DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2017/0145518 A1 Hessels Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2017/0145518 A1 Hessels Et Al US 20170145518A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2017/0145518 A1 Hessels et al. (43) Pub. Date: May 25, 2017 (54) METHOD FOR PREDICTING AND (52) U.S. Cl. TREATING CLINICALLY SIGNIFICANT CPC ..... CI2O 1/6886 (2013.01); C12O 2600/158 PROSTATE CANCER (2013.01) Applicant: MDxHealth Research B.V., Nijmegen (57) ABSTRACT (71) The present invention relates to methods, devices, combi (NL) nations, kits, and systems for predicting and treating clini cally significant prostate cancer in a urine sample of an (72) Inventors: Daphne Hessels, Nijmegen (NL); individual Suspected of Suffering from prostate cancer based Franciscus Petrus Smit, Nijmegen on expression analysis of normalised prostate tumour mark (NL); Jack A. Schalken, Nijmegen ers. The present methods, devices, combinations, kits, and (NL) systems are especially suitable for predicting and treating prostate cancer with a Gleason score of seven or more in (73) Assignee: MDxHealth Research B.V., Nijmegen individuals with a serum prostate-specific antigen (SPSA) (NL) level lower than 15 ng/ml. Specifically, the present invention relates to methods, devices, combinations, kits, and systems for predicting and treating clinically significant prostate (21) Appl. No.: 15/357,342 cancer in a urine sample of an individual Suspected of Suffering from prostate cancer, the method comprises the (22) Filed: Nov. 21, 2016 steps of: a) determining mRNA expression levels of one or more of the genes DLX1, HOXC6, TDRD1 and KLK3 in a Related U.S. Application Data urine sample of said individual; b) normalizing the mRNA expression levels of one ore more of DLX1, HOXC6, and (60) Provisional application No. 62/258,163, filed on Nov. TDRD1 using the mRNA expression level of KLK3; and c) 20, 2015. establishing clinically significant prostate cancer based on a combination of the KLK3 normalized expression levels of the combination of one or more of DLX1, HOXC6, and Publication Classification TDRD1. Treatment for prostate cancer may be administered (51) Int. C. based on the expression levels of one or more of DLX1, C12O 1/68 (2006.01) HOXC6, and TDRD1. Patent Application Publication May 25, 2017. Sheet 1 of 5 US 2017/O145518 A1 FE : R8 try 38 **** 3:38xxx &isix 3:.88: 88: *::::::::888-8:88-88 8: g: 3.3 8:S 3.8 Specificity i:38:3883:38. 3:8:38:::::::::::::ies, Patent Application Publication May 25, 2017. Sheet 2 of 5 US 2017/O145518 A1 FEE 2 is is 8 3.3. 33 38: : 38 3. 33 38 8 38: Specifixity $3:33:833 &:388:3: 383:388:::::::::::. Patent Application Publication May 25, 2017. Sheet 3 of 5 US 2017/O145518 A1 FEE 3 Sorce of the Cie 8-X scre ...... A3 : $88: Patent Application Publication May 25, 2017. Sheet 4 of 5 US 2017/O145518 A1 FORE 3 38 38 s g aw s R 288 28 g s $100 $100 Patent Application Publication May 25, 2017. Sheet 5 of 5 US 2017/O145518 A1 3:8, 5 3.5 85 88 - 3.SS 865 8.s- 8.5- 335 8S - SSA SS & CEE-X3 secre sSA SS -8 SSA as SSA, 3-6 spS38 sSA s3 s333 388 3332 tact 28 US 2017/O 1455 18 A1 May 25, 2017 METHOD FOR PREDCTING AND domain containing 1 (TDRD1), was shown to have inde TREATING CLNICALLY SIGNIFICANT pendent additional value to SPSA for predicting high-grade PROSTATE CANCER PCa upon biopsy. The combination of HOXC6, DLX1, and TDRD1 outperformed Progensa R. PCA3. Furthermore, the CROSS-REFERENCE TO RELATED PATENT predictive accuracy could be improved when urinary APPLICATIONS HOXC6, DLX1, and TDRD1 were combined with SPSA. HOXC6, DLX1, and TDRD1 are upregulated in PCa and 0001. The present application claims the benefit of pri these genes may be involved in the onset of PCa and are ority under 35 U.S.C. 119(e) to U.S. Provisional Patent associated with high-grade PCa. However, although the test Application No. 62/258,163, filed on Nov. 20, 2016, the showed promising results when performed on a urine sedi content of which is incorporated herein by reference in its ment sample, analysis of whole urine samples were not entirety. satisfactory. BACKGROUND SUMMARY 0002 The present invention relates to methods for pre dicting clinically significant prostate cancer in a biopsy 0007 Considering the above, there is an urgent clinical using a urine sample of an individual Suspected of Suffering unmet need in the art for new biomarkers that can predict from prostate cancer. It is based on expression analysis of high-grade disease to aid in decision making regarding normalised prostate tumour markers. The present methods further diagnostic evaluations (for example prostate biopsies are especially suitable for predicting prostate cancer with a or imaging) and treatment. Gleason score of seven or more in individuals with a serum 0008. It is an object of the present invention, amongst prostate-specific antigen (sPSA) level lower than 15 ng/ml. other objects, to meet the above need in the art. The present invention further relates to kits of parts for 0009. According to the invention this object is met, predicting clinically significant prostate cancer in a urine amongst other objected as outlined in the appended claims. sample based on expression analysis and to the use of 0010 Specifically, this object, amongst other objects, is, normalised prostate tumour markers for detecting prostate according to a first aspect, met by method for predicting cancer in a urine sample. clinically significant prostate cancer in a urine sample of an 0003 Worldwide, prostate cancer or PCa is the second individual Suspected of Suffering from prostate cancer, the most frequently diagnosed cancer among men, with 1.1 methods comprise the steps of: million estimated new cases and 307.500 estimated deaths in 0.011 a1) determining mRNA expression levels of one 2012. Since the introduction of serum prostate-specific or more of the genes DLX1, HOXC6, TDRD1, and antigen (sPSA) testing, the incidence of PCa has increased. KLK3 in a urine sample of said individual; However, SPSA-testing has also led to an increased amount of unnecessary biopsies and diagnosis of clinically insig 0012 b1) normalizing the mRNA expression levels of nificant tumors which would not have been life-threatening one or more of DLX1, HOXC6, and TDRD1 using the (potential overtreatment); especially in the spSA grey mRNA expression level of KLK3 (e.g., by dividing the Zone (4.0-10.0 ng/ml) where 65-70% of men have a nega expression levels of one or more of DLX1, HOXC6, tive biopsy result. Men with indolent disease, who undergo and TDRD1 by the mRNA expression level of KLK3); treatment, may suffer complications without a reduction in 0013 c) establishing clinically significant prostate can their risk of dying from PCa. Generally, men with high cer based on a combination of the KLK3 normalized grade PCa have a high probability of dying from PCa within expression levels of the combination of DLX1 and 10 years, whereas men with low-grade PCa have a minimal HOXC6 and optionally TDRD1. risk of dying from this disease. 0014 DLX1 belongs to the family of homeodomain 0004. The major challenge is to improve the detection of transcription factors which are related to the Drosophila clinically significant or high-grade PCa in an early stage. distal-less (Dll) gene. The family has been related to a Both overdiagnosis and overtreatment could be reduced if number of developmental features and appears to be well PCa-specific biomarkers could distinguish indolent from preserved across species. Dlx genes are implicated in tan aggressive tumors. Ideally the biomarkers could be mea gential migration of interneurons from the Subpallium to the Sured in a sample that can be obtained non-invasively, for pallium during vertebrate brain development. It has been example in urine. Suggested that Dlx promotes the migration of interneurons 0005. The Prostate CAncer gene 3 (PCA3)-based urinary by repressing a set of proteins that are normally expressed in test (Progensa R. PCA3, GenProbe) is the only FDA-ap terminally differentiated neurons and act to promote the proved molecular diagnostic test for the detection of PCa in outgrowth of dendrites and axons. urine. PCA3 was identified as a gene encoding a long 0015 With respect to DLX1 expression, at least two non-coding RNA that was consistently upregulated in PCa. transcript variants are known. Transcript variant 1 is longer PCA3 was shown to be of value in PCa detection, however, than transcript variant 2 and contains an internal exon in the the relation with tumor aggressiveness and thus prognostic coding region that results in a frame shift and premature stop value remains controversial. codon. Within the context of the present invention, DLX1 0006. A stepwise approach for the identification and expression level determination refers to determination of the selection of new biomarkers using gene expression profiling expression levels of both transcripts. has been suggested. A gene panel measured in urinary (0016. HOXC6 is a family member of the homeobox sediments predicted Gleason scores 7 upon prostate biopsy. superfamily of genes and the HOX subfamily contain mem The test, based on mRNA levels of Homeobox C6 bers that are transcription factors involved in controlling and (HOXC6), Distal-less Homeobox 1 (DLX1), and Tudor coordinating complex functions during development via US 2017/O 1455 18 A1 May 25, 2017 spatial and temporal expression patterns. In humans, there A suitable reference level for normalizing the expression are 39 classical HOX genes organized into the clusters A, B, levels of a target (e.g., DLX1, HOXC2, and/or TDRD1 C and D. mRNA) may include the expression level of KLK3 mRNA.
Load more

Recommended publications
  • Implications of Zonal Architecture on Differential Gene Expression
    www.nature.com/scientificreports OPEN Implications of zonal architecture on diferential gene expression profling and altered pathway expressions in mandibular condylar cartilage Aisha M. Basudan1*, Mohammad Azhar Aziz2 & Yanqi Yang3 Mandibular condylar cartilage (MCC) is a multi-zonal heterogeneous fbrocartilage containing diferent types of cells, but the factors/mechanisms governing the phenotypic transition across the zones have not been fully understood. The reliability of molecular studies heavily rely on the procurement of pure cell populations from the heterogeneous tissue. We used a combined laser-capture microdissection and microarray analysis approach which allowed identifcation of diferential zone-specifc gene expression profling and altered pathways in the MCC of 5-week-old rats. The bioinformatics analysis demonstrated that the MCC cells clearly exhibited distinguishable phenotypes from the articular chondrocytes. Additionally, a set of genes has been determined as potential markers to identify each MCC zone individually; Crab1 gene showed the highest enrichment while Clec3a was the most downregulated gene at the superfcial layer, which consists of fbrous (FZ) and proliferative zones (PZ). Ingenuity Pathway Analysis revealed numerous altered signaling pathways; Leukocyte extravasation signaling pathway was predicted to be activated at all MCC zones, in particular mature and hypertrophic chondrocytes zones (MZ&HZ), when compared with femoral condylar cartilage (FCC). Whereas Superpathway of Cholesterol Biosynthesis showed predicted activation in both FZ and PZ as compared with deep MCC zones and FCC. Determining novel zone-specifc diferences of large group of potential genes, upstream regulators and pathways in healthy MCC would improve our understanding of molecular mechanisms on regional (zonal) basis, and provide new insights for future therapeutic strategies.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Transcriptional Regulatory Networks in Neocortical Development
    Review From trans to cis: transcriptional regulatory networks in neocortical development 1 1 1,2 Mikihito Shibata , Forrest O. Gulden , and Nenad Sestan 1 Department of Neurobiology and Kavli Institute for Neuroscience, Yale School of Medicine, New Haven, CT 06510, USA 2 Department of Psychiatry and Program in Cellular Neuroscience, Neurodegeneration and Repair, Yale School of Medicine, New Haven, CT 06510, USA Transcriptional mechanisms mediated by the binding of tions among TFs and CREs form the central core of tran- transcription factors (TFs) to cis-acting regulatory ele- scriptional regulatory networks (TRNs) (Box 1) [1]. ments (CREs) in DNA play crucial roles in directing gene Interactions between TFs and CREs are complex, dynam- expression. While TFs have been extensively studied, ic,andmodulatedbyvariousepigeneticprocesses[12].While less effort has gone towards the identification and func- individual CREs may be regulated by the competitive or tional characterization of CREs and associated epigenet- cooperative binding of many TFs, multiple CREs may also ic modulation. However, owing to methodological and confer transcriptional control over the expression of any analytical advances, more comprehensive studies of single gene [12]. Furthermore, TFs and CREs regulate regulatory elements and mechanisms are now possible. transcription together with their cognate transcriptional We summarize recent progress in integrative analyses of cofactors, chromatin regulators, epigenetic modifications, these regulatory components in the development of the RNA-binding proteins, and non-coding RNAs [2,13]. This cerebral neocortex, the part of the brain involved in combinatorial and multi-level transcriptional regulation cognition and complex behavior. These studies are greatly increases the complexity of gene expression regula- uncovering not only the underlying transcriptional reg- tion, facilitating the unique spatio-temporal patterns nec- ulatory networks, but also how these networks are essary for tissue development and function [3].
    [Show full text]
  • Up-Regulation of Homeodomain Genes, DLX1 and DLX2, by FLT3 Signaling
    SUPPLEMENTARY APPENDIX Up-regulation of homeodomain genes, DLX1 and DLX2, by FLT3 signaling Julia Starkova,1,3 Sharvari Gadgil,2 Yi Hua Qiu,4 Nianxiang Zhang,4 Ivana Hermanova,3 Steven M. Kornblau,4 and Harry A. Drabkin1,3 1Division of Hematology-Oncology, Medical University of South Carolina, Charleston, SC, USA; 2Division of Medical Oncology, University of Colorado Health Sciences Center, Aurora, CO, USA; 3Department of Paediatric Haematology/Oncology, 2nd Faculty of Medicine, Charles University Prague, Czech Republic, and 4Department of Stem Cell Transplantation and Cellular Therapy, Section of Molecular Hematology and Therapy, The University of Texas M.D. Anderson Cancer Center, Houston, Texas, USA Citation: Starkova J, Gadgil S, Hua Qiu Y, Zhang N, Hermanova I, Kornblau SM, and Drabkin HA. Up-regulation of homeodomain genes, DLX1 and DLX2, by FLT3 signaling. Haematologica 2011;96(6):820-828. doi:10.3324/haematol.2010.031179 Online Supplementary Figure S1. Specificity and non-toxicity of PKC412 in MV4;11 cells (A) Results from flow cytometry analysis are shown as a percentage of cells in subG1, G1-G0, S and G2-M phases of the cell cycle after 0, 2, 5 and 24 h treatment of MV4;11 cells with PKC412. (B) Graph shows fold-change of DLX1 gene expression in MV4;11 cells after imatinib treatment. A B Online Supplementary Figure S2. AP1-binding site in the DLX1 promoter. Online Supplementary Figure S3. Diagram of the described interaction between FLT3 and DLX1. Online Supplementary Table S1. Primes sequences. Online Supplementary Table S2. DDCt values of normalized HOX gene expression in MV4; II cells after PKC412 treatment.
    [Show full text]
  • Transcriptional and Post-Transcriptional Regulation of ATP-Binding Cassette Transporter Expression
    Transcriptional and Post-transcriptional Regulation of ATP-binding Cassette Transporter Expression by Aparna Chhibber DISSERTATION Submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Pharmaceutical Sciences and Pbarmacogenomies in the Copyright 2014 by Aparna Chhibber ii Acknowledgements First and foremost, I would like to thank my advisor, Dr. Deanna Kroetz. More than just a research advisor, Deanna has clearly made it a priority to guide her students to become better scientists, and I am grateful for the countless hours she has spent editing papers, developing presentations, discussing research, and so much more. I would not have made it this far without her support and guidance. My thesis committee has provided valuable advice through the years. Dr. Nadav Ahituv in particular has been a source of support from my first year in the graduate program as my academic advisor, qualifying exam committee chair, and finally thesis committee member. Dr. Kathy Giacomini graciously stepped in as a member of my thesis committee in my 3rd year, and Dr. Steven Brenner provided valuable input as thesis committee member in my 2nd year. My labmates over the past five years have been incredible colleagues and friends. Dr. Svetlana Markova first welcomed me into the lab and taught me numerous laboratory techniques, and has always been willing to act as a sounding board. Michael Martin has been my partner-in-crime in the lab from the beginning, and has made my days in lab fly by. Dr. Yingmei Lui has made the lab run smoothly, and has always been willing to jump in to help me at a moment’s notice.
    [Show full text]
  • Ncounter Neuropathology Panel – Product Bulletin
    PRODUCT BULLETIN nCounter® Neuropathology Gene Expression Panel nCounter® Neuropathology Panel Gene Expression Panel For the study of neurodegenerative diseases The nCounter Neuropathology panels are designed NEURO ON PLA TI ST to encompass all aspects of neurodegeneration AC IC R IT E Y T for use in basic and translational research. IN C E IA L L L Each human or mouse panel provides an G I - N N T E effective means to comprehensively evaluate O G R R U I neurodegeneration and research the pathogenesis E T Y N of all types of neurodegenerative diseases. N E M U S I R L O O T B R A A T Product Highlights N E S M M IS N • Comprehensive assessment of neurodegenerative SI IO ON AT pathways and processes N MM EUROINFLA • Unique cell typing feature measures the abundance Applications of five important cell types including neurons, astrocytes, microglia, oligodendrocytes and endothelial cells • Gene expression profiling of neurodegenerative disease • Customizable with Panel Plus option—add up to 30 mechanisms for Alzheimer’s disease, Parkinson’s disease, genes of your choosing frontotemporal dementia, amyotrophic lateral sclerosis, and others • nCounter workflow is simple, user-friendly, and • Therapeutics research and signature generation efficient with just 15 minutes total hands-on time • Biomarker characterization Feature Specifications Number of Targets 770 (Human), 770 (Mouse) including internal reference genes Standard Input Material (No amplification required) 25 ng–300 ng As little as 1 ng with nCounter RNA Low Input Kit and Low Input
    [Show full text]
  • Mapping Origins of Variation in Neural Trajectories of Human Pluripotent Stem Cells
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.17.435870; this version posted March 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Mapping origins of variation in neural trajectories of human pluripotent stem cells Suel-Kee Kim1,11,13, Seungmae Seo1,13, Genevieve Stein-O’Brien1,7,13, Amritha Jaishankar1,13, Kazuya Ogawa1, Nicola Micali1,11, Yanhong Wang1, Thomas M. Hyde1,3,5, Joel E. Kleinman1,3, Ty Voss9, Elana J. Fertig4, Joo-Heon Shin1, Roland Bürli10, Alan J. Cross10, Nicholas J. Brandon10, Daniel R. Weinberger1,3,5,6,7, Joshua G. Chenoweth1, Daniel J. Hoeppner1, Nenad Sestan11,12, Carlo Colantuoni1,3,6,8,*, Ronald D. McKay1,2,* 1Lieber Institute for Brain Development, 855 North Wolfe Street, Baltimore, MD 21205 2Department of Cell Biology, 3Department of Neurology, 4Departments of Oncology, Biomedical Engineering, and Applied Mathematics and Statistics, 5Department of Psychiatry, 6Department of Neuroscience, 7McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins School of Medicine, Baltimore, MD 21205 8Institute for Genome Sciences, University of Maryland School of Medicine, Baltimore, MD 21201 9Division of Preclinical Innovation, Nation Center for Advancing Translational Science / NIH, Bethesda, MD 20892 10Astra-Zeneca Neuroscience iMED., 141 Portland Street, Cambridge, MA 01239 11Department of Neuroscience, 12Departments of Genetics, of Psychiatry and of Comparative Medicine, Kavli Institute for Neuroscience, Program in Cellular Neuroscience, Neurodegeneration and Repair, Child Study Center, Yale School of Medicine, New Haven, CT 06510, USA. 13Co-first author *Corresponding authors: [email protected] (C.C.), [email protected] (R.D.M.) Lead contact: R.
    [Show full text]
  • DLX Genes: Roles in Development and Cancer
    cancers Review DLX Genes: Roles in Development and Cancer Yinfei Tan 1,* and Joseph R. Testa 1,2,* 1 Genomics Facility, Fox Chase Cancer Center, Philadelphia, PA 19111, USA 2 Cancer Signaling and Epigenetics Program, Fox Chase Cancer Center, Philadelphia, PA 19111, USA * Correspondence: [email protected] (Y.T.); [email protected] (J.R.T.) Simple Summary: DLX homeobox family genes encode transcription factors that have indispensable roles in embryonic and postnatal development. These genes are critically linked to the morphogene- sis of craniofacial structures, branchial arches, forebrain, and sensory organs. DLX genes are also involved in postnatal homeostasis, particularly hematopoiesis and, when dysregulated, oncogen- esis. DLX1/2, DLX3/4, and DLX5/6 exist as bigenes on different chromosomes, sharing intergenic enhancers between gene pairs, which allows orchestrated spatiotemporal expression. Genomic alterations of human DLX gene enhancers or coding sequences result in congenital disorders such as split-hand/foot malformation. Aberrant postnatal expression of DLX genes is associated with hematological malignancies, including leukemias and lymphomas. In several mouse models of T-cell lymphoma, Dlx5 has been shown to act as an oncogene by cooperating with activated Akt, Notch1/3, and/or Wnt to drive tumor formation. In humans, DLX5 is aberrantly expressed in lung and ovarian carcinomas and holds promise as a therapeutic target. Abstract: Homeobox genes control body patterning and cell-fate decisions during development. The homeobox genes consist of many families, only some of which have been investigated regarding a possible role in tumorigenesis. Dysregulation of HOX family genes have been widely implicated in cancer etiology.
    [Show full text]
  • Epigenetic Mechanisms Are Involved in the Oncogenic Properties of ZNF518B in Colorectal Cancer
    Epigenetic mechanisms are involved in the oncogenic properties of ZNF518B in colorectal cancer Francisco Gimeno-Valiente, Ángela L. Riffo-Campos, Luis Torres, Noelia Tarazona, Valentina Gambardella, Andrés Cervantes, Gerardo López-Rodas, Luis Franco and Josefa Castillo SUPPLEMENTARY METHODS 1. Selection of genomic sequences for ChIP analysis To select the sequences for ChIP analysis in the five putative target genes, namely, PADI3, ZDHHC2, RGS4, EFNA5 and KAT2B, the genomic region corresponding to the gene was downloaded from Ensembl. Then, zoom was applied to see in detail the promoter, enhancers and regulatory sequences. The details for HCT116 cells were then recovered and the target sequences for factor binding examined. Obviously, there are not data for ZNF518B, but special attention was paid to the target sequences of other zinc-finger containing factors. Finally, the regions that may putatively bind ZNF518B were selected and primers defining amplicons spanning such sequences were searched out. Supplementary Figure S3 gives the location of the amplicons used in each gene. 2. Obtaining the raw data and generating the BAM files for in silico analysis of the effects of EHMT2 and EZH2 silencing The data of siEZH2 (SRR6384524), siG9a (SRR6384526) and siNon-target (SRR6384521) in HCT116 cell line, were downloaded from SRA (Bioproject PRJNA422822, https://www.ncbi. nlm.nih.gov/bioproject/), using SRA-tolkit (https://ncbi.github.io/sra-tools/). All data correspond to RNAseq single end. doBasics = TRUE doAll = FALSE $ fastq-dump -I --split-files SRR6384524 Data quality was checked using the software fastqc (https://www.bioinformatics.babraham. ac.uk /projects/fastqc/). The first low quality removing nucleotides were removed using FASTX- Toolkit (http://hannonlab.cshl.edu/fastxtoolkit/).
    [Show full text]
  • Castration Delays Epigenetic Aging and Feminizes DNA
    RESEARCH ARTICLE Castration delays epigenetic aging and feminizes DNA methylation at androgen- regulated loci Victoria J Sugrue1, Joseph Alan Zoller2, Pritika Narayan3, Ake T Lu4, Oscar J Ortega-Recalde1, Matthew J Grant3, C Simon Bawden5, Skye R Rudiger5, Amin Haghani4, Donna M Bond1, Reuben R Hore6, Michael Garratt1, Karen E Sears7, Nan Wang8, Xiangdong William Yang8,9, Russell G Snell3, Timothy A Hore1†*, Steve Horvath4†* 1Department of Anatomy, University of Otago, Dunedin, New Zealand; 2Department of Biostatistics, Fielding School of Public Health, University of California, Los Angeles, Los Angeles, United States; 3Applied Translational Genetics Group, School of Biological Sciences, Centre for Brain Research, The University of Auckland, Auckland, New Zealand; 4Department of Human Genetics, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, United States; 5Livestock and Farming Systems, South Australian Research and Development Institute, Roseworthy, Australia; 6Blackstone Hill Station, Becks, RD2, Omakau, New Zealand; 7Department of Ecology and Evolutionary Biology, UCLA, Los Angeles, United States; 8Center for Neurobehavioral Genetics, Semel Institute for Neuroscience and Human Behavior, University of California, Los Angeles (UCLA), Los Angeles, United States; 9Department of Psychiatry and Biobehavioral Sciences, David Geffen School of Medicine at UCLA, Los Angeles, United States *For correspondence: Abstract In mammals, females generally live longer than males. Nevertheless, the mechanisms [email protected] (TAH); underpinning sex-dependent longevity are currently unclear. Epigenetic clocks are powerful [email protected] (SH) biological biomarkers capable of precisely estimating chronological age and identifying novel †These authors contributed factors influencing the aging rate using only DNA methylation data. In this study, we developed the equally to this work first epigenetic clock for domesticated sheep (Ovis aries), which can predict chronological age with a median absolute error of 5.1 months.
    [Show full text]
  • Dlx1 and Dlx2 Function Is Necessary for Terminal Differentiation And
    Research article 311 Dlx1 and Dlx2 function is necessary for terminal differentiation and survival of late-born retinal ganglion cells in the developing mouse retina Jimmy de Melo1, Guoyan Du2,3, Mario Fonseca2,3, Leigh-Anne Gillespie3, William J. Turk3, John L. R. Rubenstein4 and David D. Eisenstat1,2,3,5,* 1Department of Human Anatomy and Cell Science, University of Manitoba, Winnipeg, Manitoba, R3E 3J7, Canada 2Department of Pediatrics and Child Health, University of Manitoba, Winnipeg, Manitoba, R3A 1S1, Canada 3Manitoba Institute of Cell Biology, Cancer Care Manitoba, Winnipeg, Manitoba, R3E 0V9, Canada 4Department of Psychiatry, University of California, San Francisco, CA 94143, USA 5Department of Ophthalmology, University of Manitoba, Winnipeg, Manitoba, R3E 0V9, Canada *Author for correspondence (e-mail: [email protected]) Accepted 3 November 2004 Development 132, 311-322 Published by The Company of Biologists 2005 doi:10.1242/dev.01560 Summary Dlx homeobox genes, the vertebrate homologs of Distal- Ectopic expression of Crx, the cone and rod photoreceptor less, play important roles in the development of the homeobox gene, in the GCL and neuroblastic layers of the vertebrate forebrain, craniofacial structures and limbs. mutants may signify altered cell fate of uncommitted RGC Members of the Dlx gene family are also expressed in progenitors. However, amacrine and horizontal cell retinal ganglion cells (RGC), amacrine and horizontal cells differentiation is relatively unaffected in the Dlx1/2 null of the developing and postnatal retina. Expression begins retina. Herein, we propose a model whereby early-born at embryonic day 12.5 and is maintained until late RGCs are Dlx1 and Dlx2 independent, but Dlx function is embryogenesis for Dlx1, while Dlx2 expression extends to necessary for terminal differentiation of late-born RGC adulthood.
    [Show full text]