DOCSLIB.ORG

Small Rnas Analysis in CLL Reveals a Deregulation of Mirna Expression and Novel Mirna Candidates of Putative Relevance in CLL Pathogenesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Small Rnas Analysis in CLL Reveals a Deregulation of Mirna Expression and Novel Mirna Candidates of Putative Relevance in CLL Pathogenesis Leukemia (2008) 22, 330–338 & 2008 Nature Publishing Group All rights reserved 0887-6924/08 $30.00 www.nature.com/leu ORIGINAL ARTICLE Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis S Marton1, MR Garcia1, C Robello2, H Persson3, F Trajtenberg4, O Pritsch5, C Rovira3, H Naya6, G Dighiero1 and A Cayota1 1Molecular Oncology Unit, Institut Pasteur, Montevideo, Uruguay; 2Molecular Biology Unit, Institut Pasteur, Montevideo, Uruguay; 3Department of Oncology, Lund University, Lund, Sweden; 4Structural Biology Unit, Institut Pasteur, Montevideo, Uruguay; 5Protein Biophysics Unit, Institut Pasteur, Montevideo, Uruguay and 6Bioinformatics Unit, Institut Pasteur, Montevideo, Uruguay MicroRNAs (miRNAs) are a novel class of small noncoding RNA useful to segregate patients into two main groups according to molecules that regulate gene expression by inducing degrada- the mutational status of the immunoglobulin heavy-chain tion or translational inhibition of target mRNAs. There are more variable-region gene (IgV ), the expression levels of the ZAP- than 500 miRNA genes reported in the human genome, H þ 8–11 constituting one of the largest classes of regulatory genes. 70 tyrosine kinase and CD38 expression, as well as the Increasing experimental evidence supports the idea of aberrant presence of cytogenetic abnormalities, such as 11q or 17p 12 miRNA expression in cancer pathogenesis. We analyzed the deletions. Patients with clones having unmutated (NM) IgVH pattern of miRNA expression in chronic lymphocytic leukemia genes or with high expression of either CD38 or ZAP-70 and/or (CLL) cells and our results showed a global reduction in miRNA 11q or 17p deletions have frequently a rapidly fatal course expression levels in CLL cells associated to a consistent despite aggressive therapy, whereas patients with mutated (M) underexpression of miR-181a, let-7a and miR-30d. We observed overexpression of miR-155 and a set of five miRNAs that are clones or low CD38 or ZAP-70 expression and no deleterious differentially expressed between patients with different clinical cytogenetic abnormalities have an indolent course and fre- outcomes. Five novel miRNA candidates cloned from leukemic quently die by unrelated diseases. Despite recent advances in cells are reported. Surprisingly, predicted mRNA targets for CLL biology the molecular mechanism involved in its initiation these novel miRNA revealed a high proportion of targets and progression remains elusive. Recently, a novel class of small located in a small region of chromosome 1, which is frequently noncoding RNAs dubbed microRNAs (miRNAs) have been altered in human cancer. Additionally, several targets were 13,14 shared by at least two of miRNA candidates. Predicted targets identified in plants and animals. Mature miRNAs of included several genes recently described as tumor suppres- 19–24 nt in length regulate target gene expression post- sors. These data could afford new avenues for exploring transcriptionally through base pairing within 30-UTR regions of innovative pathways in CLL biology and therapy. the target messenger RNAs inducing the degradation and/or Leukemia (2008) 22, 330–338; doi:10.1038/sj.leu.2405022; translational inhibition.13,15 Although the biological functions of published online 8 November 2007 miRNAs are not yet fully understood, it has been demonstrated Keywords: CLL; microRNA; gene expression that they participate in the regulation of developmental timing, cell death, cell proliferation, fat metabolism, hematopoiesis and patterning of the nervous system.16 The finding that more than Introduction half of the known human miRNAs are located at cancer- associated regions of the genome suggested that miRNAs might play a broad role in cancer pathogenesis.17 Consistent with this B-chronic lymphocytic leukemia (CLL), the commonest leuke- 1 notion is the observed aberrant expression of miRNAs in diverse mia of Western countries is characterized by elevated numbers cancer subtypes, including Burkitt’s lymphoma,18 colorectal of circulating clonal leukemic B cells. It was classically cancer,19 lung cancer,20 breast cancer21 and glioblastoma.22 considered as resulting from accumulation of minimally self- 2,3 Increasing experimental evidence implicates miRNAs either as renewing B cells as a consequence of defective apoptosis. oncogenes or tumor suppressors.23–26 Recently, two different Most peripheral CLL cells are typically in G /G tending to be 0 1 strategies were used to profile miRNA expression in CLL.27,28 By kinetically resting, phenotypically activated and functionally a microarray approach a specific expression signature consisting anergic with reduced levels of the B-cell antigen receptor of 13 miRNAs, including miR-15a and miR-16, was associated components IgM, IgD and CD79b with most malignant B cells with relevant prognostic factors.29 Following the report of bcl-2 over expressing the antiapoptotic B-cell lymphoma 2 (Bcl-2) 30 4–6 as a physiological target of these two miRNAs, a role of miR- protein. However, recent evidence indicates that CLL is not a 15a and miR-16 in CLL pathogenesis was also proposed through static disease that results simply from accumulation of long-lived the upregulation of bcl-2. However, recent reports revealed that lymphocytes, but as a dynamic process in which cells proliferate 7 significant reduction in miR-15 and/or miR-16 expression levels and die, often at appreciable levels. CLL shows a highly in CLL was not paralleled by any significant change in bcl-2.28 variable clinical course spanning from rapidly aggressive to 5 In another recent study using a cloning-based strategy, the completely indolent behaviors. Several biological markers have aberrant expression profile of miRNAs in CLL showed that miR- been described that can predict the clinical course and are 21, miR-150 and miR-155 were significantly overexpressed.28 Microarray methods are powerful for global analysis but they Correspondence: Dr A Cayota, Molecular Oncology Unit, Institut have technical limitations when used with miRNAs due to their Pasteur, Mataojo 2020, Montevideo CP 11400, Uruguay. E-mail: [email protected] short size and the sequence similarity between family members. Received 29 August 2007; accepted 8 October 2007; published Additionally and most importantly, microarray studies are online 8 November 2007 directed toward reported miRNAs, excluding the analysis of MicroRNAs and CLL pathogenesis S Marton et al 331 unannotated candidates. Therefore, to gain insight into the role verify equal loading. The RNA was electrophoretically trans- of miRNAs in CLL, we used a cloning-based approach ferred to GeneScreen Plus (Schleicher and Schuell, NH, USA). combined with stringent northern blot assays to study small After transfer, membranes were cross-linked with 120 mJ of UV RNAs from CLL patients. Our results show the global fluctuation (Stratagene, GE Healthcare, Buenos Aires, Argentina) and baked of miRNA expression levels in CLL cells compared to normal B at 80 1C for 1 h. Oligonucleotide probes were generated by T4 cells and the identification of five novel miRNA candidates from polynucleotide kinase-mediated end labeling (New England CLL cells. The observed changes are associated with significant Biolabs, Beverly, MA, USA) using [32P]g-ATP (end-labeling overexpression of miR-155 in combination with a reduction of grade, 47000 Ci mmolÀ1; MP Biomedicals, Illkirch, Strasbourg, miR-181a, let-7a and miR-30d. Notably, the differential profile France) and were purified from unincorporated label with G-25 of miRNA expression is associated with molecular prognostic microspin columns. Filters were prehybridized at 40 1Cin factors and clinical course in CLL. modified Church’s buffer (5% sodium dodecyl sulfate (SDS), 0.5% nonfat dry milk, 1 mM EDTA in sodium phosphate buffer 0.25 M, pH 7.2). After prehybridization for 2 h, radiolabeled- Materials and methods specific probes were added and further incubated for 1 h. Membranes were washed twice at 42 1C with 2 Â sodium B-lymphocyte purification from CLL patients and chloride/sodium citrate buffer (SSC) 0.1% SDS for 20 min, 1 Â healthy donors SSC 0.1% SDS for 20 min and 0.5 Â SSC 0.1% SDS for 20 min. Samples from CLL patients and healthy donors were provided by The hybridized membranes were exposed overnight to Kodak the Hematology and Bone Marrow Transplantation Unit of the Biomax MS X-ray films. Hybridized probes were stripped from Hospital Maciel (Montevideo, Uruguay) and by the National blots by washing twice in hot 0.1% SDS in deionized water for Blood Bank, (Montevideo, Uruguay), respectively, after obtain- 15 min and reprobed up to three times. ing informed consent according to locally approved regulations. Peripheral blood mononuclear cells (PBMCs) were isolated by centrifugation over a Ficoll–Metrizoate density gradient from peripheral venous blood samples. CLL lymphocytes were further Real-time RT-PCR analysis of precursor miRNAs purified from PBMCs by negative selection using magnetic For cDNA synthesis 1 mg of total RNA was reverse transcribed beads (Dynabeads, Invitrogen, Montevideo, Uruguay) coated with Superscript II reverse transcriptase (Invitrogen) using with MoAbs according to the manufacturer’s instructions, random hexamers (Invitrogen) to prime first-strand synthesis resulting in an enriched population containing more than 95% under conditions suggested by manufacturers. Quantitative PCR CD5 þ B cells. Samples from CLL patients were segregated (qPCR) was perfomed in a LightCycler 2.0 System (Roche according to the mutational status of IgVH genes, into NM and M Applied Science, Meylan, Grenoble, France) using 1 ml of cDNA groups. in 20 ml reaction volume with 0.4 mM of each specific primer and 2 mlof10Â FastStar DNA Master SYBR Green I (Roche Molecular Biochemicals, Meylan, Grenoble, France) according Cloning of small RNAs to the manufacturer’s instructions. Primers were designed Cloning of small RNAs was performed from pooled samples according to the flanking sequences of mature miRNAs (pre- belonging to three different patients corresponding respectively miRNAs), which amplify pre-miRNAs as well as primary to the NM and the M groups as defined above.
Load more

Recommended publications
  • Hes5 Regulates the Transition Timing of Neurogenesis and Gliogenesis In
    © 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 3156-3167 doi:10.1242/dev.147256 RESEARCH ARTICLE Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development Shama Bansod1,2, Ryoichiro Kageyama1,2,3,4 and Toshiyuki Ohtsuka1,2,3,* ABSTRACT has been reported that the high mobility group AT-hook (Hgma) During mammalian neocortical development, neural stem/progenitor genes regulate gene expression by modulating chromatin structure cells (NSCs) sequentially give rise to deep layer neurons and (Ozturk et al., 2014), maintain neurogenic NSCs, and inhibit superficial layer neurons through mid- to late-embryonic stages, gliogenesis during early- to mid-embryonic stages through global shifting to gliogenic phase at perinatal stages. Previously, we found opening of the chromatin state (Kishi et al., 2012). However, the that the Hes genes inhibit neuronal differentiation and maintain mechanism by which the expression of these epigenetic factors is NSCs. Here, we generated transgenic mice that overexpress Hes5 in controlled remains to be analyzed. NSCs of the central nervous system, and found that the transition Here, we found that Hes5, a transcriptional repressor acting timing from deep to superficial layer neurogenesis was shifted earlier, as an effector of Notch signaling, regulates the timing of while gliogenesis precociously occurred in the developing neocortex neurogenesis and gliogenesis via alteration in the expression of Hes5-overexpressing mice. By contrast, the transition from deep to levels of epigenetic factors. Notch signaling contributes to the superficial layer neurogenesis and the onset of gliogenesis were elaboration of cellular diversity during the development of various delayed in Hes5 knockout (KO) mice.
    [Show full text]
  • STAT3-Ser/Hes3 Signaling: a New Molecular Component of the Neuroendocrine System?
    Review 77 STAT3-Ser/Hes3 Signaling: A New Molecular Component of the Neuroendocrine System? Authors P. Nikolakopoulou1, S. W. Poser1, J. Masjkur1, M. Fernandez Rubin de Celis1, L. Toutouna1, C. L. Andoniadou2, R. D. McKay3, G. Chrousos4, M. Ehrhart-Bornstein1, S. R. Bornstein1, A. Androutsellis-Theotokis1, 5, 6 Affiliations Affiliation addresses are listed at the end of the article Key words Abstract evidence suggests that a common non-canonical ●▶ STAT3 ▼ signaling pathway regulates adult progenitors in ●▶ Hes3 The endocrine system involves communication several different tissues, rendering it as a poten- ▶ stem cells ● among different tissues in distinct organs, includ- tially valuable starting point to explore their ing the pancreas and components of the Hypo- biology. The STAT3-Ser/Hes3 Signaling Axis was thalamic-Pituitary-Adrenal Axis. The molecular first identified as a major regulator of neural mechanisms underlying these complex interac- stem cells and, subsequently, cancer stem cells. In tions are a subject of intense study as they may the endocrine/neuroendocrine system, this path- hold clues for the progression and treatment of a way operates on several levels, regulating other variety of metabolic and degenerative diseases. A types of plastic cells: (a) it regulates pancreatic plethora of signaling pathways, activated by hor- islet cell function and insulin release; (b) insulin mones and other endocrine factors have been in turn activates the pathway in broadly distrib- implicated in this communication. Recent uted neural progenitors and possibly also hypo- advances in the stem cell field introduce a new thalamic tanycytes, cells with important roles in level of complexity: adult progenitor cells appear the control of the adrenal gland; (c) adrenal pro- to utilize distinct signaling pathways than the genitors themselves operate this pathway.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • Supplemental Table 1. Complete Gene Lists and GO Terms from Figure 3C
    Supplemental Table 1. Complete gene lists and GO terms from Figure 3C. Path 1 Genes: RP11-34P13.15, RP4-758J18.10, VWA1, CHD5, AZIN2, FOXO6, RP11-403I13.8, ARHGAP30, RGS4, LRRN2, RASSF5, SERTAD4, GJC2, RHOU, REEP1, FOXI3, SH3RF3, COL4A4, ZDHHC23, FGFR3, PPP2R2C, CTD-2031P19.4, RNF182, GRM4, PRR15, DGKI, CHMP4C, CALB1, SPAG1, KLF4, ENG, RET, GDF10, ADAMTS14, SPOCK2, MBL1P, ADAM8, LRP4-AS1, CARNS1, DGAT2, CRYAB, AP000783.1, OPCML, PLEKHG6, GDF3, EMP1, RASSF9, FAM101A, STON2, GREM1, ACTC1, CORO2B, FURIN, WFIKKN1, BAIAP3, TMC5, HS3ST4, ZFHX3, NLRP1, RASD1, CACNG4, EMILIN2, L3MBTL4, KLHL14, HMSD, RP11-849I19.1, SALL3, GADD45B, KANK3, CTC- 526N19.1, ZNF888, MMP9, BMP7, PIK3IP1, MCHR1, SYTL5, CAMK2N1, PINK1, ID3, PTPRU, MANEAL, MCOLN3, LRRC8C, NTNG1, KCNC4, RP11, 430C7.5, C1orf95, ID2-AS1, ID2, GDF7, KCNG3, RGPD8, PSD4, CCDC74B, BMPR2, KAT2B, LINC00693, ZNF654, FILIP1L, SH3TC1, CPEB2, NPFFR2, TRPC3, RP11-752L20.3, FAM198B, TLL1, CDH9, PDZD2, CHSY3, GALNT10, FOXQ1, ATXN1, ID4, COL11A2, CNR1, GTF2IP4, FZD1, PAX5, RP11-35N6.1, UNC5B, NKX1-2, FAM196A, EBF3, PRRG4, LRP4, SYT7, PLBD1, GRASP, ALX1, HIP1R, LPAR6, SLITRK6, C16orf89, RP11-491F9.1, MMP2, B3GNT9, NXPH3, TNRC6C-AS1, LDLRAD4, NOL4, SMAD7, HCN2, PDE4A, KANK2, SAMD1, EXOC3L2, IL11, EMILIN3, KCNB1, DOK5, EEF1A2, A4GALT, ADGRG2, ELF4, ABCD1 Term Count % PValue Genes regulation of pathway-restricted GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, SMAD protein phosphorylation 9 6.34 1.31E-08 ENG pathway-restricted SMAD protein GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, phosphorylation
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Analysis of Molecular Mechanisms in Intestinal Stem Cells and Colorectal
    JENNY HÖGSTRÖM-STAKEM Analysis of Molecular Pathways in Intestinal Stem Cells and Colorectal Cancer Progression JENNY HÖGSTRÖM-STAKEM Analysis of Molecular Pathways in Recent Publications in this Series 67/2018 Lasse Karhu Computational Analysis of Orexin Receptors and Their Interactions with Natural and Synthetic Ligands 68/2018 Hanna Pitkänen Alterations and Impact of Thrombin Generation and Clot Formation in Solvent/Detergent Plasma, FXIII Deficiency and Lysinuric Protein Intolerance DISSERTATIONES SCHOLAE DOCTORALIS AD SANITATEM INVESTIGANDAM 69/2018 Riikka Havunen UNIVERSITATIS HELSINKIENSIS 87/2018 Enhancing Adoptive Cell Therapy of Solid Tumours with Armed Oncolytic Adenoviruses 70/2018 Patrick Penttilä Novel Biomarkers in Metastatic Renal Cell Carcinoma 71/2018 Jaakko Keinänen Metabolic Changes, Inflammation and Mortality in Psychotic Disorders 72/2018 Heidi Marjonen JENNY HÖGSTRÖM-STAKEM Effects of Prenatal Alcohol Exposure on the Epigenome, Gene Expression and Development 73/2018 Dyah Listyarifah The Role of the Oral Spirochete Treponema denticola in Periodontitis and Orodigestive Analysis of Molecular Pathways in Intestinal Stem Carcinogenesis Cells and Colorectal Cancer Progression 74/2018 Teija-Kaisa Aholaakko Intraoperative Aseptic Practices and Surgical Site Infections in Breast Surgery 75/2018 Cecilia Anna Brunello Tau Pathology: Secretion and Internalization as the Key for Understanding Protein Propagation 76/2018 Niko M. Perttilä Exercise and Falls among Frail Older People – Special Focus on People with Dementia 77/2018
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]