Small Rnas Analysis in CLL Reveals a Deregulation of Mirna Expression and Novel Mirna Candidates of Putative Relevance in CLL Pathogenesis

Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis

S Marton1, MR Garcia1, C Robello2, H Persson3, F Trajtenberg4, O Pritsch5, C Rovira3, H Naya6, G Dighiero1 and A Cayota1

1Molecular Oncology Unit, Institut Pasteur, Montevideo, Uruguay; 2Molecular Biology Unit, Institut Pasteur, Montevideo, Uruguay; 3Department of Oncology, Lund University, Lund, Sweden; 4Structural Biology Unit, Institut Pasteur, Montevideo, Uruguay; 5Protein Biophysics Unit, Institut Pasteur, Montevideo, Uruguay and 6Bioinformatics Unit, Institut Pasteur, Montevideo, Uruguay

MicroRNAs (miRNAs) are a novel class of small noncoding RNA useful to segregate patients into two main groups according to molecules that regulate gene expression by inducing degrada- the mutational status of the immunoglobulin heavy-chain tion or translational inhibition of target mRNAs. There are more variable-region gene (IgV ), the expression levels of the ZAP- than 500 miRNA genes reported in the human genome, H þ 8–11 constituting one of the largest classes of regulatory genes. 70 tyrosine kinase and CD38 expression, as well as the Increasing experimental evidence supports the idea of aberrant presence of cytogenetic abnormalities, such as 11q or 17p 12 miRNA expression in cancer pathogenesis. We analyzed the deletions. Patients with clones having unmutated (NM) IgVH pattern of miRNA expression in chronic lymphocytic leukemia genes or with high expression of either CD38 or ZAP-70 and/or (CLL) cells and our results showed a global reduction in miRNA 11q or 17p deletions have frequently a rapidly fatal course expression levels in CLL cells associated to a consistent despite aggressive therapy, whereas patients with mutated (M) underexpression of miR-181a, let-7a and miR-30d. We observed overexpression of miR-155 and a set of five miRNAs that are clones or low CD38 or ZAP-70 expression and no deleterious differentially expressed between patients with different clinical cytogenetic abnormalities have an indolent course and fre- outcomes. Five novel miRNA candidates cloned from leukemic quently die by unrelated diseases. Despite recent advances in cells are reported. Surprisingly, predicted mRNA targets for CLL biology the molecular mechanism involved in its initiation these novel miRNA revealed a high proportion of targets and progression remains elusive. Recently, a novel class of small located in a small region of chromosome 1, which is frequently noncoding RNAs dubbed microRNAs (miRNAs) have been altered in human cancer. Additionally, several targets were 13,14 shared by at least two of miRNA candidates. Predicted targets identified in plants and animals. Mature miRNAs of included several genes recently described as tumor suppres- 19–24 nt in length regulate target gene expression post- sors. These data could afford new avenues for exploring transcriptionally through base pairing within 30-UTR regions of innovative pathways in CLL biology and therapy. the target messenger RNAs inducing the degradation and/or Leukemia (2008) 22, 330–338; doi:10.1038/sj.leu.2405022; translational inhibition.13,15 Although the biological functions of published online 8 November 2007 miRNAs are not yet fully understood, it has been demonstrated Keywords: CLL; microRNA; gene expression that they participate in the regulation of developmental timing, cell death, cell proliferation, fat metabolism, hematopoiesis and patterning of the nervous system.16 The finding that more than Introduction half of the known human miRNAs are located at cancer- associated regions of the genome suggested that miRNAs might play a broad role in cancer pathogenesis.17 Consistent with this B-chronic lymphocytic leukemia (CLL), the commonest leuke- 1 notion is the observed aberrant expression of miRNAs in diverse mia of Western countries is characterized by elevated numbers cancer subtypes, including Burkitt’s lymphoma,18 colorectal of circulating clonal leukemic B cells. It was classically cancer,19 lung cancer,20 breast cancer21 and glioblastoma.22 considered as resulting from accumulation of minimally self- 2,3 Increasing experimental evidence implicates miRNAs either as renewing B cells as a consequence of defective apoptosis. oncogenes or tumor suppressors.23–26 Recently, two different Most peripheral CLL cells are typically in G /G tending to be 0 1 strategies were used to profile miRNA expression in CLL.27,28 By kinetically resting, phenotypically activated and functionally a microarray approach a specific expression signature consisting anergic with reduced levels of the B-cell antigen receptor of 13 miRNAs, including miR-15a and miR-16, was associated components IgM, IgD and CD79b with most malignant B cells with relevant prognostic factors.29 Following the report of bcl-2 over expressing the antiapoptotic B-cell lymphoma 2 (Bcl-2) 30 4–6 as a physiological target of these two miRNAs, a role of miR- protein. However, recent evidence indicates that CLL is not a 15a and miR-16 in CLL pathogenesis was also proposed through static disease that results simply from accumulation of long-lived the upregulation of bcl-2. However, recent reports revealed that lymphocytes, but as a dynamic process in which cells proliferate 7 significant reduction in miR-15 and/or miR-16 expression levels and die, often at appreciable levels. CLL shows a highly in CLL was not paralleled by any significant change in bcl-2.28 variable clinical course spanning from rapidly aggressive to 5 In another recent study using a cloning-based strategy, the completely indolent behaviors. Several biological markers have aberrant expression profile of miRNAs in CLL showed that miR- been described that can predict the clinical course and are 21, miR-150 and miR-155 were significantly overexpressed.28 Microarray methods are powerful for global analysis but they Correspondence: Dr A Cayota, Molecular Oncology Unit, Institut have technical limitations when used with miRNAs due to their Pasteur, Mataojo 2020, Montevideo CP 11400, Uruguay. E-mail: [email protected] short size and the sequence similarity between family members. Received 29 August 2007; accepted 8 October 2007; published Additionally and most importantly, microarray studies are online 8 November 2007 directed toward reported miRNAs, excluding the analysis of MicroRNAs and CLL pathogenesis S Marton et al 331 unannotated candidates. Therefore, to gain insight into the role verify equal loading. The RNA was electrophoretically trans- of miRNAs in CLL, we used a cloning-based approach ferred to GeneScreen Plus (Schleicher and Schuell, NH, USA). combined with stringent northern blot assays to study small After transfer, membranes were cross-linked with 120 mJ of UV RNAs from CLL patients. Our results show the global fluctuation (Stratagene, GE Healthcare, Buenos Aires, Argentina) and baked of miRNA expression levels in CLL cells compared to normal B at 80 1C for 1 h. Oligonucleotide probes were generated by T4 cells and the identification of five novel miRNA candidates from polynucleotide kinase-mediated end labeling (New England CLL cells. The observed changes are associated with significant Biolabs, Beverly, MA, USA) using [32P]g-ATP (end-labeling overexpression of miR-155 in combination with a reduction of grade, 47000 Ci mmolÀ1; MP Biomedicals, Illkirch, Strasbourg, miR-181a, let-7a and miR-30d. Notably, the differential profile France) and were purified from unincorporated label with G-25 of miRNA expression is associated with molecular prognostic microspin columns. Filters were prehybridized at 40 1Cin factors and clinical course in CLL. modified Church’s buffer (5% sodium dodecyl sulfate (SDS), 0.5% nonfat dry milk, 1 mM EDTA in sodium phosphate buffer 0.25 M, pH 7.2). After prehybridization for 2 h, radiolabeled- Materials and methods specific probes were added and further incubated for 1 h. Membranes were washed twice at 42 1C with 2 Â sodium B-lymphocyte purification from CLL patients and chloride/sodium citrate buffer (SSC) 0.1% SDS for 20 min, 1 Â healthy donors SSC 0.1% SDS for 20 min and 0.5 Â SSC 0.1% SDS for 20 min. Samples from CLL patients and healthy donors were provided by The hybridized membranes were exposed overnight to Kodak the Hematology and Bone Marrow Transplantation Unit of the Biomax MS X-ray films. Hybridized probes were stripped from Hospital Maciel (Montevideo, Uruguay) and by the National blots by washing twice in hot 0.1% SDS in deionized water for Blood Bank, (Montevideo, Uruguay), respectively, after obtain- 15 min and reprobed up to three times. ing informed consent according to locally approved regulations. Peripheral blood mononuclear cells (PBMCs) were isolated by centrifugation over a Ficoll–Metrizoate density gradient from peripheral venous blood samples. CLL lymphocytes were further Real-time RT-PCR analysis of precursor miRNAs purified from PBMCs by negative selection using magnetic For cDNA synthesis 1 mg of total RNA was reverse transcribed beads (Dynabeads, Invitrogen, Montevideo, Uruguay) coated with Superscript II reverse transcriptase (Invitrogen) using with MoAbs according to the manufacturer’s instructions, random hexamers (Invitrogen) to prime first-strand synthesis resulting in an enriched population containing more than 95% under conditions suggested by manufacturers. Quantitative PCR CD5 þ B cells. Samples from CLL patients were segregated (qPCR) was perfomed in a LightCycler 2.0 System (Roche according to the mutational status of IgVH genes, into NM and M Applied Science, Meylan, Grenoble, France) using 1 ml of cDNA groups. in 20 ml reaction volume with 0.4 mM of each specific primer and 2 mlof10Â FastStar DNA Master SYBR Green I (Roche Molecular Biochemicals, Meylan, Grenoble, France) according Cloning of small RNAs to the manufacturer’s instructions. Primers were designed Cloning of small RNAs was performed from pooled samples according to the flanking sequences of mature miRNAs (pre- belonging to three different patients corresponding respectively miRNAs), which amplify pre-miRNAs as well as primary to the NM and the M groups as defined above. Total RNA as transcripts of miRNAs (pri-miRNAs): 5S rRNA TACGGCCAT initial source for cloning small RNAs was extracted with the ACCACCCTG (forward) and GTACTAACCAGGCCCGACC Trizol reagent (Invitrogen). Cloning was performed as described (reverse); pre-let-7a-1 GGGATGAGGTAGTAGGTTGTATAG by Pfeffer et al.31 with minor modifications from 400 mg of total (forward) and TGGGATGAGGTAGTAGGTTGTATAG (reverse); RNA. Briefly, small RNAs between 18 and 26 bases were size pre-miR-16-1 GTCAGCAGTGCCTTAGCAGC (forward) and selected on a 15% denaturing polyacrylamide gel. Unlabeled CAACCTTACTTCAGCAGCACAG (reverse); pre-miR-30d GTTG DNA size markers were used instead of radiolabeled RNA. At TTGTAAACATCCCCGAC (forward) and GTAGCAGCAAACATC the end of electrophoresis the lane containing DNA size markers TGACTGAA (reverse); pre-miR-142 GACAGTGCAGTCACCCA was excised and stained with ethidium bromide. The stained TAAAG (forward) and CACAGTACACTCATCCATAAAGTAGG lane was then aligned with the gel and bands were (reverse); pre-miR-155 TGTTAATGCTAATCGTGATAGGGG excised according to the mobility of the DNA markers. (forward)) and TGCTAATATGTAGGAGTCAGTTGG (reverse); After the inclusion of 50 and 30 adapters containing Ban I pre-miR-181a GAAGGGCTATCAGGCCAGC (forward) and CC restriction sites and amplification by PCR, Ban I-digested PCR CCAAGGTACAGTCAACG (reverse). The following program products were concatamerized and cloned into pGEM T-easy conditions were applied for qPCR running: denaturation (Promega Corp., Buenos Aires, Argentina) according to the program at 95 1C for 10 min, amplification and quantification manufacturers’ instructions. Colonies were screened using PCR program consisting 40 cycles (95 1C for 10 s, 60 1C for 10 s and M13 sequencing primers. PCR products were directly and 72 1C for 10 s). The relative amount of each precursor submitted for custom sequencing. Sequence analysis and miRNA to the reference 5S rRNA gene was calculated annotation were performed using information obtained from using the following equation32 and expressed as n-fold the public databases GenBank (http://www.ncbi.nlm.nih.gov/ variation of miRNA levels in test samples (CLL cells) with Genbank/index.html) and miRBase (http://microrna.sanger.ac.uk/ respect to control samples (normal lymphocytes). Ratio ¼ target (control sample) ref (control sample) sequences/index.shtml). (E target)DCt /(E ref)DCt . Efficiencies (E) of each gene were calculated from the slopes of crossover points vs DNA concentration plot, according to the formula Northern blot analysis E ¼ 10(À1/slope). PCR specificity was checked by melting curves. A total of 30 mg of total RNA was run on a 15% denaturing Agarose gel electrophoresis was used to verify the amplification polyacrylamide gel in 0.5 Â Tris-Borate-EDTA running buffer. of a unique band in order to validate qPCR assays. In all cases Prior to transfer, gels were stained with ethidium bromide to the identity of amplicons was verified by sequencing.

Leukemia MicroRNAs and CLL pathogenesis S Marton et al 332 Prediction of miRNA targets corresponding to 7 known human miRNAs (Table 2). From pooled Putative targets for novel miRNAs candidates were predicted samples of M CLL cells, we have identiﬁed 32 clones correspond- using the online (http://www.microrna.org/mammalian/ ing to 11 previously reported human miRNAs. Overall, 13 known index.html) ‘miRanda’ algorithm.33 For each novel miRNA, miRNAs contributed to all of the cloned miRNAs from both groups target genes were selected on the basis of sequence comple- of samples. Most miRNAs were exclusively cloned from only one mentarity using a position-weighted local alignment algorithm group of samples or were cloned with different frequencies, associated to free energies (thermodynamic stability) of RNA– suggesting a different signature distinguishing between NM and M RNA duplexes. We selected the best 10 scores of targets for each groups of samples. Of note, miR-22, miR-24, miR-26a, miR-29a miRNA as the most suitable candidates. We also used the and miR-142-5p were only cloned from M CLL cells. In contrast, TargetScan algorithm34 to predict miRNAs biological targets by miR-30d and miR-191 were only cloned from NM CLL cells. searching for the presence of nonconserved 8mer and 7mer sites Although this asymmetric distribution of mature miRNAs suggested that match the seed region of novel miRNAs (http://www. a different proﬁle of miRNA expression between the NM and M targetscan.org/). group of samples, it should be taken into account that the library is not close to saturation.

Results Differential miRNA expression profile in normal and leukemic B cells Cloning of small RNAs from CLL cells The expression profile of miRNAs cloned from CLL samples and As described, cloning of small RNAs was performed separately other miRNAs reported as relevant in normal and malignant in pooled samples from ‘M’ and ‘NM’ groups of patients. The B-cell differentiation35 were evaluated by northern blot and pooled samples from patients with indolent course (M) had compared with the expression levels in normal peripheral mutated IgVH genes and were negative for ZAP-70. In contrast, CD19 þ B cells obtained from pooled samples of four healthy the pooled samples from patients with a more aggressive clinical donors. As depicted in Figure 1, northern signals of samples from course (NM) were selected for having unmutated IgVH genes representative CLL patients from both prognostic groups revealed and more than 30% of leukemic cells positive for ZAP-70. A that most miRNAs were expressed at lower levels than those seen total of 237 clones obtained from the NM group and 287 clones in normal B lymphocytes suggesting a reduced accumulation of obtained from the M group were sequenced and public database mature miRNAs in leukemic B cells with the exception of miR-16 searching was performed to identify genomic sequences and miR-191 for the NM CLL group and of miR-29a for the M CLL encoding the cloned fragments. The obtained clones were group. However, northern blot data revealed that miR-142, miR- classified according to function based on sequence identity 191, miR-15a, miR-16 and miR-29a were differentially expressed (Table 1). Annotated miRNAs represented 24 out of 237 (B10%) B between NM and M CLL samples. The only miRNA overexpressed and 32 out of 287 ( 11%) small RNAs cloned from NM and M in CLL cells when compared to normal B cells was miR-155. samples, respectively. The small RNAs sequenced included breakdown products of rRNA, snoRNA tRNA, snRNA and mitRNA, which represented more than half of total small RNA Low levels of miR-181a, miR-30d and let-7a expression cloned for both samples. Sequences not matching the human in CLL cells B B genome (NDE in Table 1) represented 10 and 14% for NM Next, we analyzed the expression profile of some known and M groups, respectively. These sequences could result from miRNAs, recently reported to play important roles in normal either unexpected contaminating nucleic acids or transcripts from mutated regions of the CLL genome not yet reported. A significant proportion of small fragments matching either Table 2 Cloned miRNAs from CLL cellsa sense or antisense strands of the human genome but unable to form hairpin structures with flanking sequences were classified miRNAs as noncoding RNA transcripts and represented 12 and 19% for the NM and the M group, respectively. Sequences matching the let-7i* 15a 16 22 24 26a 29a 30d 142 3p 142 5p 150 155 191 human genome with flanking sequences able to form typical NM F 34FF F F 32 F 453 hairpin structures that were not registered in the miRBase M1122233F 8442F of the Sanger Institute (http://microrna.sanger.ac.uk/sequences/ Abbreviations: M, mutated; miRNAs, microRNAs; NM, unmutated. search.shtml) were classified as novel miRNA candidates. From aFor each miRNA the number of confirmed sequences is shown. pooled samples of NM CLL cells, we have identified 24 clones *Indicate the miRNA nomenclature.

Table 1 Small RNAs cloned from CLL groups

Total (%) miRNAs Novel miRNA Sense/antisense noncoding mRNA NcRNAsc NDEd (%) candidatesa (%) RNA transcriptsb (%) (%) (%) (%)

NM 237 (100) 24 (10) 1 (0.5) 28 (12) 28 (12) 132 (55.5) 24 (10) M 287 (100) 32 (11) 4 (1) 25 (9) 28 (10) 157 (55) 41 (14) Abbreviations: CLL, chronic lymphocytic leukemia; M, mutated; NM, unmutated; miRNAs, microRNAs; ncRNA, noncoding RNAs; NDE, nondatabase entry. aSequences for which ﬂanking form predicted hairpin precursors. bSequences matching the human genome but did not forming miRNA-related hairpin precursors. cIncludes ribosomal, transfer, small nuclear, small nucleolar and mitochondrial RNAs. dSequences that did not match with any known human sequence from public databases.

Leukemia MicroRNAs and CLL pathogenesis S Marton et al 333

Figure 1 Expression levels of selected mature miRNAs in CLL cells relative to normal CD19 þ B lymphocytes. Expression levels were assessed by northern blot assays from total RNA isolated from leukemic cells and normal peripheral B lymphocytes. Samples from CLL patients were segregated into unmutated (three representative patients) and ‘mutated’ (four representative patients) according to the mutational status of IgVH genes. 5S rRNA detected by ethidium bromide staining of gels was used as loading control. Since normal B CD19 þ lymphocytes were negative for miR-223, a control RNA from peripheral mononuclear cells were used as normal control (peripheral blood mononuclear cells, PBMC) to assess expression of this miRNA in CLL patients.

mouse and human hematopoiesis, particularly during B- and T-lymphocyte lineage differentiation and in B-cell lymphomas.35,36 In this respect, miR-181a is expressed in bone marrow progenitor cells and is upregulated in mature B lymphocytes.35 Furthermore, miRNA let-7 was shown to be conserved broadly in many animal species with higher levels in differentiated normal cells and to be decreased in tumoral undifferentiated cells.20,37 Interestingly, northern blots clearly revealed a significant decrease in let-7a expression together with virtual absence of miR-181a expression in all samples from CLL patients independently of the mutational status of VH genes (Figure 1). As expected, neither normal B lymphocytes nor CLL samples expressed miR-223, which was reported to be confined to myeloid lineage cells. As judged by these results CLL cells could represent a less differentiated state than normal B cells Figure 2 qRT-PCR analysis of miRNA precursors expression. The in contrast to the classical view of mature and phenotypically relative amount of each precursor miRNA to the reference 5S rRNA gene activated cells. The expression levels of the respective was expressed as n-fold variation of miRNA levels in test samples (CLL precursors of miR-181a, miR-30d and let-7 were assessed cells) with respect to samples from normal CD19 þ B cells. Error bars by quantitative RT-PCR in order to distinguish between represent the standard error of the mean obtained from triplicates samples. decreased transcription and impaired processing into mature miRNAs (Figure 2). Primers were designed to flanking regions of predicted precursors and therefore identify precursors Novel miRNA candidates cloned from leukemic as well as primary transcripts of the respective miRNAs. CLL cells Results depicted in Figure 2 show that primary transcripts As depicted in Tables 1 and 2, we have cloned five not and/or precursors of miR-181a, miR-30d and let-7a are all previously described miRNA candidates from CLL samples. expressed at higher levels than precursors of other reference These novel miRNAs (Table 3) were identified and mapped to miRNAs precursors having levels of mature miRNAs similar to the human genome in public databases by blast sequence normal B cells. This data suggest that the observed decrease of analysis (http://www.ncbi.nlm.nih.gov/Genbank/index.html). mature miR-181, miR-30d and let-7a could be explained by Analysis of secondary structures was performed using the online impaired processing of precursor molecules leading to their version of the Vienna RNA package software in order to identify intracellular accumulation and/or impaired nuclear export of hairpin structures typical for miRNA precursors (http://rna.tbi. pre-miRNAs.38 univie.ac.at/cgi-bin/RNAfold.cgi/). Their potential to be miRNA

Leukemia MicroRNAs and CLL pathogenesis S Marton et al 334 precursors was scored and validated by using the online either directly or indirectly as tumor suppressors. A complete list structure-based miRNA tool (http://tagc.univ-mrs.fr/mirna/).39 of targets and the respective scores are depicted in Supplemen- One of these novel miRNAs originated from the 30 arm of the tary Table 1. Further analysis of predicted targets was performed let-7i precursor and cloned from M samples whose expression using the local version of TargetScan (Supplementary Table 3). has been recently included in the miRBase of the Sanger Interestingly, when evolutionary constraints were removed, Institute (release 10 August 2007) as hsa-let-7i*. Interestingly, several targets were found to be predicted by both algorithms. three other miRNA were cloned in samples from M leukemic Supplementary Table 2 depicts these results and includes CHD5 cells and all mapped to intronic regions of engulfment and cell with three predicted sites for the miR-1202 and PRMD16 with motility 1 gene (miR-1200), the cyclin B1 interacting protein 1 four predicted sites for the miR-1203. isoform b (miR-1201) and to a poorly characterized transcription unit with three splice sites (miR-1202). The only candidate isolated from NM samples (miR-1203) was also located in an Discussion intron of the SCAP1 protein (src family-associated phospho- protein 1). Of note, this is a cytoplasmic protein belonging to the In this work we have compared the expression profile of cloned src family kinases, preferentially expressed in T-lymphocytes small RNAs from purified CLL cells to that of normal CD19 þ B and known to interact with p59fyn. To analyze the relevance in lymphocytes by northern blot assays. According to the muta- CLL pathogenesis of these novel miRNA candidates we searched tional status of IgVH genes combined to another parameter of for their putative mRNA targets by using public online prognostic significance as ZAP-70, CLL samples were segre- algorithms as described above. We selected the best 10 scores gated into two groups with well-recognized different prognostic obtained with miRanda (Table 4 and Supplementary Table 1). and clinical outcome. In normal tissues, about 25 to 40% Although the top 10 target mRNA obtained mapped essentially of cloned small RNAs correspond to miRNAs.19,41 In the case of into human chromosomes 1 and 2, most of them surprisingly CLL, miRNAS represented about 10 % of small RNAs and mapped within a small region in the short arm of chromosome 1 included a total of 13 known miRNAs. This is in agreement with (1p31 to 1p36) known to display extremely common genetic previous reports indicating a reduced accumulation of miRNAs lesions in human cancer of epithelial, neural and hematopoietic in neoplastic tissues,19,42 which was associated with an origin.40 Interestingly, several of these highly scored targets impaired processing of miRNA precursors. In a second step contained predicted miRNA sites in their 30-UTR which were the expression level of miRNAs was assessed by northern blot. shared by two or more of the novel miRNAs described here Our results showed that most miRNAs from CLL B cells display (Table 4). These shared targets included the chromodomain reduced levels of expression when compared to normal CD19 þ helicase DNA-binding protein 5 CHD5, hairy/enhancer of split, B cells. Interestingly, this was not due to a reduced transcription Drosophila homologs 2 and 3 (HES2 and HES3) and positive of precursor miRNA (including pri- and pre-miRNAs), since our regulatory (PR) domain-containing protein 16 (PRDM16) among real-time PCR results revealed the accumulation of precursor others. Most of these genes have been predicted to function species. In this respect, previous reports have shown that

Table 3 Novel miRNA candidates cloned from CLL cells

Abbreviation: miRNA, microRNA. aThe hairpin score was calculated according to structural features of predicted hairpins using the online structure-based miRNA tool (http://tagc.univ-mrs.fr/mirna/).40 Scores under 50 are considered inadequate substrates for RNAse III-dependent processing.

Leukemia MicroRNAs and CLL pathogenesis S Marton et al 335 mammalian miRNAs can be regulated at the level of miRNA recently reported to play important roles in normal mouse and processing.43 In addition, a widespread downregulation of human hematopoiesis, particularly during B-lymphocyte lineage miRNAs in cancer resulting from a failure in the maturation differentiation and in B-cell lymphomas.35,46 Our results step was recently demonstrated.44,45 The highly stringent showed that with the exception of miR-155, all miRNAs were conditions to gain specificity in our northern blot assays have underexpressed in CLL samples irrespective of the mutational not allowed us to study accumulation of the respective status of IgVH genes. These results are in agreement with those precursors. However, the kinetics of export/processing of reported by Fulci et al.,28 but we failed to demonstrate miR-21 different miRNAs and/or differential turnover of mature miRNAs and miR-150 overexpression or a differential expression of miR- cannot be excluded. 223. Our data are in complete concordance with reports from Therefore, the causes of decreased miRNAs in CLL cells Croce’s group showing that miR-15 and miR-16 were down- remain unsolved and will require additional work. As shown in regulated in good prognosis patients, while miR-29 was down- Table 2, only 7 of the 13 miRNAs found in CLL B cells were regulated in bad prognosis group patients.27 observed in NM CLLs, whereas 11 out of these 13 were found in Interestingly, when compared to normal CD19 þ B cells, CLL M patients. Two were exclusively cloned from NM patients cells constantly exhibited a virtual absence in the expression of (miR-30d and miR-191), six from M patients miRNAs (let-7i, miR-181a and very low levels of miR-30d and let-7a regardless miR-22, miR-24, miR-26a, miR-29a and miR-142-5p) and five of the mutational status of VH genes and ZAP-70 expression. The were shared by both groups (miR-15a, miR-16, miR-142-3p, miR-181a was initially cloned by Dostie et al.47 from the human miR-150 and miR-155). Although these results need to be retinoblastoma Weri cells. A recent report35 revealed that miR- substantiated in a larger number of patients, they suggest a 181a was preferentially expressed in thymocytes and B- differential profile of miRNA expression in the two prognostic lymphoid cells and commits hematopoietic precursors cells to groups of CLL patients. Fulci et al.28 using a cloning-based the B-cell lineage, suggesting that miR-181a is a positive approach reported that miR-150, miR-29b, miR-29c and miR- regulator of B-cell differentiation in normal hematopoiesis.25 223 were cloned at higher frequencies in cells from patients The miR-181a is also strongly upregulated during skeletal with the M phenotype. By using a micrroarray-based approach muscle-cell differentiation in mammals and participates in to analyze expression levels of different known miRNAs, Calin establishing the muscle phenotype through downregulation.48 et al.27 have recently identified a set of 13 miRNAs differentially In addition, Neilson et al.30 reported a significant upregulation expressed in CLL patients according to the mutational status of of miR-181a in DP thymocytes which confers repression 0 IgVH genes and ZAP-70 expression. A majority of the miRNAs through the 3 -UTR of relevant targets, including Bcl-2 and reported as differentially expressed in CLL prognostic groups by T-cell antigen receptor-a chain. In this respect, most CLLs have these reports were also found in our study. However, our results been reported to contain high levels of the antiapoptotic protein report for the first time the expression of miR-22, miR-24, miR- Bcl-2,6 and it has been recently reported that upregulation of 26a and miR-142-5p in the M group and of miR-30d and miR- this antiapoptotic protein in CLL is the consequence of miR-15a 191 in the NM one. To gain further insight into the expression and miR-16-1 deletion or downregulation because these levels of different miRNAs, we compared CLL B cells to normal miRNAs negatively regulate Bcl-2 through 30-UTR sites.30 CD19 þ B cells by northern blot for the expression levels of However, in a recent report downregulation of miR-15a representative cloned miRNAs, as well as a number of miRNAs and miR-16 did not parallel any significant increase in

Table 4 Selected relevant mRNA targets for novel miRNA candidatesa

Novel miRNA Target gene name Target gene Location Score symbol miR-1200 Hairy/enhancer of split, Drosophila, homolog 3 HES3 1p36.31 1359 miR-1200 Ephrin receptor (receptor tyrosine kinases; rtks) EPHA10 1p34.3 1049 let-7i* PR domain-containing protein 16: PR (positive PRDM16 1p36.32 859 regulatory domain I binding factor 1 and retinoblastoma- interacting zinc ﬁnger protein) domain let-7i* Hairy/enhancer of split, Drosophila, homolog 2 HES2 1p36.31 674 let-7i* Wingless-type mmtv integration site family, member 3a WNT3A 1q42.13 584 let-7i* Sry-Box 11 SOX11 2p25.2 539 let-7i* Plexin A1 PLXNA1 3q21.2 498 miR-1201 Chromodomain helicase DNA-binding protein 5 CHD5 1p36.31 176 miR-1201 Glutathione S-transferase, Mu-1 GSTM1 1p13.3 148 miR-1201 Regulator of G-protein signaling 2 RGS2 1q31.2 131 miR-1202 PR domain-containing protein 16 PRDM16 1p36.32 1644 miR-1202 Chromodomain helicase DNA-binding protein 5 CHD5 1p36.31 1500 miR-1202 Hairy/enhancer of split, Drosophila, homolog of 3 HES3 1p36.31 1467 miR-1202 Runt-related transcription factor 3 RUNX3 1p36.11 1319 miR-1202 SRY-box 13 SOX13 1q32.1 1272 miR-1202 Wingless-type mmtv integration site family, member 3A WNT3A 1q42.13 1239 miR-1203 PR domain-containing protein 16 PRDM16 1p36.32 1277 miR-1203 Chromodomain helicase DNA-binding protein 5 CHD5 1p36.31 1015 miR-1203 Hairy/enhancer of split, Drosophila, homolog of 3 HES3 1p36.31 1003 miR-1203 Ephrin receptor EphB2 EPHB2 1p36.12 942 aPredicted target mRNAs were identiﬁed through the miRanda algorithm. *Indicate the miRNA nomenclature.

Leukemia MicroRNAs and CLL pathogenesis S Marton et al 336 Bcl-2.28 According to these reports, significantly decreased The PRDM16 (PR domain-containing protein 16) defines a levels of miR-181a in CLL cells could result in overexpression of subfamily of zinc finger proteins that appear to function as the Bcl-2 antiapoptotic protein and since this miRNA is involved negative regulators of tumorigenesis and includes the myelo- in terminal B-cell differentiation its overexpression in CLL B dysplastic syndrome (MDS) gene inactivated in myeloid cells could suggest that these cells do not parallel normal leukemia, the PRDM1 transcription repressor of c-myc involved CD19 þ B lymphocytes and represent a more undifferentiated in driving B-cell differentiation and the PRDM2 (RIZ gene) phenotype. Although Calin et al. reported miR-181 overexpres- which encodes proteins capable of binding to the retinoblastoma sion in CLL cells,27 this may be accounted for by the fact that the tumor suppressor protein.57 The PRDM16 gene was demon- microarray method used by this group includes both the strated transcriptionally activated in a subset of MDS and acute precursor and mature forms of this molecule. In agreement with myeloid leukemia bearing the t(1;3)(p36;q21) translocation.58 our results an exhaustive analysis of Fulci’s data28 revealed that Recent microarray analyses have demonstrated that the Wnt3 miR-181a was never cloned in samples from nine CLL patients. gene is overexpressed in NM CLLs.59,60 Additionally, the Wnt Thus, miR-181a deregulation may play a role in some signaling pathway was reported to be activated in CLL61 The phenotypic features of CLL B cells, such as Bcl-2 over- Wnt gene family consists of structurally related genes encoding expression. secreted signaling molecules that have been implicated in We also reported a significant decrease in expression levels of hematopoietic stem cell homeostasis, hematopoiesis, early let-7a and miR-30d. Originally observed in Caenorhabditis B-cell growth and survival, oncogenesis and in several devel- elegans, let-7a is one of the founding members of the miRNA opmental processes, including regulation of cell fate and family49 and is highly conserved in animals from worms to patterning during embryogenesis.62 humans.37 The highest levels of let-7a expression occur in The Hes3 gene belongs to a family of transcription factors differentiated adult tissues37,50 and inappropriate expression of with basic helix-loop-helix described initially in Drosophila63 let-7a results in oncogenic loss of differentiation. Currently, let-7 by acting as primary Notch effectors and by critically influen- is considered as a tumor suppressor gene20 since reduced cing cell proliferation, differentiation and apoptosis in metazo- expression levels of let-7 were frequently found in both in vitro ans.64 Hes3 was demonstrated essential to neurogenesis, and in vivo lung cancer studies. In addition, let-7 negatively myogenesis, hematopoiesis, sex determination and maintenance regulates the key oncogenes Ras and Myc by targeting their of stem cells,65 though its implication in tumorigenesis remains mRNAs for translational repression,25 highlighting its role in elusive. The run-related transcription factor 3 belongs to a family cancer pathogenesis. MiR-30d was formerly cloned from mouse of transcriptional regulators mapping into 1p36 which appeared liver, and its expression was reported in CD5 þ and CD5À as another relevant target in hematopoiesis and cancer.66 These normal B lymphocytes, although its biological significance transcription factors are important regulators of lineage-specific remains unknown.28,29 Additionally, we report four novel gene expression and are bifunctional, acting both as activators miRNA candidates from CLL cells with M phenotype and one and repressors of tissue-specific target genes.67,68 Inappropriate from those with an NM phenotype. Although these candidates levels of RUNX activity were associated with leukemia, need further confirmation to be definitively assigned as new autoimmune disease and various solid tumors.69 Thus, experi- miRNAs, the structure-based scoring of these miRNAs by using mental confirmation of the involvement of these putative targets the recently described algorithm by Ritchie et al.39 reveals that including several tumor suppressors could provide new avenues at least four out of five precursor hairpins fit requirements of true for exploring innovative pathways in CLL biology and therapy. pre-miRNAs. Overall, our results provide new data concerning miRNA Surprisingly, a significant proportion of these mRNA targets deregulation in CLL. By using a cloning approach combined mapped within a small region in the short arm of human with northern blot assays we have confirmed and extended chromosome 1 (1p31–1p36). This region is frequently deleted in previous reports dealing with an miRNA signature in CLL as well human cancers of epithelial, neural and hematopoietic origin.40 as their ability to discriminate between patients with different Initially reported in neuroblastoma,51 it is also deleted in clinical outcomes. We also describe for the first time a hematopoietic malignancies, including acute myelogenous consistent underexpression of miR-181a, miR-30d and let-7a leukemia,52 chronic myelogenous leukemia53 and lymphoma54 in CLL B cells when compared to normal CD19 þ B cells. These data suggested that one or more tumor suppressor genes According to previous reports and the predicted or experimen- mapping into 1p36 are lost or inactivated in a variety of human tally validated targets, these miRNAs could play relevant roles in cancers. The recent description in this region of CHD5 as a new initiation and progression of CLL. Whether the consistent tumor suppressor in human cancer threw light on this issue.40,55 underexpression of miRNA 181a is involved in overexpression CHD5 appeared as a target shared for miR-1201, miR-1202 and of the Bcl-2 protein and/or could suggest that the CLL B miR-1203. Interestingly, PRDM16, Wnt3 and Hes genes are lymphocyte is an immature B cell remain unsolved issue and predicted targets that map into the same region of human point to the difficulty in assigning a normal counterpart to the chromosome 1p36 and also appear to constitute shared targets CLL B lymphocyte. Finally, we report five novel miRNA for these same novel miRNA (Table 4 and Supplemental Table candidates whose potential targets could be relevant in cancer 1). CHD5 belongs to a chromodomain superfamily, including a and CLL pathogenesis. Work in progress in our laboratory aims large number of proteins with chromatin organizing modulator to extend these data and to experimentally validate the potential (chromo) domains56 characterized by helicase/ATPase- and targets of these new miRNA candidates. DNA-binding domains. In a recent report Bagchi et al.40 demonstrated that CHD5 acts as a tumor suppressor that controls proliferation, apoptosis and senescence via the p19Arf/ p53 pathway. Thus, downmodulation of CHD5 in CLL mediated Acknowledgements by these novel miRNAs could predispose to malignancy by crippling tumor-suppressive pathways involving p16Ink4a, p19Arf We thank Alvaro Pena for suggestions and for bioinformatic and p53, providing a new underlying mechanism for initiating support. This work was supported by a grant assigned to AC from tumorigenesis in CLL. ‘Comisioń Honoraria de Lucha Contra el Cańcer-FMP’ Monte-

Leukemia MicroRNAs and CLL pathogenesis S Marton et al 337 video, Uruguay. Part of this work was supported by ‘‘Fondo 23 Esquela-Kerscher A, Slack FJ. OncomirsFmicroRNAs with a role Clemente Estable’’ (Dicyt-MEC), Montevideo, Uruguay. in cancer. Nat Rev Cancer 2006; 6: 259–269. 24 He L, Thomson JM, Hemann MT, Hernando-Monge E, Mu D, Goodson S et al. A microRNA polycistron as a potential human oncogene. Nature 2005; 435: 828–833. References 25 Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A et al. RAS is regulated by the let-7 microRNA family. Cell 2005; 120: 635–647. 1 Montserrat E, Rozman C. Chronic lymphocytic leukemia: present 26 Voorhoeve PM, le Sage C, Schrier M, Gillis AJ, Stoop H, Nagel R status. Ann Oncol 1995; 6: 219–235. et al. A genetic screen implicates miRNA-372 and miRNA-373 2 Dighiero G, Kipps T, Schroeder HW, Chiorazzi N, Stevenson F, Silberstein LE et al. What is the CLL B-lymphocyte? Leuk as oncogenes in testicular germ cell tumors. Cell 2006; 124: Lymphoma 1996; 22 (Suppl 2): 13–39. 1169–1181. 3 Dameshek W. Chronic lymphocytic leukemiaFan accumulative 27 Calin GA, Ferracin M, Cimmino A, Di Leva G, Shimizu M, Wojcik disease of immunologically incompetent lymphocytes. Blood SE et al. A microRNA signature associated with prognosis and 1967; 29 (Suppl 4): 566–584. progression in chronic lymphocytic leukemia. N Engl J Med 2005; 4 Caligaris-Cappio F, Hamblin TJ. B-cell chronic lymphocytic 353: 1793–1801. leukemia: a bird of a different feather. J Clin Oncol 1999; 17: 28 Fulci V, Chiaretti S, Goldoni M, Azzalin G, Carucci N, Tavolaro S 399–408. et al. Quantitative technologies establish a novel microRNA profile 5 Chiorazzi N, Rai KR, Ferrarini M. Chronic lymphocytic leukemia. of chronic lymphocytic leukemia. Blood 2007; 109: 4944–4951. N Engl J Med 2005; 352: 804–815. 29 Calin GA, Liu CG, Sevignani C, Ferracin M, Felli N, Dumitru CD 6 Kitada S, Andersen J, Akar S, Zapata JM, Takayama S, Krajewski S et al. MicroRNA profiling reveals distinct signatures in B cell et al. Expression of apoptosis-regulating proteins in chronic chronic lymphocytic leukemias. Proc Natl Acad Sci USA 2004; lymphocytic leukemia: correlations with in vitro and in vivo 101: 11755–11760. chemoresponses. Blood 1998; 91: 3379–3389. 30 Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M 7 Messmer BT, Messmer D, Allen SL, Kolitz JE, Kudalkar P, Cesar D et al. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc et al. In vivo measurements document the dynamic cellular Natl Acad Sci USA 2005; 102: 13944–13949. kinetics of chronic lymphocytic leukemia B cells. J Clin Invest 31 Pfeffer S, Lagos-Quintana M, Tuschl T. Cloning of small RNA 2005; 115: 755–764. molecules. In: Ausubel FM, Brent R, Kingston RE, Moore DD, 8 Maloum K, Davi F, Magnac C, Pritsch O, McIntyre E, Valensi F Seidmann JG, Smith JA, Struhl K (eds). Current Protocols in et al. Analysis of VH gene expression in CD5+ and CD5À B-cell Molecular Biology. New York: Wiley, 2003, pp 26.4.1–26.4.18. chronic lymphocytic leukemia. Blood 1995; 86: 3883–3890. 32 Pfaffl MW. A new mathematical model for relative quantification 9 Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK. in real-time RT-PCR. Nucleic Acids Res 2001; 29: e45. Unmutated Ig V(H) genes are associated with a more aggressive 33 Enright AJ, John B, Gaul U, Tuschl T, Sander C, Marks DS. form of chronic lymphocytic leukemia. Blood 1999; 94: MicroRNA targets in Drosophila. Genome Biol 2003; 5: R1. 1848–1854. 34 Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often 10 Orchard JA, Ibbotson RE, Davis Z, Wiestner A, Rosenwald A, flanked by adenosines, indicates that thousands of human genes Thomas PW et al. ZAP-70 expression and prognosis in chronic are microRNA targets. Cell 2005; 120: 15–20. lymphocytic leukaemia. Lancet 2004; 363: 105–111. 35 Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate 11 Damle RN, Wasil T, Fais F, Ghiotto F, Valetto A, Allen SL et al. Ig V hematopoietic lineage differentiation. Science 2004; 303: 83–86. gene mutation status and CD38 expression as novel prognostic 36 Neilson JR, Zheng GX, Burge CB, Sharp PA. Dynamic regulation of indicators in chronic lymphocytic leukemia. Blood 1999; 94: miRNA expression in ordered stages of cellular development. 1840–1847. Genes Dev 2007; 21: 578–589. 12 Dohner H, Stilgenbauer S, Benner A, Leupolt E, Krober A, 37 Pasquinelli AE, Reinhart BJ, Slack F, Martindale MQ, Kuroda MI, Bullinger L et al. Genomic aberrations and survival in chronic Maller B et al. Conservation of the sequence and temporal lymphocytic leukemia. N Engl J Med 2000; 343: 1910–1916. expression of let-7 heterochronic regulatory RNA. Nature 2000; 13 Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and 408: 86–89. function. Cell 2004; 116: 281–297. 38 Bohnsack MT, Czaplinski K, Gorlich D. Exportin 5 is a RanGTP- 14 Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP. dependent dsRNA-binding protein that mediates nuclear export of MicroRNAs in plants. Genes Dev 2002; 16: 1616–1626. pre-miRNAs. RNA 2004; 10: 185–191. 15 Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R. Control of 39 Ritchie W, Legendre M, Gautheret D. RNA stem-loops: to be or not translation and mRNA degradation by miRNAs and siRNAs. Genes to be cleaved by RNAse III. RNA 2007; 13: 457–462. Dev 2006; 20: 515–524. 40 Bagchi A, Papazoglu C, Wu Y, Capurso D, Brodt M, Francis D 16 Carrington JC, Ambros V. Role of microRNAs in plant and animal et al. CHD5 is a tumor suppressor at human 1p36. Cell 2007; 128: development. Science 2003; 301: 336–338. 459–475. 17 Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, 41 Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Klooster- Yendamuri S et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl man WP, Enomoto M et al. Mouse microRNA profiles determined Acad Sci USA 2004; 101: 2999–3004. with a new and sensitive cloning method. Nucleic Acids Res 2006; 18 Metzler M, Wilda M, Busch K, Viehmann S, Borkhardt A. 34: e115. High expression of precursor microRNA-155/BIC RNA in children 42 Karube Y, Tanaka H, Osada H, Tomida S, Tatematsu Y, with Burkitt lymphoma. Genes Chromosomes Cancer 2004; 39: Yanagisawa K et al. Reduced expression of Dicer associated with 167–169. poor prognosis in lung cancer patients. Cancer Sci 2005; 96: 19 Michael MZ, SM OC, van Holst Pellekaan NG, Young GP, 111–115. James RJ. Reduced accumulation of specific microRNAs in 43 Obernosterer G, Leuschner PJ, Alenius M, Martinez J. Post- colorectal neoplasia. Mol Cancer Res 2003; 1: 882–891. transcriptional regulation of microRNA expression. RNA 2006; 20 Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, 12: 1161–1167. Endoh H et al. Reduced expression of the let-7 microRNAs in 44 Thomson JM, Newman M, Parker JS, Morin-Kensicki EM, Wright T, human lung cancers in association with shortened postoperative Hammond SM. Extensive post-transcriptional regulation of survival. Cancer Res 2004; 64: 3753–3756. microRNAs and its implications for cancer. Genes Dev 2006; 21 Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S 20: 2202–2207. et al. MicroRNA gene expression deregulation in human breast 45 Yue J, Tigyi G. MicroRNA trafficking and human cancer. Cancer cancer. Cancer Res 2005; 65: 7065–7070. Biol Ther 2006; 5: 573–578. 22 Chan JA, Krichevsky AM, Kosik KS. MicroRNA-21 is an 46 Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF et al. antiapoptotic factor in human glioblastoma cells. Cancer Res Accumulation of miR-155 and BIC RNA in human B cell 2005; 65: 6029–6033. lymphomas. Proc Natl Acad Sci USA 2005; 102: 3627–3632.

Leukemia MicroRNAs and CLL pathogenesis S Marton et al 338 47 Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G. Numerous activated in t(1;3)(p36;q21)-positive leukemia cells. Blood 2000; microRNPs in neuronal cells containing novel microRNAs. RNA 96: 3209–3214. 2003; 9: 180–186. 59 Rosenwald A, Alizadeh AA, Widhopf G, Simon R, Davis RE, Yu X 48 Naguibneva I, Ameyar-Zazoua M, Polesskaya A, Ait-Si-Ali S, et al. Relation of gene expression phenotype to immunoglobulin Groisman R, Souidi M et al. The microRNA miR-181 targets the mutation genotype in B cell chronic lymphocytic leukemia. J Exp homeobox protein Hox-A11 during mammalian myoblast differ- Med 2001; 194: 1639–1647. entiation. Nat Cell Biol 2006; 8: 278–284. 60 Vasconcelos Y, De Vos J, Vallat L, Reme T, Lalanne AI, 49 Ambros V. The functions of animal microRNAs. Nature 2004; 431: Wanherdrick K et al. Gene expression proﬁling of chronic 350–355. lymphocytic leukemia can discriminate cases with stable disease 50 Thomson JM, Parker J, Perou CM, Hammond SM. A custom and mutated Ig genes from those with progressive disease and microarray platform for analysis of microRNA gene expression. unmutated Ig genes. Leukemia 2005; 19: 2002–2005. Nat Methods 2004; 1: 47–53. 61 Lu D, Zhao Y, Tawatao R, Cottam HB, Sen M, Leoni LM et al. 51 Brodeur GM, Sekhon G, Goldstein MN. Chromosomal aberrations Activation of the Wnt signaling pathway in chronic lymphocytic in human neuroblastomas. Cancer 1977; 40: 2256–2263. leukemia. Proc Natl Acad Sci USA 2004; 101: 3118–3123. 52 Mori N, Morosetti R, Mizoguchi H, Koefﬂer HP. Progression 62 Reya T. Regulation of hematopoietic stem cell self-renewal. Recent of myelodysplastic syndrome: allelic loss on chromosomal arm 1p. Prog Horm Res 2003; 58: 283–295. Br J Haematol 2003; 122: 226–230. 63 Sasai Y, Kageyama R, Tagawa Y, Shigemoto R, Nakanishi S. Two 53 Mori N, Morosetti R, Spira S, Lee S, Ben-Yehuda D, Schiller G mammalian helix-loop-helix factors structurally related to Droso- et al. Chromosome band 1p36 contains a putative tumor phila hairy and Enhancer of split. Genes Dev 1992; 6: 2620–2634. suppressor gene important in the evolution of chronic myelocytic 64 Hatakeyama J, Bessho Y, Katoh K, Ookawara S, Fujioka M, leukemia. Blood 1998; 92: 3405–3409. Guillemot F et al. Hes genes regulate size, shape and histogenesis 54 Melendez B, Cuadros M, Robledo M, Rivas C, Fernandez-Piqueras J, Martinez-Delgado B et al. Coincidental LOH regions in mouse of the nervous system by control of the timing of neural stem cell and humans: evidence for novel tumor suppressor loci at 9q22-q34 differentiation. Development 2004; 131: 5539–5550. in non-Hodgkin’s lymphomas. Leuk Res 2003; 27: 627–633. 65 Katoh M, Katoh M. Integrative genomic analyses on HES/HEY 55 Okawa ER, Gotoh T, Manne J, Igarashi J, Fujita T, Silverman KA family: Notch-independent HES1, HES3 transcription in undiffer- et al. Expression and sequence analysis of candidates for the entiated ES cells, and Notch-dependent HES1, HES5, HEY1, HEY2, 1p36.31 tumor suppressor gene deleted in neuroblastomas. HEYL transcription in fetal tissues, adult tissues, or cancer. Int J Oncogene advance online publication, July 30, 2007; Oncol 2007; 31: 461–466. doi:10.1038/sj.onc.1210675. 66 Tracey WD, Speck NA. Potential roles for RUNX1 and its orthologs 56 Thompson PM, Gotoh T, Kok M, White PS, Brodeur GM. CHD5, in determining hematopoietic cell fate. Semin Cell Dev Biol 2000; a new member of the chromodomain gene family, is 11: 337–342. preferentially expressed in the nervous system. Oncogene 2003; 67 Ito Y. Oncogenic potential of the RUNX gene family: ‘overview’. 22: 1002–1011. Oncogene 2004; 23: 4198–4208. 57 Jiang GL, Huang S. The yin-yang of PR-domain family genes in 68 van Wijnen AJ, Stein GS, Gergen JP, Groner Y, Hiebert SW, Ito Y tumorigenesis. Histol Histopathol 2000; 15: 109–117. et al. Nomenclature for Runt-related (RUNX) proteins. Oncogene 58 Mochizuki N, Shimizu S, Nagasawa T, Tanaka H, Taniwaki M, 2004; 23: 4209–4210. Yokota J et al. A novel gene, MEL1, mapped to 1p36.3 is highly 69 Bae SC, Lee YH. Phosphorylation, acetylation and ubiquitination: homologous to the MDS1/EVI1 gene and is transcriptionally the molecular basis of RUNX regulation. Gene 2006; 366: 58–66.

Supplementary Information accompanies the paper on the Leukemia website (http://www.nature.com/leu)

Leukemia