Gene Regulatory Networks Controlling Differentiation, Survival, and Diversification of Hypothalamic Lhx6-Expressing Gabaergic Neurons
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Implications of Zonal Architecture on Differential Gene Expression
www.nature.com/scientificreports OPEN Implications of zonal architecture on diferential gene expression profling and altered pathway expressions in mandibular condylar cartilage Aisha M. Basudan1*, Mohammad Azhar Aziz2 & Yanqi Yang3 Mandibular condylar cartilage (MCC) is a multi-zonal heterogeneous fbrocartilage containing diferent types of cells, but the factors/mechanisms governing the phenotypic transition across the zones have not been fully understood. The reliability of molecular studies heavily rely on the procurement of pure cell populations from the heterogeneous tissue. We used a combined laser-capture microdissection and microarray analysis approach which allowed identifcation of diferential zone-specifc gene expression profling and altered pathways in the MCC of 5-week-old rats. The bioinformatics analysis demonstrated that the MCC cells clearly exhibited distinguishable phenotypes from the articular chondrocytes. Additionally, a set of genes has been determined as potential markers to identify each MCC zone individually; Crab1 gene showed the highest enrichment while Clec3a was the most downregulated gene at the superfcial layer, which consists of fbrous (FZ) and proliferative zones (PZ). Ingenuity Pathway Analysis revealed numerous altered signaling pathways; Leukocyte extravasation signaling pathway was predicted to be activated at all MCC zones, in particular mature and hypertrophic chondrocytes zones (MZ&HZ), when compared with femoral condylar cartilage (FCC). Whereas Superpathway of Cholesterol Biosynthesis showed predicted activation in both FZ and PZ as compared with deep MCC zones and FCC. Determining novel zone-specifc diferences of large group of potential genes, upstream regulators and pathways in healthy MCC would improve our understanding of molecular mechanisms on regional (zonal) basis, and provide new insights for future therapeutic strategies. -
Signalling Between Microvascular Endothelium and Cardiomyocytes Through Neuregulin Downloaded From
Cardiovascular Research (2014) 102, 194–204 SPOTLIGHT REVIEW doi:10.1093/cvr/cvu021 Signalling between microvascular endothelium and cardiomyocytes through neuregulin Downloaded from Emily M. Parodi and Bernhard Kuhn* Harvard Medical School, Boston Children’s Hospital, 300 Longwood Avenue, Enders Building, Room 1212, Brookline, MA 02115, USA Received 21 October 2013; revised 23 December 2013; accepted 10 January 2014; online publish-ahead-of-print 29 January 2014 http://cardiovascres.oxfordjournals.org/ Heterocellular communication in the heart is an important mechanism for matching circulatory demands with cardiac structure and function, and neuregulins (Nrgs) play an important role in transducing this signal between the hearts’ vasculature and musculature. Here, we review the current knowledge regarding Nrgs, explaining their roles in transducing signals between the heart’s microvasculature and cardiomyocytes. We highlight intriguing areas being investigated for developing new, Nrg-mediated strategies to heal the heart in acquired and congenital heart diseases, and note avenues for future research. ----------------------------------------------------------------------------------------------------------------------------------------------------------- Keywords Neuregulin Heart Heterocellular communication ErbB -----------------------------------------------------------------------------------------------------------------------------------------------------------† † † This article is part of the Spotlight Issue on: Heterocellular signalling -
The Epidermal Growth Factor Receptor Family As a Central Element for Cellular Signal Transduction and Diversification
Endocrine-Related Cancer (2001) 8 11–31 The epidermal growth factor receptor family as a central element for cellular signal transduction and diversification N Prenzel, O M Fischer, S Streit, S Hart and A Ullrich Max-Planck Institut fu¨r Biochemie, Department of Molecular Biology, Am Klopferspitz 18A, 82152 Martinsried, Germany (Requests for offprints should be addressed to A Ullrich; Email: [email protected]) Abstract Homeostasis of multicellular organisms is critically dependent on the correct interpretation of the plethora of signals which cells are exposed to during their lifespan. Various soluble factors regulate the activation state of cellular receptors which are coupled to a complex signal transduction network that ultimately generates signals defining the required biological response. The epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases represents both key regulators of normal cellular development as well as critical players in a variety of pathophysiological phenomena. The aim of this review is to give a broad overview of signal transduction networks that are controlled by the EGFR superfamily of receptors in health and disease and its application for target-selective therapeutic intervention. Since the EGFR and HER2 were recently identified as critical players in the transduction of signals by a variety of cell surface receptors, such as G-protein-coupled receptors and integrins, our special focus is the mechanisms and significance of the interconnectivity between heterologous signalling systems. Endocrine-Related Cancer (2001) 8 11–31 Introduction autophosphorylation of cytoplasmic tyrosine residues (reviewed in Ullrich & Schlessinger 1990, Heldin 1995, Cell surface receptors integrate a multitude of extracellular Alroy & Yarden 1997). -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
Conserved Functional Motifs of the Nuclear Receptor Superfamily As Potential Pharmacological Targets
INTERNATIONAL JOURNAL OF EPIGenetiCS 1: 3, 2021 Conserved functional motifs of the nuclear receptor superfamily as potential pharmacological targets LOUIS PAPAGEORGIOU1, LIVIA SHALZI1, ASPASIA EFTHIMIADOU2, FLORA BACOPOULOU3, GEORGE P. CHROUSOS3,4, ELIAS ELIOPOULOS1 and DIMITRIOS VLACHAKIS1,3,4 1Laboratory of Genetics, Department of Biotechnology, School of Applied Biology and Biotechnology, Agricultural University of Athens, 11855 Athens; 2Department of Soil Science of Athens, Institute of Soil and Water Resources, Hellenic Agricultural Organization-Demeter, 14123 Lycovrisi; 3University Research Institute of Maternal and Child Health and Precision Medicine, and UNESCO Chair on Adolescent Health Care, National and Kapodistrian University of Athens, ‘Aghia Sophia’ Children's Hospital; 4Division of Endocrinology and Metabolism, Center of Clinical, Experimental Surgery and Translational Research, Biomedical Research Foundation of the Academy of Athens, 11527 Athens, Greece Received March 21, 2021; Accepted May 31, 2021 DOI: 10.3892/ije.2021.3 Abstract. Nuclear receptors (NRs) are one of the most diverse organ physiology, cell differentiation and homeostasis (1,2). In and well-reported family of proteins. They are involved in humans, only 48 members of the superfamily have been found numerous cellular processes as they play pivotal roles in and genetic mutations in these NRs have been proven to cause cell signaling and the cell cycle. The participation of NRs rare diseases, such as cancer, diabetes, rheumatoid arthritis, in various applications in medicine and biology has greatly asthma and hormone resistance syndromes (3). Bearing that attracted the interest of the pharmaceutical industry for the in mind and the fact that nuclear hormone receptors possess discovery of novel and/or improved drugs for the treatment internal pockets, that bind to hydrophobic, drug-like molecules, of several diseases, including cancer, diabetes or infertility. -
Regulation of Adipose Tissue Function and Metabolic Homeostasis
REGULATION OF ADIPOSE TISSUE FUNCTION AND METABOLIC HOMEOSTASIS by Guoxiao Wang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cellular and Molecular Biology) in the University of Michigan 2014 Doctoral committee: Associate Professor Jiandie D. Lin, Chair Associate Professor Peter Dempsey Professor Ormond MacDougald Professor Liangyou Rui Professor Alan R. Saltiel © Guoxiao Wang 2014 DEDICATION To my parents and my husband, for their unconditional love ii ACKNOWLEDGEMENTS I would like to give special thanks to my mentor Jiandie Lin, who inspires confidence, enhances criticism and drives me forward. He bears all the virtues of a good mentor, always available to students despite the tremendous demands on his time. By actively doing research himself, he led us from the front and served as a role model. He has created a lab that is scientifically intense yet nurturing. He celebrates everybody’s success and respects individual difference, allowing us to “smell the rose”. I also would like to thank Siming Li, senior research staff in our lab, who has provided tremendous help from the start of my rotation and throughout my thesis research. I want to thank all my labmates, for the help I receive and friendship I enjoy. Thank you Xuyun Zhao and Zhuoxian Meng for help on our collaborative projects. Thank you Zhimin Chen and Yuanyuan Xiao for sharing resources and ideas that moves my project forward. Thank you Zoharit Cozacov for being such a terrific technician. And thank you Qi Yu and Lin Wang for providing common reagents to allow the lab to run smoothly. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Single-Cell Transcriptomics Characterizes Cell Types in the Subventricular Zone and Uncovers
bioRxiv preprint doi: https://doi.org/10.1101/365619; this version posted July 9, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single-cell transcriptomics characterizes cell types in the subventricular zone and uncovers molecular defects underlying impaired adult neurogenesis Vera Zywitza1,+, Aristotelis Misios1,+, Lena Bunatyan2, Thomas E. Willnow2,*, and Nikolaus Rajewsky1,3,* 1 Laboratory for Systems Biology of Gene Regulatory Elements, Berlin Institute for Medical Systems Biology, Max Delbrück Center for Molecular Medicine, Robert-Rössle-Str. 10, Berlin-Buch, Germany 2 Molecular Cardiovascular Research, Max Delbrück Center for Molecular Medicine, Robert-Rössle- Str. 10, Berlin-Buch, Germany 3 Lead Contact + These authors contributed equally *Correspondence: [email protected]; [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/365619; this version posted July 9, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. SUMMARY Neural stem cells (NSCs) contribute to plasticity and repair of the adult brain. Niches harboring NSCs are crucial for regulating stem cell self-renewal and differentiation. We used single-cell RNA profiling to generate an unbiased molecular atlas of all cell types in the largest neurogenic niche of the adult mouse brain, the subventricular zone (SVZ). We characterized > 20 neural and non-neural cell types and gained insights into the dynamics of neurogenesis by predicting future cell states based on computational analysis of RNA kinetics. Furthermore, we apply our single-cell approach to mice lacking LRP2, an endocytic receptor required for SVZ maintenance. -
Effects of Neuregulin 3 Genotype on Human Prefrontal Cortex Physiology
The Journal of Neuroscience, January 15, 2014 • 34(3):1051–1056 • 1051 Brief Communications Effects of Neuregulin 3 Genotype on Human Prefrontal Cortex Physiology Heike Tost,1,2 Joseph H. Callicott,1 Roberta Rasetti,1 Radhakrishna Vakkalanka,1,3 Venkata S. Mattay,1,3 Daniel R. Weinberger,1,3,4* and Amanda J. Law1,5* 1Clinical Brain Disorders Branch, Genes, Cognition, and Psychosis Program, National Institute of Mental Health, National Institutes of Health, Department of Health and Human Services, Bethesda, Maryland 20892, 2Department of Psychiatry and Psychotherapy, Central Institute of Mental Health, Medical Faculty Mannheim, University of Heidelberg, 61859 Mannheim, Germany, 3Lieber Institute for Brain Development, Johns Hopkins University Medical Campus, Baltimore, Maryland 21205, 4Departments of Psychiatry, Neurology, and Neuroscience and McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins School of Medicine, Baltimore, Maryland 21205, and 5Departments of Psychiatry and Cell and Developmental Biology, University of Colorado, School of Medicine, Aurora, Colorado 80045 The neuregulin 3 gene (NRG3) plays pleiotropic roles in neurodevelopment and is a putative susceptibility locus for schizophrenia. Specifically, the T allele of NRG3 rs10748842 has been associated with illness risk, altered cognitive function, and the expression of a novel splice isoform in prefrontal cortex (PFC), but the neural system effects are unexplored. Here, we report an association between rs10748842 and PFC physiology as measured by functional magnetic resonance imaging of human working memory performance, where a convincing link between increased genetic risk for schizophrenia and increased activation in some PFC areas has been established. In 410controlindividuals(195males,215females),wedetectedahighlysignificanteffectofNRG3genotypemanifestingasanunanticipated increase in ventrolateral PFC activation in nonrisk-associated C allele carriers. -
Transcriptional Regulatory Networks in Neocortical Development
Review From trans to cis: transcriptional regulatory networks in neocortical development 1 1 1,2 Mikihito Shibata , Forrest O. Gulden , and Nenad Sestan 1 Department of Neurobiology and Kavli Institute for Neuroscience, Yale School of Medicine, New Haven, CT 06510, USA 2 Department of Psychiatry and Program in Cellular Neuroscience, Neurodegeneration and Repair, Yale School of Medicine, New Haven, CT 06510, USA Transcriptional mechanisms mediated by the binding of tions among TFs and CREs form the central core of tran- transcription factors (TFs) to cis-acting regulatory ele- scriptional regulatory networks (TRNs) (Box 1) [1]. ments (CREs) in DNA play crucial roles in directing gene Interactions between TFs and CREs are complex, dynam- expression. While TFs have been extensively studied, ic,andmodulatedbyvariousepigeneticprocesses[12].While less effort has gone towards the identification and func- individual CREs may be regulated by the competitive or tional characterization of CREs and associated epigenet- cooperative binding of many TFs, multiple CREs may also ic modulation. However, owing to methodological and confer transcriptional control over the expression of any analytical advances, more comprehensive studies of single gene [12]. Furthermore, TFs and CREs regulate regulatory elements and mechanisms are now possible. transcription together with their cognate transcriptional We summarize recent progress in integrative analyses of cofactors, chromatin regulators, epigenetic modifications, these regulatory components in the development of the RNA-binding proteins, and non-coding RNAs [2,13]. This cerebral neocortex, the part of the brain involved in combinatorial and multi-level transcriptional regulation cognition and complex behavior. These studies are greatly increases the complexity of gene expression regula- uncovering not only the underlying transcriptional reg- tion, facilitating the unique spatio-temporal patterns nec- ulatory networks, but also how these networks are essary for tissue development and function [3]. -
The Erbb Receptor Tyrosine Family As Signal Integrators
Endocrine-Related Cancer (2001) 8 151–159 The ErbB receptor tyrosine family as signal integrators N E Hynes, K Horsch, M A Olayioye and A Badache Friedrich Miescher Institute, PO Box 2543, CH-4002 Basel, Switzerland (Requests for offprints should be addressed to N E Hynes, Friedrich Miescher Institute, R-1066.206, Maulbeerstrasse 66, CH-4058 Basel, Switzerland. Email: [email protected]) (M A Olayioye is now at The Walter and Eliza Hall Institute of Medical Research, PO Royal Melbourne Hospital, Victoria 3050, Australia) Abstract ErbB receptor tyrosine kinases (RTKs) and their ligands have important roles in normal development and in human cancer. Among the ErbB receptors only ErbB2 has no direct ligand; however, ErbB2 acts as a co-receptor for the other family members, promoting high affinity ligand binding and enhancement of ligand-induced biological responses. These characteristics demonstrate the central role of ErbB2 in the receptor family, which likely explains why it is involved in the development of many human malignancies, including breast cancer. ErbB RTKs also function as signal integrators, cross-regulating different classes of membrane receptors including receptors of the cytokine family. Cross-regulation of ErbB RTKs and cytokines receptors represents another mechanism for controlling and enhancing tumor cell proliferation. Endocrine-Related Cancer (2001) 8 151–159 Introduction The EGF-related peptide growth factors The epidermal growth factor (EGF) or ErbB family of type ErbB receptors are activated by ligands, known as the I receptor tyrosine kinases (RTKs) has four members:EGF EGF-related peptide growth factors (reviewed in Peles & receptor, also termed ErbB1/HER1, ErbB2/Neu/HER2, Yarden 1993, Riese & Stern 1998). -
Up-Regulation of Homeodomain Genes, DLX1 and DLX2, by FLT3 Signaling
SUPPLEMENTARY APPENDIX Up-regulation of homeodomain genes, DLX1 and DLX2, by FLT3 signaling Julia Starkova,1,3 Sharvari Gadgil,2 Yi Hua Qiu,4 Nianxiang Zhang,4 Ivana Hermanova,3 Steven M. Kornblau,4 and Harry A. Drabkin1,3 1Division of Hematology-Oncology, Medical University of South Carolina, Charleston, SC, USA; 2Division of Medical Oncology, University of Colorado Health Sciences Center, Aurora, CO, USA; 3Department of Paediatric Haematology/Oncology, 2nd Faculty of Medicine, Charles University Prague, Czech Republic, and 4Department of Stem Cell Transplantation and Cellular Therapy, Section of Molecular Hematology and Therapy, The University of Texas M.D. Anderson Cancer Center, Houston, Texas, USA Citation: Starkova J, Gadgil S, Hua Qiu Y, Zhang N, Hermanova I, Kornblau SM, and Drabkin HA. Up-regulation of homeodomain genes, DLX1 and DLX2, by FLT3 signaling. Haematologica 2011;96(6):820-828. doi:10.3324/haematol.2010.031179 Online Supplementary Figure S1. Specificity and non-toxicity of PKC412 in MV4;11 cells (A) Results from flow cytometry analysis are shown as a percentage of cells in subG1, G1-G0, S and G2-M phases of the cell cycle after 0, 2, 5 and 24 h treatment of MV4;11 cells with PKC412. (B) Graph shows fold-change of DLX1 gene expression in MV4;11 cells after imatinib treatment. A B Online Supplementary Figure S2. AP1-binding site in the DLX1 promoter. Online Supplementary Figure S3. Diagram of the described interaction between FLT3 and DLX1. Online Supplementary Table S1. Primes sequences. Online Supplementary Table S2. DDCt values of normalized HOX gene expression in MV4; II cells after PKC412 treatment.