DOCSLIB.ORG

Myosin 7B Is a Regulatory Long Noncoding RNA (Lncmyh7b) in the Human Heart

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Myosin 7B Is a Regulatory Long Noncoding RNA (Lncmyh7b) in the Human Heart bioRxiv preprint doi: https://doi.org/10.1101/2020.09.06.285189; this version posted September 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Myosin 7b is a regulatory long noncoding RNA (lncMYH7b) in the human heart Lindsey J. Broadwell1,2, Michael J. Smallegan2,3, Kevin M. Rigby4, Jose S. Navarro-Arriola3, Rusty L. Montgomery4, John L. Rinn1,2, Leslie A. Leinwand2,3* 1Dept of Biochemistry, CU Boulder 2Biofrontiers Institute, CU Boulder 3 Dept of Molecular, Cellular, and Developmental Biology, CU Boulder 4miRagen, Boulder, CO *Corresponding author: Leslie A. Leinwand E-mail: [email protected] Running title: Myosin 7b is a lncRNA in the heart. Keywords: Heart failure, myosin heavy chain (MyHC), myosin heavy chain 7b (MYH7b), alternative splicing, long noncoding RNA (lncRNA), gene regulation 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.06.285189; this version posted September 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. ABSTRACT disturbing the β-/α-MyHC ratio leads to compromised contractility in cardiomyocytes; in Myosin heavy chain 7b (MYH7b) is an ancient human heart failure, there is a shift to ~100% β- member of the myosin heavy chain motor protein MyHC and α-MyHC becomes undetectable (2–4, family that is expressed in striated muscles. In 7). As β-MyHC is the slower, more efficient motor, mammalian cardiac muscle, MYH7b RNA is this shift in expression is thought to be an initial expressed along with two other myosin heavy compensatory mechanism to preserve energy in the chains, b-myosin heavy chain (b-MyHC) and a- failing heart. Heart failure patients that show myosin heavy chain (a-MyHC). However, unlike functional improvement upon treatment with β- b-MyHC and a-MyHC which are maintained in a adrenergic receptor blockers have an increase in α- careful balance at the protein level, the MYH7b MyHC expression (4). This suggests that locus does not produce protein in the heart due to a maintenance of the β-MyHC/α-MyHC ratio is post-transcriptional exon-skipping mechanism that fundamental to proper cardiac function. occurs in a tissue specific manner. Whether this While MYH6 and MYH7 have been studied for locus has a role in the heart beyond producing its decades, MYH7b was not identified until the intronic microRNA, miR-499, was unclear. Using sequencing of the human genome and was initially cardiomyocytes derived from human induced annotated as a sarcomeric myosin based on pluripotent stem cells as a model system, we have sequence alignments with other known family found that the non-coding exon skipped RNA members (8). Based on phylogenetic analysis, (lncMYH7b) affects the transcriptional landscape MYH7b was identified as an ancient myosin, of the human heart, independent of miR-499. indicating that MYH7b was present before the gene Specifically, lncMYH7b regulates the ratio of b- duplication events that led to the other sarcomeric MyHC to a-MyHC, which is crucial for heart myosins (8). The human MYH7b gene is located on function. This regulation is likely achieved through chromosome 20, separate from the two canonical control of members of the TEA domain sarcomeric myosin clusters on chromosomes 14 transcription factor family (TEAD1 and TEAD3). (cardiac myosins) and 17 (skeletal muscle Therefore, we conclude that this ancient gene has myosins), supporting the idea that MYH7b may been repurposed by alternative splicing to produce have a specialized role in muscle biology (1, 8). In a regulatory long-noncoding RNA in the human certain species, including snakes and birds, MYH7b heart that affects the myosin composition of the is expressed as a typical sarcomeric myosin protein heart. in heart and skeletal muscle (9). However, MYH7b has a unique expression pattern in mammals: the INTRODUCTION encoded protein is restricted to specialized muscles and non-muscle tissues (10–12). Furthermore, The myosin family of motor proteins that drives while MYH7b RNA is expressed in mammalian striated muscle contraction consists of 10 genes cardiac and skeletal muscle, an alternative splicing with distinct functions(1). Three of these genes are event skips an exon, introducing a premature expressed in mammalian hearts (MYH6, MYH7, and termination codon (PTC) that prevents full-length MYH7b). MYH6 (α-MyHC) and MYH7 (β-MyHC) protein expression (Fig 1A) (10). This raises the are the major sarcomeric myosin proteins expressed question of why the MYH7b RNA expression has in mammalian hearts. In humans, >90% of the been conserved in mammals. One obvious heart’s myosin protein composition is comprised of hypothesis is that MYH7b transcription is preserved β-MyHC with the remaining <10% being α-MyHC in mammalian heart and skeletal muscle in order to and the two are antithetically regulated (1–5). maintain the expression of an MYH7b intronic However, various conditions can shift their relative microRNA, miR-499, in those tissues (10). proportions. The finely-tuned balance of these two However, miR-499 knockout mice have no motors is critical for proper cardiac function since discernible cardiac or skeletal muscle phenotype they have very different enzymatic properties (13). It’s possible that the species-specific which determine the contractile velocity of the regulation of myosin isoforms complicates the muscle (6). It has been well-established that interpretation of this mouse model and that miR- 499 could play an important role in human muscle 2 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.06.285189; this version posted September 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. (6, 14). Another hypothesis is that a heretofore MyHC and α-MyHC due to high sequence unknown functional molecule is expressed from the conservation in the myosin II family, these probes MYH7b gene, causing its conserved expression in were ranked according to how many mismatches sarcomeric muscle tissue. In this report, we they had with the other two transcripts. The top 29 performed a thorough dissection of this locus in were ordered from Integrated DNA Technologies order to discern the role of MYH7b gene expression and labeled with ATTO-550 dye using terminal in human cardiomyocytes and found a novel long deoxynucleotidyl transferase (TdT) as described in noncoding RNA (lncMYH7b) with roles in cardiac Gaspar et al 2017. Briefly, TdT was incubated with gene expression. 5-Propargylamino-ddUTP-ATTO-550 and an equimolar mix of the 29 probes at 37°C for 16 hrs, MATERIALS AND METHODS refreshing the TdT at 8 hrs. The labeled probes were then purified through ethanol precipitation. Cell Culture The WTC-11 iPSC line was used for all RNA-seq Matured cardiomyocytes were replated on plasma and FISH experiments. A small molecule cleaned coverslips coated in a GelTrex cushion. 48 differentiation protocol was followed (15). Wnt hrs after, the cardiomyocytes were washed three signaling was activated for 48 hrs using Chiron times with PBS, then fixed with 4% PFA for 10 99021 (GSK3 inhibitor) at 5 μM in RPMI base min at room temperature. After washing again, media with BSA and L-ascorbic acid. Wnt was coverslips were transferred to 70% ethanol and then inhibited for 48 hrs using Wnt-C59 at 2 μM kept at 4°C for at least 1 hr. The 70% ethanol was in the same base media. The media was then then removed and 1 mL Stellaris RNA FISH Wash switched to a B27 supplement with insulin in Buffer A (Biosearch Technologies Cat# SMF- RPMI for the remainder of the culture time. All WA1-60) with 10% deionized formamide for 5 cells were matured for 35 days before treatment min at room temperature. A humidifying chamber with ASO or virus. was assembled in a 15 cm tissue culture plate using a wet paper towel covered in Parafilm. For iCell Cardiomyocytes were purchased from each coverslip, 2 μL of the TdT-labeled probes Cellular Dynamics International (CMC-100-010- was added to 98 μL of Stellaris RNA FISH 001), cultured to manufacturer’s protocols, and Hybridization Buffer (Biosearch Technologies used for all qPCR experiments. qPCR probers Cat# SMF-HB1-10); 100 μL of this mixture was were purchased from Applied Biosystems and dotted onto the Parafilm in the humidifying performed according to manufacturer’s protocols. chamber. The chamber was sealed with Parafilm then left in the dark at 37 °C overnight. Coverslips ASO Treatment were then transferred back into a 12-well culture Matured cardiomyocytes were passively treated plate and washed twice with 1 mL Buffer A for 30 with either a scrambled (control) ASO or one min at 37°C, then in 1 mL Stellaris RNA FISH targeting MYH7b at 2 μM for 96 hrs. ASO was Wash Buffer B (Biosearch Technologies Cat# refreshed with media changes, every 48 hrs. ASO SMF-WB1-20) with Hoescht stain at 1:10,000 was manufactured and verified by miRagen dilution for 5 min at RT. Coverslips were then (sequence and chemistry proprietary). For the mounted using Vectashield anti-fade mounting kinetic study, iCell Cardiomyocytes were treated medium and sealed with clear nail polish. Cells with 10 uM ASO targeting MYH7b for indicated were imaged with a DeltaVision confocal timepoints.
Load more

Recommended publications
  • FLNC Missense Variants in Familial Noncompaction Cardiomyopathy
    Cardiogenetics 2019; volume 9:8181 FLNC missense variants than 2 according to current echocardio- in familial noncompaction graphic criteria, or 2.3 on CMR.1,2 Correspondence: Jaap I. van Waning, Approximately 10% of patients diagnosed Department of Clinical Genetics, EE 2038, cardiomyopathy with NCCM have concurrent congenital Erasmus MC, POB 2040, 3000CA Rotterdam, heart defects (CHD).3,4 the Netherlands. Tel.: +3107038388 - Fax: +3107043072. Jaap I. van Waning,1 In 30-40% of cases diagnosed with E-mail: [email protected] Yvonne M. Hoedemaekers,2 NCCM a pathogenic variant can be identi- 2,3 4 Wouter P. te Rijdt, Arne I. Jpma, fied. Around 80% of these pathogenic vari- Acknowledgements: JVW was supported by a Daphne Heijsman,4 Kadir Caliskan,5 ants involve the same sarcomere genes, that grant from the Jaap Schouten Foundation. Elke S. Hoendermis,6 are the major causes for hypertrophic car- WPTR was supported by a Young Talent Program (CVON PREDICT) grant 2017T001 Tineke P. Willems,7 diomyopathy (HCM) and dilated cardiomy- - Dutch Heart Foundation. 8 opathy (DCM), in particular MYH7, Arthur van den Wijngaard, 5,6 3 MYBPC3 and TTN. Filamin C (FLNC) Albert Suurmeijer, Conflict of interest: the authors declare no plays a central role in muscle functioning Marjon A. van Slegtenhorst,1 potential conflict of interest. by maintaining the structural integrity of the Jan D.H. Jongbloed,2 muscle fibers. Pathogenic variants in FLNC Received for publication: 20 March 2019. Danielle F. Majoor-Krakauer,1 2 were found to be associated with a wide Revision received: 29 July 2019. Paul A.
    [Show full text]
  • TEAD3 (NM 003214) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC210621 TEAD3 (NM_003214) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TEAD3 (NM_003214) Human Tagged ORF Clone Tag: Myc-DDK Symbol: TEAD3 Synonyms: DTEF-1; ETFR-1; TEAD-3; TEAD5; TEF-5; TEF5 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC210621 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATAGCGTCCAACAGCTGGAACGCCAGCAGCAGCCCCGGGGAGGCCCGGGAGGATGGGCCCGAGGGCCTGG ACAAGGGGCTGGACAACGATGCGGAGGGCGTGTGGAGCCCGGACATCGAGCAGAGCTTCCAGGAGGCCCT GGCCATCTACCCGCCCTGCGGCCGGCGGAAGATCATCCTGTCAGACGAGGGCAAGATGTACGGCCGAAAT GAGTTGATTGCACGCTATATTAAACTGAGGACGGGGAAGACTCGGACGAGAAAACAGGTGTCCAGCCACA TACAGGTTCTAGCTCGGAAGAAGGTGCGGGAGTACCAGGTTGGCATCAAGGCCATGAACCTGGACCAGGT CTCCAAGGACAAAGCCCTTCAGAGCATGGCGTCCATGTCCTCTGCCCAGATCGTCTCTGCCAGTGTCCTG CAGAACAAGTTCAGCCCACCTTCCCCTCTGCCCCAGGCCGTCTTCTCCACTTCCTCGCGGTTCTGGAGCA GCCCCCCTCTCCTGGGACAGCAGCCTGGACCCTCTCAGGACATCAAGCCCTTTGCACAGCCAGCCTACCC CATCCAGCCGCCCCTGCCGCCGACGCTCAGCAGTTATGAGCCCCTGGCCCCGCTCCCCTCAGCTGCTGCC TCTGTGCCTGTGTGGCAGGACCGTACCATTGCCTCCTCCCGGCTGCGGCTCCTGGAGTATTCAGCCTTCA TGGAGGTGCAGCGAGACCCTGACACGTACAGCAAACACCTGTTTGTGCACATCGGCCAGACGAACCCCGC CTTCTCAGACCCACCCCTGGAGGCAGTAGATGTGCGCCAGATCTATGACAAATTCCCCGAGAAAAAGGGA GGATTGAAGGAGCTCTATGAGAAGGGGCCCCCTAATGCCTTCTTCCTTGTCAAGTTCTGGGCCGACCTCA
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • I ABSTRACT KHAREL, PRAKASH, Ph.D., December 2018 Chemistry
    ABSTRACT KHAREL, PRAKASH, Ph.D., December 2018 Chemistry & Biochemistry RNA OXIDATION IN MULTIPLE SCLEROSIS NEURODEGENERATION (204 PP.) Dissertation advisor: Soumitra Basu An increase in the production of reactive oxygen species (ROS) and the inability of cellular machinery to adequately neutralize the ROS thus produced, lead the cells towards oxidative stress. ROS can damage all major classes of biomolecules including proteins, DNA and RNA. Recent findings show the evidence of high level of RNA oxidation in the neuronal cells of many neurological disorders suggesting a link between RNA oxidation and neurodegeneration. We have recently discovered the presence of extensive oxidative damage in the RNA molecules of neuronal cells in postmortem brains of multiple sclerosis (MS) patients. Working on the MS model system, we have established the identity of selectively oxidized mRNA molecules under MS microenvironment in human neuronal cells. Our study reveals that many of the mRNAs linked to various neurological pathways are selectively oxidized under oxidative stress. We have demonstrated the functional consequences of mRNA oxidation in two neuropathology related mRNAs (namely Nat8l and Nlrp3 mRNA). N-acetyl aspartate transferase 8 like protein (NAT8L) is a key trans-mitochondrial membrane protein that catalyzes the transfer of acetyl group from acetyl-CoA to aspartate to form N-acetyl aspartate (NAA) and transports NAA to neuronal cytoplasm. We have discovered that the oxidation in Nat8l mRNA molecule i results in the reduced expression of NAT8L enzyme. We also observed a reduced level of NAA present in the neuronal cells under oxidative stress. Using the neuronal tissue culture and MS animal model (cuprizone mouse model), we have established that a higher mRNA oxidation results in a reduced expression of NAT8L protein, which presumably contributes to the MS disease progression by weakening the myelin production machinery.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
    Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database.
    [Show full text]
  • A Rare Missense Mutation in MYH6 Confers High Risk of Coarctation of the Aorta
    bioRxiv preprint doi: https://doi.org/10.1101/180794; this version posted August 29, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A rare missense mutation in MYH6 confers high risk of coarctation of the aorta Thorsteinn Bjornsson1,12, Rosa B. Thorolfsdottir1,12, Gardar Sveinbjornsson1, Patrick Sulem1, Gudmundur L. Norddahl1, Anna Helgadottir1, Solveig Gretarsdottir1, Audur Magnusdottir1, Ragnar Danielsen2, Emil L. Sigurdsson3,4, Berglind Adalsteinsdottir5,6, Sverrir I. Gunnarsson7, Ingileif Jonsdottir1,6,8, David O. Arnar2,6, Hrodmar Helgason9, Tomas Gudbjartsson6,10, Daniel F. Gudbjartsson1,11, Unnur Thorsteinsdottir1,6, Hilma Holm1, Kari Stefansson1,6 1deCODE genetics/Amgen, Inc., Reykjavik, Iceland. 2Department of Medicine, Landspitali – The National University Hospital of Iceland, Reykjavik, Iceland. 3Department of Family Medicine, University of Iceland, Reykjavik, Iceland. 4Department of Development, Primary Health Care of the Capital Area, Reykjavik, Iceland. 5Department of Cardiology, Haukeland University Hospital, Bergen, Norway 6Faculty of Medicine, University of Iceland, Reykjavik, Iceland. 7Division of Cardiovascular Medicine, Department of Medicine, University of Wisconsin, Madison, WI, USA. 8Department of Immunology, Landspitali – The National University Hospital of Iceland, Reykjavik, Iceland. 9Children's Hospital, Landspitali – The National University Hospital of Iceland, Reykjavik, Iceland. 10Department of Cardiothoracic Surgery, Landspitali – The National University Hospital of Iceland, Reykjavik, Iceland. 11School of Engineering and Natural Sciences, University of Iceland, Reykjavik, Iceland. 12These authors contributed equally to this work. 1 bioRxiv preprint doi: https://doi.org/10.1101/180794; this version posted August 29, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Supplemental Material For
    Supplemental material for Epithelial to mesenchymal transition rewires the molecular path to PI3-Kinase-dependent proliferation Megan B. Salt1,2, Sourav Bandyopadhyay1,3 and Frank McCormick1 Authors Affiliations: 1-Helen Diller Family Comprehensive Cancer Center; 2-Biomedical Sciences Graduate Program, University of California San Francisco, San Francisco, California; 3-California Institute for Quantitative Biosciences, San Francisco, California. Supplemental Figure Legends Table S1. EMT associated changes in gene expression. Significantly (A) up- and (B) down- regulated genes in comparing H358-TwistER cells to control H358-GFP expressing cells treated with 100nM 4OHT for 12 days. The four columns on the right are associated with significantly upregulated genes, while the four columns furthest left described significantly downregulated genes. The first column for the up- and downregulated genes shows the Probe ID associated with each gene from the Affymetric Human Gene 1.0 ST microarrays. The gene name are shown in the next column, followed by the log2(fold change) in expression for each gene after 4OHT treatment in the H358-TwistER cells. The final column shows the p-value for each gene adjusted for the false discovery rate. Figure S1. Akt inhibition reduces serum-independent proliferation. (A) Proliferation of H358- TwistER cells with increasing concentrations (uM) of GSK-690693 (top) or MK-2206 (bottom). (B) Lysates from H358-TwistER cells treated for 48hrs in serum free media with indicated concentrations of GSK-690693 (top), or MK-2206 (bottom). Figure S2. The effects of TGFβ1 are specific to epithelial cells and lead to reduced serum- independent proliferation. (A) Proliferation of untreated (top) or TGFβ1 pre-treated (bottom) H358 and H441 cells in the presence (10%) or absence (SS) of serum.
    [Show full text]