Homology Requirements for Targeting Heterologous Sequences During P-Induced Gap Repair in Drosophila Melanogastd

Homology Requirements for Targeting Heterologous Sequences During P-Induced Gap Repair in Drosophila melanogastd

Tammy Dray and Gregory B. Gloor Department of Biochemistry, University of Western Ontario, London, Ontario, Canada Manuscript received January 23, 1997 Accepted for publication June 26, 1997

ABSTRACT The effect of homology on gene targeting was studied in the context of P-element-induced double- strand breaks at the white locus of Lkosophila melanogaster. Double-strand breaks were made by excision of F'-Whd, a P-element insertion in the white gene. A nested set of repair templates was generated that contained the 8 kilobase (kb) yellow gene embedded within varying amounts of white gene sequence. Repair with unlimited homology was also analyzed. Flies were scored phenotypically for conversion of the yellow gene to thewhite locus. Targeting of the yellow gene was abolished when all of the 3' homology was removed. Increases in template homology up to 51 base pairs (bp) did not significantly promote targeting. Maximum conversion was observed with a construct containing493 bp of homology, without a significant increase in frequency when homology extended to the tips of the chromosome. These results demonstrate that the homology requirements for targeting a large heterologous insertion are quite different than those for a point mutation. Furthermore, heterologous insertions strongly affect the homology requirements for the conversion of distal point mutations. Several aberrant conversion tracts, which arose from templates that contained reducedhomology, also were examined andcharacter- ized.

OUBLE-STRAND breaks arise in the genome as or noncrossover event depends upon the resolution of D a direct result of ionizing radiation, transposon the Holidayjunctions on eitherside of the newly synthe- excision or site-specific nucleases, and indirectly sized DNA (SZOST~et al. 1983). However, other possi- through DNA processing following other types of DNA ble models for double-strand break repair havealso damage (FREIDBERGet al. 1995). Scientific interest in emerged (LIN et al. 1984; HASTINGS 1988; ROSENBERG double-strand breaks has intensified since theywere and HASTINGS 1991; BELMAAZAand CHARTRAND1994; implicated as the initiating event in recombination (RE- NASSIF et al. 1994) to explain recombinational outcomes SNICK 1976; SZOSTAKet al. 1983). Findings from many that deviated from those predicted by the double-strand laboratories have confirmed that double-strand breaks break repair model. are recombinogenicand that they coincide with meiotic P elements are transposons in Drosophila that leave initiation sites in Saccharomyces cermisiae(NICOLAS et al. behind adouble-strand break in the genome upon their 1989; SUNet al. 1989; STAHL1996). Furthermore, repair excision (ENGELSet al. 1990; GLOORet al. 1991; KAUF- and recombination share many protein components in MAN and RIO 1992). The ensuing repair process has common (WEST1992; KOWALCZYKOWSKIet al. 1994; HA- been rigorously studied and proceeds by gene conver- BER 1995;JACKSON and JEGGO 1995). Taken together, sion in which sequence from a homologous template this evidence shows that double-strand breaks are not is copied into the break site (ENGELSet al. 1990; GLOOR merely DNA damage that needs to be repaired, but et al. 1991;JOHNSON-SCHLITZ and ENGELS1993; NASSIF important initiating events in the process of recombina- and ENGELS1993; ENGELSet al. 1994; NASSIFet al. 1994). tion and other genome rearrangements. The small amount of crossing over that is associated The double-strand-break repair model proposed over with P-element excision is mainly due to a mechanism a decade ago( RESNICK 19'76;SZOSTAK et al. 1983),postu- that is independent of DNA repair (SED et al. 1995; lated that the recombinationpathway begins with a dou- SVOBODAet at. 1995; GRAYet al. 1996; PRESTONand ble-strand break in the genome, which is enlarged by ENGELS1996; PRESTONet al. 1996).This is distinct from exonucleases leaving 3' single-stranded overhanging double-strand break repair in yeast, where both gene ends.These free ends are sequentially elongated by conversion and crossing over are observed when a dou- copying from a homologous template, repairing the ble-strand break is repaired (STAHL1996), except for gap in the process. Whether this produces a crossover conversion at the mating type locus ( STRATHERN1988). The homologous template for double-strand break repair in Drosophila can be located anywhere in the ge- Corresponding authm: Gregory B. Gloor, Department of Biochemis- try, University of Western Ontario, London, Ontario, Canada, NGA nome, with the highest repair frequencies being 5C1. E-mail: [email protected] achieved when it is located on the homologue at the

Genetics 147: 689-699 (October, 1997) 690 T. Dray and G. B. Gloor

site 9 755 whrte ye1 -5ow 00

2012 2RT2 ef+ walLyD walL G Hi- 20109 + 4- 44-4- w hite yellow white I 493 bp

whrte yellow 375 bp

51 bp

wnrre yellow 25 bp

wnrte

FIGURE1.-Repair templates contain whitegene sequence derived from P(m1ter). Thewhitegene is flanked by P-element ends (large arrowheads) and contains up to 12 single bp substitutions depending on theconstruct. These substitutions act as markers for a conversion event. The heterologous yellow gene sequence was cloned in just upstream of the white gene 3’ untranslated region. Alterations to the length of white gene sequence were made in the 3‘ untranslated region using restriction enzymes. A chromosome with unlimited homology (w) on eitherside of the heterologous insert was produced by Pelement-mediated gene targeting. The locations of primers used in PCR amplification are shown using the A493 template for reference (see text for details). Thearrows indicate the direction of primer elongation during PCR. In this and subsequentfigures, the white and yellow genes are shown as open boxes, the untranslated and untranscribed regions are shown as thin lines. same relative position of the break site (ENGELSet al. TE RIELE et al. 1992; NASSIFand ENGELS1993; SCHEERER 1990; GLOORet al. 1991; NASSIFand ENGELS1993; ENG and ADAIR 1994). The present experimentswere under- ELS et al. 1994). Using this system, heterologous inser- taken to determine thehomology requirements for tar- tions have been targeted efficiently to a double-strand geting an 8 kb heterologous insert to a P-element exci- break in the genome (JOHNSON-SCHLITZand ENGELS sion-induced gap in the Drosophila white (w) gene. 1993; NASSIFet al. 1994; KEELER et al. 1996). Homology recognition during recombination,which MATERIALS AND METHODS is catalyzed byRecA and its respective homologues Template constructs: All constructs were derived from (HEYER1994), is important for selection of a proper pP{7rwalL) (NASSIFet al. 1994). This plasmid contains a 4 kb exchange partner. Many studies have been carried out mini white gene that is marked by 12 individual bp substitu- in a variety of organisms to determine the homology tions that add or remove a restriction site without affecting requirements for particulara recombination system. Ex- white gene function (GLOOR et al. 1991). A polylinker is located in the 3’ untranslated region of the white gene, 238 bp periments in Escherichia coli (WATTet al. 1985; SHENand downstream of the relative point of P-dd excision (0’- HUANG1986), bacteriophage T4 (SINGERet al. 1982), et al. 1984). Sequences that are cloned into thepolylinker do mammalian cells (RUBNITZand SUBRAMANI 1984; not affect the function of the white protein. The 8 kb yellow LISKAYet al. 1987; BAKERet al. 1996), plants (BAURet (y) gene, obtained on a SalI fragment from a plasmid con- al. 1990), and yeast UINKS-ROBERTSONet al. 1993) have taining the yellow and rosy genes (GEYERand CORCES1987), was cloned into the XhoI site of the polylinker in each of the determined homology requirement ranges for their re- constructs. The white gene sequence is flanked on both sides spective recombination systems. by P-element ends that enable the construct to move when Homology is also an important parameterin optimiz- supplied with a transposase source. The general structures of ing gene targeting, a technique that involves the ex- the repair templates are shown in Figure 1. change of genomic information for vitremodified The 3’ untranslatedregion in pP(7rmlLJ corresponds to in the region from nucleotide position -2233 to -3027 using DNA sequence. This being the case, sections of nonho- the numbering scheme of O’HAREet al. (1984). The 763 bp mology will be present between the two partners that of this region that are located downstream of the polylinker will interfere with recombination. Gene targeting, in were chosen to investigate the effect of altering the amount general, is extremely sensitive to the amount of avail- of homologous sequence flanking a heterologous insert in able homology, and sequence divergence between the the context of double-strand break repair. Five repair templates were made using unique restriction target and template, as well as insufficient amounts of enzyme cleavage sites in the 3‘ untranslated region. An EcoRI/ flanking homology, reduces the overall conversion fre- Eco 01091 double digest removed the entire untranslated re- quency (I-IPsnet al. 1991; DENGand WECCHI1992; gion flanking the yellow gene to produce AO. BssHII (-2387) for Gene Targeting GeneHomology for 69 1

the process, a wild-type body (yellow’) phenotype also re- hd . p{xmlLY Ki A 2-3 x C(7)DX, ywf sulted. ywf’ + ’+ To study repair under optimal conditions, an X chromosome with a phenotypically wild-type white locus marked by the 12 single bp alterations and containing the yellow gene insertion was used as a repair template. In effect, homology extended to thetips of the chromosomeoutside of the region containing the base alterations and the yellow gene insertion. Female flies carrying this repair template chromosome, an X chromosome containing thepotential break site (w“) flanked t 7 y+ revertant y revenonrevertant nt by achaete and split, and A2-3 (99B) were mated to two yzd% m ales males males males males (not scored) +; + males. Progeny were scored as outlined above. Polymerase chain reaction: Phenotypic revertants were analyzed by PCR (SAIKIet al. 1988). They were screened for the presence of the original repair template using primers that FIGURE2.-Male flies carrying a Pelement insertion allele amplified the P-element ends of the construct (20108, GAG of the white (2”), a repair template (P(mualLyA}),and a trans- TGTCGTATTGAGTCTGAG; CasRt-2, AAGAGATAGCGGAC posase source (A2-3(99B))linked to Kinked (Ki),were mated GCAGCG mlLy D, TACGCAATTTTCTTGAGCGG 20109, to attached Xvirgins. Male progeny were scored for targeting GAAAGGTTGTGTGCGGACGA) (Figure 1). An 85” hot start of both white and yellow gene sequences. A similar mating was followed by the following cycling profile: 1 min at 95” scheme was used for the infinite homology template, except (denaturation), 1 min at 72” (annealing) and 1 min 30 sec female flies with the template on the homologous Xchromo- at 72” (elongation). Each subsequent cycle reduced the an- some andA2-3(99B) linked tothe third chromosome nealing temperature by lo, until afinal annealing temperature marker Drop (Dr)were used. PCR was performed to confirm of 55” was reached. Twenty more cycles at this annealing tem- these results. perature followed. PCR products were resolved on a 1.4% agarose gel. Revertants that retained a copy of the repair template were discarded. cleavage followed by BaB1 exonucleolytic degradation and A second PCR screen was performed toanalyze the conver- Eco 01091 cleavage produced the A25 andA51 constructs. In sion tract of each revertant fly. Primers flanked the site of P the same manner, A375 was made, except that the Nszl site Wh” excision (ef+, GGTTGTCGTACCTCTCATGG; Hi-, ACA (-2758) was used instead of BssHII. Lastly, an Nszl/Eco 01091 GCGAAAGAGCAACTACG, walLy G, TAATAGTCGAGGATC digest produced A493. Each construct name is derived from CTGC; mlLy D) (Figure 1).PCR was done as outlined above, the amount of 3‘ flanking homology that remains in the con- except a final annealing temperature of 50” was chosen. PCR struct. All cloning steps were done as per standard protocols products were cut with three separate restriction enzymes, found in SAMBKOOKet al. (1989). which correspond to the alterations made in the repair tem- Drosophila stocks: Drosophila were grown on a standard plate (GLOOKet al. 1991; NMSIF et al. 1994). PCR products cornmeal-agar medium with 4% sucrose, brooded every 5-7 were run on a 3% agarose gel. Analysis of fragment lengths days and kept at24”. Genetic symbols not otherwise explained determined if repair of the gap involved the template, and are in LINDSLEYand ZIMM (1992). to what extent it was copied. C{l)DX,yf/shi*‘; +; +: A compound X stockwith M cytotype Several flies were collected that were predicted to contain and shiberd’, a temperature-sensitive, lethal gene. Male flies aberrant conversion tracts based upon the products of the do not survive a 28“ incubation, facilitating virgin collection. above PCR reactions. Convertantscontaining an aberrantcon- yw”? +; +: A stock that contains the P-element insertion version tract were analyzed by long-range PCR (BARNES1994). allele ul”d*0k’7 (ul”“) (ENGELSet al. 1990). P-zu”“ is a 629 bp The following primers were used: white gene primers (ef+, nonautonomous Pelement inserted positionat -2025 in the 2362 GCACATCGTCGAACACCACG, H-GTGTTTTATGTA white locus (0’- et al. 1984). Insertion results in an 8 bp CCGATAAACGAG, w~-GCGAGAGCGGGCCAACCAAG, w8- duplication of surrounding genomic sequence, anda bleach- GTGCCTCTTTCATGTC’ITCG, zUS-CTTGCCGAGCATCGA white eye phenotype. GCACA, wl 0-ACCACACAAATGGCAAGTAG), yellow gene yw; +; KiA2-3 (99B): A stock homozygous for animmobile primers (walLyD, walLyC),and a P-element end primer (2223 Pelement on the third chromosome(ROBERTSON et al. 1988). CGTCCGCACCACAACCTTTCC) . The A2-3 (99B) chromosome contains a stable transposase Cloning and sequencing of PCR products: Several of the source, capable of mobilizing other P elements. It is marked aberrant conversion tracts were cloned into pBluescript I1 by the dominant bristle phenotype, Ki. SK+ for further characterization. Ten conversion tracts were Transformation: The constructs were inserted into the ge- amplified using the primers that flanked the region of inter- nome by Pelement-mediated transformation (RUBINand est. Each PCR amplimer was phosphorylated by the addition SPRADLING1982; SPRADLINGand RUBIN1982; ROBERTSONet of T4 polynucleotide kinase. The vector, pBluescript I1 SK+, al. 1988).Transformants were stocked out with a new chromo- was digested with EcoRV and then dephosphorylated by the some marked with yul”? Transformed males that contained addition of Shrimp Alkaline Phosphatase. Each PCR ampli- ddwere mated to females that carried KiA2-3 (99B) (ROE mer was ligated into pBluescript I1 SK+ and transformed into EKTSON et al. 1988). E.coli. DNA was isolated from each clone, and dideoxy se- Double-strand break repair in Drosophila: Male progeny quencing was performed to precisely characterize the conver- carrying whd, a template and a transposase source were indi- sion tracts. All steps were done following standard protocols vidually mated to five compound X females (Figure 2). Prog- found in SAMBKOOKet al. (1989). eny with phenotypes indicative of successful double-strand break repair using the ectopic template were identified on RESULTS the basis of eye and body color. Reversion of the white gene produced a wild-type eye (white’) phenotype. If the heterolo- Constructs were preparedthat contained various gous yellow gene sequencewas also copied into thegap during amounts of whitegene sequence flanking the 8 kb yellow 692 T. Dray and G. B. Gloor

21/41 TABLE 1 10123 51%10123 44% 1 Reversion and conversion summary Convertants" Revertants Template Males testedbTotal yellow' Site 9+

A0 22,263 90 21 0 NP' A25 47,899 120 33 1 NP A5 1 24,932 28 16 0 NP A375 37,811 64 34 8 6 A493 23,229 67 23 10 9 - Infinite 3,956 61 41 21 17 A0A25 A51 A375 A493 O0 a Independent events. Repair Templates * Some of these events were not independent. 'NP, Site 9 not present in the template. FIGURES.-Conversion of the yellow gene to the site of P- Whd excision was measured as a percentage of total conversion events. Conversion was determined using PCR amplification entire 3' flanking homology was deleted, conversion of in conjunction with restriction enzyme analysis that identified the yellow gene was 0% (0/21). At 25 bp of homology, template-specific white gene sequence. The error bars shown on this and later figures show the standarderror of the bino- one targeting event was noted (1/33), however, thiswas mial. not significantly different from the A0 data. There was no yellow conversion observed when A51 was supplied gene to determine the homology requirements for tar- as a template (0/16). geting a large heterologous insertion to the white locus The yellow gene was not targeted at a high frequency (Figure 1). Flies that carried dd,a transposase source until 375 bp of 3' flanking sequence was provided. In and a repair template were mated, and their progeny this instance, the conversion frequency was 24% (8,' were inspected for evidence of double-strand break re- 34). The addition of another 118 bp of homology al- pair and yellow gene conversion (Figure 2). The repair most doubled the percentageof yellow gene convertants, templates contained white gene sequence, marked by as seen by the number of targeting events using the up to 12 individual bp substitutions, and theyellow gene A493 repair template (10/23). The yellow conversion inserted just downstream of the relative break site. The frequency was elevated further when homology ex- amount of white sequence on the 3' flanking side of tended to the tips of the chromosome (21/41, 51%), yellow varied from no homology to unlimited homology. although it was not significantly different from that seen All white+ revertants were tested, using PCR, for conver- with the A493 targeting template. sion of the template sequence into the P-element-in- Conversion of the white gene: Single base pair substi- duced double-strand break. Flies that were phenotypi- tutions in the template white gene served as markers to cally yellow' were analyzed by PCR to ensure that the follow the double-strand break repair process. Previous yellow gene had been targeted to the white locus. work (GLOORet al. 1991; NASSIFand ENCELS1993; NAS Conversion of the yellow gene: Flies that had under- SIF et al. 1994) demonstratedthat the conversion of gone P-element-induced double-strand break repair individual sites characteristically decreases with increas- were characterized according to the conversion of a ing distance from the relative point of P-w"~excision, series of base pair substitutions and the nonhomolo- irrespective of template. For example, site 6, which pre- gous insert into the break site. Targeting of the yellow cisely corresponds to the position of P-whd,is copied gene was determined as a percentage of total conver- into the gap more frequently than site 4, which is 135 sion events, as opposed to a percentage of total flies bp upstream. scored, because the repair frequency is subject to the Site 9, in which an RsaI site is introduced into the position of the template within the genome (ENGELSet template white gene, is common to A375, A493 and al. 1990; GLOORet al. 1991; ENCELSet al. 1994; NASSIF the infinite homology repair templates, but deleted in et al. 1994). Therefore, an analysis of conversion events the others. Table 1 and Figure 4 show that this site was in relation to total flies scored would have reflected the copied into the P-element-induced gap less than half template position-dependence of repair, as opposed to asefficiently with A375 (6/34) than with theother the effect of homology. Figure 3 shows the relative pro- two (9/23 for A493 and 17/41 for infinite homology). portion of independent yellow gene targeting events as When A375 was present in the genome, 18% of all a percentage of the total number independent con- conversion events included site 9. Increasing the version events for each template, which are given in amount of flanking homology to 493 bp increased the Table 1. proportion of convertants with site 9 to 39%, with little A set of constructs, each with a differing amount of increase in the value when homology extended to the flanking white gene homology, were tested. When the end of the chromosome (42%).Site 9, as seen in Figure Homology for Gene Targeting 693 R e pa ir TemplatesRepairConversion Frequency

I FIGURE4.-The conver- yellow site 9 yellow I 24% sion frequencies for site 9, A375 site 9 e3, 18% a pointmutation, were cal- culated as a proportion of I ye//ow ’ I 44% total conversion events for ~e”Ow site 9 A375, A493 and the infi- A493 site 9 I39% nite homology templates. Conversion frequencies forthe yellow geneare P”OW site 9 yellow 51% shown for reference. 00 $site 9 -42%

1, is located downstream of the heterologous insertion. A portion of the junction of A493-42 was strikingly The conversion frequencies of the other marker sites, similar to yellow sequence immediately downstream of which are located on the5‘ side of the yellow gene, were the yellow gene sequence in the conversion tract. There similar to those published previously (GLOORet al. 1991; are four base pair differences between this junction NASSIFand ENGELS1993; NASSIFet al. 1994) (data not region shown in square brackets in Table 2 and the shown). canonical yellow sequence. This may be indicative of Aberrant events: In addition to the conversion tracts mismatch repair between two nonhomologous ends. characterized in the previous sections, twoclasses of Another class ofaberrant events was yellow+ and con- aberrant events were recovered. The classes are divided tained the 5’ Pelement end. Three flies with this gen- on the basis of phenotype. The first class consisted of eralstructure were collected fromexperiments that 28 revertant flies with a yellow phenotype in which no used either A0 or A25 as repair templates. Their struc- PCR product was observed upon PCR amplification tures, determined byPCR and DNA sequencing of with eft andHi- (Figure 1).These events were obtained cloned PCR products, are shown in Figure 5, G-I. The from all five reduced homology constructs. Eight presence of a yellow gene in the genome located at events, chosen at random, were examined by PCR and cytological position 3C was confirmed by in situ hybrid- all were found to contain some yellow sequence inserted ization to polytene chromosomes (ENGELSet al. 1986). into the white gene. Furthermore, in all eight events, Along with the expected white gene and yellow gene the sequence 5’ to the yellow gene insertion originated sequence found in other yellow+ conversion events, the from the P(umlLy}template, and the sequence 3’ to the 5’ P-element end is found directly downstream of the yellow gene originated from the genomic white gene. template 3’ untranslated region. In one of these three Long range PCR analysis (BARNES1994) indicated that events, AO-53, there was -1000 bp of sequence of 5’ portions of the yellow gene had been copied into the unknown origin adjacent to this P-element end (Figure gap in each case. 5, G). An oligonucleotide complementary to this se- Six of these events were cloned and characterized by quence was prepared and used for PCR amplification. DNA sequencing (Figure 5, A-F). There were two types A productive PCR amplification resulted when this of structures. One type had a deletion of some yellow primer was used to amplify DNA prepared from the gene and the adjacent white gene sequence (Figure 5, AO-53 repair event, butnot when DNA prepared from A-D). The junction between the yellow and white se- the A0 P{umlLy) transformant line was used (data not quence always had a few nucleotides of sequence that shown). This indicates that the unknown flanking se- was apparently unrelated to either the yellow or white quence did not originate from the region flanking the sequence. In general, the junctionswere fairly A/T rich template insertion site. The other two events, AO-101 and somewhat repetitive. These junction sequences and and A25-67, also had the template P end inserted at the flanking yellow and white gene sequences are given the P-whdexcision site. Sequencing adjacent to the P- in Table 2. element end indicated that there was white gene se- The second type of structure contained a portion of quence originating from the 3’ region that abuts the P- the 5’ yellow gene and a duplication of the white se- whdexcision site (Figure 5, H, and I). However, PCR quence (Figure 5, E, and F). The junctionbetween the amplimers of this region, in both AO-101 and A25- yellow and white sequences contained short segments of 67, were larger than expected (data not shown), indi- A/T rich sequence, followed by a stretchof nucleotides cating the insertion of sequences of unknown origin derived from the P-element terminal repeat (Table 2). within the 3’ untranslated region of the white gene. 694 T. Dray and G. B. Gloor

Finally, one event, A25-70, had a structure similar to those described above, but did not contain any unknown flanking sequence (Figure5, J). This conversion -1 909 -3269 tract had a deletion of approximately 75 bp from the A I A375-25 3' side of the P-element end. The3' flanking white gene sequencebegins at position -3035 (O'HARF,et al. -3303 1984), which corresponds to a location in the 3' untranslated region, 1010 bp downstream of the P-d'exci- B I A375-39 sion site. Together, theseresults indicate that conversionof an 1182 -3115 8 kb insertion into the white locus depends upon the I A493-41 amount of white gene homology available in the tem- C plate. The presence of the large heterology within the 21 69-281 3 template can disrupt the conversionof point mutations located within the 3' flanking white sequence. In addi- D I A493-47 tion, reductions in the amount of homology can lead to the partialcopying of both white and yellozu gene -1 830 -2020 sequence into the double-strand break. E A25-120 DISCUSSION -1109 -2020 Gene targeting in Drosophila melanogaster: The posi- F @.. A493-42 tive association between the nature and extent of homology and the frequency of meiotic and mitotic recombination has been well documented in a variety of 60-53 organisms (SINGERet al. 1982; RUBNITZand SUBRAMANI G 1984; WATT et al. 1985; SHENand HUANC1986; LISKAY et al. 1987; BAURet al. 1990;JINKS-ROBERTSON et al. 1993; BAKERet al. 1996). One of the main interests has been H AO-101 determining the homology requirements for a particular system, with the impetus beinga desire tospecifically incorporaterecombinant DNA intothe genome, or I A25-67 what is now known as gene targeting. Research in Drosophila melanogaster has shown that P- 75 -3035 element-induced breaks can be repaired from a tem- , plate located on the homologue, ectopically or on a i:i& i 3 J A25-70 plasmid (ENGELSet al. 1990; GLOORet al. 1991;Jo~~- SON-SCHLITZand ENGELS1993; NASSIF and ENCELS FIGURE5.-Twelve aberrant events were characterized mo- 1993; ENCELS et al. 1994;NASSIF et al. 1994; KEEL.ER lecularly to determine their conversion tracts. Sixof these conversion events had varying-sized deletions of the 3' end et al. 1996). Furthermore,large heterologous inserts of the yellow gene (A-F). Four others carried complete copies located on ectopic templates can also be copied effi- of the yellow gene and also contained a 5' P-element end ciently into the gap. In fact, it was shown that the 8 (G-I), with three of these containing sequence of unknown kb yellow gene, when embeddedwithin white sequence, origin. The sizeof the unknown sequence is -1000 bp in could be targeted at frequencies comparable a to point AO-53, between 1300 and 2300 bp in AO-101 and between 4300 and 5300 bp in A25-67. In this figure the P-element mutation (NASSIFet al. 1994). ends are shown as gray arrows; unconverted white gene se- Homolog saturation: Thistargeting study investi- quence is represented as an open box, converted white gene gated the effects of altering the amount of homology sequence isshown as a vertical-line filled box; yellow gene adjacentto the yellow gene. A repairtemplate con- sequence is the black-filled box; and large segments of un- taining 493 bp of 3' flanking homology showeda yellow known sequence are represented as hatched or diamond filled boxes. Wider areas withinthe white gene correspond to gene conversion frequency of 44%. A template con- the location of exons. The numbers in A-F and J represent taining homology that extended to thetips of the chro- the last nucleotide in either the yellow, white or P-element mosomehad a comparableconversion frequency sequences remaining at the junction. The sequence coordi- (51%),indicating that further extensions in homology nates for the yellow gene are those of CHfi et al. (1986), for past 493 bp did notsignificantly increase the conversion the white gene are those of O'HAREet al. (1984), and for the frequency. This suggests that there is an upper limit P-element sequence are those of O'HARF. and RUBIN(1983). The sequences of the junction regions that join the two ends for template homology requirements, above which, no from A-F are given in Table 2. further increase in conversion efficiency occurs. Re- Homology for Gene Targeting 695

TABLE 2 Sequences of the aberrant junctions in the yellow gene deletions

yellow gene white gene Name sequence Intervening sequence‘ A375-25 ATAATGTCGAATGTT ATTTATGTTACATGTTACATTACATTAC GCATGTGTGTGAGTG ATTATTTACA A375-39 GCAATGAAACTAAAA TC GGAATCGCAGAAAA A493-41 AAAGCAATGAAACTA TTATTAAACTTATTTCATGAAATAA GCGAAAGGCAAGAGA A493-47 AAAAAATATCTGA ATAATAGTTATT CTATAATAATAAGAA A25-120 TTGACCACTTAGCGC ATATAATAATTT(CATCATG) GTGGGTCTGGCCATT A493-42 GTTTATTATGCGTGT [GGCTGGTTGTATTACTTTACTTAACTT GTGGGTCTGGCCATT ATTTICATGTTAATTATAACATAATGTT ATTACTTA(ATGTTATTTCATCATG) ‘’ P-element terminal inverted repeat sequence shown in parentheses. ‘Sequence that closely resembles yellow gene sequence shown in square brackets. Sequence from the eight base target site duplication in the white gene is underlined. search on gene targeting using replacement and inser- relative position of transposon excision, the reversion tion vectors in mammalian cells has indicated thatthese frequency using a template with 12 bp alterations was systems can be saturated with respect to homology as between 5 and 7.5% (NASSIFand ENGELS1993). In the well (HASTYet al. 1991; DENGand CAPECCHI1992), al- same context, our experiments show that a template though the amount of homology required for satura- with a large 8 kb insertion had a reversion frequency tion is -20-fold greater than is required in the experi- of 1.5 2 0.2% (61 events of 3956 progeny scored, Table ments we report here. 1).This is a threefold reduction, at least, in reversion Heterologous inserts: The conversion frequency of efficiency, indicating that, even when homology is un- the yellow gene is lowered by -50% when the amount limited, small and large heterologies are notequivalent. of flanking homology is decreased to 375 bp from 493 The analysis of our data using a model for double- bp. Therefore,we conclude that the boundary foropti- strand break repair, which assumesa constantprobabil- mal targeting lies somewhere between the values of 375 ity of gap enlargement (GLOORet al. 1991; NASSIFand and 493 bp. The question is whether this boundary is ENGELS1993), indicates thatthe reduction in yellow static, or whether it moves depending on the type of gene conversion is due to the decrease in flanking ho- heterology in the template. mology, and is not a function of gap widening. This is Resultsof earlier work (NASSIFand ENGELS1993) consistent with theidea that the homology require- indicated that < 115 bp of flanking homology were re- ments for a heterologous insertion and a point muta- quired for maximum conversion from a template con- tion are significantly different. taining 12 engineered bp alterations. Subsequent stud- Resettingthe homology requirements: Within the ies with 763 bp of flanking homology indicated that the full-length repair template, there are 12 single bp alter- yellow gene behaved comparably to a point mutation ations, three of which are located within the 3’ flanking with respectto conversion (NASSIFet al. 1994). This sequence. Site 9 is located 70 bp downstream of the observation suggested that < 115 bp of homology might yellow insertion, and is found inall repair templates that be sufficient for yellow gene conversion. However, a contain >70 bp of adjacent sequence. Conversion of study done using human nuclear extracts found that this point mutant into the double-strand break site de- larger inserts required longer stretchesof flanking DNA pended on available homology, as seen in Figure 5. for efficient recombination(LOPEZ et al. 1992). Our When A375 was provided, the conversion frequency results are consistent with this study, and indicate that was less than half those seen when constructs con- the size of heterologous sequence doesaffect targeting taining 2493 bp were used for repair. efficiency in Drosophila, since greater than 375 bp is This observation is interesting when put in the con- required for high levels of yellow conversion at the white text of the data obtainedfrom the conversion of point locus. mutations. It was proposed that <115 bp of homology Therefore, thetwo key parameters in this experimen- was required to convert abase substitution at maximum tal system are the amount of available homology and efficiency (NASSIFand ENGELS1993). However, the the size of the heterologous sequence. We have noted present data suggests that this homology requirement that when homology is limiting, differences in conver- is “reset” when a large heterologous insert is located sion efficiencies between a large (8 kb) and a small within close proximity. As seen with the yellow gene, a (point mutation) heterology are observed. When the conversion frequency plateau for site 9 was not observed template was located on the homologue at the same untilthe A493 template was provided. Withthis 696 T. Dray and G. B. Gloor amount of homology, conversion frequencies were resolution step, the two ends would be joinedby a non- comparable to those seen with infinite homology, indi- homologous pathway (WER1995). Similartypes of cating that an upper limit had been reached.Since site events havebeen seen in other systems where they were 9 is located 70 bp downstream of yellow, A493 actually explained by a model in which only one of the ends contains 423 bp of white sequence adjacent to this invaded the template ( BELMAAZAand CHARTRAND1994; marker. This is more than three times the amount of JASIN 1996). flanking sequence required with a template containing The observation that such yellow deletions were not only the 12 bp alterations. This means that thepresence found using the infinite homology template, and that of a large heterology affects the ability of a smaller the side of decreased homology in the template corre- one positioned nearby to be converted during double- sponds to the side where the deletion occurs, suggests strand break repair. In effect, the heterologous se- that the formationof deletions is promoted on the side quence alters the homology requirements for the con- of decreased homology. However, we cannot rule out version of the point mutation. that a bias in our selection scheme prevented us from The system analyzed in this experiment has proper- recovering deletions on the other side of the double- ties that arequite different from those observed in yeast. strand break. Gene conversion in yeast cellsis associated with recipro- The junctions between deleted yellow sequence and cal exchange, but there is not an association in Dro- the 3' flanking sequence (either white gene sequence sophila mitotic cells. Furthermore, inSaccharomyces cere- or P-element terminal repeat sequence) varied in size visiue, the presence of one or more small heterozygous from 2 to 38 bp and were notably A/T rich and some- sites between the break site and another heterozygosity what repetitive. These types ofjunctions have been seen significantly reduce the conversion frequency of the often in studies that characterized imprecise Pelement distal site (BORTSand HABER1987, 1989). This is differ- excision events (0'- and RUBIN1983; TAKASU-ISHI- ent from similar experiments in Drosophila, in which KAWA et al. 1992; JOHNSON-SCHLITZand ENGELS1993; small heterozygosities have little effect on the conver- STAVELYet al. 1995). A few models have emerged to sion of distal sites (PRESTONet al. 1996). Our results explain these junction sequences, including a hairpin show that a large heterozygosity is required to affect model (TAKASU-ISHIKAWAet al. 1992) and replication the conversion of distal sites. Interestingly, the presence slippage (0'- and RUBIN1983; STAVELYet al. 1995). of multiple heterozygosities, including the presence of However, both of these models werebased upon P- large insertions, have no effect on the frequency of element sequence at the termini of the free ends. In meiotic recombination in Drosophila (HILLIKERet al. four of the six characterized events, P-element sequence 1988,1991). These observations demonstrate thediffer- is not presentat the ends, andyet the junction sequence ences between double-strand break repair in yeast and is stillvery similar to the two conversion events that Drosophila, and between mitotic double-strand break do have P-element sequence at one terminus. Another repair and meiotic recombination in Drosophila (HIL- possibility is that the right end may invade and copy LIKER et d. 1994). some information from a nonspecific template to pro- Aberrant events: There were 10 aberrant conversion duce the junction region. A previous study has sug- tracts that were characterized (Figure 4, A-J). The gested that junction sequence could be derived from model for P-element-induced double-strand break re- distant sequences (TAKASU-ISHIKAWAet al. 1992). pair outlines a process whereby the free ends search The four aberrantyellow+ conversion events that con- the genome for a homologous template, invade it, and tain a P-element end can also be explained by a one- initiate DNA synthesis (NASSIF et al. 1994). The yellow end invasion model (Figure 4, G-J). For this, we assume deletion events could be explained if copying initiated the left end invades the homologous template, copies at the left end, and extended into the heterologous through the complete yellow gene sequence and into yellow sequence before DNA replication ceased. If a con- the adjacent sequence including the template P-ele- struct with a deletion in the 3' untranslated region was ment end. Once again, the right end may not find a provided, we suggest that the right end might not find suitable template and the free ends could be ligated a suitable template, and may simply undergo exo- together at regions of short homology. In A25-70, a nucleolytic degradation. The deletions in the flanking stretch of 3 A/T bp, coincident to both the P-element white gene sequence seen in the conversion tracts from end and the white gene, seems to have been sufficient A375-25, A375-39, A493-41 and A493-47 indicate for recognition between the two ends. The other three that it has been degraded priorto joining with the other events contain alterations within the 3' untranslated free end. The conversion tracts from A25-120 and region of the white gene, suggesting that the right end A493-42, which include P-element inverted repeat ter- may have invaded aninappropriate duplex, or that minus sequence, imply that the right end has under- some other repair mechanism has occurred. gone very little, if any, degradation. In this model, the Homology requirements: The model for the repair amount of correctly targeted sequence would only de- of P-element-induced chromosome breaks requires that pend upon the extent of left end elongation. At the the free endsbe able to recognize the template. In for Gene Targeting Gene Homology for 697 this instance, as proposed with most other forms of STAVELYet al. 1995), giving them more time to conduct recombination, recognition is homology dependent the homology search. Indeed, it has been noted that and probably reliant upon direct interactions between most double-strand breaks made by P-element excision DNA molecules (HEYER1994). Results from this experi- are repaired without gap widening (JOHNSON-SCHLITZ ment corroborate these findings. Removal of all of the and ENGELS1993). whitegene sequence flanking one side of the insertabol- In contrast, free ends that do not contain P-element ishes yellow gene targeting, as no yellowf events are end sequence, as a result of exonucleolytic degradation recovered with the A0 construct. One event was recov- of a double-strand break, might be expected to have ered when there is an adjacent25 bp of white sequence, a more dynamic nature because IRBPmay not bind but this is not significantly different from the results immediately, or as tightly.Consequently, the endscould obtained with the A0 and A51 templates. be undergoing exonucleolytic degradation while trying No changes to the amount of 5' flanking homology to find a template for repair. As a result, more homol- were made in any of the constructs, which meant that ogy may be required in the template when P-element there was 2456 bp of available template homology to end sequence is notcontained within the search- the left of the break site in each template. Even with ing end. this constant amount of white gene sequence present, At least two pathways have been proposed in yeast yellow conversion frequencies were decreased for AO, for eukaryotic double-strand break repair: one that is A25, A51 and A375, indicating a need forhomologous RAD52 and homology dependent, and another that is sequences on the 3' side of the insertion. This has been Ku dependent and requires little or no sequence ho- found to be true in other cases where a homology inter- mology UACKsON andJEGG0 1995; JEGGO et al. 1995). ruption located close to the break site in the target If this holds true in flies, then the above differences caused a decrease in recombination rates (STRUHL could be attributed to the presence or absence of IRBP 1987; LOPEZet al. 1992), and also when the amount of in the repair process. Unlike a previous study (KEELER homology flanking one side of a mutationin a targeting and GLOOR1997), none of the events reported here vector was reduced below a critical threshold (THOMAS involve the transposon ends in the homology search. et al. 1992). The effect of the P-element ends on this double-strand Studies on transposon replacement at the white locus break repair system need to be examined in future stud- have found that 31 bp of homology at the searching ies. We cannot rule out the possibility that the observed ends is sufficient for targeting 15 kb of nonhomologous differences also may be attributed to the particular se- sequence (KEELER and GLOOR1997). This indicated quence of nucleotides in the DNA itself. that very smallstretches of DNA can be used to conduct Summary: Double-strand breaks have been widely the homology search. Such short stretches of homology used to induce high frequencies of gene targeting in did not suffice in this experiment; almost double this Drosophila at the whitelocus (ENGELSet al. 1990; GLOOR amount of homology in the template (51 bp of homol- et al. 1991;JOHNSON-SCHLITZ and ENGELS1993; NASSIF ogy in A5l) did not produce any conversion events in and ENGELS1993; ENGELSet al. 1994; NASSIFet al. 1994; this series of experiments. KEELER et al. 1996; KEELER and GLOOR1997), at other loci in Drosophila (LANKENAU et al. 1996; and This discrepancy may reflect varylng homology re- MCCALL BENDER1996; MERLI et al. 1996; WILLIAMSand O'HARE quirements for different types of searching ends. The 1996), in nematodes (PLASTERKand GROENEN1992) investigation into the role of the searching ends in- and in mammalian cells (ROUETet al. 1994; CHOULIKA volved the precise replacement of P-dd with the tem- et al. 1995;JASIN 1996). The findings in this article will plate transposon by a gene conversion process. The serve to enhance the efficiency of these eukaryotic tar- searching ends in this circumstance included sequence geting systems, as sufficient homology is required to derived from the P-element ends (O'BROCHTAet al. induce a high number of correct targeting events. As 1991; JOHNSON-SCHLITZand ENGELS 1993; STAVELYet well, the characterization of the aberrant events will al. 1995; KEELER and GLOOR1997), which are known help to define possible outcomes whenhomology is to bind specific proteins that facilitate transposition. limiting, and further explain the process of P-element- For example, inverted repeat binding protein (IRBP) , induced gene conversion. a host-encoded traneacting factor and recently discov- The authors thank FAYE MALES andCOLIN COROSfor excellent ered to be the Drosophila homologue of the Ku autoan- technical assistance. We thank K. KEELER, G. DOSSANTOS,N. NASSIF tigen, binds to the inverted repeat ends of the transpo- and J. MURRAYfor providing helpful comments on the manuscript. son (R~oand RUBIN1988; BEALLet al. 1994). While Ku T.D. was supported by an Ontario Graduate Scholarship and by a has been found to bind to free ends indiscriminately, scholarshipfrom the National Scienceand Engineering Research Council of Canada. Thiswork was supported by a research operating it is yet to be determined whether IRBP binds to the P grant to G.G. from the Medical Research Council of Canada. element previous to, or following excision. If the for- mer, then it would be conceivable that the P-element LITERATURECITED BAKER,M. D., L. R. READ, B. G. BEAT~Vand P. NG, 1996 Require- ends, unlike other freeDNA ends, would be less predis- mens forectopic homologous recombination in mammalian posed to exonuclease degradation (BEALLet al. 1994; somatic cells. Mol. Cell. Biol. 16: 7122-7132. 698 T. Dray and G. B. Gloor

BARNES,W. M., 1994 PCR amplification of up to 35-kb DNA with JASIN, M., 1996 Genetic manipulation of genomes with rare-cutting high fidelity and high yield from A bacteriophage templates. endonucleases. Trends Genet. 12: 224-228. Proc. Natl. Acad. Sci. USA 91: 2216-2220. JEGGO,P. A,, G. E. TACCIOLIand S. P. JACKSON,1995 Menage a trois: BAUR, M.,I. POTRYKUSand J. PASZKIOWSKI,1990 Intermolecular ho- double strand break repair, V(D)J recombination and DNA-PK. mologous recombination in plants. Mol. Cell. Biol. 10492-500. BioEssays 17: 949-957. BEALL, E.L., A. ADMON and D. C. Rro, 1994 A Drosophila protein JINKS-ROBERTSON,S., M. MICHELITCHand S. RAMCHARAN, 1993 Sub- homologous to the human p70 Ku autoimmune antigeninteracts strate length requirements for efficient mitotic recombination with the Ptransposable element inverted repeats. Proc. Natl. in Saccharomyces cereuisiae. Mol. Cell. Biol. 13: 3937-3950. Acad. Sci. USA 91: 12681-12685. JOHNSON-SCHLITZ,D.M., and W.R. ENGELS,1993 P element-in- BELMAAZA,A,, and P. CHARTRAND,1994 One-sided invasion events duced interallelic gene conversion of insertions and deletions in in homologous recombination at double-strand breaks. Mutat. Drosophila. Mol. Cell. Biol. 13: 7006-7018. Res. 314: 199-208. KAUFMAN, P.D., and D. C. Rro, 1992 P element transposition in BORTS, R. H., and J. E. HABER,1987 Meiotic recombination in yeast: vitro proceeds by a cut-and-paste mechanism and uses GTP as a alteration by multiple heterozygosities. Science 237: 1459-1465. cofactor. Cell 69 27-39. BORTS, R.H., andJ. E. HABER,1989 Length and distribution of mei- KEELER, K J., and G. B. GLOOR,1997 Efficient gap repair in Drosoph- otic gene conversion tracts and crossovers in Saccharomyces cereuis- ila melanogaster requires a maximum of 31 nucleotides of se- iae. Genetics 123: 69-80. quence homology at the searching ends.Mol. Cell. Biol. 17: 627- CHIA,W., G. Horns, M. MARTIN,Y. MENG,K. MOSESet al., 1986 634. Molecular analysis of the yellow locus in Drosophila. EMBO J. 13: KEELER, K. J., T. DRAY,J. E. PENNEY andG. B. GLOOR,1996 Gene 3597-3605. targeting of a plasmid-borne sequence to a double-strand DNA CHOUL.IKA,A,, A. PERRIN, B. DUJONand J. F. NICOLAS,1995 Induc- break in Drosophila melanogaster. Mol. Cell. Biol. 16: 522-528. tion of homologous recombination in mammalian chromosomes Kow~~cz~~ows~~,S. C., D. A. DIXON, A. K. EGGLESTON,S. D. LAUDER by using the I-SceI system of Saccharomycescereuisiae. Mol. Cell. and W.M. REHRAUER,1994 Biochemistry of homologous re- Biol. 15: 1968-1973. combination in Escherichia coli. Microbiol. Rev. 58: 401-465. DENG,C., and M.R. CAPECCHI, 1992 Reexamination of gene tar- LANKENAU, D. H., V. G. CORCESand W.R. ENGELS,1996 Compari- geting frequency as a function of the extent of homology be- son of targeted-gene replacement frequencies in Drosophila mela- tween the targeting vector and the target locus. Mol. Cell. Biol. nogaster at the forked and white loci. Mol. Cell. Biol. 16: 3535- 12: 3365-3371. 3544. ENGELS,W. R., C. R. PRESTON, P.THOMPSON and W. B. EGGLESTON, LIN, F., K SPERLEand N. STERNBERG,1984 Model for homologous 1986 In situ hybridization to Drosophila salivary chromosomes recombination during transfer of DNA into mouse L cells: role with biotinylated probes and alkaline phosphatase. BRL Focus for DNA ends in the recombination process. Mol. Cell. Biol. 4 8: 6-8. 1020-1034. ENGELS,W. R., D. M. JOHNSON~CHLITZ,W. B. EGGLESTONand J. S LINDSLEY, D. L.,and G. G. ZIMM,1992 The Genome of Drosophila mela- VED, 1990 High-frequency P element loss in Drosophila is ho- nogaster. Academic Press, San Diego. mologdependent. Cell 62: 515-525. LISKAY, R. M., A. LETSOU and J. L. STACHELEK,1987 Homology re- ENGELS,W. R., C.R. PRESTON and D. M. JOHNSON-SCHLITZ,1994 quirementfor efficient gene conversion between duplicated Long-range cis preference in DNA homology search over the chromosomal sequences in mammalian cells. Genetics 115 161- length of a Drosophila chromosome. Science 263: 1623-1625. 167. FREIDBERG,E. C., G. C. WALKERand W. SIEDE,1995 DNA Repair and LOPEZ,B. S., E. CORTEGGIANI,P. BERTRANDMERCATand J. COPPEY, Mutagenesis. ASM Press, Washington, D.C. 1992 Directional recombination is initiated at a double strand GEYER, P. and V. G. CORCES,1987 Separate regulatory elements K., break in human nuclear extracts. Nucleic Acids Res. 20: 501- are responsible for the complex pattern of tissue-specific and 506. developmental transcription of the yellow locus in Drosophila mela- McCALL, and W. BENDER,1996 Probes of chromatin accessibility nogaster. Genes Dev. 1: 996-1004. IC, in the Drosophila bithurax complex respond differently to Poly- GLOOR,G. B., N. A. NASSIF, D. M. JOHNSON-SCHLITZ,C. R. PRESTON comb-mediated repression. EMBO J. 15: 569-580. and W. R. ENGELS,1991 Targetedgene replacement in Dro- MERLI,C., D. E. BERGSTROM,J. A. CYGAN and R. K. BLACKMAN,1996 sophila via P element-induced gap repair. Science 253: 1110- Promoter specificity mediates theindependent regulation of 1117. neighboring genes. Genes Dev. 10: 1260-1270. GRAY,Y. H. M.,M. M. TANAKA and J. A. SVED,1996 P-element-induced recombination in Drosophila melanogaster: hybrid element NASSIF, N.A,, and W. R. ENGELS,1993 DNA homology requirements for mitotic gap repair in Drosophila. Proc. Natl. Acad. Sci. USA insertion. Genetics 144: 1601-1610. HABER,J. E., 1995 In vivo biochemistry: physical monitoring of re- 90: 1262-1266. combination induced by site-specific endonucleases. BioEssays NASSIF,N., J. PENNEY,S. PAL,W. R. ENGELSand G. B. GLOOR,1994 17: 609-620. Efficient copying of nonhomologous sequences from ectopic sites via P element-induced gap repair. Mol. Cell. Biol. 14 1613- HASTINGS, P. J., 1988 Recombination in the eukaryotic nucleus. Bt oEssays 9: 61-64. 1625. Wn,P., J. RIVERA-PEREZand A. BRADLEY,1991 Thelength of NICOLAS,A,, D. TRECO,N. P. SCHULTESand J. W. SzoSTAK, 1989 An homology required for gene targeting in embryonic stem cells. initiation site for meiotic gene conversion in the yeast Saccharo- Mol. Cell. Biol. 11: 5586-5591. myces cereuisiae. Nature 338: 35-39. HEYER,W. D., 1994 The search for the right partner: homologous O’BROCHTA,D. A., S. P. GOMEZand A. M. HANDLER, 1991 P element pairing and DNAstrand exchangeproteins in eukaryotes. Experi- excision in Drosophila melanogaster and related drosophilids. Mol. mentia 50: 223-233. Gen. Genet. 225: 387-394. HILLIKER,A. J., S. H. CLARKand A. CHOVNICK,1988 Genetic analysis O’W, K, and G. M. RUBIN,1983 Structure of Ptransposable of intragenic recombination inDrosophila, pp. 506in TheRecom- elements and theirsites of insertion and excision in the Drosophila bination of Genetic Material, edited by K LOW.Academic Press, melanogaster genome. Cell 34: 25-35. San Diego. O’HARE, IC, C. MURPHY,R. LEVISand G. RUBIN,1984 DNA sequence of the white locus of Drosophila melanogaster. J. Mol. Biol. 180: HILLIKER., A. _I,1.. S. H. CLARKand A. CHOVNICK,1991 The effect of DNA sequence polymorphisms in intragenic recombination in 437-455. the rosy locus of Drosophila melanogaster. Genetics 129: 779-781. PLASTERK,R. H., and J. T. GROENEN,1992 Targeted alterations of HILLIKER,A. J., G. HARAUZ,A. G. RFAUME,M. GRAY, S. H. CLARKet the Caenurhabditis ekgans genome by transgene instructed DNA al., 1994 Meiotic gene conversiontract length distribution double strand break repair following Tcl excision. EMBO J. 11: within the rosy locus of Drosophila melanogaster. Genetics 137: 287-290. 1019-1026. PRESTON,C. R., and W.R. ENGELS,1996 P-element-induced male JACKSON,S. P., and P. A. JEGGO, 1995 DNA double-strand break re- recombination and geneconversion in Drosophila. Genetics 144: pair and V(D)J recombination: involvement of DNA-PK. Trends 1611-1622. Biochem. Sci. 20: 412-415. PRESTON,C. R., J. A. SVEDand W. R. ENGELS,1996 Flanking duplica- G ene TargetingHomology for Gene 699

tions and deletions associated with P-induced male recombina- STAVELY, B. E., T. R. HESLIP,R. B. HODGETTS and J. B. BELL, 1995 tion in Drosophila. Genetics 144: 1623-1638. Protected Pelement termini suggest a role for inverted-repeat- RESNICK,M. A,, 1976 The repair of double-strand breaks in DNA binding protein in transposase-induced gap repair in Drosophila a model involving recombination. J. Theor. Biol. 59: 97-106. melanogaster. Genetics 139: 1321-1329. RIO, D. C., and G. M. RUBIN,1988 Identification and purification STRATHERN,J. N., 1988 Controland execution of homothallic of a Drosophila protein that binds to the terminal 31-base-pair switching in Saccharomyces cereuisia, pp. 445-464 in Genetic Recom- repeats of the P transposable element. Proc. Natl. Acad. Sci. USA bination, edited by R. KUCHERLAPATIand G. R. SMITH.American 85: 8929-8933. Society of Microbiology, Washington, D.C. ROBERTSON,H. M., C. R. PRESTON,R. W. PHILLIS,D. JOHNSON- STRUHL,IC, 1987 Effect of deletion and insertion on double-strand- SCHLITZ,W. K. BENZet al., 1988 A stable genomic source of P break-repair in Saccharomycescereuisia. Mol. Cell. Biol. 7: 1300- element transposase in Drosophilamelanogaster. Genetics 118: 1303. 461-470. SUN, H., D. TRECO, N. P. SCHULTESand J. W. SzosTAK, 1989 Double- ROSENBERG,S. M., and P. J. HASTING, 1991 The split end model strand breaks at an initiation site for meiotic gene conversion. for homologous recombination at double strand breaks and at Nature 338: 87-90. Chi. Biochimie 73: 385-397. SVED,J. A,, L. M. BLACK MAN,^. SVOBODAand R. COLLESS,1995 Male ROUET,P., F. SMIHand M. JASIN,1994 Introduction of double-strand recombination with single and homologous P elements in Dro- breaks into the genome of mouse cells by expression of a rare- sophila melanagaster. Mol. Gen. Genet. 246: 381-386. cutting endonuclease. Mol. Cell. Biol. 14 8096-8106. SVOBODA,Y. H., M. K. ROBSONand J. A. SVED,1995 Pelement-in- RUBIN,G. M., and A. C. SPRADLING,1982 Genetic transformation of duced male recombination canbe produced in Drosophila melano- Drosophila with transposable element vectors. Science 218: 348- gaster by combining end-deficient elements in trans. Genetics 353. 139: 1601-1610. RUBNITZ,J., and S. SUBRAMANI,1984 The minimum amount of ho- SZOSTAK,J. W., T. L. ORR-WEAVER,R. J. ROTHSTEINand F. W. STAHL, mology required for homologous recombination inmammalian 1983 The double-strand-break repair model forrecombination. cells. Mol. Cell. Biol. 4: 2253-2258. Cell 33: 25-35. SAIKI,R. IC, D. H. GELFAND,S. STOFFEL,S. J. SCHARF,R. G. HICUCHI TAKASU-ISHIKAWA,E., M. YOSHIHARAand Y.HOTTA, 1992 Extra se- et al., 1988 Primerdirected enzymatic amplification of DNA quences found atP element excision sites in Drosophila melanogas- with a thermostable DNA polymerase. Science 239: 487-491. ter. Mol. Gen. Genet. 232: 17-23. TE RIELE,H., E. R. WNDAGand A. BERNS,1992 Highly efficient SAMBROOK,J., E. F. FRITSCHand T. MANIATIS, 1989 Molecular Clon- ing: A Labmatq Manual, 2nd ed.Cold Spring HarborPress, Cold gene targeting in embryonic stem cells through homologous Spring Harbor, New York. recombination with isogenic DNA constructs. Proc. Natl. Acad. SCHEERER,J. B., and G. M. ADAIR,1994 Homology dependence of Sci. USA 89: 5128-5132. targeted recombination at theChinese Hamster APRT locus. THOMAS, K. R., C. DENC and M. R. WECCHI,1992 High-fidelity gene targeting in embryonic stem cells by using sequence re- Mol. Cell. Biol. 14: 6663-6673. placement vectors. Mol. Cell. Biol. 12 2919-2923. SHEN,P., andH.V. HUANG,1986 Homologousrecombination in WATT,V. M., C. J. INGLES,M. S. URDU and W. J. Ru~R,1985 Ho- Escherichia coli: dependence on substrate length and homology. mology requirements for recombination in Escherichia coli. Proc. Genetics 112: 441 -457. Natl. Acad. Sci. USA 82: 4768-4772. SINGER,B. S., L. GOLD,P. GAUSSand D. H. DOHERTY,1982 Deter- WEST,S. C., 1992 Enzymes and molecular mechanisms of genetic mination of the amount of homology required for recombina- recombination. Annu. Rev. Biochem. 61: 603-640. tion in bacteriophage T4. Cell 31: 25-33. WILLIAMS,C. J., and K. O'W,1996 Elimination of introns at the SPRADLING,A. C., and G. M. RUBIN,1982 Transposition of cloned Drosophila suppressor-offorked locus by Pelement-mediated gene P elements into Drosophila germ line chromosomes. Science conversion shows that an RNA lacking a stop codon is dispens- 218: 341-347. able. Genetics 143: 345-351. STAHL,F., 1996 Meiotic recombination in yeast: coronation of the double-strand-break repair model. Cell 87: 965-968. Communicating editor: R. S. HAWLEY