DOCSLIB.ORG

GENOMIC REGULATION of CLOCK FUNCTION a Dissertation Submitted

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
GENOMIC REGULATION of CLOCK FUNCTION a Dissertation Submitted GENOMIC REGULATION OF CLOCK FUNCTION A dissertation submitted to Kent State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Jessica L. Vespoli July, 2015 © Copyright All rights reserved Dissertation written by Jessica L. Vespoli B.S., University of Pittsburgh Johnstown, 2009 Approved by __________________________________________________ Dr. Eric M. Mintz, Ph.D., Department of Biological Sciences, Doctoral Advisor __________________________________________________ Dr. Gail Fraizer, Ph.D., Department of Biological Sciences __________________________________________________ Dr. Olena Piontkivska, Ph.D., Department of Biological Sciences __________________________________________________ Dr. Aaron Jasnow, Ph.D., Department of Psychological Sciences __________________________________________________ Dr. Fayez Safadi, Ph.D., Department of Anatomy & Neurobiology, NEOMED Accepted by __________________________________________________ Dr. Laura Leff, Ph.D., Chair, Department of Biological Sciences __________________________________________________ Dr. James L. Blank, Ph.D., Dean, College of Arts and Sciences ii Table of Contents Page List of Figures……………………………………………………………………………vii List of Tables……………………………………………………………………………..ix List of Abbreviations……………………………………………………………………...x Acknowledgements……………………………………………………………………...xiv CHAPTER I. Introduction………………………………………………………………. 1 Background on Circadian Rhythms ................................................................................ 1 The Molecular Circadian Clock………………………………………………………...3 The Suprachiasmatic Nucleus…………………………………………………………. 6 SCN organization……………………………………………………………………...10 VIP in the SCN……………………………………………………………………….. 12 AVP in the SCN……………………………………………………………………… 13 GRP in the SCN…………………………………………………………………….... 14 Peripheral Clocks……………………………………………………………………...15 Estrogen and the Genomic Circadian Clock…………………………………………. 16 Relevance to Human Health …………………………………………………………. 17 Specific Aims………………………………………………………………………….21 iii CHAPTER II. Circadian and subregional gene expression in the suprachiasmatic nucleus……...…………………………………………………………………………… 24 Introduction……………………………………………………………………. ...24 Materials and Methods………………………………………………………… ...26 Animals………………………………………………………………… ..............26 Tissue Preparation……………………………………………………… ..............26 Analysis……………..…………………………………………………................28 Results………………………………………………………………………….... 29 Microarray analysis of rhythmic gene expression...………………… ............…..29 Microarray analysis of regional gene expression….………………… .............….34 Discussion………………………………………………………………………..36 CHAPTER III. Estrogen response element and the core circadian clock genes: a bioinformatics analysis.…..………………………………………………… …………...44 Introduction…………………………………………… ............………………………....44 Materials and Methods……………………………… ............…………………………...49 Sequences…………………………………………… .........................…………………..49 ERE predictions and alignment……………………… ........................………………….49 Results………………………………………………… ............………………………....53 Predicted EREs……...……………………………… ........................…………………...53 Conservation of EREs……………………………… .........................…………………...55 Discussion…………… ............…………………………………………………………..56 CHAPTER IV. Estrogen and the peripheral clock………………………………………61 Introduction………… ............…………………………………………………………....61 Materials and Methods……………… ............…………………………………………...62 iv Animals…………………………………………………… ........................……………..62 Tissue preparation and analysis of gene expression.…………… ........................……….63 Results ................................................................................................................................66 Liver ...................................................................................................................................66 Uterus .................................................................................................................................77 Discussion ..........................................................................................................................90 CHAPTER V. Global Discussion .....................................................................................95 Future Directions ...............................................................................................................98 References ........................................................................................................................100 v List of Figures Page CHAPTER I. Introduction Fig. 1.1. Molecular Circadian Feedback Loop………………………………………...4 Fig. 1.2. The SCN ……………..………………………………………………………6 Fig. 1.3. The pathway of light through the SCN……...……………………………….8 Fig. 1.4. SCN ssubregions………………………………….…………………………11 Fig. 1.5. The pathway of estrogenic action…………………………………………...17 CHAPTER II. Temporal analysis of the SCN by microarray Fig. 2.1. Regional gene expression differences……………...………………………..27 Fig. 2.2. qPCR of circadian gene expression………...………………………………..30 Fig. 2.3. Venn diagram of regional expression ……………...………………………..33 Fig. 2.4. Comparison of the Dorsal and Ventral SCN ……………..……………..…..37 Fig. 2.5. Allen Brain atlas images for circadian genes ……………………………….39 CHAPTER III. Estrogen Response Elements and the Core Circadian Clock: a bioinformatics analysis Fig. 3.1. Scatter Plot of Predicted EREs in core circadian clock genes ......................... 54 vi CHAPTER IV. Fig. 4.1. Clock expression in the Liver 2 hours after treatment .........................................64 Fig. 4.2. Clock expression in the Liver 24 hours after treatment ......................................65 Fig. 4.3. Bmal1 expression in the Liver 2 hours after treatment .......................................67 Fig. 4.4. Bmal1 expression in the Liver 24 hours after treatment .....................................68 Fig. 4.5. Per1 expression in the Liver 2 hours after treatment .........................................70 Fig. 4.6. Per1 expression in the Liver 24 hours after treatment .......................................71 Fig. 4.7. Per2 expression in the Liver 2 hours after treatment .........................................73 Fig. 4.8. Per2 expression in the Liver 24 hours after treatment .......................................74 Fig. 4.9. Per3 expression in the Liver 2 hours after treatment .........................................75 Fig. 4.10. Per3 expression in the Liver 24 hours after treatment .....................................76 Fig. 4.11. Clock expression in the Uterus 2 hours after treatment ....................................78 Fig. 4.12. Clock expression in the Uterus 24 hours after treatment ..................................79 Fig. 4.13. Bmal1 expression in the Uterus 2 hours after treatment ...................................81 Fig. 4.14. Bmal1 expression in the Uterus 24 hours after treatment .................................82 Fig. 4.15. Per1 expression in the Uterus 2 hours after treatment .....................................83 Fig. 4.16. Per1 expression in the Uterus 24 hours after treatment ...................................84 Fig. 4.17. Per2 expression in the Uterus 2 hours after treatment .....................................86 Fig. 4.18. Per2 expression in the Uterus 24 hours after treatment ...................................87 Fig. 4.19. Per3 expression in the Uterus 2 hours after treatment .....................................88 Fig. 4.20. Per3 expression in the Uterus 24 hours after treatment ...................................89 vii List of Tables Page Table 2.1. Known clock-related cycling genes in the SCN ............................................. 31 Table 2.2. Cycling genes in the SCN of unknown circadian function ...............................32 Table 2.3. Results of DAVID functional analysis .............................................................35 Table 2.4. Gene list of the 85 differentially expressed ventral genes ...............................38 Table 3.1. Ensembl genome identification for all species and genes ......................... 46-48 Table 3.2. Predicted EREs for Clock related and control genes ........................................50 Table 3.3. Conservation of predicted EREs for all genes ................................................ 52 Table 4.1 Summary of the effect of estrogen on clock genes in the liver and uterus ........91 viii List of Abbreviations ACTH – adrenocorticotropic hormone AGT – angiotensinogen ARC – arcuate nucleus AVP – arginine vasopressin Bmal1 – brain and muscle aryl hydrocarbon receptor nuclear translocator (ARNT) –like Brca1 – Breast Cancer 1, Early Onset BST – bed nucleus of the stria terminalis CK – casein kinase Clock – circadian locomotor output cycles kaput Cox7 – Cytochrome C Oxidase Subunit Cry1 – cryptochrome 1 Cry2 – cryptochrome 2 CT – circadian time ix CTSD – Cathepsin D DD – constant darkness EMC – extraskeletal myxoid chondrosarcoma ER – estrogen receptor ERE – estrogen response element ERU – estrogen response unit Gapdh – Glyceraldehyde-3-Phosphate Dehydrogenase GHT – geniculohypothalamic tract GPI – Glucose-6-Phosphate Isomerase GPR30 – G protein-coupled receptor 30 GRP – gastrin releasing polypeptide i.p. – intraperitoneal LCM – laser capture microscopy LD – light-dark Nt – nucleotide x OVX – ovariectomized Per1 – period 1 Per2 – period 2 Per3 – period 3 PSMB2 – Proteasome (Prosome, Macropain) Subunit, Beta Type, 2 PVN – paraventricular nucleus qPCR – quantitative realtime
Load more

Recommended publications
  • Implications of Zonal Architecture on Differential Gene Expression
    www.nature.com/scientificreports OPEN Implications of zonal architecture on diferential gene expression profling and altered pathway expressions in mandibular condylar cartilage Aisha M. Basudan1*, Mohammad Azhar Aziz2 & Yanqi Yang3 Mandibular condylar cartilage (MCC) is a multi-zonal heterogeneous fbrocartilage containing diferent types of cells, but the factors/mechanisms governing the phenotypic transition across the zones have not been fully understood. The reliability of molecular studies heavily rely on the procurement of pure cell populations from the heterogeneous tissue. We used a combined laser-capture microdissection and microarray analysis approach which allowed identifcation of diferential zone-specifc gene expression profling and altered pathways in the MCC of 5-week-old rats. The bioinformatics analysis demonstrated that the MCC cells clearly exhibited distinguishable phenotypes from the articular chondrocytes. Additionally, a set of genes has been determined as potential markers to identify each MCC zone individually; Crab1 gene showed the highest enrichment while Clec3a was the most downregulated gene at the superfcial layer, which consists of fbrous (FZ) and proliferative zones (PZ). Ingenuity Pathway Analysis revealed numerous altered signaling pathways; Leukocyte extravasation signaling pathway was predicted to be activated at all MCC zones, in particular mature and hypertrophic chondrocytes zones (MZ&HZ), when compared with femoral condylar cartilage (FCC). Whereas Superpathway of Cholesterol Biosynthesis showed predicted activation in both FZ and PZ as compared with deep MCC zones and FCC. Determining novel zone-specifc diferences of large group of potential genes, upstream regulators and pathways in healthy MCC would improve our understanding of molecular mechanisms on regional (zonal) basis, and provide new insights for future therapeutic strategies.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • A Wheel of Time: the Circadian Clock, Nuclear Receptors, and Physiology
    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press PERSPECTIVE A wheel of time: the circadian clock, nuclear receptors, and physiology Xiaoyong Yang1 Program in Integrative Cell Signaling and Neurobiology of Metabolism, Section of Comparative Medicine, Department of Cellular and Molecular Physiology, Yale University School of Medicine, New Haven, Connecticut 06519, USA It is a long-standing view that the circadian clock func- The rhythmic production and circulation of many tions to proactively align internal physiology with the hormones and metabolites within the endocrine system 24-h rotation of the earth. Recent studies, including one is instrumental in regulating regular physiological pro- by Schmutz and colleagues (pp. 345–357) in the February cesses such as reproduction, blood pressure, and metabo- 15, 2010, issue of Genes & Development, delineate strik- lism. Levels of circulating estrogen and progesterone ingly complex connections between molecular clocks and fluctuate with the menstrual cycle, which in turn affect nuclear receptor signaling pathways, implying the exis- circadian rhythms in women (Shechter and Boivin 2010). tence of a large-scale circadian regulatory network co- In parallel with a diurnal rhythm in circulating adrenocor- ordinating a diverse array of physiological processes to ticotropic hormone, secretion of glucocorticoids and aldo- maintain dynamic homeostasis. sterone from the adrenal gland rises before awakening (Weitzman 1976). Glucocorticoids boost energy produc- tion, and aldosterone increases blood pressure, together gearing up the body for the activity phase. Similarly, Light from the sun sustains life on earth. The 24-h plasma levels of thyroid-stimulating hormone and triiodo- rotation of the earth exposes a vast number of plants thyronine have a synchronous diurnal rhythm (Russell and animals to the light/dark cycle.
    [Show full text]
  • Melatonin Synthesis and Clock Gene Regulation in the Pineal Organ Of
    General and Comparative Endocrinology 279 (2019) 27–34 Contents lists available at ScienceDirect General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen Review article Melatonin synthesis and clock gene regulation in the pineal organ of teleost fish compared to mammals: Similarities and differences T ⁎ Saurav Saha, Kshetrimayum Manisana Singh, Braj Bansh Prasad Gupta Environmental Endocrinology Laboratory, Department of Zoology, North-Eastern Hill University, Shillong 793022, India ARTICLE INFO ABSTRACT Keywords: The pineal organ of all vertebrates synthesizes and secretes melatonin in a rhythmic manner due to the circadian Aanat gene rhythm in the activity of arylalkylamine N-acetyltransferase (AANAT) – the rate-limiting enzyme in melatonin Circadian rhythm synthesis pathway. Nighttime increase in AANAT activity and melatonin synthesis depends on increased ex- Clock genes pression of aanat gene (a clock-controlled gene) and/or post-translation modification of AANAT protein. In Melatonin synthesis mammalian and avian species, only one aanat gene is expressed. However, three aanat genes (aanat1a, aanat1b, Pineal organ and aanat2) are reported in fish species. While aanat1a and aanat1b genes are expressed in the fish retina, the Photoperiod fi Temperature nervous system and other peripheral tissues, aanat2 gene is expressed exclusively in the sh pineal organ. Clock genes form molecular components of the clockwork, which regulates clock-controlled genes like aanat gene. All core clock genes (i.e., clock, bmal1, per1, per2, per3, cry1 and cry2) and aanat2 gene (a clock-controlled gene) are expressed in the pineal organ of several fish species. There is a large body of information on regulation of clock genes, aanat gene and melatonin synthesis in the mammalian pineal gland.
    [Show full text]
  • Transcriptional Regulatory Networks in Neocortical Development
    Review From trans to cis: transcriptional regulatory networks in neocortical development 1 1 1,2 Mikihito Shibata , Forrest O. Gulden , and Nenad Sestan 1 Department of Neurobiology and Kavli Institute for Neuroscience, Yale School of Medicine, New Haven, CT 06510, USA 2 Department of Psychiatry and Program in Cellular Neuroscience, Neurodegeneration and Repair, Yale School of Medicine, New Haven, CT 06510, USA Transcriptional mechanisms mediated by the binding of tions among TFs and CREs form the central core of tran- transcription factors (TFs) to cis-acting regulatory ele- scriptional regulatory networks (TRNs) (Box 1) [1]. ments (CREs) in DNA play crucial roles in directing gene Interactions between TFs and CREs are complex, dynam- expression. While TFs have been extensively studied, ic,andmodulatedbyvariousepigeneticprocesses[12].While less effort has gone towards the identification and func- individual CREs may be regulated by the competitive or tional characterization of CREs and associated epigenet- cooperative binding of many TFs, multiple CREs may also ic modulation. However, owing to methodological and confer transcriptional control over the expression of any analytical advances, more comprehensive studies of single gene [12]. Furthermore, TFs and CREs regulate regulatory elements and mechanisms are now possible. transcription together with their cognate transcriptional We summarize recent progress in integrative analyses of cofactors, chromatin regulators, epigenetic modifications, these regulatory components in the development of the RNA-binding proteins, and non-coding RNAs [2,13]. This cerebral neocortex, the part of the brain involved in combinatorial and multi-level transcriptional regulation cognition and complex behavior. These studies are greatly increases the complexity of gene expression regula- uncovering not only the underlying transcriptional reg- tion, facilitating the unique spatio-temporal patterns nec- ulatory networks, but also how these networks are essary for tissue development and function [3].
    [Show full text]
  • Role of the Nuclear Receptor Rev-Erb Alpha in Circadian Food Anticipation and Metabolism Julien Delezie
    Role of the nuclear receptor Rev-erb alpha in circadian food anticipation and metabolism Julien Delezie To cite this version: Julien Delezie. Role of the nuclear receptor Rev-erb alpha in circadian food anticipation and metabolism. Neurobiology. Université de Strasbourg, 2012. English. NNT : 2012STRAJ018. tel- 00801656 HAL Id: tel-00801656 https://tel.archives-ouvertes.fr/tel-00801656 Submitted on 10 Apr 2013 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITÉ DE STRASBOURG ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTE CNRS UPR 3212 · Institut des Neurosciences Cellulaires et Intégratives THÈSE présentée par : Julien DELEZIE soutenue le : 29 juin 2012 pour obtenir le grade de : Docteur de l’université de Strasbourg Discipline/ Spécialité : Neurosciences Rôle du récepteur nucléaire Rev-erbα dans les mécanismes d’anticipation des repas et le métabolisme THÈSE dirigée par : M CHALLET Etienne Directeur de recherche, université de Strasbourg RAPPORTEURS : M PFRIEGER Frank Directeur de recherche, université de Strasbourg M KALSBEEK Andries
    [Show full text]
  • FOXN3 Inhibits Cell Proliferation Though Regulating E2F1 in Prostate Cancer
    Research Paper FOXN3 Inhibits Cell Proliferation though Regulating E2F1 in Prostate Cancer NING. ZHANG, HAIJUN. YANG* AND QINGQI. ZENG Department of Traditional Chinese Medicine, Jiangsu Health Vocational College, No. 69 Huangshanling Road, Nanjing, Jiangsu 211800, China Zhang et al.: FOXN3 Inhibits Cell Proliferation in Prostate Cancer In this study, it was demonstrated that forkhead box N3 was downregulated in prostate cancer tissues compared to the matched normal adjacent tissues. Prostate cancer patients with high forkhead box N3 expression more frequently had longer survival (P<0.05) than those with low forkhead box N3 expression. Forkhead box N3 inhibited prostate cancer cell proliferation in vitro and in vivo. In addition, forkhead box N3 repressed expression of E2F1, a reported potential oncogene at the messenger ribonucleic acid and protein levels. Taken together, these data delineate an unrecognized function of forkhead box N3 as a tumor suppressor in prostate cancer via repressing the expression of E2F1. Key words: Prostate cancer, FOXN3, E2F1, cell proliferation As a common urogenital system malignant tumor in could down-regulate E2F5 in human cells to control men, prostate cancer (PC) threatens men’s health and cell cycle or inhibit protein biosynthesis[6]. In addition, becomes an important cause of death in the elderly[1]. studies have shown that FOXN3 is significantly The incidence of PC has increased in most countries downregulated in several cancer tissues including oral and PC represents a major disease burden worldwide in laryngeal carcinoma hepatocellular carcinoma, the past decade[2,3]. Treatment options for PC depended squamous cell carcinoma and colon cancer[6,9,10].
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Correlation Between Circadian Gene Variants and Serum Levels of Sex Steroids and Insulin-Like Growth Factor-I
    3268 Correlation between Circadian Gene Variants and Serum Levels of Sex Steroids and Insulin-like Growth Factor-I Lisa W. Chu,1,2 Yong Zhu,3 Kai Yu,1 Tongzhang Zheng,3 Anand P. Chokkalingam,4 Frank Z. Stanczyk,5 Yu-Tang Gao,6 and Ann W. Hsing1 1Division of Cancer Epidemiology and Genetics and 2Cancer Prevention Fellowship Program, Office of Preventive Oncology, National Cancer Institute, NIH, Bethesda, Maryland; 3Department of Epidemiology and Public Health, Yale University School of Medicine, New Haven, Connecticut; 4Division of Epidemiology, School of Public Health, University of California at Berkeley, Berkeley, California; 5Department of Obstetrics and Gynecology, Keck School of Medicine, University of Southern California, Los Angeles, California; and 6Department of Epidemiology, Shanghai Cancer Institute, Shanghai, China Abstract A variety of biological processes, including steroid the GG genotype. In addition, the PER1 variant was hormone secretion, have circadian rhythms, which are associated with higher serum levels of sex hormone- P influenced by nine known circadian genes. Previously, binding globulin levels ( trend = 0.03), decreasing we reported that certain variants in circadian genes 5A-androstane-3A,17B-diol glucuronide levels P P were associated with risk for prostate cancer. To pro- ( trend = 0.02), and decreasing IGFBP3 levels ( trend = vide some biological insight into these findings, we 0.05). Furthermore, the CSNK1E variant C allele was examined the relationship of five variants of circadian associated with higher
    [Show full text]
  • Up-Regulation of Homeodomain Genes, DLX1 and DLX2, by FLT3 Signaling
    SUPPLEMENTARY APPENDIX Up-regulation of homeodomain genes, DLX1 and DLX2, by FLT3 signaling Julia Starkova,1,3 Sharvari Gadgil,2 Yi Hua Qiu,4 Nianxiang Zhang,4 Ivana Hermanova,3 Steven M. Kornblau,4 and Harry A. Drabkin1,3 1Division of Hematology-Oncology, Medical University of South Carolina, Charleston, SC, USA; 2Division of Medical Oncology, University of Colorado Health Sciences Center, Aurora, CO, USA; 3Department of Paediatric Haematology/Oncology, 2nd Faculty of Medicine, Charles University Prague, Czech Republic, and 4Department of Stem Cell Transplantation and Cellular Therapy, Section of Molecular Hematology and Therapy, The University of Texas M.D. Anderson Cancer Center, Houston, Texas, USA Citation: Starkova J, Gadgil S, Hua Qiu Y, Zhang N, Hermanova I, Kornblau SM, and Drabkin HA. Up-regulation of homeodomain genes, DLX1 and DLX2, by FLT3 signaling. Haematologica 2011;96(6):820-828. doi:10.3324/haematol.2010.031179 Online Supplementary Figure S1. Specificity and non-toxicity of PKC412 in MV4;11 cells (A) Results from flow cytometry analysis are shown as a percentage of cells in subG1, G1-G0, S and G2-M phases of the cell cycle after 0, 2, 5 and 24 h treatment of MV4;11 cells with PKC412. (B) Graph shows fold-change of DLX1 gene expression in MV4;11 cells after imatinib treatment. A B Online Supplementary Figure S2. AP1-binding site in the DLX1 promoter. Online Supplementary Figure S3. Diagram of the described interaction between FLT3 and DLX1. Online Supplementary Table S1. Primes sequences. Online Supplementary Table S2. DDCt values of normalized HOX gene expression in MV4; II cells after PKC412 treatment.
    [Show full text]