Drug Metab. Pharmacokin. 19(2): 135–149(2004).

Note Tissue­speciˆc mRNA Expression Proˆles of Human Nuclear Receptor Subfamilies

Masuhiro NISHIMURA1,*, Shinsaku NAITO1 and Tsuyoshi YOKOI2 1Department of Drug Metabolism, Division of Pharmacology, Drug Safety and Metabolism, Otsuka Pharmaceutical Factory, Inc., Tokushima, Japan 2Division of Drug Metabolism, Faculty of Pharmaceutical Sciences, Kanazawa University, Kanazawa, Japan

Full text of this paper is available at http://www.jssx.org

Summary: Pairs of forward and reverse primers and TaqMan probes speciˆc to each human nuclear receptor were prepared. Analysis of the mRNA expression level of each target of 43 nuclear receptors in total RNA from single and pooled specimens of various human organs (liver, kidney, adrenal gland, lung, heart, brain, cerebellum, skeletal muscle, spleen, thymus, thyroid gland, prostate, testis, uterus, placen­ ta, bone marrow, trachea, and salivary gland) was performed by real­time reverse transcription PCR using an ABI PRISM 7700 sequence detector system. The mRNA expression of 33 nuclear receptors (NR1A1,1A2,1B1,1B2,1B3,1C1,1C2,1C3,1D1,1D2,1F1,1F2,1F3,1H2,1H3,1I1,1I2,2B1,2B2, 2B3, 2C1, 2C2, 2F1, 2F2, 3A2, 3B1, 3C1, 3C2, 3C4, 4A1, 4A2, 4A3, and 6A1) was successfully detected in all of the tissues by this method. NR1H4, 2A1, and 3C3 mRNAs were not detectable in the heart, heart, and liver, respectively. NR5A2 mRNA was not detectable in either the brain or cerebellum. NR3A1 mRNA was not detectable in the small intestine, colon, brain, and cerebellum. NR5A1 mRNA was not detectable in the kidney, stomach, small intestine, and colon. NR1I3 mRNA was detected in the liver, kidney, stomach, small intestine, adrenal gland, lung, brain, skeletal muscle, thymus, thyroid gland, prostate, testis, placenta, and trachea. NR2A2 mRNA was detected in the liver, kidney, prostate, testis, uterus, and trachea. NR2E1 mRNA was detected in the adrenal gland, brain, cerebellum, testis, placenta, and bone marrow. NR2E3 mRNA was detected in the adrenal gland, thyroid gland, prostate, testis, uterus, trachea, and salivary gland. This study provides information concerning the tissue distribution of the mRNA expression of 43 human nuclear receptors. The mRNA expression proˆles of CYP3A4, CYP3A5 and ABC­transporters are also shown. These results are valuable for establishing a nuclear receptor­mediated screening system for new chemical entities in new drug development.

Key words: nuclear receptor; mRNA expression; tissue distribution; quantiˆcation

experimental condition. Introduction Recently, a relationship between NR1C (PPAR) and Recently, nuclear receptors are established as im­ CYP4A was reported by Waxman.18) The NR1Is, such portant transcription factors that regulate such widely as VDR, PXR and CAR has been reported to be diverse physiological functions as the control of cell involved in the transcriptional regulation of CYP3A diŠerentiation and homeostasis as well as the expression (Drocourt et al.19) and Pascussi et al.20) Arelationship of Phase I and Phase II enzymes and transporters. Over between NR1I3 (CAR) and CYP2B was reported by 70 distinct members of the nuclear receptor superfamily Sueyoshi et al.21) A considerable degree of cross talk have been identiˆed to date.1) The nomenclature is sum­ between nuclear receptors and drug metabolizing marized in Table 1. The tissue distributions of many enzymes and transporters would be expected to exist. In nuclear receptors such as the NR1Cs,2,3) NR1Fs,4–7) addition, the process of induction is not a single recep­ NR2As,8–10) NR2Bs,11,12) NR4As,13–16) and NR6A117) have tor­protein relationship. Thus, the mRNA expression been reported. However, the tissue distribution of the proˆles of nuclear receptors constitute important infor­ mRNA expression of large numbers of human nuclear mation to study the regulation mechanisms of drug receptors has not been evaluated in the same metabolizing enzymes and transporters and to establish

Received; August 29, 2003, Accepted; January 17, 2004 *To whomall correspondence should be addressed :MasuhiroNISHIMURA,Ph.D.,Division of Pharmacology, Drug Safety and Metabolism, Otsuka Pharmaceutical Factory, Inc., Naruto, Tokushima 772­8601, Japan. Tel. {81­88­685­1151 ext 335, Fax. {81­88­686­8176, E­mail: nisimums—otsukakj.co.jp

135 136 Masuhiro NISHIMURA, et al.

Table 1. A Nomenclature for nuclear receptors

Subfamily and Group Gene Name Trivial Name

1A NR1A1 THRA, TRa,c­erbA­1 NR1A2 THRB, TRb,c­erbA­2 1B NR1B1 RARA, RARa NR1B2 RARb,HAP NR1B3RAR g, RARD, RARG 1C NR1C1 PPARa NR1C2 PPARb, PPARd,NUC1,FAAR NR1C3PPAR g 1D NR1D1 RevErba, EAR1, EAR1A NR1D2 RevErbb,EARb, BD72, HZF2, RVR, EAR­1r 1F NR1F1 RORA, RORa,RZRa NR1F2 RORB, RORb,RZRb NR1F3RORC, ROR g,TOR 1H NR1H2 Ner­I, LXRb, UR, NER, RIP15, OR1 NR1H3LXR a,RLD1 NR1H4 HRR­1, FXR, RIP14 1I NR1I1 VDR NR1I2 PXR NR1I3CAR 2A NR2A1 HNF4A, HNF4a NR2A2 HNF4G, HNF4g 2B NR2B1 RXRa NR2B2 RXRb, H2RIIBP NR2B3RXR g 2C NR2C1 TR2, TR2–11, TR2a NR2C2 TR4, TR2b, TAK1, TR2R1 2E NR2E1 TLX, TLL NR2E3 2F NR2F1 COUP­TFa, COUP­TFI, COUPTFA, EAR3, SVP44 NR2F2 COUP­TFb, COUP­TFII, COUPTFB, ARP1, SVP40 3A NR3A1 ESR1 NR3A2 ESR2 3B NR3B1 ESRRA 3C NR3C1 GRa NR3C2 MR NR3C3 PGR NR3C4 AR 4A NR4A1 NGFI­B, NUR77, N10, TR3, NAK1, TIS1 NR4A2 NURR1, NOT, RNR1, HZF­3, TINUR, TR3b NR4A3NOR­1, MINOR, TEC, CHN 5A NR5A1 FTZ­F1, SF1, ELP, AD4BP NR5A2 FTF, LRH1, PHR1, CPF, FFLR 6A NR6A1 RTR, GCNF a nuclear receptor­mediated screening system for new from CLONTECH Laboratories, Inc. (Hilden, Palo chemical entities. Alto, CA, USA). The total RNA source information for The present study was therefore undertaken to inves­ these human tissues is shown in Table 2.YeasttRNA tigate the tissue distribution of mRNA expression of 43 was purchased from Life Technologies, Inc. (Rockville, human nuclear receptors, CYP3As and ABC­transport­ MD, USA), and the TaqMan One­Step RT­PCR Master ers using high­sensitivity real­time reverse transcription Mix Reagents Kit, TaqMan GAPDH Control Reagents PCR (RT­PCR). (Part No. 402869), TaqMan b­Actin Control Reagents (Part No. 401846), Micro Amp} Optical 96­Well Materials and Methods Reaction Plates, Optical Adhesive Covers, and Optical Materials: Pooled total RNA prepared from adult Cover Compression Pads were purchased from Applied human tissues (liver, kidney, adrenal gland, lung, heart, Biosystems (Foster City, CA, USA). All other chemicals brain, cerebellum, skeletal muscle, spleen, thymus, used in this study were of reagent grade. thyroid gland, prostate, testis, uterus, placenta, bone Oligonucleotides: The pairs of primers and the Taq­ marrow, trachea, and salivary gland) was purchased Man probes for the target mRNAs were designed from mRNA Expression Proˆles of Human Nuclear Receptors 137

Table 2. Total RNA source information for various tissues the human mRNA sequence (Table 3)usingPrimer Express software (Applied Biosystems). GenBank acces­ Tissue Pool size Age Sex Race sion number and position from the initiation codon are Liver 1 27 M A shown in Table 3. The primer andWor probe was homol­ Kidney1 32 M A ogysearched byan NCBI BLAST search to ensure that Stomach 1 50 M C Small intestine 5 20–61 F, M C it was speciˆc for the target mRNA transcript. The Colon 3 20, 35, 55 F, M C primers and TaqMan probes were synthesized by QIA­ Adrenal gland 62 15–61 F, M C GEN (Tokyo, Japan). The TaqMan probes contained Lung 1 27 M A 6­carboxy‰uorescein (FAM) at the 5? end and 6­carbox­ Heart 1 25 M A ytetramethylrhodamine (TAMRA) at the 3? end and Brain 1 28 M A Cerebellum 24 16–70 F, M C were designed to hybridize to a sequence located be­ Skeletal muscle 2 43, 46 F, M C tween the PCR primers. Spleen 14 30–66 F, M C Experimental conditions for TaqMan RT­PCR: Thymus 9 15–25 F, M C The total RNAs obtained from adult human tissues Thyroid gland 65 15–61 F, M C were diluted with RNase­free water to 20 mgWmL, then Prostate 47 14–57 M C Testis 19 17–61 M C further diluted with 50 mgWmL yeast tRNA. To prepare Uterus 10 15–77 F C the calibration curve, various amounts of 50 mgWmL Placenta 7 22–35 F C yeast tRNA ranging from 1.28 to 100,000 pg total RNA Bone marrow 7 18–54 F, M C were used. For the RT­PCR reaction, the TaqMan Trachea — 18–54 F, M C One­Step RT­PCR Master Mix Reagents Kit (Applied Salivarygland 24 15–60 F, M C Biosystems) containing 300 nM forward primer, 900 nM —,nodata;F,female;M,male;C,Caucasian;A,Asian. reverse primer, and 200 nM TaqMan probe was used at

Table 3. Primers and probes used for RT­PCR analysis.

mRNA Sequence Position

Housekeeping genes B2M (beta­2­microglobulin) (GenBank accession number NMä004048) Forward primer 5?­TGCTCGCGCTACTCTCTCTTT­3? 26–46 Reverse primer 5?­ATGTCGGATGGATGAAACCC­3? 164–145 Probe 5?­CCTGGAGGCTATCCAGCGTACTCCAAAGAT­3? 51–80 GUSB (glucuronidase, beta) (GenBank accession number NMä000181) Forward primer 5?­TCTGTCAAGGGCAGTAACCTG­3? 745–765 Reverse primer 5?­CGCCACGACTTTGTTTTCTG­3? 813–794 Probe 5?­TCAAGTTGGAAGTGCGTCTTTTGGATGC­3? 767–794 HPRT1 (hypoxanthine phosphoribosyltransferase 1) (GenBank accession number NMä000194) Forward primer 5?­GAACGTCTTGCTCGAGATGTG­3? 139–159 Reverse primer 5?­CCAGCAGGTCAGCAAAGAATT­3? 238–218 Probe 5?­AGGCCATCACATTGTAGCCCTCTGTG­3? 174–199 PPIA (peptidylprolyl isomerase A) (GenBank accession number NMä021130) Forward primer 5?­TCCTGGCATCTTGTCCATG­3? 282–300 Reverse primer 5?­CCATCCAACCACTCAGTCTTG­3? 371–351 Probe 5?­CAAATGCTGGACCCAACACAAATGG­3? 302–326 TFRC (transferrin receptor) (GenBank accession number NMä003234) Forward primer 5?­TTGGACATGCTCATCTGGG­3? 893–911 Reverse primer 5?­ATGACCGAGATGGTGGAAACT­3? 979–959 Probe 5?­ACCCTTACACACCTGGATTCCCTTCCTTC­3? 920–948 Nuclear Receptors NR1A1 (GenBank accession number NMä003250) Forward primer 5?­GGGACAAGGCAACTGGTTATC­3? 170–190 Reverse primer 5?­GGAGGTTCTTCTGGATTGTGC­3? 256–236 Probe 5?­ACTTGTGAGGGCTGCAAGGGCTTCTT­3? 205–230 NR1A2 (GenBank accession number X04707) Forward primer 5?­CAGATCATCCTCCTCAAAGGC­3? 886–906 Reverse primer 5?­AAAGTCTCACTTTCCGGGTCA­3? 968–948 Probe 5?­TGCATGGAGATCATGTCCCTTCGC­3? 910–933 NR1B1 (GenBank accession number NMä000964) Forward primer 5?­CAGCTGGGCAAATACACTACG­3? 610–630 138 Masuhiro NISHIMURA, et al.

Table 3. continued.

mRNA Sequence Position

Reverse primer 5?­ATGCACTTGGTGGAGAGTTCA­3? 707–687 Probe 5?­TCTCTCTGGACATTGACCTCTGGGACAAGTTC­3? 653–684 NR1B2 (GenBank accession number AF157483) Forward primer 5?­CCTTTGGAAATGGATGACACA­3? 595–615 Reverse primer 5?­TTTTGTCGGTTCCTCAAGGTC­3? 684–664 Probe 5?­ACAGGCCTTCTCAGTGCCATCTGCTT­3? 619–644 NR1B3 (GenBank accession number NMä000966) Forward primer 5?­TGTCACCGCGACAAAAACTG­3? 376–395 Reverse primer 5?­TTCCGGTCATTTCGCACAG­3? 494–476 Probe 5?­ATCATCAACAAGGTGACCAGGAATCGCTG­3? 397–425 NR1C1 (GenBank accession number L02932) Forward primer 5?­GCAGCTGCAAGATCCAGAAAA­3? 422–442 Reverse primer 5?­GTCCAAAACGAATCGCGTTG­3? 523–504 Probe 5?­CGATTTCACAAGTGCCTTTCTGTCGGGA­3? 469–496 NR1C2 (GenBank accession number L07592) Forward primer 5?­AGTACGAGAAGTGTGAGCGCA­3? 320–340 Reverse primer 5?­ATAGCGTTGTGTGACATGCCC­3? 428–408 Probe 5?­CAAGATTCAGAAGAAGAACCGCAACAAGTGC­3? 345–375 NR1C3 (GenBank accession number L40904) Forward primer 5?­GCCAAGCTGCTCCAGAAAAT­3? 1297–1316 Reverse primer 5?­TCCGTCTTCTTGATCACCTGC­3? 1379–1359 Probe 5?­ACAGACCTCAGACAGATTGTCACGGAACAC­3? 1318–1347 NR1D1 (GenBank accession number X72631) Forward primer 5?­CTGCAAGGGCTTTTTCCGT­3? 453–471 Reverse primer 5?­ATGCGGACGATGGAGCAAT­3? 539–521 Probe 5?­CCAGCAGAACATCCAGTACAAAAGGTGTCTGA­3? 480–511 NR1D2 (GenBank accession number D16815) Forward primer 5?­GTTCTTCCAGCTCAGCCTCAA­3? 38–58 Reverse primer 5?­TGGCGAGATCACCATTCTTG­3? 184–165 Probe 5?­TAGTTTCCAGTCCTCCTCCTCTTCTGTTCCAT­3? 93–124 NR1F1 (GenBank accession number NMä134261) Forward primer 5?­CAGCAAAGCAATGCCACCT­3? 301–319 Reverse primer 5?­GTAATCGACAGTGTTGGCAGC­3? 391–371 Probe 5?­CTCCTGTCCTCGTCAGAAGAACTGTTTGATTG­3? 321–352 NR1F2 (GenBank accession number NMä006914) Forward primer 5?­CCTCACATCCGTACCCAACTT­3? 555–575 Reverse primer 5?­GCAATTCGGTCGATTTCAGTC­3? 647–627 Probe 5?­ACCTATAGCTCTTTCAACAATGGGCAGTTAGCACC­3? 580–614 NR1F3 (GenBank accession number NMä005060) Forward primer 5?­TTCCGAGGATGAGATTGCC­3? 1236–1254 Reverse primer 5?­TTCCTTTTCTCTTGGAGCCCT­3? 1313–1293 Probe 5?­TCTACACAGCCCTTGTTCTCATCAATGCC­3? 1256–1284 NR1H2 (GenBank accession number U07132) Forward primer 5?­TGATGTCCCAGGCACTGATG­3? 132–151 Reverse primer 5?­CCTCTTCGGGATCTGGGAT­3? 202–184 Probe 5?­TCAGCCTGCAGCACAGACTGGGT­3? 160–182 NR1H3 (GenBank accession number U22662) Forward primer 5?­AGACTTTGCCAAAGCAGGG­3? 972–990 Reverse primer 5?­ATGAGCAAGGCAAACTCGG­3? 1079–1061 Probe 5?­TTCATCAACCCCATCTTCGAGTTCTCC­3? 1003–1029 NR1H4 (GenBank accession number U68233) Forward primer 5?­TGGGTCGCCTGACTGAATT­3? 1301–1319 Reverse primer 5?­ACTGCACGTCCCAGATTTCAC­3? 1417–1397 Probe 5?­CGGACATTCAATCATCACCACGCTGA­3? 1321–1346 NR1I1 (GenBank accession number NMä000376) Forward primer 5?­CATCATTGCCATACTGCTGGAC­3? 390–411 Reverse primer 5?­CTCCCTCCACCATCATTCACAC­3? 494–473 Probe 5?­CATAAGACCTACGACCCCACCTACTCCGACT­3? 418–448 NR1I2 (GenBank accession number AF061056) Forward primer 5?­GGCCACTGGCTATCACTTCAA­3? 141–161 Reverse primer 5?­TTCATGGCCCTCCTGAAAA­3? 209–191 Probe 5?­TCATGACATGTGAAGGATGCAAGGGC­3? 164–189 mRNA Expression Proˆles of Human Nuclear Receptors 139

Table 3. continued.

mRNA Sequence Position

NR1I3 (GenBank accession number NMä005122) Forward primer 5?­CATGGGCACCATGTTTGAAC­3? 372–391 Reverse primer 5?­AGGGCTGGTGATGGATGAA­3? 442–424 Probe 5?­TGTGCAGTTTAGGCCTCCAGCTCATC­3? 396–421 NR2A1 (GenBank accession number NMä000457) Forward primer 5?­AAGACAAGAGGAACCAGTGCC­3? 407–427 Reverse primer 5?­GGCTTCCTTCTTCATGCCA­3? 477–459 Probe 5?­CTACTGCAGGCTCAAGAAATGCTTCCG­3? 429–455 NR2A2 (GenBank accession number NMä004133) Forward primer 5?­TGTGATGGGTGCAAGGGTTT­3? 85–104 Reverse primer 5?­ATTGCCGACTGAACCTGCAA­3? 160–141 Probe 5?­TTCAGACGCAGCATTCGTAAGAGTCACA­3? 106–133 NR2B1 (GenBank accession number X52773) Forward primer 5?­TCAATGGCGTCCTCAAGGTC­3? 338–357 Reverse primer 5?­TTGCCTGAGGAGCGGTCC­3? 434–417 Probe 5?­CCGCCCACCCCTCAGGAAACAT­3? 359–380 NR2B2 (GenBank accession number M84820) Forward primer 5?­TCTCCCTTTCCAGTCATCAGTTC­3? 391–413 Reverse primer 5?­CAGGGAGTGACACTGTTGAGTTAA­3? 508–485 Probe 5?­CCTGGTCTGCCCCCTCCAGCT­3? 427–447 NR2B3 (GenBank accession number U38480) Forward primer 5?­CCAGGAATCAACTTGGTTGC­3? 262–281 Reverse primer 5?­AAGGGCTTGATGTCCTCTGAA­3? 344–324 Probe 5?­CAGCTCTCAGCTAAATGTGGTCAACAGTGTCA­3? 288–319 NR2C1 (GenBank accession number M29960) Forward primer 5?­GCCACTTCTCAGCGATTCACA­3? 1098–1118 Reverse primer 5?­GCCTGGAAAGAAGGAATCGAA­3? 1247–1227 Probe 5?­CTCACCATGCCTTCTCCTATGCCTGAGT­3? 1132–1159 NR2C2 (GenBank accession number L27586) Forward primer 5?­AGTCTGCATCCCGTCTGCTTT­3? 1220–1240 Reverse primer 5?­GAGGGTGAAGAGCTCATTCCA­3? 1344–1324 Probe 5?­CTCTCAATGCACCGGGCAAGGTCAAT­3? 1243–1268 NR2E1 (GenBank accession number NMä003269) Forward primer 5?­GGAATAGCACAATGGGCCA­3? 685–703 Reverse primer 5?­TGTCACCGTTCATGCCAGAT­3? 754–735 Probe 5?­CCGGTTGATGCTAACACTCTACTGGCTG­3? 706–733 NR2E3 (GenBank accession number NMä016346) Forward primer 5?­AAACCTGTGCTAAGCTGGAGC­3? 542–562 Reverse primer 5?­GGGAGGAAGAGGAGTATGGAGA­3? 640–619 Probe 5?­TTGATGTCACCAGCAATGACCCTGAG­3? 584–609 NR2F1 (GenBank accession number NMä005654) Forward primer 5?­AGCACTACGGCCAATTCACCT­3? 287–307 Reverse primer 5?­GGCACGGCATGTGTAAGTTAA­3? 372–352 Probe 5?­CAAAAGTTTCTTCAAGAGGAGCGTCCGCA­3? 318–346 NR2F2 (GenBank accession number NMä021005) Forward primer 5?­CACCGTCTCCTCCTCAGTCA­3? 1113–1132 Reverse primer 5?­CATATCCCGGATGAGGGTTTC­3? 1197–1177 Probe 5?­AGAGCAATTGTTTTTCGTCCGTTTGGTAGGTA­3? 1134–1165 NR3A1 (GenBank accession number NMä000125) Forward primer 5?­AATCTGCCAAGGAGACTCGC­3? 530–549 Reverse primer 5?­GTGCACTGGTTGGTGGCTG­3? 683–665 Probe 5?­CTGTGCAGTGTGCAATGACTATGCTTCA­3? 552–579 NR3A2 (GenBank accession number NMä001437) Forward primer 5?­TGACCAAGTTGGCCGACAA­3? 893–911 Reverse primer 5?­TCCATCCAACAGCTCTCCAAG­3? 1010–990 Probe 5?­ATGATCAGCTGGGCCAAGAAGATTCCC­3? 925–951 NR3B1 (GenBank accession number NMä004451) Forward primer 5?­AGACAGCGGGCAAAGTGCT­3? 1169–1187 Reverse primer 5?­CAGTCCATCATGGCCTCGA­3? 1271–1253 Probe 5?­TGCCCATGCACAAGCTGTTCTTGG­3? 1223–1246 NR3C1 (GenBank accession number M10901) Forward primer 5?­AGCATGCCGCTATCGAAA­3? 1422–1439 140 Masuhiro NISHIMURA, et al.

Table 3. continued.

mRNA Sequence Position

Reverse primer 5?­CCTGTAGTGGCCTGCTGAATT­3? 1517–1497 Probe 5?­AGGCTGGAATGAACCTGGAAGCTCGAA­3? 1448–1474 NR3C2 (GenBank accession number M16801) Forward primer 5?­AACTGTGAAGGCAGCGGATT­3? 1447–1466 Reverse primer 5?­TCACCCCAACAATAGCAGAGG­3? 1549–1529 Probe 5?­AGCTATTACCCAGAGGCCAGCATCCCTT­3? 1501–1528 NR3C3 (GenBank accession number NMä000926) Forward primer 5?­GCATCGTTGATAAAATCCGC­3? 1826–1845 Reverse primer 5?­AGCAACAGCATCCAGTGCTCT­3? 1965–1945 Probe 5?­AACTGCCCAGCATGTCGCCTTAGAAAGTG­3? 1852–1880 NR3C4 (GenBank accession number NMä000044) Forward primer 5?­TGTCAACTCCAGGATGCTCTACTT­3? 2271–2294 Reverse primer 5?­ATTCGGACACACTGGCTGTACAT­3? 2363–2341 Probe 5?­CTGGTTTTCAATGAGTACCGCATGCACA­3? 2305–2332 NR4A1 (GenBank accession number L13740) Forward primer 5?­ACTTTGGGAAGGAAGATGCTG­3? 1181–1201 Reverse primer 5?­TTCGGATGACCTCCAGAGAA­3? 1255–1236 Probe 5?­ATGTACAGCAGTTCTACGACCTGCTCTCCG­3? 1205–1234 NR4A2 (GenBank accession number NMä006186) Forward primer 5?­ACCTTGCTTGTACCAAATGCC­3? 225–245 Reverse primer 5?­CTTGTAGTAAACCGACCCGGA­3? 369–349 Probe 5?­CAGCAGTCCTCCATTAAGGTAGAAGACATTCAG­3? 256–288 NR4A3 (GenBank accession number NMä006981) Forward primer 5?­CACTGAGATCACGGCTACAGC­3? 132–152 Reverse primer 5?­TTTGGTACACGCAGGAAGGC­3? 235–216 Probe 5?­TTCGTGGAGGGCTACTCGAGCAACT­3? 181–205 NR5A1 (GenBank accession number NMä004959) Forward primer 5?­GTCTGCCTCAAGTTCATCATCC­3? 1105–1126 Reverse primer 5?­TCCTGAGCGTCTTTCACCA­3? 1184–1166 Probe 5?­CAGCCTGGATTTGAAGTTCCTGAATAACCA­3? 1131–1160 NR5A2 (GenBank accession number NMä003822) Forward primer 5?­CTCATCCGAGCCAATGGACTT­3? 415–435 Reverse primer 5?­CAAGGCAGCATGGTTCAGA­3? 552–534 Probe 5?­CTAGAAGCCATGTCTCAGGTGATCCAAGCTA­3? 439–469 NR6A1 (GenBank accession number U64876) Forward primer 5?­TACGTGGCAGGAGCTAATCCT­3? 966–986 Reverse primer 5?­TTCATCGGAGGGCGAGTACTT­3? 1068–1048 Probe 5?­TGTCTTCCCTCACCGTTTACAGCAAGC­3? 989–1015 Cytochrome P450s CYP3A4* (GenBank accession number AF182273) Forward primer 5?­GATTGACTCTCAGAATTCAAAAGAAACTGA­3? 825–854 Reverse primer 5?­GGTGAGTGGCCAGTTCATACATAATG­3? 973–948 Probe 5?­AGGAGAGAACACTGCTCGTGGTTTCACAG­3? 946–918 CYP3A5* (GenBank accession number NMä000777) Forward primer 5?­CCTTACCCCAGTTTTTGAAGCA­3? 684–705 Reverse primer 5?­TCCAGATCAGACAGAGCTTTGTG­3? 881–859 Probe 5?­TTTCTTTCGAATTCTGGGAGTCAATCATC­3? 850–822 ATP­binding cassette transporters ABCA1* (GenBank accession number NMä005502) Forward primer 5?­AACAGCAGTTGGATGGCTTAGA­3? 1169–1190 Reverse primer 5?­CACAGAACCATTACTGGACTGGA­3? 1263–1241 Probe 5?­AAGACATCGTGGCGTTTTTGGCC­3? 1202–1224 ABCB1* (MDR1) (GenBank accession number NMä000927) Forward primer 5?­AGGAAGACATGACCAGGTATGC­3? 323–344 Reverse primer 5?­CCAACATCGTGCACATCAAAC­3? 506–486 Probe 5?­CCTGGCAGCTGGAAGACAAATACACAA­3? 411–437 ABCC1* (MRP1) (GenBank accession number NMä004996) Forward primer 5?­ACTCATTCAGCTCGTCTTGTCC­3? 546–567 Reverse primer 5?­TCAACCCTGTGATCCACCAGA­3? 682–662 Probe 5?­AGATCGCTCACCCCTGTTCTCGGAAA­3? 576–601 ABCC2* (MRP2) (GenBank accession number NMä000392) Forward primer 5?­ACGGACAGCTATCATGGCTTCT­3? 1176–1197 mRNA Expression Proˆles of Human Nuclear Receptors 141

Table 3. continued.

mRNA Sequence Position

Reverse primer 5?­TGGTCACATCCATGAGCTTCT­3? 1306–1286 Probe 5?­ACCCTATCCAACTTGGCCAGGAAGGAGT­3? 1216–1243 ABCC3* (MRP3) (GenBank accession number NMä003786) Forward primer 5?­CTTAAGACTTCCCCTCAACATGC­3? 1731–1753 Reverse primer 5?­GGTCAAGTTCCTCTTGGCTCA­3? 1837–1817 Probe 5?­TGTGTCTCTGAAACGGATCCAGCAATTC­3? 1788–1815

*Primers and probes were sequences employed in our previous study.57)

50 mLWtube. Ampliˆcation and detection were per­ expression proˆles of CYP3As and ABC­transporters. formed using the ABI PRISM 7700 Sequence Detector Analysis was conducted by RT­PCR using the ABI System (Applied Biosystems) with the following proˆle: PRISM 7700 Sequence Detector System in the presence 1 cycle at 489C for 30 min, 1 cycle at 959C for 10 min, of the TaqMan probe. For preparation of the nuclear and 40 cycles each at 959C for 15 sec and 609Cfor1 receptor calibration curves, the total RNA obtained min. For GAPDH, 200 nM forward primer, 200 nM from the brain (NR2B2, NR2B3, NR4A3, NR1B3, reverse primer, and 100 nM TaqMan probe were used, NR2E1, NR1F2, NR1B2), kidney (NR2A2, NR1I1), and for b­actin, 300 nM forward primer, 300 nM testis (NR6A1, NR2C2, NR3A2, NR5A1), and uterus reverse primer, and 200 nM TaqMan probe were used. (NR3C3) was used for the individual nuclear receptor Data analysis: Samples were deemed positive at any isoforms. The hepatic total RNA was used for the given cycle when the value of the emitted ‰uorescence calibration curve of other nuclear receptor isoforms. To was greater than the threshold value calculated by the prepare the calibration curve, various amounts ranging instrument's software (Sequence Detector Ver. 1.6.3). from 1.28to 100,000 pg total RNA were used. The The threshold cycle (Ct), which is deˆned as the cycle lower limit of the quantiˆcation of each mRNAs ranged at which PCR ampliˆcation reaches a signiˆcant value between 1.28pg and 4,000 pg of total RNA per 50 mLof (i.e., usually 15 times greater than the standard devia­ reaction mixture. The upper limit of the quantiˆcation tion of the baseline), is given as the mean value. The of each mRNA was higher than 100,000 pg of total relative expression of each mRNA was calculated by the RNA per 50 mL of reaction mixture (data not shown). DCt method (where DCt is the value obtained by sub­ Table 4 shows the relative amount of housekeeping tracting the Ct value of the PPIA mRNA from the Ct genes in each tissue. Data are expressed as the ratio of value of the target mRNA), which was employed in our the lowest value in each housekeeping gene. For exam­ previous studies.22,23) Speciˆcally, the amount of target ple, the expression of b­actin mRNA was 270­fold relative to the PPIA mRNA was expressed as 2|(DCt). higher in the thymus than in the lung, and the level of Data are expressed as the ratio of target mRNA to PPIA GAPDH mRNA expression was 603­fold higher in the mRNA. Studies were conducted in duplicate and data skeletal muscle than in the lung. Furthermore, the levels are shown as mean values. of b­actin,B2M,GAPDH,GUSB,HPPT1,PPIA,and TFRC mRNA expression were highest in the thymus, Results and Discussion spleen, skeletal muscle, testis, testis, thymus, and bone New chemical entities are routinely screened in vitro marrow, respectively. Thus, a tissue­speciˆc expression and in vivo for their ability to induce drug metabolizing proˆle in each housekeeping gene was observed. The enzymes and transporters in an attempt to predict drug mRNA expression of PPIA showed the lowest variabil­ interactions and in vivo clearance in human. Recently, ity among the 7 housekeeping genes. Therefore, in the nuclear receptors have been established as key factors present study, we considered that PPIA would be that regulate the expression of Phase I and Phase II suitable as an endogenous control for the measurement enzymes and transporters. The investigation of nuclear of nuclear receptor mRNAs. receptors is an important step forward in understanding Table 5 shows the values for human nuclear receptor the control mechanism of these enzymes and transport­ I mRNAs in various tissues. Both NR1A1 and NR1A2 ers. The establishment of a nuclear receptor­mediated mRNAs were expressed at high levels in the brain and screening system for new chemical entities by using skeletal muscle. NR1A1 mRNA was also expressed at cultured cells or human derived tissues will provide high level in the cerebellum; however, NR1A2 mRNA platforms to facilitate the new drug development. From was expressed at low levels in these tissues. NR1B1 this point of view, in the present study, we attempted to mRNA was expressed at high levels in the stomach, investigate the tissue­speciˆc mRNA expression proˆles small intestine, and colon, NR1B2 mRNA was ex­ of 43 nuclear receptors. We also provided the mRNA pressed at high levels in the skeletal muscle, prostate, 142 Masuhiro NISHIMURA, et al.

Table 4. Relative amounts of human housekeeping gene mRNAs in various tissues

Tissue b­actin B2M GAPDH GUSB HPRT1 PPIA TFRC

Liver 4.06 2.04 17.1 4.86 1.71 1.30 1.77 Kidney 1.82 1.00 15.6 3.13 3.81 1.87 3.96 Stomach 187 6.96 40.4 1.78 5.54 4.29 27.7 Small intestine 151 5.50 42.4 1.64 5.54 4.99 21.4 Colon 136 8.72 53.1 1.77 5.72 4.13 37.5 Adrenal gland 93.1 9.88 43.3 6.66 8.69 7.01 41.6 Lung 1.00 3.43 1.00 1.11 1.20 1.80 11.3 Heart 4.06 3.93 40.6 1.00 1.00 1.02 1.00 Brain 30.7 1.11 144 3.84 35.1 10.4 21.5 Cerebellum 66.9 1.31 144 6.96 26.8 8.20 61.2 Skeletal muscle 9.78 1.45 603 1.05 2.58 1.00 47.7 Spleen 234 24.3 23.3 6.48 6.04 4.26 16.2 Thymus 270 14.7 70.0 9.68 14.1 12.0 43.7 Thyroid gland 90.2 8.03 53.4 10.6 10.1 6.70 16.6 Prostate 55.9 13.4 38.7 8.22 8.69 7.34 23.3 Testis 39.4 2.91 53.8 28.7 124 8.14 74.0 Uterus 66.5 7.59 31.2 8.63 6.66 6.41 25.6 Placenta 43.9 7.67 39.0 16.3 3.76 5.80 334 Bone marrow 158 12.3 75.3 8.08 12.5 5.15 422 Trachea 115 12.6 49.5 5.72 5.24 4.53 27.6 Salivary gland 34.1 3.97 34.2 3.22 2.14 3.26 7.84

Data are expressed as the ratio of the lowest value in each housekeeping gene. Total RNA of 50,000 pg per 50 mL of the reaction mixture was used in each tissue. Experiments were performed in duplicate. B2M, b­2 microglobulin; GAPDH, glyceraldehyde­3­phosphae dehydrogenase; GUSB, b­glucuronidase; HPRT1, hypoxanthine phosphoribosyltransferase; PPIA, peptidylprolylisomerase A; TFRC, transferrin receptor.

and placenta, and NR1B3 mRNA was expressed at high widely expressed in adult tissues. Similar to the ˆndings levels in the skeletal muscle, uterus, and trachea. of another study in the mouse,4) NR1F1 mRNA was Peroxisome proliferators­activated receptors (PPARs) more widely expressed in adult tissues. Consistent with are members (NR1Cs) of the nuclear hormone receptor the ˆndings of another study,5) NR1F2 mRNA was superfamily that can be activated by various xenobiotics abundantly expressed in the brain. Similar to the ˆnd­ and natural fatty acids. To date, three subtypes of ings of other studies,6,7) NR1F3 mRNA was also ex­ NR1Cs (PPARs) have been described in amphibians, pressed at high levels in skeletal muscle and liver. Both rodents, and humans: NR1C1 (PPARa), NR1C2 the NF1F1 and 1F3 mRNA levels were the highest in the (PPARb,NUC1),andNR1C3(PPARg).2,24–28) The skeletal muscle, but NR1F2 mRNA levels were the mRNA expression of 3 NR1C subtypes (NR1C1, 1C2, highest in the brain. Consistent with the ˆndings of and 1C3) was successfully detected in all of the tissues another study,32) the NR1H2 mRNA was widely ex­ by this method. Similar to the ˆndings of other pressed in many tissues. The NR1H3 mRNA was ex­ studies.2,3) NR1C1 mRNA was expressed at high levels in pressed at high levels in the liver, as reported previous­ the liver, kidney, and skeletal muscle. Issemann and ly.33) NR1H4 mRNA expression was the lowest in many Green2) reported that NR1C1 mRNA is expressed at tissues. NR1I1 mRNA was expressed at high levels in high levels in the liver, kidney, and heart in the mouse. the kidney, small intestine and colon, with low levels of Braissant et al.3) also reported that NR1C1 mRNA is expression in other tissues. Consistent with the ˆndings expressed at high levels in the liver and kidney in the rat. of other studies,34–36) NR1I2 mRNA was expressed at Similar to the ˆndings of another study in the rat,3) high levels in the liver, small intestine and colon, with NR1C2 mRNA was more widely expressed in adult low levels of expression in other tissues. NR1I3 mRNA tissues, and particularly high levels of NR1C2 mRNA was expressed at high levels in the liver and kidney, with were detected in the skeletal muscle and placenta. no or very weak expression in other tissues. The results NR1C3 mRNA was also more widely expressed in adult for NR1I3 were similar to those reported in the litera­ tissues, and particularly high levels of NR1C3 mRNA ture.37,38) were detected in the placenta. Braissant et al.3) reported Table 6 shows the values for human nuclear receptor that NR1C3 mRNA is expressed at high levels in the II mRNAs in various tissues. Consistent with the previ­ spleen. Consistent with the ˆndings of other studies in ous studies in human subjects8) and the rat,9,10) NR2A1 human subjects29) and the mouse,4,30,31) both NR1D1 (HNF4a) mRNA was expressed at very high levels in the (Rev­Erba) and NR1D2 (Rev­Erbb) mRNAs were more liver, kidney and colon. NR2A2 mRNA was detected in mRNA Expression Proˆles of Human Nuclear Receptors 143

Table 5. Expression for human nuclear receptor I gene mRNAs in various tissues

Tissue NR1A1 NR1A2 NR1B1 NR1B2 NR1B3 NR1C1

Liver 0.00936 0.0186 0.000301 0.000862 0.00446 0.0513 Kidney 0.0775 0.0161 0.000305 0.00158 0.0105 0.0377 Stomach 0.0453 0.0144 0.0175 0.00126 0.0151 0.0129 Small intestine 0.0720 0.00678 0.0230 0.000280 0.00471 0.0207 Colon 0.0802 0.0111 0.0340 0.000279 0.00840 0.0161 Adrenal gland 0.0554 0.0124 0.000375 0.00214 0.0159 0.0198 Lung 0.0497 0.0109 0.00115 0.000836 0.0150 0.00737 Heart 0.0981 0.00919 0.000877 0.000977 0.0161 0.0146 Brain 0.131 0.0424 0.000119 0.00243 0.00246 0.00523 Cerebellum 0.253 0.00678 0.000371 0.000319 0.0133 0.00729 Skeletal muscle 0.372 0.171 0.00220 0.00685 0.0301 0.270 Spleen 0.0177 0.0125 0.00138 0.00233 0.0115 0.0116 Thymus 0.0127 0.00468 0.000292 0.000252 0.00590 0.00501 Thyroid gland 0.0542 0.00952 0.000523 0.00380 0.0197 0.0132 Prostate 0.0369 0.0265 0.000357 0.00461 0.0189 0.0154 Testis 0.0573 0.00344 0.00224 0.000532 0.0127 0.00770 Uterus 0.0764 0.0171 0.000914 0.00402 0.0484 0.0124 Placenta 0.0231 0.0140 0.000490 0.00632 0.0166 0.00803 Bone marrow 0.0158 0.00299 0.000672 0.000148 0.00366 0.00590 Trachea 0.0370 0.0196 0.00140 0.00345 0.0472 0.0120 Salivary gland 0.0364 0.00942 0.000308 0.00321 0.0199 0.0128

Tissue NR1C2 NR1C3 NR1D1 NR1D2 NR1F1 NR1F2

Liver 0.00493 0.00279 0.00936 0.00731 0.0346 0.0000190 Kidney 0.0237 0.00891 0.0234 0.00648 0.0295 0.000715 Stomach 0.0290 0.0138 0.0285 0.0256 0.0146 0.000943 Small intestine 0.0160 0.00523 0.0389 0.00648 0.00834 0.0000866 Colon 0.0372 0.0208 0.0347 0.00626 0.00952 0.000175 Adrenal gland 0.0175 0.00327 0.0649 0.00985 0.0981 0.00285 Lung 0.0122 0.00969 0.0102 0.00463 0.0409 0.000274 Heart 0.0203 0.00617 0.0161 0.00630 0.0160 0.000772 Brain 0.0139 0.00120 0.0373 0.0138 0.0116 0.0225 Cerebellum 0.0266 0.00189 0.124 0.0342 0.0623 0.00256 Skeletal muscle 0.0693 0.00781 0.210 0.0994 0.154 0.000448 Spleen 0.0217 0.00843 0.0230 0.0230 0.0245 0.0000903 Thymus 0.00744 0.00238 0.00923 0.00558 0.00814 0.00166 Thyroid gland 0.0283 0.00823 0.0875 0.0409 0.0228 0.000738 Prostate 0.0156 0.00643 0.0352 0.0190 0.0200 0.00659 Testis 0.0269 0.0108 0.0414 0.0188 0.0612 0.00141 Uterus 0.0154 0.00864 0.0708 0.0294 0.0321 0.0145 Placenta 0.0811 0.0417 0.0105 0.0177 0.0319 0.00422 Bone marrow 0.00795 0.00469 0.00643 0.00545 0.0176 0.000296 Trachea 0.0205 0.00425 0.136 0.0203 0.0290 0.000827 Salivary gland 0.0101 0.00130 0.115 0.0187 0.00773 0.000206

the liver, kidney, stomach, small intestine, colon, and bone marrow, and consistent with the ˆndings of prostate, testis, uterus, and trachea.The mRNA expres­ another study in the mouse.40) NR2E1 showed the sion of the NR2B1, 2B2, and 2B3 was successfully highest level of mRNA expression in the brain.NR2E3 detected in all of the tissues by the present method, and mRNA was detected in the stomach, small intestine, the results obtained were similar to those reported in colon, adrenal gland, thyroid gland, prostate, testis, rodents.11,12) The mRNA expression of the NR2C1 and uterus, trachea, and salivary gland.The mRNA expres­ 2C2 was successfully detected in all of the tissues in the sion of the NR2F1 and 2F2 was successfully detected in present study, and the NR2C1 and 2C2 mRNA levels all of the tissues in the present study. were the highest in the testis and skeletal muscle, respec­ Table 7 shows the values for human nuclear receptor tively.The results for NR2C2 were similar to those III mRNAs in various tissues.Both NR3A1 and NR3A2 reported in the literature.39) NR2E1 mRNA was detected mRNAs were widely expressed, but at reduced levels. in the adrenal gland, brain, cerebellum, testis, placenta, NR3B1 mRNA was widely expressed, with the highest 144 Masuhiro NISHIMURA, et al.

Table 5. continued.

Tissue NR1F3 NR1H2 NR1H3 NR1H4 NR1I1 NR1I2 NR1I3

Liver 0.146 0.0938 0.0249 0.00913 0.000288 0.125 0.0442 Kidney 0.0442 0.155 0.0138 0.00410 0.0191 0.000145 0.0137 Stomach 0.00800 0.0529 0.0104 0.000415 0.00711 0.00113 0.0000041 Small intestine 0.00643 0.0274 0.0123 0.00744 0.0273 0.0266 0.000612 Colon 0.00478 0.0417 0.0136 0.00137 0.0329 0.0165 BLQ Adrenal gland 0.00570 0.122 0.00483 0.0116 0.0136 0.000106 0.0000277 Lung 0.0354 0.139 0.00605 0.0000185 0.00468 0.0000068 0.0000082 Heart 0.0213 0.275 0.0198 BLQ 0.000827 0.0000077 BLQ Brain 0.000101 0.0619 0.00146 0.0000197 0.0000133 0.0000177 0.0000126 Cerebellum 0.00598 0.122 0.00247 0.0000014 0.0000925 0.0000276 BLQ Skeletal muscle 0.529 0.755 0.00692 0.000236 0.000748 0.00118 0.000231 Spleen 0.00208 0.153 0.0140 0.000104 0.00181 0.0000300 BLQ Thymus 0.0484 0.0589 0.00281 0.0000183 0.000500 0.0000095 0.0000038 Thyroid gland 0.0401 0.112 0.00517 0.0000068 0.00165 0.000105 0.0000012 Prostate 0.0331 0.112 0.00377 0.000159 0.00135 0.0000568 0.0000132 Testis 0.0303 0.154 0.0216 0.000722 0.00137 0.000430 0.000200 Uterus 0.0112 0.0977 0.00450 0.000312 0.000647 0.0000346 BLQ Placenta 0.000233 0.160 0.0114 0.0000201 0.00260 0.0000085 0.0000900 Bone marrow 0.000464 0.100 0.00267 0.0000592 0.00508 0.0000042 BLQ Trachea 0.0244 0.109 0.00455 0.0000274 0.00392 0.000192 0.0000141 Salivary gland 0.0360 0.0775 0.00397 0.0000023 0.00131 0.0000335 BLQ

BLQ, below the limit of quantiˆcation. Data are expressed as the ratio of target mRNA to PPIA mRNA. Experiments were performed in duplicate.

Table 6. Expression for human nuclear receptor II gene mRNAs in various tissues

Tissue NR2A1 NR2A2 NR2B1 NR2B2 NR2B3 NR2C1 NR2C2 NR2E1 NR2E3 NR2F1 NR2F2

Liver 0.225 0.00714 0.136 0.0120 0.0000948 0.00113 0.000656 BLQ BLQ 0.00574 0.0202 Kidney 0.512 0.0331 0.0420 0.0172 0.000102 0.00137 0.00120 BLQ BLQ 0.0201 0.0647 Stomach 0.0387 0.00523 0.0135 0.00690 0.000406 0.00204 0.000334 BLQ 0.000219 0.0143 0.0884 Small intestine 0.120 0.0408 0.0218 0.00331 0.000750 0.000761 0.000219 BLQ 0.000179 0.00250 0.0285 Colon 0.208 0.00962 0.0245 0.00392 0.000575 0.000511 0.000162 BLQ 0.0000909 0.00217 0.0377 Adrenal gland 0.000542 BLQ 0.0335 0.0139 0.000520 0.00227 0.00192 0.000148 0.000442 0.0263 0.0636 Lung 0.000534 BLQ 0.0217 0.0109 0.00476 0.000573 0.00121 BLQ BLQ 0.0321 0.0379 Heart BLQ BLQ 0.0436 0.0317 0.00409 0.00128 0.00177 BLQ BLQ 0.00302 0.0464 Brain 0.0000594 BLQ 0.00709 0.0137 0.00252 0.00144 0.00142 0.00476 BLQ 0.0202 0.00535 Cerebellum 0.0000170 BLQ 0.00757 0.0354 0.000722 0.00564 0.00517 0.0000348 BLQ 0.0364 0.00926 Skeletal muscle 0.00367 BLQ 0.311 0.0708 0.132 0.0140 0.00556 BLQ BLQ 0.00362 0.0679 Spleen 0.000104 BLQ 0.0289 0.0178 0.000237 0.00333 0.00109 BLQ BLQ 0.00652 0.133 Thymus 0.000108 BLQ 0.00650 0.00737 0.0000666 0.00168 0.00140 BLQ BLQ 0.00149 0.00687 Thyroid gland 0.000119 BLQ 0.0343 0.0193 0.000416 0.00551 0.00145 BLQ 0.000480 0.00524 0.0359 Prostate 0.000308 0.00124 0.0239 0.0133 0.000710 0.00357 0.00124 BLQ 0.00191 0.0168 0.0623 Testis 0.00568 0.00929 0.0203 0.0149 0.000769 0.0238 0.00367 0.000165 0.00187 0.00789 0.0769 Uterus 0.00149 0.000338 0.0165 0.00846 0.000899 0.00929 0.00115 BLQ 0.000306 0.0382 0.237 Placenta 0.000181 BLQ 0.0278 0.0134 0.000500 0.00554 0.00235 0.0000154 BLQ 0.0533 0.0733 Bone marrow 0.0000189 BLQ 0.0474 0.00584 0.0000393 0.00175 0.00109 0.0000260 BLQ 0.00221 0.00498 Trachea 0.000298 0.00267 0.0320 0.0126 0.000651 0.00141 0.00114 BLQ 0.000921 0.00800 0.0684 Salivary gland 0.0000842 BLQ 0.0201 0.0125 0.000431 0.000807 0.00107 BLQ 0.000538 0.00300 0.0169

BLQ, below the limit of quantiˆcation. Data are expressed as the ratio of target mRNA to PPIA mRNA. Experiments were performed in duplicate. level of expression in the skeletal muscle. The results for widely expressed. NR3B1 were similar to those reported in the mouse.41) Table 9 shows the values for human nuclear receptor NR3C1, 3C2, 3C3, and 3C4 mRNAs were widely V mRNAs in various tissues. NR5A1 mRNA was expressed. expressed at high levels in the adrenal gland, heart, Table 8 shows the values for human nuclear receptor spleen, and testis, with no or very weak expression in IV mRNAs in various tissues. Similar to the ˆndings of other tissues. The results for NR5A1 were similar to other studies,13–16) NR4A1, 4A2, and 4A3 mRNAs were those reported in the literature.42–44) NR5A2 mRNA was mRNA Expression Proˆles of Human Nuclear Receptors 145

Table 7. Expression for human nuclear receptor III gene mRNAs in various tissues

Tissue NR3A1 NR3A2 NR3B1 NR3C1 NR3C2 NR3C3 NR3C4

Liver 0.0122 0.0000191 0.0772 0.0173 0.00904 BLQ 0.110 Kidney 0.00199 0.000460 0.225 0.0115 0.0188 0.000295 0.0100 Stomach 0.000179 0.000934 0.0393 0.0283 0.0189 0.00128 0.00532 Small intestine BLQ 0.000186 0.0600 0.0130 0.0197 0.000686 0.00175 Colon BLQ 0.000402 0.0643 0.0109 0.0540 0.000727 0.00387 Adrenal gland 0.00188 0.00373 0.0390 0.0157 0.00926 0.00156 0.00266 Lung 0.000312 0.000154 0.0324 0.0191 0.0118 0.000658 0.00719 Heart 0.000589 0.000513 0.182 0.0132 0.00465 0.00133 0.00870 Brain BLQ 0.000120 0.0233 0.0226 0.00662 0.0000439 0.00111 Cerebellum BLQ 0.000452 0.0482 0.0522 0.0236 0.0000571 0.00124 Skeletal muscle 0.0156 0.000571 0.973 0.289 0.0479 0.000612 0.0703 Spleen 0.00248 0.00145 0.0319 0.0479 0.0160 0.00141 0.00211 Thymus 0.000947 0.00268 0.0193 0.0321 0.00584 0.0000554 0.00388 Thyroid gland 0.00353 0.000165 0.0363 0.0440 0.0522 0.000810 0.00734 Prostate 0.00435 0.000189 0.0273 0.0502 0.0112 0.00310 0.0600 Testis 0.00324 0.00876 0.0390 0.0495 0.0131 0.00316 0.0278 Uterus 0.0474 0.000527 0.0215 0.0746 0.0128 0.0878 0.0595 Placenta 0.0000961 0.0000339 0.0708 0.0778 0.0138 0.000705 0.000672 Bone marrow 0.00103 0.000253 0.0294 0.0450 0.00338 0.0000439 0.000460 Trachea 0.00554 0.000833 0.0632 0.0378 0.0219 0.00143 0.0136 Salivary gland 0.000406 0.000314 0.125 0.0144 0.0231 0.00371 0.00178

BLQ, below the limit of quantiˆcation. Data are expressed as the ratio of target mRNA to PPIA mRNA. Experiments were performed in duplicate.

Table 8. Expression for human nuclear receptor IV gene mRNAs in Table 9. Expression for human nuclear receptor V gene mRNAs in various tissues various tissues

Tissue NR4A1 NR4A2 NR4A3 Tissue NR5A1 NR5A2

Liver 0.00285 0.000416 0.000452 Liver 0.00191 0.00272 Kidney 0.0353 0.000527 0.00200 Kidney BLQ 0.0000220 Stomach 0.0223 0.00249 0.00358 Stomach BLQ 0.0000765 Small intestine 0.0110 0.000695 0.00121 Small intestine BLQ 0.000790 Colon 0.0185 0.000990 0.00131 Colon BLQ 0.000559 Adrenal gland 0.378 0.0220 0.0794 Adrenal gland 0.326 0.0000210 Lung 0.346 0.00510 0.0166 Lung 0.0000351 0.000871 Heart 0.0349 0.000507 0.00387 Heart 0.195 0.0000269 Brain 0.0133 0.00136 0.00381 Brain 0.000181 BLQ Cerebellum 0.0183 0.00615 0.00600 Cerebellum 0.000106 BLQ Skeletal muscle 1.25 0.0412 0.392 Skeletal muscle 0.0000736 0.000181 Spleen 0.0506 0.00588 0.0176 Spleen 0.177 0.0000197 Thymus 0.0239 0.00106 0.00873 Thymus 0.000774 0.0000389 Thyroid gland 0.120 0.00339 0.0109 Thyroid gland 0.0000198 0.0000845 Prostate 0.291 0.00702 0.0143 Prostate 0.000418 0.000210 Testis 0.0954 0.00259 0.00814 Testis 0.0492 0.000261 Uterus 0.166 0.00233 0.0165 Uterus 0.0000535 0.00154 Placenta 0.0201 0.000715 0.00337 Placenta 0.0000288 0.0000522 Bone marrow 0.0253 0.0107 0.00789 Bone marrow 0.000366 0.0000571 Trachea 0.440 0.0266 0.0286 Trachea 0.000148 0.000177 Salivary gland 0.182 0.0131 0.00787 Salivary gland 0.0000151 0.0000137

Data are expressed as the ratio of target mRNA to PPIA mRNA. BLQ, below the limit of quantiˆcation. Data are expressed as the ratio Experiments were performed in duplicate. of target mRNA to PPIA mRNA. Experiments were performed in duplicate. not expressed or was expressed at very low levels in expressed, and consistent with the ˆndings of another many tissues. The results for NR5A2 were similar to study in humans,17) NR6A1 mRNA expression was the those reported in the literature.42,45,46) highest in the testis, with very weak expression in other Table 10 shows the values for human nuclear receptor tissues. VI mRNAs in various tissues. NR6A1 was widely The induction of CYP3A by xenobiotics was regulat­ 146 Masuhiro NISHIMURA, et al. edby NR1I2. 47) Westlind­Johnsson et al.48) founda Both CYP3A4 andNR1I2 mRNA were expressedhighly signiˆcant coregulation of the CYP3A transcripts and in the liver andsmall intestine ( Tables 5 and 11). of NR1I2 mRNA. Thus, NR1I2 is a key factor in the CYP3A5 mRNA was expressedhighly in the liver and regulation of both CYP3A4 andCYP3A5 in human. prostate (Table 11), however, NR1I2 mRNA expression in the prostate was low (Table 5). Xie et al.49) reported that NR1I2 is an essential mediator of CYP3A Table 10. Expression for human nuclear receptor VI gene mRNAs xenoregulation using NR1I2­null mice. NR1I2 can also in various tissues regulate the expression of ABCB1 (trivial name of MDR1) encoding the P­glycoprotein.50,51) However, Tissue NR6A1 Wolbold et al.52) showedthat the constitutive NR1I2 Liver 0.00106 expression level did not correlate with the extent of Kidney 0.00208 CYP3A4 or ABCB1 induction after rifampicin treat­ Stomach 0.000735 ment in human. ABCB1 mRNA was expressedhighly in Small intestine 0.00264 Colon 0.00345 the adrenal glandandplacenta ( Table 11), however, Adrenal gland 0.00245 NR1I2mRNAexpressioninbothtissueswaslow Lung 0.00196 (Table 5). These ˆndings indicate that other nuclear Heart 0.000844 receptor(s) may be of great importance in CYP3As andW Brain 0.000871 or ABCB1 mRNA expression. ABCA1 expression cor­ Cerebellum 0.00278 Skeletal muscle 0.00473 relates with the expression level of nuclear receptors, Spleen 0.000980 NR1H2 andNR1H3. 53,54) Both ABCA1 andthese Thymus 0.000383 nuclear receptors were widely expressed in many tissues Thyroidgland 0.00843 (Tables 5 and 11). Hast et al.55) reportedthat the Prostate 0.00184 ABCC2 (trivial name of MRP2) was regulatedby three Testis 0.0689 Uterus 0.00173 distinct nuclear receptors (NR1H4, NR1I2 and NR1I3). Placenta 0.00517 The level of ABCC2 mRNA expression was highest in Bone marrow 0.00285 the liver (Table 11), andNR1H4, NR1I2 andNR1I3 Trachea 0.00338 mRNA were expressedat high levels in the liver Salivary gland0.00158 (Table 5). Teng et al.56) reportedthat NR1I2 was in­ Data are expressedas the ratio of target mRNA to PPIA mRNA. volvedin the regulation of ABCC3 (trivial name of Experiments were performedin duplicate. MRP3) mRNA expression. ABCC1 (trivial name of

Table 11. Expression for human cytochrome P450s andABC transporters mRNAs in various tissues

Tissue CYP3A4 CYP3A5 ABCA1 ABCB1 ABCC1 ABCC2 ABCC3

Liver 0.0652 0.00523 0.113 0.00524 0.00197 0.0811 0.161 Kidney 0.000140 0.000738 0.0247 0.00417 0.00461 0.0223 0.0171 Stomach 0.0000805 0.000633 0.0141 0.000499 0.0113 0.000328 0.0368 Small intestine 0.0135 0.000373 0.00697 0.00404 0.00295 0.00628 0.0150 Colon 0.0000070 0.000249 0.0220 0.00267 0.00476 0.000119 0.0593 Adrenal gland 0.000559 0.00132 0.179 0.180 0.0106 0.000488 0.156 Lung 0.0000030 BLQ 0.104 0.0000964 0.00800 0.000210 0.00530 Heart BLQ BLQ 0.0672 0.000149 0.0117 0.000125 0.00719 Brain 0.0000025 BLQ 0.00450 0.00260 0.00138 0.0000845 0.000110 Cerebellum BLQ BLQ 0.00867 0.00377 0.00406 0.000480 0.000122 Skeletal muscle 0.000415 BLQ 0.0711 0.000777 0.0495 0.00324 0.00115 Spleen BLQ BLQ 0.0456 0.00721 0.0208 0.000937 0.0140 Thymus 0.0000762 0.000172 0.0466 0.00153 0.0205 0.00147 0.00284 Thyroidgland 0.0000019 BLQ 0.0254 0.00236 0.0146 0.000459 0.00294 Prostate 0.0000396 0.00196 0.0170 0.00381 0.0131 0.000495 0.00873 Testis 0.000118 BLQ 0.0367 0.00226 0.0320 0.00187 0.00417 Uterus 0.0000034 0.000269 0.0374 0.0151 0.00820 0.000540 0.00500 Placenta 0.0000059 0.000154 0.115 0.0291 0.00607 0.00248 0.00512 Bone marrow 0.0000034 BLQ 0.0132 0.00205 0.0150 0.000439 0.00632 Trachea 0.0000126 0.000452 0.0285 0.00219 0.0267 0.000557 0.0101 Salivary gland0.0000030 BLQ 0.00798 0.000415 0.00280 0.000375 0.00288

BLQ, below the limit of quantiˆcation. Data are expressedas the ratio of target mRNA to PPIA mRNA. Experiments were performedin dupli­ cate. mRNA Expression Proˆles of Human Nuclear Receptors 147

MRP1) and ABCC3 mRNA were expressed at high L­type pyruvate kinase gene and the hepatocyte nuclear levels in the adrenal gland and thymus (Table 11). On factor 4 transcription factor in exocrine and endocrine the other hand, NR1I2 mRNA was expressed at low pancreas. J. Biol. Chem., 269: 8944–8951 (1994). levels in both tissues (Table 5), suggesting that another 11) Mangelsdorf, D. J., Borgmeyer, U., Heyman, R. A., nuclear receptor(s) may also be of importance in the Zhou, J. Y., Ong, E. S., Oro, A. E., Kakizuka, A. and mRNA expression of ABC transporters. Evans, R. M.: Characterization of three RXR genes that mediate the action of 9­cis retinoic acid. Genes Dev., 6: This study has provided information concerning the 329–344 (1992). tissue­speciˆc proˆles of mRNA expression of 43 12) Liu, Q. and Linney, E.: The mouse retinoid­X receptor­ human nuclear receptors, CYP3A4, CYP3A5 and ABC g gene: genomic organization and evidence for function­ transporters. There is a considerable degree of cross talk al isoforms. Mol. Endocrinol., 7: 651–658 (1993). between receptors and proteins, thus the process of 13) Milbrandt, J.: Nerve growth factor induces a gene constitutive expression and induction of drug homologous to the glucocorticoid receptor gene. Neu­ metabolizing enzymes and transporters is not a single ron, 1: 183–188 (1988). receptor­protein relationship. Our ˆndings in various 14) Bandoh, S., Tsukada, T., Maruyama, K., Ohkura, N. human tissues in the present study would provide and Yamaguchi, K.: DiŠerential expression of NGFI­B valuable information for understanding the relationship and RNR­1 genes in various tissues and developing brain between the nuclear receptors and enzymes, especially in of the rat: comparative study by quantitative reverse transcription­polymerase chain reaction. J. Neuroen­ the research ˆeld of drug development. docrinol., 9: 3–8 (1997). References 15) Labelle, Y., Zucman, J., Stenman, G., Kindblom, L.­ G., Knight, J., Turc­Carel, C., Dockhorn­Dworniczak, 1) Nuclear Receptor Nomenclature Committee: A uniˆed B., Mandahl, N., Desmaze, C., Peter, M., Aurias, A., nomenclature system for the nuclear receptor superfami­ Delattre, O. and Thomas, G.: Oncogenic conversion of ly. Cell, 97: 161–163 (1999). a novel orphan nuclear receptor by chromosome translo­ 2) Issemann, I. and Green, S.: Activation of a member of cation. Hum. Mol. Genet., 4: 2219–2226 (1995). the steroid hormone receptor superfamily by peroxisome 16) Maruyama, K., Tsukada, T., Bandoh, S., Sasaki, K., proliferators. Nature, 347: 645–650 (1990). Ohkura, N. and Yamaguchi, K.: Expression of the 3) Braissant, O., Foufelle, F., Scotto, C., Dauca, M. and putative transcription factor NOR­1 in the nervous, the Wahli, W.: DiŠerential expression of peroxisome endocrine and the immune systems and the developing proliferators­activated receptors (PPARs): Tissue distri­ brain of the rat. Neuroendocrinology, 65: 2–8 (1997). bution of PPAR­a,­b,and­g in the adult rat. En­ 17) Lei, W., Hirose, T., Zhang, L.­X., Adachi, H., docrinology, 137: 354–366 (1996). Spinella,M.J.,Dmitrovsky,E.andJetten,A.M.: 4) Retnakaran, R., Flock, G. and Giguere, V.: Identiˆca­ Cloning of the human orphan receptor germ cell nuclear tion of RVR, a novel orphan nuclear receptor that acts factorWretinoid receptor­related testis­associated recep­ as a negative transcriptional regulator. Mol. En­ tor and its diŠerential regulation during embryonal docrinol., 8: 1234–1244 (1994). carcinoma cell diŠerentiation. J. Mol. Endocrinol., 18: 5) Carlberg, C., van Huijsduijnen, R., Staple, J. K., 167–176 (1997). DeLamarter, J. F. and Becker­Andre,á M.: RZRs, a new 18) Waxman, D. J.: P450 gene induction by structurally family of retinoid­related orphan receptors that function diverse xenochemicals: central role of nuclear receptors as both monomers and homodimers. Mol. Endocrinol., CAR, PXR, and PPAR. Arch. Biochem. Biophys., 369: 8: 757–770 (1994). 11–23 (1999). 6) Ortiz, M. A., Piedraˆta, F. J., Pfahl, M. and Maki, R.: 19) Drocourt,L.,Ourlin,J.C.,Pascussi,J.M.,Maurel,P. TOR: a neworphan receptor expressed in the thymus and Vilarem, M. J.: Expression of CYP3A4, CYP2B6, that can modulate retinoid and thyroid hormone signals. and CYP2C9 is regulated by the vitamin D receptor Mol. Endocrinol., 9: 1679–1691 (1995). pathway in primary human hepatocytes. J. Biol. Chem., 7) Hirose, T., Smith, R. J. and Jetten, A. M.: RORg:the 277: 25125–25132 (2002). thirdmemberofRORWRZR orphan receptor subfamily 20) Pascussi, J. M., Drocourt, L., Gerbal­Chaloin, S., that is highly expressed in skeletal muscle. Biochem. Fabre, J. M., Maurel, P. and Vilarem, M. J.: Dual eŠect Biophys. Res. Commun., 205: 1976–1983 (1994). of dexamethasone on CYP3A4 gene expression in 8) Drewes, T., Senkel, S., Holewa, B. and RyŠel, G. U.: human hepatocytes. Eur. J. Biochem., 268: 6346–6357 Human hepatocyte nuclear factor 4 isoforms are (2001). encoded by distinct and diŠerentially expressed genes. 21) Sueyoshi, T., Kawamoto, T., Zelko, I., Honkakoski, P. Mol. Cell Biol., 16: 925–931 (1996). and Negishi, M.: The repressed nuclear receptor CAR 9) Sladek, F. M., Zhong, W., Lai, E. and Darnell, Jr. J. responds to phenobarbital in activating the human E.: Liver­enriched transcription factor HNF­4 is a novel CYP2B6 gene. J. Biol. Chem., 274: 6043–6046 (1999). member of the steroid hormone receptor superfamily. 22) Nishimura, M., Yaguti, H., Yoshitsugu, H., Naito, S. Genes Dev., 4: 2353–2365 (1990). and Satoh, T.: Tissue distribution of mRNA expression 10) Miquerol, L., Lopez, S., Cartier, N., Tulliez, M., of human cytochrome P450 isoforms assessed by high­ Raymondiean, M. and Kahn, A.: Expression of the sensitivity real­time reverse transcription PCR. 148 Masuhiro NISHIMURA, et al.

Yakugaku Zasshi, 123: 369–375 (2003). L.,Watson,M.A.,Jones,S.A.,McKee,D.D.,Oliver, 23) Nishimura, M., Ueda, N. and Naito, S.: EŠects of B.B.,Willson,T.M.,Zetterstrom,ä R. H., Perimann, T. dimethyl sulfoxide on the gene induction of cytochrome and Lehmann, J. M.: An orphan nuclear receptor P450 isoforms, UGT­dependent glucuronosyl trans­ activated by pregnanes deˆnes a novel steroid signaling ferase isoforms, and ABCB1 in primary culture of pathway. Cell, 92: 73–82 (1998). human hepatocytes. Biol. Pharm. Bull., 26: 1052–1056 36) Lehmann, J. M., McKee, D. D., Watson, M. A., (2003). Willson,T.M.,Moore,J.T.andKliewer,S.A.:The 24) Dreyer, C., Krey, G., Keller, H., Givel, F., Helftenbein, human orphan nuclear receptor PXR is activated by G. and Wahli, W.: Control of the peroxisomal beta­ compounds that regulate CYP3A4 gene expression and oxidation pathway by a novel family of nuclear hor­ cause drug interactions. J. Clin. Invest., 102: 1016–1023 mone receptors. Cell, 68: 879–887 (1992). (1998). 25) Gottlicher,ä M., Widmark, E., Li Q. and Gustafsson 37) Base, M., Gulick, T., Choi, H. S., Martinoli, M. G., J.­Å.: Fatty acids activate a chmera of the cloˆbric acid­ Simha, D. and Moore, D. D.: A new orphan member of activated receptor and the glucocorticoid receptor. Proc. the nuclear hormone receptor superfamily that interacts Natl. Acad. Sci. USA, 89: 4653–4657 (1992). with a subset of retinoic acid response elements. Mol. 26) Schmidt, A., Endo, N., Rutledge, S. J., Vogel, R., Cell Biol., 14: 1544–1551 (1994). Shinar, D. and Rodan, G. A.: Identiˆcation of a new 38) Choi,H.S.,Chung,M.,Tzameli,I.,Simha,D.,Lee,Y. member of the steroid hormone receptor superfamily K., Seol, W. and Moore, D. D.: DiŠerential transactiva­ that is activated by a peroxisome proliferators and fatty tion by two isoforms of the orphan nuclear hormone acids. Mol. Endocrinol., 6: 1634–1641 (1992). receptor CAR. J. Biol. Chem., 272: 23565–23571 (1997). 27) Sher, T., Yi, H. F., McBride, O. W. and Gonzalez, F. 39) Hirose, T., Fujimoto, W., Yamaai, T., Kim, K. H., J.: cDNA cloning, chromosomal mapping, and func­ Matsuura, H. and Jetten, A. M.: TAK1: molecular tional characterization of the human peroxisome cloning and characterization of a new member of the proliferators activated receptor. Biochemistry, 32: nuclear receptor superfamily. Mol. Endocrinol., 8: 5598–5604 (1993). 1667–1680 (1994). 28) Kliewer,S.A.,Forman,B.M.,Blumberg,B.,Ong,E. 40) Monaghan,A.P.,Grau,E.,Bock,D.andSchutz,ä G.: S., Borgmeyer, U., Mangelsdorf, D. J., Umesono, K. The mouse homolog of the orphan nuclear receptor and Evans, R. M.: DiŠerential expression and activation tailless is expressed in the developing forebrain. De­ of a family of murine peroxisome proliferators­activated velopment, 121: 839–853 (1995). receptors. Proc.Natl.Acad.Sci.USA, 91: 7355–7359 41) Sladek, R., Bader, J.­A. and Giguere,à V.: The orphan (1994). nuclear receptor estrogen­related receptor a is a tran­ 29) Dumas, B., Harding, H. P., Choi, H.­S., Lehmann, K. scriptional regulator of the human medium­chain acyl A.,Chung,M.,Lazar,M.A.andMoore,D.D.:Anew coenzyme a dehydrogenase gene. Mol. Cell Biol., 17: orphan member of the nuclear hormone receptor super­ 5400–5409 (1997). family closely related to Rev­Erb. Mol. Endocrinol., 8: 42) Boerboom, D., Pilon, N., Behdjani, R., Silversides, D. 996–1005 (1994). W. and Sirois, J.: Expression and regulation of tran­ 30) Forman,B.,Chen,J.,Blumberg,B.,Kliewer,S.A., scripts encoding two member of the NR5A nuclear Henshaw,R.,Ong,E.S.andEvans,R.M.:Cross­take receptor subfamily of orphan nuclear receptors, among RORa1 and the Rev­Erb family of orphan steroidogenic factor­1 and NR5A2, in equine ovarian nuclear receptors. Mol. Endocrinol., 8: 1253–1261 cells during the ovulatory process. Endocrinology, 141: (1994). 4647–4656 (2000). 31) Huchet,M.,Cassia,R.,Zakin,L.,Cereghini,S.and 43) Kimura, R., Yoshii, H., Nomura, M., Kotomura, N., Zakin, M.: The early expression of Rev­Erbb occurs in Mukai, T., Ishihara, S., Ohba, K., Yanase, T., Gotoh, the developing nervous systemof mouse embryo. Cell O., Nawata, H. and Morohashi, K.: Identiˆcation of Mol. Biol., 44: 553–556 (1998). novel ˆrst exons in Ad4BPWSF­1 (NR5A1) gene and 32) Shinar,D.M.,Endo,N.,Rutledge,S.J.,Vogel,R., their tissue­ and species­speciˆc usage. Biochem. Rodan, G. A. and Schmidt, A.: NER,anewmemberof Biophys. Res. Commun., 278: 63–71 (2000). the gene family encoding the human steroid hormone 44) Ramayya, M. S., Zhou, J., Kino, T., Segars, J. H., nuclear receptor. Gene, 147: 273–276 (1994). Bondy, C. A. and Chrousos, G. P.: Steroidogenic factor 33) Apfel, R., Benbrook, D., Lernhardt, E., Ortiz, M. A., 1 messenger ribonucleic acid expression in steroidogenic Salbert, G. and Pfahl, M.: A novel orphan receptor and nonsteroidogenic human tissues: Northern blot and speciˆc for a subset of thyroid hormone­responsive in situ hybridization studies. J. Clin. Endocrinol. elements and its interaction with the retinoid Wthyroid Metab., 82: 1799–1806 (1997). hormone receptor subfamily. Mol. Cell Biol., 14: 45) Nitta, M., Ku, S., Brown, C., Okamoto, A. Y. and 7025–7035 (1994). Shan, B.: CPF: an orphan nuclear receptor that regu­ 34) Zhang, H., LeCulyse, E., Liu, L., Hu, M., Matoney, lates liver­speciˆc expression of the human cholesterol L., Zhu, W. and Yan, B.: Rat pregnane X receptor: 7a­hydroxylase gene. Proc.Natl.Acad.Sci.USA, 96: molecular cloning, tissue distribution, and xenobiotic 6660–6665 (1999). regulation. Arch. Biochem. Biophys., 368: 14–22 (1999). 46) Wang, S. L., Yang, H., Xie, Y. H., Wang, Y., Li, J. Z., 35) Kliewer,S.A.,Moore,J.T.,Wada,L.,Staudinger,J. Wang,L.,Wang,Z.G.andFu,J.L.:Establishmentof mRNA Expression Proˆles of Human Nuclear Receptors 149

transgenic mice carrying the gene of human nuclear polymorphic and coordinately regulated. Drug Metab. receptor NR5A2 (hB1F). World J. Gastroenterol., 9: Rev., 33: 155 (2001). 1333–1336 (2003). 53) Costet,P.,Luo,Y.,Wang,N.,andTall,A.R.:Sterol­ 47) Quattrochi, L. C., and Guzelian, P. S.: CYP3A regula­ dependent transactivation of the ABC1 promoter by the tion: from pharmacology to nuclear receptors. Drug liver X receptorWretinoid X receptor. J. Biol. Chem., Metab. Dispos., 29: 615–622 (2001). 275: 28240–28245 (2000). 48) Westlind­Johnsson, A., Malmebo, S., Johansson, A., 54) Repa,J.J.,Turley,S.D.,Lobaccaro,J.A.,Medina, Otter, C., Andersson, T. B., Johansson, I., Edwards, R. J.,Li,L.,Lustig,K.,Shan,B.,Heyman,R.A., J., Boobis, A. R., and Ingelman­Sundberg, M.: Com­ Dietschy, J. M., and Mangelsdorf, D. J.: Regulation of parative analysis of CYP3A expression in human liver absorption and ABC1­mediated eŒux of cholesterol by suggests only a minor role for CYP3A5 in drug RXR heterodimers. Science, 289: 1524–1529 (2000). metabolism. Drug Metab. Dispos., 31: 755–761 (2003). 55) Kast,H.R.,Goodwin,B.,Tarr,P.T.,Jones,S.A., 49) Xie, W., Barwick, J. L., Downes, M., Blumberg, B., Anisfeld, A. M., Stoltz, C. M., Tontonoz, P., Kliewer, Simon, C. M., Nelson, M. C., Neuschwander­Tetri, B. S., Willson, T. M., and Edwards, P. A.: Regulation of A.,Brunt,E.M.,Guzelian,P.S.,andEvans,R.M.: multidrug resistance­associated protein 2 (ABCC2) by Humanized xenobiotic response in mice expressing the nuclear receptors pregnane X receptor, farnesoid X­ nuclear receptor SXR. Nature, 406: 435–439 (2000). activated receptor, and constitutive androstane receptor. 50) Synold,T.W.,Dussault,I.,andForman,B.M.:The J. Biol. Chem., 277: 2908–2915 (2002). orphan nuclear receptor SXR coordinately regulates 56) Teng, S., Jekerle, V., and Piquette­Miller, M.: Induc­ drug metabolism and eŒux. Nature Med., 7: 584–590 tion of ABCC3 (MRP3) by pregnane X receptor activa­ (2001). tors. Drug Metab. Dispos., 31: 1296–1299 (2003). 51) Geick, A., Eichelbaum, M., and Burk, O.: Nuclear 57) Nishimura, M., Yoshitsugu, H., Naito, S., and receptor response elements mediate induction of Hiraoka, I.: Evaluation of gene induction of drug­ intestinal MDR1 by rifampin. J. Biol. Chem., 276: metabolizing enzymes and transporters in primary 14581–14587 (2001). culture of human hepatocytes using high­sensitivity 52) Wolbold, R., Eichelbaum, M., and Burk, O.: Induction real­time reverse transcription PCR. Yakugaku Zasshi, of intestinal CYP3A4 and MDR1 by rifampin is 122: 339–361 (2002).