DOCSLIB.ORG

Note Tissuespeci€C Mrna Expression Pro€Les of Human Nuclear Receptor Subfamilies

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Note Tissuespeci€C Mrna Expression Pro€Les of Human Nuclear Receptor Subfamilies Drug Metab. Pharmacokin. 19(2): 135149(2004). Note Tissue­specic mRNA Expression Proles of Human Nuclear Receptor Subfamilies Masuhiro NISHIMURA1,*, Shinsaku NAITO1 and Tsuyoshi YOKOI2 1Department of Drug Metabolism, Division of Pharmacology, Drug Safety and Metabolism, Otsuka Pharmaceutical Factory, Inc., Tokushima, Japan 2Division of Drug Metabolism, Faculty of Pharmaceutical Sciences, Kanazawa University, Kanazawa, Japan Full text of this paper is available at http://www.jssx.org Summary: Pairs of forward and reverse primers and TaqMan probes specic to each human nuclear receptor were prepared. Analysis of the mRNA expression level of each target of 43 nuclear receptors in total RNA from single and pooled specimens of various human organs (liver, kidney, adrenal gland, lung, heart, brain, cerebellum, skeletal muscle, spleen, thymus, thyroid gland, prostate, testis, uterus, placen­ ta, bone marrow, trachea, and salivary gland) was performed by real­time reverse transcription PCR using an ABI PRISM 7700 sequence detector system. The mRNA expression of 33 nuclear receptors (NR1A1,1A2,1B1,1B2,1B3,1C1,1C2,1C3,1D1,1D2,1F1,1F2,1F3,1H2,1H3,1I1,1I2,2B1,2B2, 2B3, 2C1, 2C2, 2F1, 2F2, 3A2, 3B1, 3C1, 3C2, 3C4, 4A1, 4A2, 4A3, and 6A1) was successfully detected in all of the tissues by this method. NR1H4, 2A1, and 3C3 mRNAs were not detectable in the heart, heart, and liver, respectively. NR5A2 mRNA was not detectable in either the brain or cerebellum. NR3A1 mRNA was not detectable in the small intestine, colon, brain, and cerebellum. NR5A1 mRNA was not detectable in the kidney, stomach, small intestine, and colon. NR1I3 mRNA was detected in the liver, kidney, stomach, small intestine, adrenal gland, lung, brain, skeletal muscle, thymus, thyroid gland, prostate, testis, placenta, and trachea. NR2A2 mRNA was detected in the liver, kidney, prostate, testis, uterus, and trachea. NR2E1 mRNA was detected in the adrenal gland, brain, cerebellum, testis, placenta, and bone marrow. NR2E3 mRNA was detected in the adrenal gland, thyroid gland, prostate, testis, uterus, trachea, and salivary gland. This study provides information concerning the tissue distribution of the mRNA expression of 43 human nuclear receptors. The mRNA expression proles of CYP3A4, CYP3A5 and ABC­transporters are also shown. These results are valuable for establishing a nuclear receptor­mediated screening system for new chemical entities in new drug development. Key words: nuclear receptor; mRNA expression; tissue distribution; quantication experimental condition. Introduction Recently, a relationship between NR1C (PPAR) and Recently, nuclear receptors are established as im­ CYP4A was reported by Waxman.18) The NR1Is, such portant transcription factors that regulate such widely as VDR, PXR and CAR has been reported to be diverse physiological functions as the control of cell involved in the transcriptional regulation of CYP3A dierentiation and homeostasis as well as the expression (Drocourt et al.19) and Pascussi et al.20) Arelationship of Phase I and Phase II enzymes and transporters. Over between NR1I3 (CAR) and CYP2B was reported by 70 distinct members of the nuclear receptor superfamily Sueyoshi et al.21) A considerable degree of cross talk have been identied to date.1) The nomenclature is sum­ between nuclear receptors and drug metabolizing marized in Table 1. The tissue distributions of many enzymes and transporters would be expected to exist. In nuclear receptors such as the NR1Cs,2,3) NR1Fs,47) addition, the process of induction is not a single recep­ NR2As,810) NR2Bs,11,12) NR4As,1316) and NR6A117) have tor­protein relationship. Thus, the mRNA expression been reported. However, the tissue distribution of the proles of nuclear receptors constitute important infor­ mRNA expression of large numbers of human nuclear mation to study the regulation mechanisms of drug receptors has not been evaluated in the same metabolizing enzymes and transporters and to establish Received; August 29, 2003, Accepted; January 17, 2004 *To whomall correspondence should be addressed :MasuhiroNISHIMURA,Ph.D.,Division of Pharmacology, Drug Safety and Metabolism, Otsuka Pharmaceutical Factory, Inc., Naruto, Tokushima 772­8601, Japan. Tel. {81­88­685­1151 ext 335, Fax. {81­88­686­8176, E­mail: nisimumsotsukakj.co.jp 135 136 Masuhiro NISHIMURA, et al. Table 1. A Nomenclature for nuclear receptors Subfamily and Group Gene Name Trivial Name 1A NR1A1 THRA, TRa,c­erbA­1 NR1A2 THRB, TRb,c­erbA­2 1B NR1B1 RARA, RARa NR1B2 RARb,HAP NR1B3RAR g, RARD, RARG 1C NR1C1 PPARa NR1C2 PPARb, PPARd,NUC1,FAAR NR1C3PPAR g 1D NR1D1 RevErba, EAR1, EAR1A NR1D2 RevErbb,EARb, BD72, HZF2, RVR, EAR­1r 1F NR1F1 RORA, RORa,RZRa NR1F2 RORB, RORb,RZRb NR1F3RORC, ROR g,TOR 1H NR1H2 Ner­I, LXRb, UR, NER, RIP15, OR1 NR1H3LXR a,RLD1 NR1H4 HRR­1, FXR, RIP14 1I NR1I1 VDR NR1I2 PXR NR1I3CAR 2A NR2A1 HNF4A, HNF4a NR2A2 HNF4G, HNF4g 2B NR2B1 RXRa NR2B2 RXRb, H2RIIBP NR2B3RXR g 2C NR2C1 TR2, TR211, TR2a NR2C2 TR4, TR2b, TAK1, TR2R1 2E NR2E1 TLX, TLL NR2E3 2F NR2F1 COUP­TFa, COUP­TFI, COUPTFA, EAR3, SVP44 NR2F2 COUP­TFb, COUP­TFII, COUPTFB, ARP1, SVP40 3A NR3A1 ESR1 NR3A2 ESR2 3B NR3B1 ESRRA 3C NR3C1 GRa NR3C2 MR NR3C3 PGR NR3C4 AR 4A NR4A1 NGFI­B, NUR77, N10, TR3, NAK1, TIS1 NR4A2 NURR1, NOT, RNR1, HZF­3, TINUR, TR3b NR4A3NOR­1, MINOR, TEC, CHN 5A NR5A1 FTZ­F1, SF1, ELP, AD4BP NR5A2 FTF, LRH1, PHR1, CPF, FFLR 6A NR6A1 RTR, GCNF a nuclear receptor­mediated screening system for new from CLONTECH Laboratories, Inc. (Hilden, Palo chemical entities. Alto, CA, USA). The total RNA source information for The present study was therefore undertaken to inves­ these human tissues is shown in Table 2.YeasttRNA tigate the tissue distribution of mRNA expression of 43 was purchased from Life Technologies, Inc. (Rockville, human nuclear receptors, CYP3As and ABC­transport­ MD, USA), and the TaqMan One­Step RT­PCR Master ers using high­sensitivity real­time reverse transcription Mix Reagents Kit, TaqMan GAPDH Control Reagents PCR (RT­PCR). (Part No. 402869), TaqMan b­Actin Control Reagents (Part No. 401846), Micro Amp} Optical 96­Well Materials and Methods Reaction Plates, Optical Adhesive Covers, and Optical Materials: Pooled total RNA prepared from adult Cover Compression Pads were purchased from Applied human tissues (liver, kidney, adrenal gland, lung, heart, Biosystems (Foster City, CA, USA). All other chemicals brain, cerebellum, skeletal muscle, spleen, thymus, used in this study were of reagent grade. thyroid gland, prostate, testis, uterus, placenta, bone Oligonucleotides: The pairs of primers and the Taq­ marrow, trachea, and salivary gland) was purchased Man probes for the target mRNAs were designed from mRNA Expression Proles of Human Nuclear Receptors 137 Table 2. Total RNA source information for various tissues the human mRNA sequence (Table 3)usingPrimer Express software (Applied Biosystems). GenBank acces­ Tissue Pool size Age Sex Race sion number and position from the initiation codon are Liver 1 27 M A shown in Table 3. The primer andWor probe was homol­ Kidney1 32 M A ogysearched byan NCBI BLAST search to ensure that Stomach 1 50 M C Small intestine 5 2061 F, M C it was specic for the target mRNA transcript. The Colon 3 20, 35, 55 F, M C primers and TaqMan probes were synthesized by QIA­ Adrenal gland 62 1561 F, M C GEN (Tokyo, Japan). The TaqMan probes contained Lung 1 27 M A 6­carboxyuorescein (FAM) at the 5? end and 6­carbox­ Heart 1 25 M A ytetramethylrhodamine (TAMRA) at the 3? end and Brain 1 28 M A Cerebellum 24 1670 F, M C were designed to hybridize to a sequence located be­ Skeletal muscle 2 43, 46 F, M C tween the PCR primers. Spleen 14 3066 F, M C Experimental conditions for TaqMan RT­PCR: Thymus 9 1525 F, M C The total RNAs obtained from adult human tissues Thyroid gland 65 1561 F, M C were diluted with RNase­free water to 20 mgWmL, then Prostate 47 1457 M C Testis 19 1761 M C further diluted with 50 mgWmL yeast tRNA. To prepare Uterus 10 1577 F C the calibration curve, various amounts of 50 mgWmL Placenta 7 2235 F C yeast tRNA ranging from 1.28 to 100,000 pg total RNA Bone marrow 7 1854 F, M C were used. For the RT­PCR reaction, the TaqMan Trachea 1854 F, M C One­Step RT­PCR Master Mix Reagents Kit (Applied Salivarygland 24 1560 F, M C Biosystems) containing 300 nM forward primer, 900 nM ,nodata;F,female;M,male;C,Caucasian;A,Asian. reverse primer, and 200 nM TaqMan probe was used at Table 3. Primers and probes used for RT­PCR analysis. mRNA Sequence Position Housekeeping genes B2M (beta­2­microglobulin) (GenBank accession number NMä004048) Forward primer 5?­TGCTCGCGCTACTCTCTCTTT­3? 2646 Reverse primer 5?­ATGTCGGATGGATGAAACCC­3? 164145 Probe 5?­CCTGGAGGCTATCCAGCGTACTCCAAAGAT­3? 5180 GUSB (glucuronidase, beta) (GenBank accession number NMä000181) Forward primer 5?­TCTGTCAAGGGCAGTAACCTG­3? 745765 Reverse primer 5?­CGCCACGACTTTGTTTTCTG­3? 813794 Probe 5?­TCAAGTTGGAAGTGCGTCTTTTGGATGC­3? 767794 HPRT1 (hypoxanthine phosphoribosyltransferase 1) (GenBank accession number NMä000194) Forward primer 5?­GAACGTCTTGCTCGAGATGTG­3? 139159 Reverse primer 5?­CCAGCAGGTCAGCAAAGAATT­3? 238218 Probe 5?­AGGCCATCACATTGTAGCCCTCTGTG­3? 174199 PPIA (peptidylprolyl isomerase A) (GenBank accession number NMä021130) Forward primer 5?­TCCTGGCATCTTGTCCATG­3? 282300 Reverse primer 5?­CCATCCAACCACTCAGTCTTG­3? 371351 Probe 5?­CAAATGCTGGACCCAACACAAATGG­3? 302326 TFRC (transferrin receptor) (GenBank accession number NMä003234) Forward primer 5?­TTGGACATGCTCATCTGGG­3? 893911 Reverse primer 5?­ATGACCGAGATGGTGGAAACT­3? 979959 Probe 5?­ACCCTTACACACCTGGATTCCCTTCCTTC­3? 920948 Nuclear Receptors NR1A1 (GenBank accession number NMä003250) Forward primer 5?­GGGACAAGGCAACTGGTTATC­3? 170190 Reverse primer 5?­GGAGGTTCTTCTGGATTGTGC­3? 256236 Probe 5?­ACTTGTGAGGGCTGCAAGGGCTTCTT­3? 205230 NR1A2 (GenBank accession number X04707) Forward primer 5?­CAGATCATCCTCCTCAAAGGC­3? 886906 Reverse primer 5?­AAAGTCTCACTTTCCGGGTCA­3? 968948 Probe 5?­TGCATGGAGATCATGTCCCTTCGC­3? 910933 NR1B1 (GenBank accession number NMä000964) Forward primer 5?­CAGCTGGGCAAATACACTACG­3? 610630 138 Masuhiro NISHIMURA, et al. Table 3.
Load more

Recommended publications
  • Conserved Functional Motifs of the Nuclear Receptor Superfamily As Potential Pharmacological Targets
    INTERNATIONAL JOURNAL OF EPIGenetiCS 1: 3, 2021 Conserved functional motifs of the nuclear receptor superfamily as potential pharmacological targets LOUIS PAPAGEORGIOU1, LIVIA SHALZI1, ASPASIA EFTHIMIADOU2, FLORA BACOPOULOU3, GEORGE P. CHROUSOS3,4, ELIAS ELIOPOULOS1 and DIMITRIOS VLACHAKIS1,3,4 1Laboratory of Genetics, Department of Biotechnology, School of Applied Biology and Biotechnology, Agricultural University of Athens, 11855 Athens; 2Department of Soil Science of Athens, Institute of Soil and Water Resources, Hellenic Agricultural Organization-Demeter, 14123 Lycovrisi; 3University Research Institute of Maternal and Child Health and Precision Medicine, and UNESCO Chair on Adolescent Health Care, National and Kapodistrian University of Athens, ‘Aghia Sophia’ Children's Hospital; 4Division of Endocrinology and Metabolism, Center of Clinical, Experimental Surgery and Translational Research, Biomedical Research Foundation of the Academy of Athens, 11527 Athens, Greece Received March 21, 2021; Accepted May 31, 2021 DOI: 10.3892/ije.2021.3 Abstract. Nuclear receptors (NRs) are one of the most diverse organ physiology, cell differentiation and homeostasis (1,2). In and well-reported family of proteins. They are involved in humans, only 48 members of the superfamily have been found numerous cellular processes as they play pivotal roles in and genetic mutations in these NRs have been proven to cause cell signaling and the cell cycle. The participation of NRs rare diseases, such as cancer, diabetes, rheumatoid arthritis, in various applications in medicine and biology has greatly asthma and hormone resistance syndromes (3). Bearing that attracted the interest of the pharmaceutical industry for the in mind and the fact that nuclear hormone receptors possess discovery of novel and/or improved drugs for the treatment internal pockets, that bind to hydrophobic, drug-like molecules, of several diseases, including cancer, diabetes or infertility.
    [Show full text]
  • Single-Cell Transcriptomics Characterizes Cell Types in the Subventricular Zone and Uncovers
    bioRxiv preprint doi: https://doi.org/10.1101/365619; this version posted July 9, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single-cell transcriptomics characterizes cell types in the subventricular zone and uncovers molecular defects underlying impaired adult neurogenesis Vera Zywitza1,+, Aristotelis Misios1,+, Lena Bunatyan2, Thomas E. Willnow2,*, and Nikolaus Rajewsky1,3,* 1 Laboratory for Systems Biology of Gene Regulatory Elements, Berlin Institute for Medical Systems Biology, Max Delbrück Center for Molecular Medicine, Robert-Rössle-Str. 10, Berlin-Buch, Germany 2 Molecular Cardiovascular Research, Max Delbrück Center for Molecular Medicine, Robert-Rössle- Str. 10, Berlin-Buch, Germany 3 Lead Contact + These authors contributed equally *Correspondence: [email protected]; [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/365619; this version posted July 9, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. SUMMARY Neural stem cells (NSCs) contribute to plasticity and repair of the adult brain. Niches harboring NSCs are crucial for regulating stem cell self-renewal and differentiation. We used single-cell RNA profiling to generate an unbiased molecular atlas of all cell types in the largest neurogenic niche of the adult mouse brain, the subventricular zone (SVZ). We characterized > 20 neural and non-neural cell types and gained insights into the dynamics of neurogenesis by predicting future cell states based on computational analysis of RNA kinetics. Furthermore, we apply our single-cell approach to mice lacking LRP2, an endocytic receptor required for SVZ maintenance.
    [Show full text]
  • Alternative Splicing in the Nuclear Receptor Superfamily Expands Gene Function to Refine Endo-Xenobiotic Metabolism S
    Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2020/01/24/dmd.119.089102.DC1 1521-009X/48/4/272–287$35.00 https://doi.org/10.1124/dmd.119.089102 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 48:272–287, April 2020 Copyright ª 2020 by The American Society for Pharmacology and Experimental Therapeutics Minireview Alternative Splicing in the Nuclear Receptor Superfamily Expands Gene Function to Refine Endo-Xenobiotic Metabolism s Andrew J. Annalora, Craig B. Marcus, and Patrick L. Iversen Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, Oregon (A.J.A., C.B.M., P.L.I.) and United States Army Research Institute for Infectious Disease, Frederick, Maryland (P.L.I.) Received August 16, 2019; accepted December 31, 2019 ABSTRACT Downloaded from The human genome encodes 48 nuclear receptor (NR) genes, whose Exon inclusion options are differentially distributed across NR translated products transform chemical signals from endo- subfamilies, suggesting group-specific conservation of resilient func- xenobiotics into pleotropic RNA transcriptional profiles that refine tionalities. A deeper understanding of this transcriptional plasticity drug metabolism. This review describes the remarkable diversifica- expands our understanding of how chemical signals are refined and tion of the 48 human NR genes, which are potentially processed into mediated by NR genes. This expanded view of the NR transcriptome over 1000 distinct mRNA transcripts by alternative splicing (AS). The informs new models of chemical toxicity, disease diagnostics, and dmd.aspetjournals.org average human NR expresses ∼21 transcripts per gene and is precision-based approaches to personalized medicine.
    [Show full text]
  • A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord
    A Transcription Factor Code Defines Nine Sensory Interneuron Subtypes in the Mechanosensory Area of the Spinal Cord Marta Garcia Del Barrio1, Steeve Bourane1, Katja Grossmann1, Roland Schu¨ le2, Stefan Britsch3,4, Dennis D.M. O’Leary1, Martyn Goulding1* 1 Molecular Neurobiology Laboratory, The Salk Institute for Biological Studies, La Jolla, California, United States of America, 2 Urologische Klinik/Frauenklinik und Zentrale Klinische Forschung, Klinikum der Universita¨t Freiburg, Freiburg, Germany, 3 Department of Medical Genetics, Max-Delbru¨ck-Center for Molecular Medicine, Berlin-Buch, Germany, 4 Institute for Molecular and Cellular Anatomy Ulm University, Ulm, Germany Abstract Interneurons in the dorsal spinal cord process and relay innocuous and nociceptive somatosensory information from cutaneous receptors that sense touch, temperature and pain. These neurons display a well-defined organization with respect to their afferent innervation. Nociceptive afferents innervate lamina I and II, while cutaneous mechanosensory afferents primarily innervate sensory interneurons that are located in lamina III–IV. In this study, we outline a combinatorial transcription factor code that defines nine different inhibitory and excitatory interneuron populations in laminae III–IV of the postnatal cord. This transcription factor code reveals a high degree of molecular diversity in the neurons that make up laminae III–IV, and it lays the foundation for systematically analyzing and manipulating these different neuronal populations to assess their function. In addition, we find that many of the transcription factors that are expressed in the dorsal spinal cord at early postnatal times continue to be expressed in the adult, raising questions about their function in mature neurons and opening the door to their genetic manipulation in adult animals.
    [Show full text]
  • The Microrna Cluster Mir-106B~25 Regulates Adult Neural Stem/Progenitor Cell Proliferation and Neuronal Differentiation
    www.impactaging.com AGING, February 2011, Vol. 3, No. 2 Research Paper The MicroRNA Cluster miR-106b~25 Regulates Adult Neural Stem/Progenitor Cell Proliferation and Neuronal Differentiation 1 1 1,2 1 1,2 Jamie O. Brett , Valérie M. Renault , Victoria A. Rafalski , Ashley E. Webb , Anne Brunet 1 Department of Genetics; Stanford University School of Medicine; Stanford, CA 94305; USA 2Neurosciences Program; Stanford University School of Medicine; Stanford, CA 94305; USA Key words: aging, neural stem cells, microRNAs, FoxO transcription factors, insulin signaling, neuronal differentiation Received: 2/15/11; Accepted: 2/19/11; Published: 2/20/11 Corresponding author: Anne Brunet, PhD; Email: [email protected] © Brett et al. This is an open‐access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract: In adult mammals, neural stem cells (NSCs) generate new neurons that are important for specific types of learning and memory. Controlling adult NSC number and function is fundamental for preserving the stem cell pool and ensuring proper levels of neurogenesis throughout life. Here we study the importance of the microRNA gene cluster miR‐ 106b~25 (miR‐106b, miR‐93, and miR‐25) in primary cultures of neural stem/progenitor cells (NSPCs) isolated from adult mice. We find that knocking down miR‐25 decreases NSPC proliferation, whereas ectopically expressing miR‐25 promotes NSPC proliferation. Expressing the entire miR‐106b~25 cluster in NSPCs also increases their ability to generate new neurons. Interestingly, miR‐25 has a number of potential target mRNAs involved in insulin/insulin‐like growth factor‐1 (IGF) signaling, a pathway implicated in aging.
    [Show full text]
  • Role of Transcription Factors AP-2 and NFI in Development and Glioblastoma by Saket Jain a Thesis Submitted in Partial Fulfillm
    Role of Transcription Factors AP-2 and NFI in Development and Glioblastoma by Saket Jain A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Experimental Oncology Department of Oncology University of Alberta ©Saket Jain, 2018 Abstract Gene regulation pathways involved in embryonic development are commonly implicated in cancer. Transcription factors play key roles in all aspects of development including cell proliferation, migration and differentiation. Aberrant expression of many developmentally-regulated transcription factors contributes to many malignancies. In this thesis, we studied the role of transcription factor family AP-2 in retinal development and glioblastoma (GBM) and the role of transcription factor family NFI in GBM. Four of the five members of the AP-2 family (AP-2α, AP-2β, AP-2 and AP-2) have previously been shown to be expressed in developing retina. In Chapter 2, we show that the fifth member of the AP-2 family, AP-2ε, is also expressed in the developing mammalian retina. Our data point to a specialized role for AP-2 in a subset of amacrine cells, with AP-2 being restricted to the GABAergic amacrine lineage. AP-2 is co-expressed with AP-2, AP-2β and AP-2 in subsets of amacrine cells, suggesting roles for both AP-2 homodimers and AP-2 heterodimers in the regulation or AP-2 target genes in the retina. Our work suggests spatially- and temporally-coordinated roles for combinations of AP-2 transcription factors in amacrine cells during retinal development. Several studies have implicated aberrant regulation of AP-2 with cancer.
    [Show full text]
  • Master Regulator Analysis of Paragangliomas Carrying Sdhx, VHL,Or MAML3 Genetic Alterations John A
    Smestad and Maher BMC Cancer (2019) 19:619 https://doi.org/10.1186/s12885-019-5813-z RESEARCHARTICLE Open Access Master regulator analysis of paragangliomas carrying SDHx, VHL,or MAML3 genetic alterations John A. Smestad1,2 and L. James Maher III2* Abstract Background: Succinate dehydrogenase (SDH) loss and mastermind-like 3 (MAML3) translocation are two clinically important genetic alterations that correlate with increased rates of metastasis in subtypes of human paraganglioma and pheochromocytoma (PPGL) neuroendocrine tumors. Although hypotheses propose that succinate accumulation after SDH loss poisons dioxygenases and activates pseudohypoxia and epigenomic hypermethylation, it remains unclear whether these mechanisms account for oncogenic transcriptional patterns. Additionally, MAML3 translocation has recently been identified as a genetic alteration in PPGL, but is poorly understood. We hypothesize that a key to understanding tumorigenesis driven by these genetic alterations is identification of the transcription factors responsible for the observed oncogenic transcriptional changes. Methods: We leverage publicly-available human tumor gene expression profiling experiments (N = 179) to reconstruct a PPGL tumor-specific transcriptional network. We subsequently use the inferred transcriptional network to perform master regulator analyses nominating transcription factors predicted to control oncogenic transcription in specific PPGL molecular subtypes. Results are validated by analysis of an independent collection of PPGL tumor specimens (N = 188). We then perform a similar master regulator analysis in SDH-loss mouse embryonic fibroblasts (MEFs) to infer aspects of SDH loss master regulator response conserved across species and tissue types. Results: A small number of master regulator transcription factors are predicted to drive the observed subtype- specific gene expression patterns in SDH loss and MAML3 translocation-positive PPGL.
    [Show full text]
  • Genetic Disorders of Nuclear Receptors
    Genetic disorders of nuclear receptors John C. Achermann, … , Louise Fairall, Krishna Chatterjee J Clin Invest. 2017;127(4):1181-1192. https://doi.org/10.1172/JCI88892. Review Series Following the first isolation of nuclear receptor (NR) genes, genetic disorders caused by NR gene mutations were initially discovered by a candidate gene approach based on their known roles in endocrine pathways and physiologic processes. Subsequently, the identification of disorders has been informed by phenotypes associated with gene disruption in animal models or by genetic linkage studies. More recently, whole exome sequencing has associated pathogenic genetic variants with unexpected, often multisystem, human phenotypes. To date, defects in 20 of 48 human NR genes have been associated with human disorders, with different mutations mediating phenotypes of varying severity or several distinct conditions being associated with different changes in the same gene. Studies of individuals with deleterious genetic variants can elucidate novel roles of human NRs, validating them as targets for drug development or providing new insights into structure-function relationships. Importantly, human genetic discoveries enable definitive disease diagnosis and can provide opportunities to therapeutically manage affected individuals. Here we review germline changes in human NR genes associated with “monogenic” conditions, including a discussion of the structural basis of mutations that cause distinctive changes in NR function and the molecular mechanisms mediating pathogenesis. Find the latest version: https://jci.me/88892/pdf The Journal of Clinical Investigation REVIEW SERIES: NUCLEAR RECEPTORS Series Editor: Mitchell A. Lazar Genetic disorders of nuclear receptors John C. Achermann,1 John Schwabe,2 Louise Fairall,2 and Krishna Chatterjee3 1Genetics and Genomic Medicine, UCL Great Ormond Street Institute of Child Health, University College London, London, United Kingdom.
    [Show full text]
  • Expression Profiling of Nuclear Receptors in Breast Cancer Identifies TLX As a Mediator of Growth and Invasion in Triple-Negative Breast Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No. 25 Expression profiling of nuclear receptors in breast cancer identifies TLX as a mediator of growth and invasion in triple-negative breast cancer Meng-Lay Lin1,*, Hetal Patel1,*, Judit Remenyi2, Christopher R. S. Banerji3,4, Chun-Fui Lai1, Manikandan Periyasamy1, Ylenia Lombardo1, Claudia Busonero1, Silvia Ottaviani1, Alun Passey1, Philip R. Quinlan5, Colin A. Purdie5, Lee B. Jordan5, Alastair M. Thompson6, Richard S. Finn7, Oscar M. Rueda8, Carlos Caldas8, Jesus Gil9, R. Charles Coombes1, Frances V. Fuller-Pace2, Andrew E. Teschendorff3,4, Laki Buluwela1, Simak Ali1 1 Department of Surgery & Cancer, Imperial College London, London, UK 2 Division of Cancer Research, University of Dundee, Ninewells Hospital & Medical School, Dundee, UK 3 Statistical Genomics Group, UCL Cancer Institute, University College London, London, UK 4 Centre of Mathematics and Physics in Life & Experimental Sciences, University College London, UK 5 Dundee Cancer Centre, Clinical Research Centre, University of Dundee, Ninewells Hospital & Medical School, Dundee, UK 6 Department of Surgical Oncology, MD Anderson Cancer Center, Houston, USA 7 Geffen School of Medicine at UCLA, Los Angeles, CA USA 8 Cancer Research UK Cambridge Institute, University of Cambridge Li Ka Shing Centre, Cambridge, UK 9 Cell Proliferation Group, MRC Clinical Sciences Centre, Imperial College London, Hammersmith Campus, London, UK * These authors have contributed equally to this work Correspondence to: Simak Ali, e-mail: [email protected] Keywords: cancer, nuclear receptors, expression profiling, breast cancer, tumour classification Received: March 11, 2015 Accepted: April 30, 2015 Published: May 13, 2015 ABSTRACT The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer.
    [Show full text]
  • WO 2012/054896 Al
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number ι (43) International Publication Date ¾ ί t 2 6 April 2012 (26.04.2012) WO 2012/054896 Al (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, C12N 5/00 (2006.01) C12N 15/00 (2006.01) CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, C12N 5/02 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (21) International Application Number: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, PCT/US201 1/057387 ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, (22) International Filing Date: NO, NZ, OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, 2 1 October 201 1 (21 .10.201 1) RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, (25) Filing Language: English ZM, ZW. (26) Publication Language: English (84) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of regional protection available): ARIPO (BW, GH, 61/406,064 22 October 2010 (22.10.2010) US GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, 61/415,244 18 November 2010 (18.1 1.2010) US UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, (71) Applicant (for all designated States except US): BIO- DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, TIME INC.
    [Show full text]
  • Gene Regulatory Networks Controlling Differentiation, Survival, and Diversification of Hypothalamic Lhx6-Expressing Gabaergic Neurons
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.21.106963; this version posted August 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: Gene regulatory networks controlling differentiation, survival, and diversification of hypothalamic Lhx6-expressing GABAergic neurons. Authors: Dong Won Kim1, Kai Liu1,10, Zoe Qianyi Wang1, Yi Stephanie Zhang1, Abhijith Bathini1, Matthew P Brown1, Sonia Hao Lin1, Parris Whitney Washington1, Changyu Sun1, Susan Lindtner7, Bora Lee8, Hong Wang1, Tomomi Shimogori9, John L.R. Rubenstein7, Seth Blackshaw1-6 Affiliations: 1Solomon H. Snyder Department of Neuroscience, 2Department of Ophthalmology, 3Department of Neurology, 4Center for Human Systems Biology, 5Institute for Cell Engineering, 6Kavli Neuroscience Discovery Institute, Johns Hopkins University School of Medicine, Baltimore, MD, 21205, USA, 7Nina Ireland Laboratory of Developmental Neurobiology, Department of Psychiatry, UCSF Weill Institute for Neurosciences, University of California, San Francisco, San Francisco, CA 94158, USA, 8Center for Neuroscience, Korea Institute of Science and Technology (KIST), Seoul, 02792, Korea, 9RIKEN Center for Brain Science, Laboratory for Molecular Mechanisms of Brain Development, 2-1 Hirosawa, Wako, Saitama, 351-0198, Japan. 10Present address: Genentech, South San Francisco, CA 94080. Address all correspondence to [email protected] (S.B.) Abstract: GABAergic neurons of the hypothalamus regulate many innate behaviors, but little is known about the mechanisms that control their development. We previously identified hypothalamic neurons that express the LIM homeodomain transcription factor Lhx6, a master regulator of cortical interneuron development, as sleep- promoting. In contrast to telencephalic interneurons, hypothalamic Lhx6 neurons do not undergo long-distance tangential migration and do not express cortical interneuronal markers such as Pvalb.
    [Show full text]
  • Anatomical Profiling of Nuclear Receptor Expression Reveals A
    Resource Anatomical Profiling of Nuclear Receptor Expression Reveals a Hierarchical Transcriptional Network Angie L. Bookout,1 Yangsik Jeong,1 Michael Downes,2 Ruth T. Yu,2 Ronald M. Evans,2 and David J. Mangelsdorf1,* 1 Department of Pharmacology, Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, 6001 Forest Park Road, Dallas, TX 75390, USA 2 Gene Expression Laboratory, Howard Hughes Medical Institute, The Salk Institute, 10010 North Torrey Pines Road, La Jolla, CA 92037, USA *Contact: [email protected] DOI 10.1016/j.cell.2006.06.049 SUMMARY fat-soluble vitamins A and D, thyroid hormone, fatty acids, oxysterols, bile acids, and numerous xenobiotic lipids de- In multicellular organisms, the ability to regulate rived from the diet. Additional members of this family are reproduction, development, and nutrient utili- called orphan receptors because their ligands remain zation coincided with the evolution of nuclear unknown. Together, NRs govern expression of genes in- receptors (NRs), transcription factors that uti- volved in a broad range of reproductive, developmental, lize lipophilic ligands to mediate their function. metabolic, and immune response programs. NRs also Studying the expression profile of NRs offers a encompass one of the most successful targets for drugs currently available or being developed to treat a multitude simple, powerful way to obtain highly relational of therapeutic indices, including hypertension, cancer, di- information about their physiologic functions as abetes, cardiovascular disease, cholesterol gallstone dis- individual proteins and as a superfamily. We ease, and the metabolic syndrome (Gronemeyer et al., surveyed the expression of all 49 mouse NR 2004; Shulman and Mangelsdorf, 2005).
    [Show full text]