vivax para- GCAGATGGA) complementary to a portion sites with the variant B-epitope repeat se- of the repeat sequences ANGAGNQPG and quence have a wide geographic distribution GDRAAGQPA respectively. AL54 (CCATG- [5,20]. In continuation of our earlier studies of CAGTGTAACCTGTGGA) complementary the prevalence of CS proteins with the variant to the genus conserved CS region, R II was repeat sequence ANGAGNQPG in P. vivax also used. CS gene-specific primers were used field isolates from PNG and Brazil, we to determine the nucleotide sequence of the CS investigated: (1) nonsynonymous changes in gene by the dideoxynucleotide method [21]. the repeat region of P. vivax that result in the emergence of variant repeat sequences; (2) types of CS protein-bearing P. vivax parasites Results that predominate in PNG and Brazil; and (3) polymorphism outside the repeat region, in the On PCR-mediated amplification of the P. T-cell determinants, of the P. vivax CS protein. vivax CS protein gene amplification, genomic DNA extracted from blood samples of the patients from PNG and Brazil yielded DNA Materials and Methods fragments approximately 1.2 kb in length. We sequenced the CS protein genes of a total of Origin of P. vivax parasites. Microscopically 115 CS clones representing 15 isolates from confirmed P. vivax-infected blood was collec- PNG and 24 from Brazil. The entire sequence ted directly from individuals living in a high of a total of 13 CS clones representing 8 P. malaria-endemic region of PNG (Madang) in vivax isolates from Brazil and 3 clones March 1990 and from persons in relatively low representing 2 isolates from PNG was deter- malaria-endemic regions of Brazil (Paragami- mined. The CS genes of the remaining 102 P. nos and around Sao Paulo) between 1986 and vivax clones were sequenced to reveal sequen- 1990. ces outside the repeat regions and portions of 107 the central repeat sequences. Of the 115 CS remaining 11 clones had type 2 repeat clones, we have previously described the sequences, indicating that the variants coexist complete sequence of 4 CS genes (P19/D, P4/ within a single isolate. B, B7/4, and B 19/2) and the partial sequence of Similarly, polymorphism was noted in the another 20 CS clones [5]. For the purpose of repeat and nonrepeat regions of the P. vivax presentation, we are designating the CS protein from Brazil (Fig. 1). We sequenced GDRA(D/A)GQPA and ANGA(G/D)(N/ 8 clones from the B19 isolate, seven from the D)QPG CS protein repeats as type 1 and type B37, 6 each from the B5 and B10 isolates, 5 2 repeats, respectively. from the B7, 3 each from the B11, B15, B21, B31, B34, B40, and B43, and 2 clones from the Within-isolate polymorphism of the circum- B14, B20, B26, B30, B38, and B39. Like the sporozoite proteins. To determine the pre- mixed infection observed in the P19 isolate sence of parasite polymorphs among patients from PNG, isolates B7 and B 19 had both type from PNG, we sequenced 13 clones from the 1 and type 2 repeat sequence bearing parasites. P19 isolate, 10 clones from the P4 isolate, and However, no amino acid variation was noted 2 clones from each of the isolates P6, P7, P9, among 2-7 clones sequenced from each of the P10, P18, P25, P26, P72, and P73. A distinct 11 isolates from Brazil. variability in sequences was noted among the clones of P19, P4, P6, and P10 isolates; these Evolution of the repeat region of the circum- variations ranged from a change of a single sporozoite protein. Based on the nature of the amino acid residue to insertion of a stretch of non-synonymous changes, we have grouped amino acids (Fig. 1). The isolate P19 was a the repeat domain of the CS genes of P. vivax mixture of both type 1 and_type 2 CS repeat- into four categories (Fig. 2). The repeat bearing parasites; two clones, P19/L and P19/ sequences in rows 1-3 encode the type 1 CS M, had type 1 repeat sequences, while the repeat sequences, and the sequence in the RI Repeats RII Isolate CLOnes 13 .38 52 82 294 295 298 310 311 316 341 350 355 359 364 374 388 P19 9 L G q A Type 2 G D A T N K V A E L T G L 1 • ° • • ...
Load more

Recommended publications
  • Research Toward Vaccines Against Malaria
    © 1998 Nature Publishing Group http://www.nature.com/naturemedicine REVIEW Louis Miller (National Institute of Allergy and Infectious Diseases) and Stephen Hoffman (Naval Medical Research Institute) review progress toward developing malaria vaccines. They argue that multiple antigens from different stages may be needed to protect the diverse populations at risk, and that an optimal vaccine would Induce Immunity against all stages. Vaccines for African children, In whom the major mortality occurs, must induce immunity against ase,cual blood stages. Research toward vaccines against malaria Malaria is one of the major causes of the only stage of the life cycle that causes disease and death between the Tropic LOUIS H. MILLER1 disease. The stages before the asexual of Cancer and Tropic of Capricorn. & STEPHEN L. HOFFMAN2 blood stage are lumped together and Plasmodium falciparum has an especially called pre-erythrocytic. A small propor­ profound impact on infants and children in sub-Saharan Africa, tion of the asexual blood stages differentiate into sexual stages, where its effect on health is increasing as chloroquine resistance the gametocytes in red cells that infect mosquitoes; vaccines to spreads across the continent. We believe that vaccination the mosquito stages are called transmission-blocking vaccines. against P. falciparum is the intervention with the greatest poten­ The parasites' multistage life cycle and the fact that immune re­ tial to reduce malaria-associated severe morbidity and mortality sponses that recognize one stage often do not affect the next in areas with the most intense transmission and that it may do stage have made vaccine development for malaria more diffi­ so without necessarily preventing blood stage infection.
    [Show full text]
  • Unexpected Fold in the Circumsporozoite Protein Target of Malaria Vaccines
    Unexpected fold in the circumsporozoite protein target of malaria vaccines Michael B. Doud, Adem C. Koksal, Li-Zhi Mi, Gaojie Song, Chafen Lu, and Timothy A. Springer1 Immune Disease Institute, Children’s Hospital Boston and Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115 Contributed by Timothy A. Springer, April 4, 2012 (sent for review March 19, 2012) Circumsporozoite (CS) protein is the major surface component of Plas- The CS structures reveal a unique “αTSR” domain that is modium falciparum sporozoites and is essential for host cell invasion. related to TSR domains yet has unique features (Figs. 1 C and D A vaccine containing tandem repeats, region III, and thrombospondin and 2). Region III forms an integral part of the fold as a unique type-I repeat (TSR) of CS is efficacious in phase III trials but gives only amphipathic α-helix running orthogonally to the classic three- a 35% reduction in severe malaria in the first year postimmunization. stranded TSR homology region. This α1-helix, together with We solved crystal structures showing that region III and TSR fold into a “CS flap” (Fig. 1 C and D), decorates one face of the TSR asingleunit,an“αTSR” domain. The αTSR domain possesses a hydro- β-sheet (Fig. 2A). By packing against the β-sheet, the region III phobic pocket and core, missing in TSR domains. CS binds heparin, but α-helix gives the αTSR domain a hydrophobic core lacking in αTSR does not. Interestingly, polymorphic T-cell epitopes map to spe- TSR domains. A short linker containing a conserved hydro- cialized αTSR regions.
    [Show full text]
  • Professor Salimata Thurston Née Wade
    2010 Winner of AU-ECOWAS Women Scientists Award Life Sciences and Earth Professor Salimata Thurston née Wade Mrs. Salimata Thurston née Wade is a top-notch tenured Professor of Physiology and Human Nutrition at the Faculty of Sciences and Technology of Université Cheikh Anta Diop, Dakar (UCAD). She was Head of Department of Animal Biology of the FST, UCAD from 2004 to 2006 and currently serves as Director of the Nutrition Laboratory and is in charge of doctoral training at the Ecole Doctorale ED-SEV of UCAD. Born in Dakar, at the Médina, on 28 February 1951, Mrs. Wade completed her primary education in Dakar and continued with secondary education at the Lycée Carnot School for Young Girls later known as Lycée John F. Kennedy. She obtained her baccalauréat D with honours in 1972. She continued her education in France at the Université Paris 7 and specialized in Physiology and General Human Biology, with focus on Nutrition. In 1978, she joined INSERM’s prestigious Unit 1 for Research in Nutrition of the Bichat Hospital. Mrs Wade would spend 9 years there in order to carry out research, particularly on biological signs of malnutrition and effects of interplay between malnutrition and infection. In 1986, Mrs Wade defended her Doctoral thesis on the theme “Transthyretin (Prealbumine) and Thymuline (Zn-FTS) in Protein- Energy Malnutrition” at the Université Paris 7. She was awarded High Honours by the jury. She also underwent several internships in various laboratories, such as Dunn Nutrition Laboratory of the Medical Research Council (HNR) o f Cambridge, England in order to specialise in the measurement of energy expenditure in men and the use of stable isotopes in nutrition.
    [Show full text]
  • Based on the Circumsporozoite Protein Protein: a Case Study With
    Adjuvant-like Effect of Vaccinia Virus 14K Protein: A Case Study with Malaria Vaccine Based on the Circumsporozoite Protein This information is current as Aneesh Vijayan, Carmen E. Gómez, Diego A. Espinosa, of September 26, 2021. Alan G. Goodman, Lucas Sanchez-Sampedro, Carlos Oscar S. Sorzano, Fidel Zavala and Mariano Esteban J Immunol published online 21 May 2012 http://www.jimmunol.org/content/early/2012/05/21/jimmun ol.1102492 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2012/05/21/jimmunol.110249 Material 2.DC1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 26, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published May 21, 2012, doi:10.4049/jimmunol.1102492 The Journal of Immunology Adjuvant-like Effect of Vaccinia Virus 14K Protein: A Case Study with Malaria Vaccine Based on the Circumsporozoite Protein Aneesh Vijayan,* Carmen E. Go´mez,* Diego A.
    [Show full text]
  • Presence of a Circumsporozoite-Like Protein in Micronemes of Blood-Stage Merozoites of Malaria Parasites A.H
    Presence of a circumsporozoite-like protein in micronemes of blood-stage merozoites of malaria parasites A.H. Cochrane,1 S. Uni,2 M. Maracic,' L. di Giovanni,1 M. Aikawa,2 & R.S. Nussenzweig1 We demonstrate for the first time the presence of a circumsporozoite (CS)-like protein in invasive blood stages of malaria parasites. Immunogold electron microscopy using antisporozoite monoclonal antibodies localized these antigens in the micronemes of merozoites. Western immunoblot and two-dimensional gel electrophoresis of mature blood-stage extracts of Plasmodium falciparum, P. berghei, P. cynomolgi, and P. brasilianum identified polypeptides having the same apparent molecular mass and isoelectric points as the corresponding sporozoite (CS) proteins. The CS-like protein of merozoites is present in relatively minor amounts, compared to the CS protein of sporozoites. Mice with long-term P. berghei blood-induced infections develop antibodies which react with sporozoites. Introduction cursors have been demonstrated in the micronemes of Sporozoites are the invasive stage of plasmodia in- sporozoites (7). oculated into the vertebrate host by the bite of An- opheles mosquitos. Their surface membrane is covered Methods and results by the circumsporozoite (CS) protein which arises CS proteins, like the protective response they induce, from higher M, (relative molecular mass) precursors. have been considered to be stage specific (reviewed in All CS proteins contain an immunodominant region 1). In the present study, using antisporozoite mAbs we consisting of a single epitope which is tandemly re- have demonstrated, for the first time, the presence of peated and species specific. Monoclonal antibodies CS-like proteins in the micronemes of blood-stage (mAbs) directed against this repeat region inhibit merozoites of P.
    [Show full text]
  • A T-Cell Response to a Liver-Stage Plasmodium Antigen Is Not Boosted by Repeated Sporozoite Immunizations
    A T-cell response to a liver-stage Plasmodium antigen is not boosted by repeated sporozoite immunizations Sean C. Murphya, Arnold Kasb, Brad C. Stoneb, and Michael J. Bevanc,d,1 aDepartment of Laboratory Medicine, University of Washington Medical Center, Seattle, WA 98195; bBenaroya Research Institute, Seattle, WA 98101; and cDepartment of Immunology, and dThe Howard Hughes Medical Institute, University of Washington, Seattle, WA 98195 Contributed by Michael J. Bevan, March 1, 2013 (sent for review February 2, 2013) + Development of an antimalarial subunit vaccine inducing protective instead associated with antibodies and CD4 T-cell responses (21). cytotoxic T lymphocyte (CTL)-mediated immunity could pave the way Thus, CSP is an important but currently insufficient target for use for malaria eradication. Experimental immunization with sporozoites as a single-antigen vaccine. Because responses to non-CSP anti- induces this type of protective response, but the extremely large gens can protect in the absence of CSP-specific immunity in mice number of proteins expressed by Plasmodium parasites has so far (11, 22–25), we and others are working to discover novel protective prohibited the identification of sufficient discrete T-cell antigens to antigens to broaden the immune repertoire. develop subunit vaccines that produce sterile immunity. Here, using Single immunization using CPS or late-arresting GAP ap- mice singly immunized with Plasmodium yoelii sporozoites and high- proaches usually provides greater protection than an equivalent throughput screening, we identified a unique CTL response against number of RAS parasites (11, 26). RAS parasites arrest shortly after the parasite ribosomal L3 protein. Unlike CTL responses to the circum- hepatocyte infection, whereas GAPs progress further depending on sporozoite protein (CSP), the population of L3-specific CTLs was not the specific genetic lesion.
    [Show full text]
  • Apicomplexan Cytoskeleton and Motors: Key Regulators in Morphogenesis, Cell Division, Transport and Motility
    International Journal for Parasitology 39 (2009) 153–162 Contents lists available at ScienceDirect International Journal for Parasitology journal homepage: www.elsevier.com/locate/ijpara Invited Review Apicomplexan cytoskeleton and motors: Key regulators in morphogenesis, cell division, transport and motility Joana M. Santos a, Maryse Lebrun b, Wassim Daher a, Dominique Soldati a, Jean-Francois Dubremetz b,* a Department of Microbiology and Molecular Medicine, Faculty of Medicine–University of Geneva CMU, 1 rue Michel-Servet, 1211 Geneva 4, Switzerland b UMR CNRS 5235, Bt 24, CC 107 Université de Montpellier 2, Place Eugène Bataillon, 34095 Montpellier cedex 05, France article info abstract Article history: Protozoan parasites of the phylum Apicomplexa undergo a lytic cycle whereby a single zoite produced by Received 30 July 2008 the previous cycle has to encounter a host cell, invade it, multiply to differentiate into a new zoite gen- Received in revised form 13 October 2008 eration and escape to resume a new cycle. At every step of this lytic cycle, the cytoskeleton and/or the Accepted 16 October 2008 gliding motility apparatus play a crucial role and recent results have elucidated aspects of these pro- cesses, especially in terms of the molecular characterization and interaction of the increasing number of partners involved, and the signalling mechanisms implicated. The present review aims to summarize Keywords: the most recent findings in the field. Apicomplexa Ó 2008 Australian Society for Parasitology Inc. Published by Elsevier Ltd.
    [Show full text]
  • Role of Opsonophagocytosis in Immune Protection Against Malaria
    Review Role of Opsonophagocytosis in Immune Protection against Malaria Wolfgang W. Leitner 1, Megan Haraway 2, Tony Pierson 2 and Elke S. Bergmann-Leitner 2,* 1 Basic Immunology Branch, Division of Allergy, Immunology, and Transplantation/National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20852, USA; [email protected] 2 Immunology Core/Malaria Biologics Branch, Walter Reed Army Institute of Research, Silver Spring, MD 20910, USA; [email protected] (M.H.); [email protected] (T.P.) * Correspondence: [email protected]; Tel.: +1-301-319-9278 Received: 8 May 2020; Accepted: 26 May 2020; Published: 30 May 2020 Abstract: The quest for immune correlates of protection continues to slow vaccine development. Todate, only vaccine-induced antibodies have been confirmed as direct immune correlates of protection against a plethora of pathogens. Vaccine immunologists, however, have learned through extensive characterizations of humoral responses that the quantitative assessment of antibody responses alone often fails to correlate with protective immunity or vaccine efficacy. Despite these limitations, the simple measurement of post-vaccination antibody titers remains the most widely used approaches for vaccine evaluation. Developing and performing functional assays to assess the biological activity of pathogen-specific responses continues to gain momentum; integrating serological assessments with functional data will ultimately result in the identification of mechanisms that contribute to protective immunity and will guide vaccine development. One of these functional readouts is phagocytosis of antigenic material tagged by immune molecules such as antibodies and/or complement components. This review summarizes our current understanding of how phagocytosis contributes to immune defense against pathogens, the pathways involved, and defense mechanisms that pathogens have evolved to deal with the threat of phagocytic removal and destruction of pathogens.
    [Show full text]
  • The Selection of a Hepatocyte Cell Line Susceptible to Plasmodium Falciparum Sporozoite Invasion That Is Associated with Expression of Glypican-3
    fmicb-10-00127 February 27, 2019 Time: 13:2 # 1 ORIGINAL RESEARCH published: 28 February 2019 doi: 10.3389/fmicb.2019.00127 The Selection of a Hepatocyte Cell Line Susceptible to Plasmodium falciparum Sporozoite Invasion That Is Associated With Expression of Glypican-3 Rebecca E. Tweedell1,2, Dingyin Tao2†, Timothy Hamerly1,2†, Tanisha M. Robinson3†, Simon Larsen4, Alexander G. B. Grønning4, Alessandra M. Norris1, Jonas G. King2,5, Henry Chun Hin Law1, Jan Baumbach4,6‡, Elke S. Bergmann-Leitner3‡ and Rhoel R. Dinglasan1,2* 1 Department of Infectious Diseases and Immunology, Emerging Pathogens Institute, University of Florida, Gainesville, FL, Edited by: United States, 2 W. Harry Feinstone Department of Molecular Microbiology and Immunology, Johns Hopkins Malaria Celio Geraldo Freire-de-Lima, Research Institute, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD, United States, 3 Malaria Vaccine Universidade Federal do Rio Branch, Walter Reed Army Institute of Research, Silver Spring, MD, United States, 4 Computational BioMedicine Lab, de Janeiro, Brazil Department of Mathematics and Computer Science, University of Southern Denmark, Odense, Denmark, 5 Department Reviewed by: of Biochemistry, Molecular Biology, Entomology & Plant Pathology, Mississippi State University, Starkville, MS, United States, Rodrigo Andrés López-Muñoz, 6 Chair of Experimental Bioinformatics, TUM School of Life Sciences Weihenstephan, Technical University of Munich, Southern University of Chile, Chile Munich, Germany Miguel Prudêncio, University of Lisbon, Portugal In vitro studies of liver stage (LS) development of the human malaria parasite *Correspondence: Rhoel R. Dinglasan Plasmodium falciparum are technically challenging; therefore, fundamental questions [email protected]fl.edu about hepatocyte receptors for invasion that can be targeted to prevent infection remain †These authors have contributed unanswered.
    [Show full text]
  • Malaria Liver Stage Parasites Strategies for Immune Evasion and Host Modulation: Implication for Vaccine Design
    Open Access Austin Journal of Vaccines & Immunotherapeutics Mini Review Malaria Liver Stage Parasites Strategies for Immune Evasion and Host Modulation: Implication for Vaccine Design Dabbu Kumar Jaijyan1, Himanshu Singh1 and Agam Prasad Singh1* Abstract Infectious Diseases Laboratory, National Institute of Malaria is a devastating infectious disease caused by protozoan parasite Immunology, India of the genus Plasmodium. When an infected mosquito bites a vertebrate host *Corresponding author: Singh AP, National Institute it leaves a small number of sporozoites under the skin. Sporozoites from the of Immunology, Aruna Asaf Ali Marg, New Delhi-110067, site of bite, end up in lymph node or liver. In the lymph node these parasite India. Tel: (+91-11) 26703707; 26715032; Fax: +91-11- are degraded and act as source of antigen for the immune system. In liver, the 26717104; Email: [email protected] sporozoites invade into a hepatocyte and develop into mature schizonts. Liver stage parasites are able to evade host immune responses as well as modulate Received: July 19, 2014; Accepted: September 30, the various host pathways. Study of Plasmodium liver stage exportome may 2014; Published: October 16, 2014 provide valuable vaccine candidates and those with strong T cell epitope may be inducted into pre erythrocytic stage vaccine pipeline. Hepatocytes process and present foreign antigens on its surface hence some of the Plasmodium exported proteins are also likely presented on its surface similar to circumsporozoite protein. In terms of designing vaccine delivery system and the antigen load in liver, recent advances suggest that one need to deliver antigen in <20% of hepatocytes. Presence of antigen in large population of hepatocytes (>25%) leads to silencing of CTLs, which are no longer effective in killing the pathogens.
    [Show full text]
  • Evaluating Seroprevalence to Circumsporozoite Protein to Estimate Exposure to Three Species of Plasmodium in the Brazilian Amazo
    Pereira et al. Infectious Diseases of Poverty (2018) 7:46 https://doi.org/10.1186/s40249-018-0428-1 RESEARCH ARTICLE Open Access Evaluating seroprevalence to circumsporozoite protein to estimate exposure to three species of Plasmodium in the Brazilian Amazon Virginia Araujo Pereira1, Juan Camilo Sánchez-Arcila1, Mariana Pinheiro Alves Vasconcelos2, Amanda Ribeiro Ferreira1, Lorene de Souza Videira1, Antonio Teva3, Daiana Perce-da-Silva4, Maria Teresa Queiroz Marques5, Luzia Helena de Carvalho6, Dalma Maria Banic4, Luiz Cristóvão Sobrino Pôrto5 and Joseli Oliveira-Ferreira1* Abstract Background: Brazil has seen a great decline in malaria and the country is moving towards elimination. However, for eventual elimination, the control program needs efficient tools in order to monitor malaria exposure and transmission. In this study, we aimed to evaluate whether seroprevalence to the circumsporozoite protein (CSP) is a good tool for monitoring the exposure to and/or evaluating the burden and distribution of Plasmodium species in the Brazilian Amazon. Methods: Cross-sectional surveys were conducted in a rural area of Porto Velho, Rondônia state. Parasite infection was detected by microscopy and polymerase chain reaction. Antibodies to the sporozoite CSP repeats of Plasmodium vivax, P. falciparum,andP. malariae (PvCS, PfCS, and PmCS) were detected using the enzyme-linked immunosorbent assay technique. Human leukocyte antigen (HLA)-DRB1 and DQB1 genes were typed using Luminex® xMAP® technology. Results: The prevalence of immunoglobulin G against P. vivax CSP peptide (62%) was higher than P. falciparum (49%) and P. malariae (46%) CSP peptide. Most of the studied individuals had antibodies to at least one of the three peptides (72%), 34% had antibodies to all three peptides and 28% were non-responders.
    [Show full text]
  • The Role of Rhomboid Proteases and a Oocyst Capsule Protein
    THE ROLE OF RHOMBOID PROTEASES AND A OOCYST CAPSULE PROTEIN IN MALARIA PATHOGENESIS AND PARASITE DEVELOPMENT BY PRAKASH SRINIVASAN Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Thesis Advisor: Prof. Marcelo Jacobs-Lorena Department of Genetics CASE WESTERN RESERVE UNIVERSITY August, 2007 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of ______________________________________________________ candidate for the Ph.D. degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS Table of Contents 1 List of Tables 2 List of Figures 4 Acknowledgements 5 Abstract 7 CHAPTER 1: Introduction and Research Objectives 9 Introduction 10 Malaria: History and Facts 10 Discovery of Mosquitoes as vectors 10 Malaria: Life Cycle 12 Life cycle in the vertebrate host 12 Life cycle in the mosquito 15 Sporozoite invasion of the liver 29 Study of gene function in parasites 32 Research Objectives 34 CHAPTER 2: Analysis of Plasmodium and Anopheles Transcriptomes during Oocyst Differentiation 37 CHAPTER 3: PbCap380, a novel Plasmodium Oocyst Capsule Protein
    [Show full text]