Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations

1999 Transposon-induced homologous recombination at the maize P locus and in transgenic Arabidopsis Yongli Xiao Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Genetics Commons, and the Molecular Biology Commons

Recommended Citation Xiao, Yongli, "Transposon-induced homologous recombination at the maize P locus and in transgenic Arabidopsis " (1999). Retrospective Theses and Dissertations. 12626. https://lib.dr.iastate.edu/rtd/12626

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS

This manuscript has been reproduced from the microfihn master. UMI films the text directly fix)m the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter &ce, while others may be fi^m any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photogr^hs, print bleedthrough, substandard margins, and improper alignment can adverse^ affect reproduction.

In the unlikely event that the author did not said UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, b^inning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photogr^hed in one exposure and is included in reduced form at the back of the book.

Photographs included in the original manuscript have been reproduced xerographically in this copy. EBgher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contsict UMI directly to order. UMI A Bell & Howell lofijrmation Company 300 North Zeeb Road, Ann Aiiwr MI 48106-1346 USA 313/761-4700 800/521-0600

Transposon-induced homologous recombination at the maize P locus

and in transgenic Arabidopsis

by

Yongli Xiao

A dissertation submitted to the graduate faculty

in partial fulfilment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major Genetics

Major Professon Thomas A. Peterson

Iowa State University

Ames, Iowa

1999 DMJ Ntunber: 9924780

UMI Microform 9924780 Copyriglit 1999, by UMI Company. AU rights reserved.

This microform edition is protected against unauthorized copying under Title 17, United States Code.

UMI 300 North Zeeb Road Ami Arbor, MI 48103 Graduate College Iowa State University

This is to certify the Doctoral dissertation of

YongliXiao

Has met the dissertation requirement of Iowa State University

Signature was redacted for privacy.

Major Professor

Signature was redacted for privacy.

For the Major Program

Signature was redacted for privacy. iii

TABLE OF CONTENTS

CHAPTER 1. INTRODUCTION 1 Dissertation Organization I Literature Review 2 References 32

CHAPTER 2. Ac INSERTION SITE AFFECTS THE FREQUENCY OF TRANSPOSON- INDUCED HOMOLOGOUS RECOMBINATION AT THE MAIZE P LOCUS 51 Abstract 51 Introduction 52 Materials and Methods 55 Results 57 Discussion 61 References 66

CHAPTER 3. INTRACHROMOSOMAL HOMOLOGOUS RECOMBINATION IN ARABIDOPSIS INDUCED BY A MAIZE TRANSPOSON 81 Abstract 81 Results and Discussion 82 Methods 87 References 89 Acknowledgements 91

CHAPTER 4. GENERAL SUMMARY 99 References 103

ACKNOWLEDGEMENTS 107 1

CHAPTER 1. GENERAL INTRODUCTION

Dissertation Organization

This dissertation is organized in an alternative formaL It contains four chapters including general introduction and general sununary. References are placed at the end of each chapter. Two chapters include papers: Chapter 3 is paper reviewed by Nature Genetics, and Chapter 2 is in preparation for submission to Genetics for formal publication.

Chapter 2 presents an analysis of the effects of a maize transposable element

(transposon). Activator (Ac), on homologous recombination at maize P locus. The results show that the insertion position of the Ac transposon relative to two homologous direct repeats at the P locus can affect the frequency of the homologous recombination, whereas the orientation of the transposon insertion may not have a significant effect on recombination.

The possible mechanism is discussed. This is the first report to demonstrate that a transposon insertion position can affect the frequency of homologous recombination in plants.

Chapter 3 demonstrates that transposon-induced homologous recombination can occur on an artificial construct in transgenic Arabidopsis, a dicotyledonous model plant.

Here, the maize transposon (Ac/Ds system) increases homologous recombination frequency over 1000 fold in plants with an active transposon than in control plants with the same reporter construct but lacking an active transposon. In Arabidopsis, transposon-induced recombination was observed in different organs during different developmental stages, and several germinally transmitted events were recovered. Therefore, transposon-induced 2 homologous recombination appears to be a general phenomenon in plants and may play an important role in genome evolution.

Literature Review

Transposable elements are segments of DNA that can promote their own insertion into new locations via element-encoded transposase proteins. Transposable elements are widespread among different organisms and play an important role in genome evolution.

(Ginzburg era/. 1984; Mackay 1986; Finnegan 1989; Kidwell and Lisch 1997).

Transposable elements in bacteria

In bacteria, there are three type of transposable elements: Insertion seguenceJlS) elements, transposons (Tn) and Mu bacteriophage. IS elements were discovered during the study of mutations in the galactose and lactose operons (Jordan et aL 1968; Malamy 1966,

1970; Shapiro 1969) and in the early genes of bacteriophage k (Brachet etal. 1970). Electron microscopic analysis of DNA/DNA heteroduplexes indicated that many of these mutations carried distinct DNA segment insertions; hence they are called insertion sequences (Fiandt et al, 1972; Hirsch et aL 1972; Malamy et al. 1972). After the initial discovery of IS elements

(ISl, IS2, IS3, IS4), many others were found in the genomes, plasmids and bacteriophages of a wide range of bacterial genera and species. The length of IS elements are from 800 to 2500 bp, and their copy number is from 0 to a few hundred per genome. All IS elements have perfect or nearly perfect terminal inverted repeats (IRs) of about 9-41 bp. These are recognition sites for transposase, which is the enzyme for transposition produced by the transposable element Upon insertion into a new position, an IS element generates small (2 to 3

13bp) directly repeated duplications of the target DNA at the insertion point This sequence

is called target site duplication (TSD). The original IS element remains in place (Ohtsubo and

Sekine 1996).

Prokaryotic transposons (Tn), like IS elements, encode transposase, have inverted

terminal repeats and generate target site duplications. Unlike IS element, Tns usually contain

other genes, such as drug resistance genes. In addition, Tns can be classified into two groups:

1) Composite transposons are complex transposons with a central region containing genes

(including drug resistance genes) flanked by IS elements on both sides. For example, TnlO

has two IS 10 elements located in opposite orientation at both ends. Between the IS 10

elements, there is -6.7 kb of unique sequence including a tetracycline resistance gene. TnlO

generates a 9 bp target site duplication after transposition (Kleckner 1979, 1989).

2) Noncomposite transposons also carry drug resistance genes like composite transposons,

but they do not terminate with IS elements. They have their own terminal inverted repeats

required for transposition. Tn3 is one example of a noncomposite transposon; it contains an

ampicillin resistance gene and it is the first described transposon carrying an antibiotic

resistance gene (Hedges and Jacob, 1974). Tn3 is 4957 bp and has 38 bp terminal inverted

repeats. In addition to the ampicillin resistance gene, Tn3 contains the tnpA and tnpB genes

encoding the transposase and resolvase for Tn3 transposition in the central region. Tn3

produces a 3 bp target site duplication (Heffron et al. 1979; Grindley 1983).

There are two types of transposition mechanisms used by bacterial transposons. 1)

Replicative transposition involves the fusion of the donor DNA carrying the transposon and

the recipient DNA into a single molecule known as a co-integrate. The transposon becomes duplicated with one copy located at each junction between donor and recipient DNA 4

Subsequently, the co-integrate resolves into two products, each containing one copy of the

transposon. 2) In nonreplicative transposition (or simple insertion), the transposon moves

from one location to another without replication. The element is lost fr-om the original

position. DiSerent transposons can use different mechanisms; for example, Tn3 uses

replicative transposition, while TnlO transposes by a nonreplicative mechanism. Most of the

transposable elements have only modest or little target site-selectivity. However, bacterial

transposon Tn7 can insert at high frequency into a specific site called an "attachment" site, or

attTnJ, in the chromosomes of many bacteria (Barth etaL 1976; Craig 1989, 1991)

Ty elements in Saccharomyces cerevisiae

Ty elements in yeast are called retrotransposons because their mechanism of

transposition is similar to that of retroviruses (Boeke and Sandmeyer 1991). Ty elements

transpose by making an RNA copy of the integrated DNA sequence and then generating a

new Ty element by reverse transcription. Ty elements have long terminal repeats (LTRs) at

their ends, which range from about 150 bp to 2 kb. The 5' end LTR serves as the promoter,

and the 3' LTR is utilized as the transcription terminator. The mRNA contains two open

reading frames (ORPs) for gag and pol polyproteins. Gag is a structural protein involved in

assembly into a virus-like particle. Pol encodes the enzymes required for replication,

including protease, integrase, reverse transcriptase and ElNase H. After translation, GAG

proteins assemble into the particles with POL proteins, the template mRNA, and a primer

tRNA inside. Reverse transcription takes place inside the particles and generates a cDNA copy. The cDNA then integrates into the chromosome by using the integrase protein which creates a 5 bp target site duplication (Boeke and Sandmeyer 1991, Xiong and Eickbush, 5

1990). In yeast, there are five Ty element families, Tyl-Ty5 (Boeke and Sandmeyer 1991;

Voytas and Boeke, 1992). Ty elements also do not have specific insertion sequence preference, but recent studies revealed that Ty5 events are targeted to silent chromatin regions. Thus, it appears that chromatin structure plays a role of directing Ty5 integration

(Zou etal 1995, 1996).

P element in Drosophila

The Drosophila P element is 2907 bp in length and has a perfect 31 bp terminal inverted repeat and an 11 bp subterminal inverted repeat. The P element generates an 8 bp target site duplication caused by a staggered cut at the time of insertion (O'Hare and Ruben

1983). Several research results indicate that the P elements transpose via a nonreplicative mechanism and do not involve an RNA intermediate (Engels et al. 1990; Kauman and Rio

1992).

A number of studies on the insertion preference of P element indicate that euchroraatic sites are more often targeted than heterochromatin (Engels 1989; Berg and

Spradling 1991). Within euchromatin regions, some loci have higher frequency of P element insertion (Green 1977; Simmons et al. 1984; Robertson et oL 1988; Williams and Bell 1988).

Within genes, P elements more often insert into noncoding upstream regions (Kelley et al.

1987). O'Hare et aL reported that P elements were more likely to insert into sequences containing a consensus octamer GGCCGAC (O'Hare and Rubin 1983; O'Hare et al. 1992).

Some P elements preferentially insert into sites closely linked to the donor sites (Tower et aL

1993; Golic 1994). Also, during interchromosomal transposition, P elements preferentially 6

insert into the corresponding region of the homologous chromosome (Tower and Kurapati

1994).

During P element transposition, a double-strand DNA break is created at the donor

site and is repaired by using the homologous sequence from the sister chromatid (Engels et

al. 1990; Gloor et oL 1991). At least two Drosophila proteins, the Ku and DNA-dependent

protein kinase (DNA-PK) proteins participate in the repair process (Beall et al. 1994; Weaver

1995; Beall and Rio 1996). A recent study demonstrated that P transposase made a novel cleavage at the donor site: the transposase cut staggeredly at the P element termini to

generate 17 nucleotide 3' extensions at each P element end, and the terminal single strands

bound the transposase during transposition (Beall and Rio 1997, 1998). The P-element- induced double strand break has been successfully used in gene replacement experiments to

manipulate specific sites in the Drosophila genome (Gloor etal. 1991; Heslip and Hodgetts

1994).

Transposition of P elements can significantly increase the level of recombination in

Drosophila male germline (Hiraizumi 1971; KidweU and Kidwell 1976) and somatic cells

(Sved et al. 1990). Most male recombination events occur through an aberrant transposition process, and are associated with flanking sequence duphcations and deletions (Gray et al.

1996; Preston and Engels 1996; Preston et al. 1996).

Transposable elements in maize

Barbara McClintock first developed the concept of transposition in maize based on changes in chromosomal position of a locus of chromosome breakage she called Dissociation

(Ds). Subsequently, she identified transposable elements as causative agents of the 7

instabilities of several loci (McClintock 1948, 1949). Since that dme, different transposable

elements have been discovered and studied. For example, Peterson has identified several

tnaiyp transposons such as En/Spm, Uq, Feu, Spf (Peterson 1953; Gonella and Peterson

1978; Eriedemann and Peterson 1982). The best studied Activawr-Dissociation,

Enhancer-inhibitor (Suppressor-mutator), Mutator and Dotted element families (Doring et

al. 1986; Fireeling 1984; Nevers and Saedler 1977). There are two types of transposable

elements in each family: autonomous elements and nonautonomous elements (McClintock

1950). An autonomous element can transpose by itself since it encodes the transposase,

whereas nonautonomous elements can not catalyze their own transposition because they lack

the functional transposase. Nonautonomous elements may be derived from autonomous

elements by deletion, mutation, but some others contain sequences unrelated to the

autonomous elements except for the two termini (Doring and Starlinger 1986; Fedoroff

1989). When the autonomous member of a transposable element family is present in the

genome, transposase is provided and the nonautonomous elements can transpose. The

following section discusses maize transposable elements in more detail using the Activator-

Dissociation (Ac/Ds) system as an example.

Structure of Ac/Ds elements

The Ac element is a 4.6 kb autonomous transposable element. It has 11 bp imperfect

(one mismatch) terminal inverted repeats ( l lKs) (Figure la). An 8 bp target site duplication

(TSD) is generated at its insertion site by staggered cuts during the insertion process (Phlman et al 1984; Muller-Neumann et al. 1984; Freeling 1984). Kunze et oL found that the Ac element encoded one 3.5-kb mRNA that contained 5 exons and was translated into a single 8

a. Ac element

5' end 3' end

CAGGGATGAAA TTTCATCCCTA

b. Ds elements

Ds9

•cl" Ds2

Dsl

Double Ds

Insertion site

Figure 1. The structures of Ac and Ds elements •, exon; •, subtenninal; H, sequence unrelated to Ac; •, TIRs; •, TSD 9 product consisting of 807 anuno acids. The sequence of Ac required to catalyze transposition in trans starts about 300 bp from the 5' end and terminates at 264 bp from the 3' end. This region contains the transposase gene (Kunze et al. 1987). Several transcription start sites were found between 302 and 357 bp from the 5' end of the element (Kunze etoL 1987). Near the TTRs and about 250 bp from both ends, there are sub-terminal regions that are important for transposition (Feldmar and Kunze 1991; Coupland et al. 1988,1989; Kunze and Starlinger

1989).

Dsisa nonautonomous transposable element and can transpose if Ac transposase is present. Interestingly, the structures of Ds elements are heterogeneous, but they all have Ac- like TTRs. There are four different types of Ds elements based on their structures (Figure lb).

1) The simple Ds elements, like Ds9 (Pohlman et al. 1984), contain deletions of the internal sequences of Ac elements. 2) Composite Ds elements, like Ds2 (Merckelbach et al. 1986) and wxB4::Ds (Varagona and Wessler 1990), have rearranged Ac sequences or unrelated sequences in the internal region. 3) The Dsl elements have 13-bp 5'end and 26-bp 3' end

(including the TIRs) sequences homologous to Ac element, but otherwise they share no similarity to Ac element (Sutton et aL 1984; Gerlach et al. 1987). 4). Double Ds elements contain one internally deleted Ds element inserted into another identical Ds element in opposite orientation (Doring et al. 1984).

The transposition of Ac/Ds elements

The first clues to Ac transposition came from studies of Ac transposition from maize

P locus (see following section). Greenbatt and Brink first found that Ac transposition was nonreplicative because it physically excised from the donor site and reinserted in a new 10 position (Greenblatt and Brink 1962). Genetic and molecular evidence shows that Ac transposes during or shortly after completion of DNA replicatioiL Moreover, only one of the replicated Ac elements is able to transpose (Figure 2; Greenblat 1984; Chen et aL1987,

1992). However, in Petunia and tobacco protoplasts, the excision of Ac/Ds from supposedly unreplicated plasmids was detected (Houba-Herin etal. 1990, 1994). More recent experiments were done utilizing the wheat dwarf virus (WDV) origin of replication and

WDV genes required for viral DNA replication in plasmids. In this system, Ds excised at least 3 X 10^-fold more frequently from replicating vector DNA than nonreplicating vector

DNA in maize cells (Wirtz et aL 1997). The excised Ac can reinsert into replicated or unreplicated target sites (Figure 2; Chen et al. 1992). It is well documented that Ac preferred to insert to physically linked target sites (Dooner and Belachew, 1989; Dowe et al. 1990;

Peterson 1990; Grotewold et al. 1991; Athma et al. 1992; Weil et al. 1992; Chen et al. 1992), which indicates that the Ac donor and recipient site may be physically associated during transposition (Greenblatt 1984; Schwartz 1989a; Robbins et al. 1989).

Ac/Ds element transposition in cis required the 11 bp of i lKs and about 250 bp of the sub-terminal regions at each end (Coupland et al. 1988,1989; Varagona and Wessler 1990).

The replacement of the four terminal bases from the 3' TIR of Ac (Hehl and Baker 1989) or the five terminal bases from 5' TIR (Healy et al. 1993) completely abolished transposition of the element. The sub-terminal regions of Ac contain repetitive AAACGG motifs and ACG and TCG trinucleotides. In vitro, Ac transposase can bind to these motifs (Kunze and

StarUnger 1989). The mutation of individual copies of the motifs resiilts in a reduction in excision frequency (Chatteijee and Starlinger 1995). The 0.4-kb Dsl element has only one

AAACGG motif closely adjacent to the 5' TIR. The mutation of this motif completely 11

X7

Rgure 2. Two possible sites for Ac transposition, and their genetic consequences (a) transposition into replicated DNA (b) transposition into unreplicated DNA. Note that only one copy of replicated Ac is able to transpose. active Ac; inactive Ac 12 abolished Dsl excision (Bravo-Angel et oL 1995). This further confirmed the importance of the sub-terminal region for transposition. Recently, a bipartite DNA binding domain in Ac transposase has been characterized; this domain recognizes the subterminal sequences and the terminal inverted repeats (Becker and Kunze, 1997). Ac transposase binds to ACG and

TCG trinucleotides, which are repeated more than 20 times in the subterminal region. This study demonstrated that the C-terminal subdomain of transposase can bind the subterminal region alone, whereas both C- and N-terminal subdomains are required to bind TIRs.

The Ac element can reversibly cycle between active and inactive phases during plant and kernel development, termed "changes in phase". In the inactive phase, an Ac element behaves like Ds (McClintock 1963, 1964, 1965). The inactivation of Ac was shown to be a somatic process and to be associated with hypermethylation of restriction sites in the promoter and untranslated leader region (Schwartz and Dennis 1986; Chomet et aL 1987;

Schwartz 1989b; Brutnel and DeUaporta 1994). Schwartz and Dennis (1986) and Wang et a/.(1996, 1998) performed an extensive analysis of changes in phase of Ac in the wx-m9 allele. They showed that the active Ac is hypomethylated near the 5' end of the element, the inactive form is completely methylated at all HpoH. sites, and the revertant Ac is partially demethylated. In all phases, the 3' ends of Ac are heavily methylated. The methylation is limited to the Ac element and does not extend to the flanking DNA (Schwartz and Dennis

1986). Other restriction sites near the transcription start site of the Ac element are methylated in two other inactive forms {wx-m?::inactive and P-w::!) (Chomet et al. 1987; Brutnel and

DeUaporta 1994). The transcription level of the inactive element is very low and hence little or no transposase is detected (Kunze 1988; Brutnel and DeUaporta 1994). Interestingly, methylation of the BamtQ site in the promoter region of Ds9 inactive form is reversed in the 13 presence of an active Ac element in the genome. Therefore, the trans-acting transposase induces demethylation of the methylated Ds9 inactive form (Schwartz 1989). Additionally, tissue culture conditions result in reactivation of silent Ac elements (McClintock 1984;

Peschke et al. 1987), and this reactivation process is also associated with the demethylation of the element (Brettell and Dennis 1991). Some retrotransposons can also be reactivated during tissue culture (Hirchika 1993).

The Ac elements in the wx-m7::Ac and wx-m9::Ac alleles are identical, yet they eUcit different excision patterns of a Ds element in the bz-m2 allele. These differences are due to specific trans effects of each Ac element, and not the presence of modifier genes in the maize genome (Heinlein 1995). On the other hand, some lines of evidence indicate that host plant genes are involved in transposition. Host proteins that bind subterminal regions of Ac elements were found in both tobacco and maize (Becker and Kunze 1996; Levy et al. 1996).

Additionally, a recessive mutation found in Arabidopsis can increase the frequency of Ac transposition. These data support the idea that host factors participate in Ac/Ds transposition

(Jarvis et al. 1997).

Ac/Ds elements in heterologous plants

Ac/Ds elements have been shown to be able to transpose in many heterologous plants

(Table 1). In tomato, the germinal transposition frequency of Ds elements is about 15-40%, but it varied between and within plants (Belzile et aL 1989; Carroll et al. 1995). In tobacco, the germinal excision frequency of Ac/Ds is reported to range from 0 to 83%, but in most plants, the frequency is about 2%-5% (Hehl and Baker 1990; Jones et al. 1989,1991;

Rommens et al. 1992; Scofield et al. 1992). In general, the Ac activity in tomato and tobacco 14

is higher than in maize, where the germinal transposition frequency of Ac is reported to range

from about 0.4%-17% (Brink and Williams 1973; Dooner and Belachew 1989; Greenblatt

1968). However, measuring transposition frequency in plants is problematic. Plants lack a

germ line, so somatic excision events can produce sectors that contribute to the germinal

events. By using a construct with a fusion of the anther-specific Arabidopsis thaliana apg

Table 1. Transposition of the maize Ac transposable element in heterologous plants

Plant spec^ Class Transformation Reference

Rice Monocot Transient Laufs et al. 1990

Rice Monocot Transgenic Izawaera/. 1991

Wheat Monocot Transient Laufs et al. 1990

Barley Monocot Transient McEkoyetaL 1997

Tobacco Dicot Transgenic Baker era/. 1986

Tomato Dicot Transgenic YodctetaL 1988

Potato Dicot Transgenic Knapp et al. 1988

Petunia Dicot Transgenic Haring et al. 1989

Datura innoxia Dicot Transgenic Schmidt-Rogge et al. 1994 Carrot Dicot Transgenic van Sluys et al. 1987

Arabidopsis Dicot Transgenic van Sluys et al. 1987

Soybean Dicot Transgenic Zhou and Atherly 1990 Lettuce Dicot Transgenic YdSigetal. 1993 15

promoter and the maize Ac transposase gene, the gametophytic excision frequency in tobacco

was determined to be up to 0.3% (Firek et al. 1996). The strength of the promoter could also

affect the transposition frequency, as indicated by the observation that the stronger CaMV

35S promoter can increase the germinal excision frequency (Scofield et al. 1992).

On the other hand, the germinal Ac excision frequency is very low (about 0.2-0.5%)

in Arabidopsis (Dean et al. 1992; Schmidt and Willmitzer 1989). If the native Ac promoter is

replaced by CaMV 35S promoter, the excision frequency can be greatly increased

(Grevelding et al. 1992; Swinburne et al. 1992; Honma et al. 1993). The enhancer domain of

the CaMV 35S promoter fused to the Ac transpose gene also increases the transposase

mRNA level (Balcells et al. 1994). In addition, the deletion of 537 bp within the Ac 5'

untranslated leader region significantly increases the excision frequency of the element

(Lawson et al. 1994). Ac can transpose at low frequency in Petunia, but the secondary

transposition frequency has been shown to be high (Haring et al. 1989; Robbins et al. 1994).

Ac/Ds system is well developed for tagging genes in heterologous plants. The first

gene for flower color in Petunia was isolated using an autonomous Ac one element system in

Petunia (Chuck et al. 1993). By using the two-element transposon (Ac/Ds) tagging system in

Arabidopsis (Bancroft et aL 1992), other genes were tagged, including the albS {albino) gene

(Long et ai 1993), and the drll gene (Bancroft et al. 1993). In tomato, \h& feebly gene and

Cf-4 gene were tagged using \!b& Ac/Ds system. The feebly gene affects the development and production of anthocyanin (van der Biezen et al. 1996), and Cf-4 gene is involved in resistance to Cladosporium fUlvum race 5 in tomato (Takken et al. 1998). Just recently, the immutans (im) gene in Arabidopsis was cloned by Ac/Ds tagging and chromosome walking at the same time (Carol et al. 1999; Wu et al. 1999). The immutans gene encodes a protein 16 with homology to alternative oxidase, and mutations in immutans produce a recessive green- and white sectored leaf phenotype.

In Arabidopsis, there are currently about 500 independent Ac insertion lines and 900 independent Ds insertion lines which can be used for gene tagging (Bhatt et aL 1996; Long et aL 1997; IDubois etal. 1998). Because Ac/Dj elements in Arabidopsis also tend to transpose to sites close to their original position (Bancroft and Dean 1993; KeUer et aL 1993), the large number of independent lines with Ac/Ds insertions at different positions throughout the

Arabidopsis genome will greatly facilitate gene tagging and isolation in Arabidopsis.

Improved techniques for gene isolation in Arabidopsis use Ac/Ds elements in so-called enhancer orap and gene trap constructs. Both constructs utilize an immobilized Ac element as the source of Ac transposase. The enhancer trap construct carries a modified Ds element containing the GUS (glucuronidase) reporter gene (Jefferson et al. 1987) with a weak or minimal promoter. Once the enhancer trap element inserts within or close to a gene, the GUS reporter gene can be expressed under the control of the enhancer of this gene. The gene trap element contains a splice acceptor sequence in front of the GUS gene. Because the gene trap element does not contain a promoter, the GUS gene will not be expressed unless the element inserts into the transcribed region of a chromosomal gene and accepts splicing from an upstream exon. There are several advantages of the enhancer trap and gene trap approaches.

First, they can detect functionally redundant genes because the simple insertion of the construct will not give any phenotype. Second, if the mutation is caused by insertion of the enhancer trap or gene trap, the GUS gene expression pattern will reflect the expression pattern of the tagged gene. Third, enhancer trap and gene trap can identify genes that cause embryo lethality in heterozygotes (Sundaresan etal. 1995). LRPl, a gene expressed in lateral 17 and adventitious root primordia of Arabidopsis, was cloned by using an enhancer trap element (Smith and Fedoroff, 1995). The gene trap strategy was successfully utilized to identify the Arabidopsis PROUFERA gene, which is required for cell division throughout development (Springer et al. 1995). Additionally, the Arabidopsis FRUITFULL MADS-box gene was shown to mediate cell differentiation during fruit development using a fruitfull (ful-

1) mutant caused by an enhancer trap insertion. The GUS reporter expression pattern in this enhancer trap line faithfully mimics RNA in situ hybridization results, illustrating the advantage of the enhancer trap approach (Gu et aL 1998).

Transposable elements in Arabidopsis

Arabidopsis as a model organism for higher plant research

The small mustard Arabidopsis thaliana started to attract the interest of plant researchers in the early 1960s (Redei, 1975). Arabidopsis is a typical higher plant, but its features of small size, short life cycle, ease of growth in a laboratory environment and prolific seed production have made it a popular model for many plant biologists. In 1983, the first genetic map of Arabidopsis was reported, demonstrating the power of large-scale mutagenesis and the ease of performing classical genetic manipulation (Koomneef et al.

1983). With the development of molecular biology, the small genome size and simple structure of the nuclear genome were determined (Leutwiler et al. 1984; Pruitt and

Meyerowitz 1986; Meyerowitz 1987). At the same time, the methodology for transformation of Arabidopsis (tissue culture and seed transformation methods) was described (An et al.

1986; Feldmaim and Marks 1987). Some flower mutants from Maarten Koomneef and other mutants from Albert Kranz and George Redei were available in the 1980*s. The large number 18

of mutants caused by T-DNA insertion generated by Ken Feldmann and colleagues enabled

researchers to relate genes to mutant phenotypes (Feldmann and Marks 1987; Feldmann et al.

1994). The simple whole plant infiltration transformation method enables the rapid

generation of large numbers of Arabidopsis transformants for screening purposes (Bechtold

et aL 1993). As I described above, transposon tagging and other transposon systems for gene

isolation have been successfully established in Arabidopsis (Feldmann et al. 1994).

Positional cloning is feasible in Arabidopsis because of its small genome with relatively few

repetitive sequences (Arondel et al. 1992; Wu et al. 1999). The development of molecular

marker maps, recombinant inbred lines and YAC and BAG libraries are making it

increasingly user-ftiendly. The international cooperative project to sequence the entire

Arabidopsis genome is expected to be complete by 2(X)0. All of these developments will

provide further opportunities for scientists to study plant development, evolution,

metabolism, genetics, environmental adaptation, pathogen interaction and other topics using

Arabidopsis as a model (Somerville and Meyerowitz, 1994).

Transposable elements in Arabidopsis

In Arabidopsis, only one active endogenous DNA transposable element (Tagl) has

been identified thus far. Tagl was identified in a chlorate-resistant mutant ad an insertion in

the nitrate transporter gene CHLl in Arabidopsis ecotype Landsberg (Tsay, 1993). The Tagl element is 3.3 kb in length and has 22 bp terminal inverted repeats at both ends. It creates an

8 bp target site duplication upon insertion. Recently, its 2.3-kb major transcr^t was characterized. It encodes a putative 84.2 kD transposase with two nuclear localization signal sequences and a region conserved among transposases of the Ac family (Liu and Crawford 19

1998a). TagI can excise in the embryo and all other organs inArabidopsis. The time of excision is restricted to the late stage of vegetative and reproductive development in the shoot. The germinal excision frequency can be as high as 25-30% and is affected by copy number, genetic dosage and chromosomal location (Liu and Crawford 1998b). Although there are no Tagl elements in the Columbia or WS ecotypes of Arabidopsis, Tagl is widely distributed among other Arabidopsis ecotypes. The copy number is one or two in almost all

-containing ecotypes (Erank et al. 1998). However, it is unknown whether they are all active in these ecotypes. Another reported transposable element in Arabidopsis is the

Emigrant family, which shares all features of Mi l ts, miniature inverted-repeat transposable elements identified in maize and other cereal grass, barley, sorghum and rice (Casacuberta et al. 1998; Wessler et aL 1995)

In addition to DNA transposons, a number of retrotransposons has been identified in

Arabidopsis. The Arabidopsis retrotransposons are in low copy number (Voytas and Ausubel

1988; Voytas et al. 1990; Wright et aL 1996), which is quite unlike the high copy number observed in other plants, like maize (Bennetzen 1996; Voytas 1996). Tatl and Athila are the only known elements with moderate copy number. In some ecotypes, there can be 10 and 30 copies respectively (Peleman et al. 1991; Pelissier et al. 1995). All retrotransposon families studied thus far in Arabidopsis are inactive. It seems that retrotransposon activity has been suppressed inArabidopsis (Voytas 1996). Despite the inactivity of the rosid&nl Arabidopsis retrotransposon, the tobacco retrotransposon Tntl can undergo JlNA-mediated transposition and create a 5 bp target site duplication after being introduced into Arabidopsis (Lucas et al.

1995). 20

MaizeFlocos

The maize P locus is located on the short aim of chromosome 1 and is involved in the synthesis of a red flavonoid pigment in the pericarp, cob and other floral tissues (Coe and

Neuffer 1977). Alleles of the P locus are generally identified by a two-letter suffix indicating their expression patterns in the pericarp and cob; as shown in Figure 3, P-rr specifies red pericarp and red cob, P-y/w gives white pericarp and white cob, and P-wr specifies white pericarp and red cob. The P gene controls the transcription of three genes, C2, Chil and Al, involved in biosynthesis of 3-deoxy flavonoids and phlobaphenes (Figure 4; Styles and

Ceska, 1977,1989; Grotewold et oL 1991b). The P gene encodes a Myb-homologous protein

P-rr P-mv P-wr P-w P-ovov

Figure 3. Different alleles of P gene 21

p-Coumaroyl CoA -i- Maloi^I CoA

^ C2

Chalcone

Chi A

Flavanone

Hydroxylase

Dihydroflavanol FIavan-4-ol R+Cl A1i FIavan-3,4-diol Polymerization

Bzl^

Bz2^ Anthocyanins Phlobaphenes

Figure 4. Biosynthetic pathway for anthocyaiiin and phlobaphene pigments in maize.

The C2, Chi and A1 genes encode enzymes for chalcone synthase, chalcone isomerase and dihydroflavonol reductase respectively. The A2 {AntkocyaninlessI), Bzl {Bronzel) and Bz2

{Bronze2) genes are required for biosynthesis of anythocyanins but not for phlobaphene. P is the regulator of the phlobaphene pathway, whereas R and CI are regulators of the anthocyanin pathway. (This figure is from Chopra et al. 1996 and reprinted by permission of the author). 22 that binds to the promoter of the A1 gene (dihydroflavonol reductase) and activates transcription (Grotewold et oL 1994).

The maize P locus was cloned by Ac tagging (Lechelt et al. 1989). The P locus in P- rr alleles shows a complex structure (Figure 5). The coding region is about 7-kb and is flanked by two 5.2-kb direct repeats at both ends (Figure 5). It contains three exons and two introns. There are two P transcripts that are produced by alternatively splicing at their 3'ends.

The first transcript is 1802 nucleotides and encodes a 43.7-kDa protein with homology to

Myb proteins. The second transcr^t is 945 nt and encodes a 17.3-kDa protein with a truncated Myb DNA binding domain. Transient assays in maize cells show that 1802 nt

Homologous recombinatioa induced by Ac insertion

Rgure 5. The structure of the maize P locus showing the two transcripts generated by alternative splicing and the Ac-induced homologous recombination

El; exon 1; E2: exon 2; E3: exon 3; E4: exon 4; II; intron 1; 12: intron 2; 13: intron 3

5.2 kb direct repeats; : Ac insertion 23

transcript is capable of activating the Al gene, whereas the fiinction of the 945 nt transcript is still unknown (Grotewold et al. 1991b, Grotewold et al. 1994). The P-rr gene introns 2 and 3 are 4.6 and 6.7-kb respectively, which are the largest introns yet described in plants (Athma etal. 1992).

The insertion of the maize transposon Ac at the P locus affects P gene expression and causes different phenotypes. The phenotype of the P-w allele, variegated pericarp and variegated cob (Figure 3) (Emerson 1917), is due to Ac insertion in the second intron of the P gene (Barclay and Brink 1954; Lechelt et al. 1989). Excision of the Ac element from the P locus causes the red stripes on colorless background of the P-w kernels. Another P allele gives rise to orange variegated pericarp and cob and is termed as P-ovov (Figure 3) (Athma et al. 1992). In the P-ovov allele, Ac is inserted at almost the same position as in P-w, but in the opposite orientation. The orientation of Ac insertion possibly causes the different P gene expression pattern in P-w and P-ovov alleles. In the P-w alleles, the Ac transcription direction is the same as that of P gene; hence P gene transcription terminates within the Ac element. In contrast, in the P-ovov allele, Ac is transcribed in the opposite direction as the P gene, the P gene can be transcribed through the Ac insertion, and the Ac sequence can be spliced from the message. Ac insertions in the exons of the P gene gives rise to colorless kernels with few red sectors (Athma et at. 1992), probably because the P gene function can be restored only by rare precise excisions. A null allele called P-ww-lll2 is generated through Ac-induced homologous recombination between the two 5.2 kb direct repeats that flank the P gene. The Ac-induced recombination deletes the entire P gene coding region and the Ac element, and results in colorless pericarp and cob (Figure 5; Athma and Peterson,

1991). 24

Recombination in plants

Recombination plays crucial roles in maintaining stability and generating diversity in

genomes in living organisms. Basically, there are three types of recombination: 1)

Homologous recombination; 2) Illegitimate recombination; 3) Site-specific recombination.

Homologous recombination is the exchange of covalent linkages between DNA molecules in

regions with highly similar or identical sequences. In contrast, illegitimate recombination

between the participating DNA molecules does not need any sequence similarity. For

example, transforming DNA constructs can randomly integrate into the maize genome

following transformation by particle bombardment. Site-specific recombination occurs at

specific regions, and the sequence similarity requirement is very limited. For example, ±e

integration of bacteriophage A, DNA into the E.coli host chromosome uses this pathway.

Homologous recombination in plants

Meiotic recombination ensures homologous chromosome pairing and disjunction

during meiosis. It also generates chromosomes with new allelic patterns different from their

progenitor chromosomes, and hence is critical for generating genetic diversity. In plants, the concept of uneven distribution of meiotic recombination across the chromosomes has been established (Dooner 1986; Tanksley et al. 1992; Moore et aL 1993; Civardi et al. 1994;

Schmidt et aL 1995). For example, the ratio of physical to genetic distance on Arabidopsis thaliana chromosome 4 is about 185 kb/cM. However, the ratio varies from 550 kb/cM in the recombination cold spots, to 30-50 kb/cM in recombination hot spots (Schmidt et aL 1995).

Many studies of recombination in plants have demonstrated that genes are recombination hot spots (Nelson 1968; Freeling 1978; Dooner et aL 1985; Wessler and Varagona 1985; Dooner 1986; Brown and Sundaresan 1991; Xu et aL 1995; Okagaki and Weil 1997; Dooner and

Martinez-Ferez 1997). The average recombination frequency of the entire maize genome is about 1470 kb/cM to 4700 kh/cM (Dooner et aL 1985; Civardi et oL 1994), but the intragenic recombination frequencies can be up to lOO-fokl higher. For example, at the maize bronzel

(bzl) locus, the meiotic recombination frequency is about 14 kb/cM, which is the highest recombination rate of any plant gene analyzed to date (Dooner 1986; Dooner and Martinez-

Ferez 1997). At maize anthocyaninlessl (al) locus, the intragenic recombination rate is about 217 kb/cM, while the recombination frequency in the adjacent 140 kb interval between al and shrunken! (sh2) is about 1560 kb/cM. Therefore, genes are preferred sites for meiotic recombination (Civardi et aL 1994). However, meiotic crossover has also been detected in a low copy region with no detectable transcript (Timmermans et al. 1996). Fine restriction mapping of crossover sites have revealed that meiotic recombination is not evenly distributed within a gene. Recombination hot spots were detected near the 5' regions of the al and bl genes in maize (Xu et aL 1995; Patterson et aL 1995), while recombination events preferentially occur at the 3' end of the maize rl gene (Eggleston et aL 1995). Although the mechanism of meiotic recombination in plants is still unclear, it seems to occur between highly similar sequences within unmethylated, nonrepetitive regions of the genome and it may be controlled by both cis- and trans-zcxmg factors that affect specific chromosomal regions (Timmermans etaL 1996, 1997).

Intrachromosomal homologous recombination has been studied as a model system to address the mechanism of homologous recombination in plants. Usually, constructs with overlapping, nonfrinctional parts of marker genes in close proximity are transformed into plant genomes as recombination substrates. The products of homologous recombination are 26 selected as restored marker gene function (Gal et al. 1991; Peterhans et al. 1990; Assaad and

Signer 1992; Tovar and Lichtenstein 1992; Swoboda et aL 1994). Normally, the intrachromosomal homologous recombination frequency is low and has been estimated at

10"^ to 10'^ events/genome (Swoboda etal. 1994; Chiurazzi et aL 1996). However, the frequency of intrachromosomal homologous recombination can be enhanced by several factors: 1) Physical and chemical agents, such as low doses of X-ray, ganuna-ray and UV

(Tovar and Lichtenstein 1992; Label et al. 1993; Puchta et al. 1995),

Methylmethanesulfonate (MMS), and mitomycin C (Puchta et aL 1995). 2) Double-Strand

Breaks (DSBs) induced by site-specific endonucleases, such as I-Scel (Puchta et aL 1993), and HO endonuclease target site. Expression of HO endonuclease can enhance the intrachromosomal homologous recombination 10-fold (Chiurazzi et aL 1996). 3)

Transposable elements, such as Ac, can induce homologous recombination between two 5.2 kb direct repeats at the maize P locus; without Ac insertion, the maize P locus is very stable

(Athma and Peterson 1991). Similarly, a tandem duplication in the maize bz locus is destabilized by Ac insertion (Dooner and Martinez-Ferez 1997). In transgenic tobacco, the Ac transposon can induce a low level of ectopic homologous recombination (Shalev and Levy

1997). Also, the Mutator transposon promotes recombination between directly repeated sequences in the maize Knotted locus (Lowe et al. 1992; Mathem and Hake 1997). Taken together, the common feature of these factors is that they can generate DNA double strand breaks. Therefore, it is reasonable to deduce that homologous recombination in plants may be initiated by DNA double stranded breaks (DSBs) as in yeast (see review by Shinohara and

Ogawa 1995). The studies of genomic DSB repair in transgenic tobacco indicate that there are two related pathways involved in plants for repair of genomic DSBs by homologous 27

recombination (Puchta et aL 1996; Puchta 1998a). In one pathway, the homologies on both

sides of the DSB are used, similar to the double strand break repair (DSBR) model proposed

by Szostak et aL (1983). In the one-sided invasion (OSI) model, homologous recombination

is restricted to one side of the DSB; this pathway has been shown to be used in

recombination in somatic plant cells (Puchta 1998a).

Illegitimate recombination in plants

Illegitimate recombination is thought to be the major pathway for DSB repair in

higher eukaryotes (Puchta 1998). The mechanism of illegitimate recombination in plants is

derived from studies of integration of transgenes into plant genomes. For example, the

integration of T-DNA into plant genomes can cause deletions or duplications of the plant

DNA at the insertion site, and truncation of the T-DNA border sequences. Occasionally, filler

DNA has been found at the new junctions (Gheysen et aL 1991; Mayerhofer et aL 1991;

Ohba et aL 1995; Bundock and Hooykaas 1995; review by Tinland 1996). Recently, a major

chromosomal rearrangement induced by T-DNA transformation in Arabidopsis was characterized, in which the reciprocal translocation between chromosomes was caused by T-

DNA insertion (Nacry et aL 1998). The direct gene transfer method (calcium phosphate

method) was used to generate transgenic rice. Around the transgene integration site, a short duplication of rice genomic sequence and a short region of homology between the transforming plasmid and target site DNA were found. Also, chromosomal rearrangements including deletions and translocations were observed at the integration site and the flanking region (Takano et aL 1997). By transformation of linearized plasmid with different terminal configurations into tobacco, non-homologous DNA end joining (illegitimate recombination) 28 in plant cells was found to be associated with deletions and filler DNA insertion. The filler

DNA sequences were derived firom internal sequences of the incoming plasmid or from the tobacco genome (Gorbunova and Levy 1997). More recently, DSBs in transformed T-DNA were generated in tobacco somatic cells by endonuclease l-Scel. Analysis of the repair process found that, in addition to deletions, there are many cases associated with the insertion of unique and repetitive genomic sequences into the rejoint site (Salomon and Puchta 1998).

In maize, spontaneous deletions at the waxy locus and bz-R locus were both associated with filler DNA at the novel junction (Wessler et al. 1990; Ralston et al. 1988)

In plants, illegitimate recombination is also used in repair of transposon excision sites. The small sequence rearrangements created by transposon excision are called

"footprints"; these footprints commonly comprise deletions, additions, substitutions or inversions. Two models have been proposed to explain footprint formation, and both models involve cellular DNA repair functions (Peacock et al. 1984; Saedler and Nevers 1985; Coen et al. 1989). Analysis of Ac excision footprints in the maize waxy locus and in transgenic

Arabidopsis indicates that the transposon-adjacent sequences can influence DNA repair at the excision site (Scott et al. 1996; Rinehart et aL 1997).

Overall, illegitimate recombination in plants is a complicated process and needs further investigation. It is usually associated with deletions, duplications, insertions of fiUer

DNA, and the presence of short repeats around the recombination site. An error-prone DNA replication mechanism was recently proposed for plant illegitimate recombination

(Gorbunova and Levy 1997; Rubin and Levy 1997). 29

Site-spedfic recombination in plants

There is no known endogenous site-specific recombination system in plants.

However, two heterologous systems have been used to induce site-specific recombination in

plants. One is the Ctdlox system from bacterophage PI and the other is the FLP/FRT system from yeast Saccharomyces cerevisiae.

The Crdlox system is derived from the bacteriophage PI. Cre is a 38.5 kDa recombinase produced by the cre gene; it can catalyze recombination at 34 bp lox sites. The standard lox site contains two 13 bp perfect inverted repeats separated by an 8 bp spacer sequence, which determines the direction of the lox site (for review, see Yarmolinsky and

Sternberg 1988).

The Crdlox system was first shown to function in tobacco cells using a transient assay. Cvdlox specific deletion and inversion events were detected and shown to be dependent upon the orientation of the two lox sites (Dale and Ow 1990). Later, Cxdlox site specific recombination occurred in stable transformants of tobacco with lox sites and a chimeric Cre gene (Odell et al. 1990). In this experiment, stable transformants with recombination substrates were re-transformed with a cre expression construct, or crossed to cre expressing plants. The recombination substrate contained a blocking fragment with lox sites at both ends, inserted between the nopaline synthase (nos) promoter and a kanamycin resistance gene {npt). The npt gene could not be expressed until the blocking fragment was removed via Cvdlox recombination. In transgenic tobacco and Arabidopsis, selective markers between two lox sites in direct orientation were successfully removed by re-transformation with the cre gene or by crossing with cre-expvessing plants (Dale and Ow 1991; Russell et al.

1992). Another example of transgene manipulation is the combination of gene inactivation 30

and activation in one Cve/lox recombination event (Bayley et aL 1992). The transgene

construct consisted of a luciferase gene (/uc) with two flanking lox sites that was placed

between a CaMV 35S promoter and a hygromycin resistance gene Qipg). The primary

transformant expresses luc gene via the CaMV 35S promoter, but it is hygromycin sensitive.

After introducing Cre recombinase, the luc gene was deleted by recombination between the

two lox sites, and the hpt gene was joined to the 35S promoter. In a similar strategy, lox-hpt

and 35S-lox-cre in different tobacco chromosomes can result in chromosome translocation

and inactivation of cre gene expression at the same time (Qin et al. 1994; 1995). By

combining the transposon (Ac/Ds) and Ocdlox systems, a more powerful recombination

system was developed in Arabidopsis and tobacco. Basically, two lox sites are transformed

into the plant genome. One lox site is contained within a modified Ds element, which can be

mobilized by Ac transposase. The hx site located at the integration site and can not move.

Later, Cre recombinase mediates site-specific recombination between the two lox sites to

generate deletions and inversions depending on the orientation of two lox sites (Medberry et al. 1995; Osborne et al. 1995; Stuurman et al. 1996). The Cte/lox system has also been used

to direct transgene integration in plants (Albert et al. 1995; Vergunst et al. 1998a,b). The outlines of the experiments are as follows: A target site containing a single lox site is placed in the plant genome. Subsequently, an incoming circular construct that contains a second lox site can be induced to recombine with the first lox site by the action of the Cre recombinase.

Re-excision of the integration construct can be prevented by the use of mutant lox sites together with integrative displacement of the cre gene promoter; alternatively, the cre gene can be expressed transiently. Successful site-specific integration events were reported in these studies (Albert et aL 1995; Vergunst et aL 1998a,b). Recently, the achievement of T- 31

DNA with two lox sites circularizing itself in the plant genome because of expression of ere

displays a convenient way to apply Cre recombinase to site-specific integration in plants

(Vergunst et aL 1998).

FLP/FRT is a site-specific recombination system from the 2 jim plasmid of

Saccharomyces cerevisiae. Its recombination function is involved in copy number

amplification in double rolling circle replication. The FLP recombinase is a 48 kDa protein

encoded by the FLP gene of the 2 pim plasmid. It can catalyze the recombination reaction

between two FRT sites. The FRT site is 34 bp and consists of two 13 bp inverted repeats with

one mismatch separated by an 8 bp asymmetric spacer sequence (for reviews see Futcher

1988; Cox 1988).

In plants, the FLP/FRT system has been used to induce both intra- and inter-

molecular recombination in maize and rice protoplasts by excising a blocking fragment

between two FRT sites, similar to the strategies described above for the Cxdlox system

(Lyznik et al. 1993,1996). Sinularly, in stable transgenic tobacco, the FLP/FRT system was

used to successfully remove a blocking fragment and restored a marker gene (Lloyd and

Davis 1994). In Arabidopsis, the antisense-oriented GUS gene flanked by two FRT sites in

inverted orientation was placed downstream of the 35S promoter as the FLP recombination substrate. The HJ'-dependent site-specific recombination caused the inversion of the antisense-oriented GUS reporter and allowed GUS expression (Sonti et al. 1995).

Additionally, the soybean heat-shock promoter has been used to drive FLP in maize cells and

Arabidopsis, which provided an easy way to control ±e FLP mediated site-specific recombination in plants (Lyznik et al. 1995; Kilby et al. 1995). 32

Transposons in plants are diverse; their transposition involves functions encoded by

the transposons and also probably the host plant Recently, genetic transformation has

enabled the introduction of different transposons from prokaryotic, fungal and other plant sources into a variety of plant targets. A major goal of these studies is the development of an efficient gene targeting system while some progress towards this goal has been achieved,

more research is needed to understand recombination in plants.

References

Albert, EL, E. C. Dale, E. Lee, D. W. Ow, 1995 Site-specific integration of DNA into wild- type and mutant lox sites placed in the plant genome. Plant J. 7:649-59

An, G., B. D. Watson, and C. C. Chang, 1986 Transformation of tobacco, tomato, potato, and Arabidopsis thaliana using a binary Ti vector system. Plant Physiol. 81:301-305

Arondel, V., B. Lemieux, 1. Hwang, S. Gibson, H. M. Goodman, C. R. Somerville, 1992 Map-based cloning of a gene controlling omega-3 fatty acid desaturation in Arabidopsis. Science 258:1353-5

Assaad, F. F., and E. R. Signer, 1992 Somatic and germinal recombination of a direct repeat in Arabidopsis. Genetics 132:553-66

Athma, P., E. Grotewold, T. Peterson, 1992 Insertional mutagenesis of the maize P gene by intragenic transposition of Ac. Genetics 131:199-209

Athma, P., and T. Peterson, 1991 Ac induced homologous recombination at the maize P locus. Genetics 128:163-173

Baker, B., J. Schell, H. Lorz, N. F. Fedoroff, 1986 Transposition of the maize-controlling element "Activato/' in tobacco. Proc. Natl. Acad. Sci. USA 83:4844-4848

Balcells, L., and G. Coupland, 1994 The presence of enhancers adjacent to the Ac promoter increases the aboundance of transposase mRNA and alters the timing of Ds excision in Arabidopsis. Plant MoL Biol. 24:789-798

Bancroft L A. M. Bhatt, C. Sjodin, S. Scofield, J. D. Jones, C. Dean, 1992 Development of 33

an efficient two-element transposon tagging system inArabidopsis thaliana. MoL Gen. Genet. 233:449-461

Bancroft I, and C. Dean, 1993 Transposition pattern of the maize element Ds in Arabidopsis thaliana. Genetics 134:1221-1229

Bancroft I, J. D. Jones, C. Dean, 1993 Heterologous transposon tagging of the DRLl locus in Arabidopsis. Plant Cell 5:631-8

Barclay, P. C., R. A. Brink, 1954 The relation between Modulator ziid Activator in maize. Proc. Natl. Acad. Sci. USA 40:1118-1126

Barth, P. T., N. Datta, R. W. Hedges, N. J. Grinter, 1976 Transposition of a deoxyribonucleic acid sequence encoding trimethoprim and streptomycin resistances from R483 to other replicons. J. Bacterial 125:800-810

Bayley, C. C., M. Morgan, E. C. Dale, D. W. Ow, 1992 Exchange of gene activity in transgenic plants catalyzed by the Cre-lox site-specific recombination system. Plant Mol. Biol. 18:353-361

BeaU, E. L., A. Admon, and D. C. Rio, 1994 ADrosophila protein homologous to the human p70 Ku autoimmune antigen interacts with the P transposabie element inverted repeats. Proc. NatL Acad. ScL USA 91:12681-12685

Beall, E. L., and D. C. Rio, 1996 Drosophila IRBP/Ku p70 corresponds to the mutagen- sensitive mus309 gene and is involved in P element excision in vivo. Genes Dev. 10:921-933

Beall, E. L., and D. C. Rio, 1997 Drosophila P element transposase is a novel site-specific endonuclease. Genes Dev. 11:2137-2151

Beall, E. L., and D. C. Rio, 1998 Transposase makes critical contacts with, and is stimulated by, single-stand DNA at the P element termini in vitro. EMBO J. 17:2122-2136

Bechtold, N., J. Ellis, G. PeUetier, 1993 In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. C. R. Acad. Sci. 316:1188-1193

Becker, H-A., and R. Kunze, 1996 Binding sites for maize nuclear proteins in the subterminal regions of the transposabie element Activator. Mol. Gen. Genet. 251:428-35

Becker, H-A., and R. Kunze, 1997 Maize Activator transposase has a bipartite DNA binding domain that recognizes subterminal sequences and the terminal inverted repeats. MoL Gen. Genet. 254:219-230

BelzUe, F., M. W. Lassner, Y, Tong, R. Khush, J. I. Yoder, 1989 Sexual transmission of transposed Activator elements in transgenic tomatoes. Genetics 123:181-189 34

Berg, C. A., and A. C. Spradling, 1991 Studies on the rate and site-specificity of P-element transposition. Gcngft'cs 127:515-524

Bhatt, A. M., T. Page, E. J. R. Lawson, C. Lister and C. Dean, 1996 Use of Ac as an insertional maXAgen 'mArabidopsis. Plant J. 9:935-945 van der Biezen, E. A., B. F. Brandwagt, W. van Leeuwen, H. J. Nijkamp, J. Hille, 1996 Identification and isolation of the FEEBLY gene from tomato by transposon tagging. Mol. Gen. Genet. 251:267-280

Boeke, J. D., and S. B. Sandmeyer, 1991 Yeast transpsosable elements. In The Molecular and Cellular Biology of the Yeast Saccharomyces, J. Broach, E. Jones and J. Pringle,(eds) Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp193-261

Brachet, P., H. Eisen, A. Rambach, 1970 Mutations of coliphage lambda affecting the expression of replicative functions O and P. MoL Gen. Genet. 108:266-276

Bravo-Angel, A. M., H. A. Becher, R. Kunze, B. Hohn, W. H. Shen, 1995 The binding motifs for Ac transposase are absolutely required for excision of Dsl in maize. Mol. Gen. Genet. 248:527-534

Brettell, R. I. S., and E. S. Dennis, 1991 Reactivation of sUent Ac following tissue culture is associated with heritable alternations in its methylation pattern. Mol. Gen. Genet. 229:365- 372

Brink, R. A., and E. Williams, 1973 Mutable R-navajo alleles of cyclic origin in maize. Genetics 73:273-296

Brown, J., and V. Sundaresan, 1991 A recombination hotspot in the maize Ai intragenic region. Theor. AppL Genet. 81:185-188

Brutnel, T. P., and S. L. Dellaporta, 1994 Somatic inactivation and reactivation of Ac associated with changes in cytosine methylation and transposase expression. Genetics 138:213-225

Bundock, P., and P. Hooykaas, 1996 Integration oiAgrobacterium tumefciens T-DNA in the Saccharmyces cerevisiae genome by illegitimate recombination. Proc. Natl. Acad. Sci. USA 93:15272-15275

Carol, P., D. Stevenson, C. Bisanz, J. Breitenbach, G. Sandmann, R. Mache, G. Coupland, and M. Kuntz, 1999 Mutations in the Arabidopsis gene IMMUTANS cause a variegated phenotype by inactivating a chloroplast terminal oxidase associated with phytoene desaturation. Plant Cell 11:57-68 35

Carroll, B. J., V. 1. Klimyuk, C. M. Thomas, G. J. Bishop, K. Harrison, S. R. Scofield and J. D. G. Jones, 1995 Germinal transpositions of the maize element Dissociation from T-DNA loci in tomato. Genetics 139:407-420

Casacuberta, E., J. M. Casacuberta, P. Puigdomenech, A. Monfort, 1998 Presence of miniature inverted-repeat transposable elements (MTIEs) in the genome of Arabidopsis ^taliana: characterisation of the Emigrant family of elements. Plant J. 16:79-85

Chatterjee, S., and P. Starlinger, 1995 The role of subterminal sites of transposable element Ds of mays in excision. MoL Gen. Genet. 249:281-288

Chen, J., I. M. Greenblatt, S. L. Dellaparta, 1987 Transposition of Ac from the P locus of maize into unreplicated chromosomal sites. Genetics 117:109-116

Chen, J., 1. M. Greenblatt, S. L. Dellaparta, 1992 Molecular analysis of Ac transposition and DNA replication. Genetics 130:665-676

Chiurazzi, M., A. Ray, J. F. Viret, R. Perera, X-H. Wang, A. M. Lloyd, E. R. Signer, 1996 Enhancement of somatic intrachromosomal homologous recombination in Arabidopsis by the HO endonuclease. Plant Cell 8:2057-66

Chomet, P.S., S. Wessler, S. L. Dellaporta, 1987 Inactivation of the maize transposable element Activator (Ac) is associated with its DNA modiHcation. EMBO J. 6:295-302

Chuck, G., T. Robbins, C. Nijjar, E. Ralston, N. Courtney-Gutterson, H. K. Dooner, 1993 Tagging and cloning of a petunia flower color gene with the maize transposable element Actovator. Plant Cell 5:371-378

Civardi, L., Y. Xia, K. J. Edwards, P. S. Schnable, B. J. Nikolau, 1994 The relationship between genetic and physical distances in the cloned al-sh2 interval of the Zea mays L. genome. Proc. Natl. Acad, Sci. USA 91:8268-72

Coe, E. H., and M. G. Neuffer, 1977 The genetics of com. In: Sprague G. F. (ed) Com and com improvement. American Society of Agronomy, Madison, Wisconsin, USA, pp 111-223

Coen, E. S., T. P. Robbins, J. Almeida, A. Hudson and R. Carpenter, 1989 Consequences and mechanisms of transposition m Antirrhinum majus. In: Berg, D.E., Howe, M. M.(eds) Mobile DNA. American Society for Microbiology, Washington DC, pp. 413-436 in Mobile DNA,

Coupland, G., B. Baker, J. Schell, P. Starlinger, 1988 Characterization of the maize transposable element Ac by internal deletion. EMBO J. 7:3653-3659 36

Coapland, G., C. Plum, S. Chatteijee, A. Post, P. Starlinger, 1989 Sequences near the termnini are reqiiired for transposition of the maize transposon Ac in transgenic tobacco plants. PTOC. Natl Acad. ScL USA 86:9385-9388

Cox, M. M., 1988 FLP site-specific recombination system of Saccharomyces cerevisias. In: Kucherlapati R and Smith GR (eds) American Society for Microbiology, Washington, DC pp 429-443

Craig, N. L., 1989 Transposon Tn7. In: Berg, D.E., Howe, and M. M. (eds) Mobile DNA. American Society for Microbiology, Washington DC, pp211-225

Craig, N. L., 1991 Tn7: a target site-specific transposon. Mol. Microbiol. 5:2569-2573

Dale, E. C., and D. W. Ow, 1990 Intra- and intermolecular site-specific recombination in plant cells mediated by bacteriophage PI recombinase. Gene 91:79-85

Dale, E. C., and D. W. Ow, 1991 Directed excision of a transgene from the plant genome. Proc. Natl. Acad. Sci. USA 88:10558-62

E)ean, C., C. Sjodin, T. Page, J. Jones and C. Lister, 1992 Behaviour of the maize transposable element Ac in Arabidopsis thealiana. Plant J. 2:69-81

Dooner, H. KL, E. Week, A. Adams, E. Ralston, M. Favreau, and J. English, 1985 A molecular genetic analysis of insertion in the bronze locus in maize. Mol. Gen. Genet. 200:240-246

Dooner, H. K., 1986 Genetic fine structure of the bronze locus in maize. Genetics 113:739- 746

Dooner, H. K., and A. Belachew, 1989 Transpositin pattern of the maize element Ac from the bz-m2(Ac) allele. Genetics 122:447-457

Dooner, H. K., and I. M. Martinez-Ferez, 1997 Recombinaiton occurs uniformly within the bronze gene, a meiotic recombination hotspot in the maize genome. Plant Cell 9:1633-1646

Doring, H-P., E. Tillmann, and P. Starlinger, 1984 DNA sequence of the maize transposable element Dissociation. Nature 307:127-130

Doring, H-P., and P. Starlinger, 1986 Molecular genetics of transposable elements in plants. Anna. Rev. Genet 20:175-200

Dowe, M. J. jr., G. W. Roman, A. S. Klein, 1990 Excision and transposition of two Ds transposons from the bronze mutable 4 derivative 6856 allele of Zea mays L. Mol. Gen. Genet. 221:475-485 37

Dubois, P., S. Cutler, and F. J. Belzile, 1998 Regional insertional mutagenesis on chromosome m of Arabidopsis thcdiana using maize Ac element. Plant J. 13:141-151

Eggleston, W. B., M. Alleman, and J. L. Kermicle, 1995 Molecular organization and germinal instability of the R-strippled maize. Genetics 141:347-360

Emerson, R. A., 1917 Genetical studies of variegated pericarp in maize. Genetics 2:1-35

Engels, W. R., 1989 P-element in Drosophlia. In: Berg, D., Howe, M., (eds) P element in IDrosophila, American Society of Microbiology, Washington DC, pp 437-484

Engels, W. R., D. M. Johnson-Schlitz, W. B. Eggleston, J. Sved, 1990 Efigh-frequency P- element loss in Drosophila is homolog-dependenL Cell 62:515-525

Fedoroff, N., 1989 Maize transposable elements. In: Berg, D.E., Howe, and M. M. (eds) Mobile DNA. American Society for Microbiology, Washington DC, pp159-221 Feldmann, K. A, and M. D. Marks, 1987 A^roZ>actenam-mediated transformation of germinating seeds of Arabidopsis thaliana: A non-tissue culture approach. MoL Gen. Genet. 208:1-9

Feldmann, K. A, R. L. Malmberg, and C. Dean, 1994 Mutagenesis in Arabidopsis. In:Meyerowitz, E. M. and Somerville, C. R. (eds) Cold Spring Harbon Cold Spring Harbor Laboratoary Press, pp. 137-172

Feldmar, F., and R. Kunze, 1991 The ORFs protein, the putative transposase of maize tranposable element Ac, has a basic DNA binding domain. EMBO J. 10:4003-4010

Fiandt, M., W. Szybalski, M. H. Malamy, 1972 Polar mutations in lac, gal and phage X consist of a few IS-DNA sequences inserted with either orientation. Mol. Gen. Genet. 119:223-231

Finnegan, D. J., 1989 Eukaryotic transposable elements and genome evolution. Trends Genet. 5:103-107

Firek, S., D. J. martin, M. R. Roberts, F. Sturgess, R. Scott and J. Draper, 1996 Gametiphte- specific transposition of the maize Ds element in tansgenic tobacco. Plant J. 10:569-578

Frank, M. J. D. Preuss, A Mack, T. C. Kuhlmann, N. M. Crawford, The Arabidopsis transposable element Tagl is widely distributed amone Arabidopsis ecotypes. Mol. Gen. Genet. 257:478-484

Rreeling, M., 1978 Allelic variation at the level of intragenic recombination. Genetics 89:211-224 38

Freeling, M., 1984 Plant transposable elements and insertion sequences. Annu. Rev. PUmt Physiol. 35:271-298

Iriedemann, P., and P. A. Peterson, 1982 The Uq controlling element system in maize. MoL Gen. Genet. 187:19-29

Futcher, A. B., 1988 The 2 |jjn circle plasmid of Saccharomyces cerevisias. Yeast 4:27-40

Gal, S., B. Pisan, T. Hohn, N. Grimsley, B. Hohn, 1991 Genomic homologous recombination in planta. EMBOJ. 10:1571-1578

Gerlach, W. L., E. S. Dennis, W. J. Peacock, M. T. Clegg, 1987 The Dsl element family in maize and Tripsacum. J. MoL Evol. 26:329-334

Gheysen, G., V. Villarroel, and M. Van Montagu, 1991 Illegitimate recombination in plants: a model for T-DNA integration. Genes Dev. 5:287-297

Ginzburg, L R., P. M. Bingham, and S. Yoo, 1984 On the theory of speciation by transposable elements. Genetics 107:331-341

Gloor, G. B., N. A Nassif, D. M. Johnson-Schlitz, C. R. Preston, W. R. Engels, 1991 Targeted gene replacement in Drosophila via P-element-induced gap repair. Science 253:1110-1117

Golic, K. G., 1994 Local transposition of P elements in Drosophila melanoganster and recombination between duplicated elements using a site-specific recombinase. Genetics 137: 551-563

Gonella, J. A., and P. A Peterson, 1978 The Feu controUing-element system in maize, n. On the possible heterogeneeity o fcontrolling elements. HI. On the variable dilute pigmenting capacity of r-cu. MoL Gen. Genet. 167:29-36

Gorbunova, V., and A A. Levy, 1997 Non-homologous DNA end joining in plant cells is associated with deletions and filler DNA insertions. Nucleic Acids Res. 25:4650-7

Green, M.M., 1977 Genetic instablility in Drosophila melanoganster. de novo induction of putative insertion mutations. Proa. Natl. Acad. Sci. USA 74:3490-3493

Grindley, N. D. F., 1983 Transposition of Tn3 and related transposons. Cell 32:3-5

Greenblatt, L M., R. A Brink, 1962 Twin mutations in medium varigated pericarp maize. Genetics 47:489-501

Greenblatt, L M., 1968 The mechanism of modulator transposition in maize. Genetics 58: 585-597 39

Greenblat, L M., 1984 A Chromosomal replication pattern deduced from pericarp phenotypes resulting from movements of the transposable element, Mudulator, in maize. Genetics 108:471-485

Grevelding, C., D. Becker, R. Kunze, A. van Menges, V. Fantes, J. Schell, R. Masterson, 1992 High rates of Ac/Ds germinal transposition in Arabidopsis suitable for gene isolation by insertional mutagenesis. Proc. Natl. Acad. Sci. USA 89:6085-6089

Grotewold, E., P. Athma, T. Petreson, 1991a A possible hot spot for Ac insertion in the maize P gene. MoL GeruGenet. 230:329-331

Grotewold, E., P. Athma, T. Petreson, 1991b Alternatively spliced produced of the maize P gene encodes proteins with homology to DNA binding domain of Myb-like transcription factors. Proc. Natl. Acad. Sci. USA 88:4578-4591

Grotewold, E., B. Drummond, B. Bowen, T. Petreson, 1994 The myb-homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene subset. Cell 76:543-553

Gu, Q., C. Ferrandiz, M. F. Yanofeky, R. Martienssen, 1998 The FRUTFULL MADS-box gene mediates cell differentialtion during Arabidopsis fruit development. Devlopment 125:1509-1517

Haring, M. A., J. Gao, T. Volbeda, C. M. T. Rommens, H. J. L Nijkamp, J. Hille, 1989 A comparative study of Tam3 and Ac transposition in transgenic tobacco and petunia plants. Plant Mol. Biol. 13:189-201

Healy, J., C. Corr, J. Deyoung, B. Baker, 1993 Linked and unlinked transposition of a genetically marked Dissociation element in transgenic tomato. Genetics 134:571-584

Hehl, R., and B. Baker, 1989 Induced transpositin of Ds by a stable Ac in crosses of trangenic tobacco plants. Mol. Gen. Genet. 217:53-59

Heinlein, M., 1995 Variegation patterns caused by excision of the maize transposable element Dissociation (J)s) are autonomously regulated by allele-specific Activator (Ac) elements and are not due to trans-acting modifier genes. Mol. Gen. Genet. 246:1-9

Honma, M. A, B. J. Baker, C. S. Waddell, 1993 High-frequency germinal transposition of DsALS in Arabidopsis. Proc. Natl. Acad Sci. USA 90:6342-6246

Hedges, R. W., and A. F. Jacob, 1974 Transposition of ampicillin resistance from RP4 to other leplicons. Mol. Gen. Genet. 132:31-40 40

Heffron, F., B. J. McCarthy, H. Ohtsubo, and E. Ohtsubo, 1979 DNA sequence analysis of the transposon Tn3: three genes and three sites involved in transposition of Tn3. Cell 18:1153-1164

Hehl, R. and B. Baker, 1990 Property of the maize transposable elememt Acticvator in transgenic tobacco plants: a versatile inter-species genetic tool Plant Cell 2:709-721

Heslip, T. R., and R. B. Hodgetts, 1994 Targeted transposition at the vestigial locus of Drosophila melanogaster. Genetics 138:1127-35

Hiraizumi, Y., 1971 Spontaneous recombination in Drosophila melanogaster males. Proc. NatL Acad. Set USA 6»:26S-270

Elirchika, H., 1993 Activation of tobacco retrotransposons during tissue culture. EMBO J. 12:2521-2528

Elirsch, H-J., P. Starlinger, P. Brachet, 1972 Two kinds of insertions in bacterial genes. MoL Gen.Genet. 119:191-206

Houba-Herin, N., D. Becker, A. Post, Y. Larondelle, P. Starlinger, 1990 Excision of a Ds- like maize transposable element (AcA) in a transient assay in Petunia enhanced by a truncated coding region of the transposable element Ac. Mol. Gen. Genet. 224:17-23

Houba-Herin, N., M. Domin, J. Pedron, 1994 Transposition of a Ds element from a plasmid into the plant genome in Nicotiana plumbaginifolia protoplast-derived cell. Plant J. 6:55-66

Izawa, T., C. Miyazaki, M. Yamamoto, R. Terada, S. lida, K. Shimamoto, 1991 Introduction and transposition of the maize transposable element Ac in rice {Oryza sativa L.). MoL Gen. Genet. 227:391-6

Jarvis, P., F. Belzile, T. Page, C. Dean, 1997 Increased Ac excision (iae): Arabidopsis thaliana mutations affecting Ac transposition. Plant J. 11:907-19

Jefiferson, R. A., T. A Kavanagh, and M. W. Bevan, 1987 GUS fusions: P-Glucuronidase as a sensitive and versatile gene marker in higher plants. EMBO J. 6:3901-3907

Jones, J. D. G., F. M. Garland, P. Maliga, H. K. Dooner, 1989 Visual detection of transposition of the maize element Activator (Ac) in tobacco seedlings. Science 244:204-207

Jones, J. D. G., L. Harper, F. M. Garland, E. J. Ralston, H. K. Dooner, 1991 Reversion and altered variegation of an SPT: Ac allele in tobacco. Maydica 36: 329-335

Jordan E., H. Saedler, P. Starlinger, 1968 O-zero and strong polar mutants in the gal operon are inertions. Mol. GetL Genet. 102:353-363 41

Kauman, P. D., and D. C. Rio, 1992 P-element transposition in vitro proceeds by a cut-and - paste mechanism and uses GTP as a cofactor. Cell 69; 27-39

Keller, J., E. Lim, and H. K. Dooner, 1993 Preferential transposition of Ac to linked sites in Arabidopsis. Theor. AppL Genet 86:585-588

Kelley, M., R. S. Kidd, R. L. Berg, M. W. Young, 1987 Restriction of P-element insertions at the Notch locus of in Drosophila melanogaster. MoL Cell BioL 7:1545-1548

Kidwell, M. G., and J. F. Kidwell, 1976 Selection for male recombination in Drosophila melanogaster. Genetics 84:333-351

Kidwell, M. G. and D. Lisch, 1997 Transposable elements as sources of variation in animals and plants. Proc. Natl. Acad. Sci. USA 94:7704-7711

Klecker, N., 1979 DNA sequence analysis of TnlO insertions: origin and role of 9-bp flanking repetitions during TnlO translocation. Cell 16:711-720

Klecker, N., 1989 Transposon TnlO. In: Berg, D.E., Howe, M. M. (eds) Mobile DNA. American Society for Microbiology, Washington DC, pp227-268

Knapp, S., G. Coupland, H. Uhrig, P. Starlinger, F. Salamini, 1988 Transposition of the maize transposable element Ac in Solanum tuberosum. Mol. Gen. Genet. 213:285-290

Koomneef, M. E., J. Van Eden, C. J. Hanhart, P. Stam, F. J. Braaksma, and W. J. Feenstra, 1983 Linkage map of Arabidopsis thaliaruL J. Hered. 74:265-272

Kunze, R., U. Stochaj, J. Laufs, and P. Starlinger, 1987 Transcription of transposable element Activator (Ac) of Zea mays L. EMBO J. 6:1555-1563

Kunze, R., P. Starlinger, D. Schwartz, 1988 DNA methylation of the maize transposable element Ac interferes with its transcription. Mol. Geru Genet. 214:325-327

Kunze, R., and P. Starlinger, 1989 The putative transposase of transposable element Ac from Zea mays L. interacts with subterminal sequences of Ac. EMBO J. 8:3177-3185

Kunze, R., 1996 The maize transposable element Activator (Ac). In: Seadler, H. and Gierl,A.(eds). Transposable elements. Springer-Verlag Berlin Heidelberg New York, ppl86

Laufs, J., U. Wirtz, M. Kammann, V. Matzeit, S. Schaefer, J. Schell, A. P. Czemilofsky, B. Baker, 1990 Wheat dwarf virus Ac/Ds vectors: expression and excision of transposable elements introduced into various cereals by aviral replicon. Proc. Natl. Acad Sci. USA ^7:1752-6 42

Lawson, E. J. R., S. R. Scofield, C. Sjodin, J. D. G. Jones, C. Dean, 1994 Modificarion of the 5' untranslated leader region of the maize Activator element leads to increased activity on Arabidopsis. MoL Gen. Genet. 245:608-615

Lebel, E. G., J. Masson, A. Bogucki, and J. Paszkowski, 1993 Stress-induced intrachromosomal homologous recombination in plant somatic cells. Proc. Natl. Acad. Sci. 5 A 90:424-426

Lechelt, C., T. Peterson, A. Laird, J. Chen, S. L. Dellaporta, E. Dennis, W. J. Peacock, and P. Starlinger, 1989 Isolation and molecular analysis of the maize P locus. MoL Gen. Genet. 219:225-234

Leutwiler, L. S., B. R. Hough-Evans, and E. M. Meyerowitz, 1984 The DNA of Arabidopsis thaliana. Mol. Gen. Genet. 194:15-23

Lca^, a. a., M. Fridlender, U. H. Rubin, Y. Sitrit, 1996 Binding of Nicotiana nuclear proteins to the subterminal regions of the Ac transposable element. Mol. Gen. Genet. 251:436-41

Liu, D., and N. M. Crawford, 1998a Characterization of the putative transposase mRNA of Tagl, which is ubiqutously expressed in and can be induced by Agrobacterium- mediated transformation vnthdTagl DNA. Genetics 149:693-701

Liu, D., and N. M. Crawford, 1998b Characterization of the germinal and somatic activity of the Arabidopsis transposable element Tagl. Genetics 148:445-456

Lloyd, A. M., and R. W. Davis, 1994 Functional expression of the yeast FLP/FRT site- specific recombination system in Nicotiana tabacum. Mol. Gen. Genet.

Long, D., M. Martin, E. Sundberg, J. Swinburne, P. Puangsomlee, G. Coupland, 1993 The maize transposable element system Ac/Ds as a mutagen in Arabidopsis-. identification of an albino mutation induced by Ds insertion. Proc. NatL Acad Sci. USA 90:10370-10374

Long, D., J- Goodrich, K. Wilson, E. Sundberg, M. Martin, P. Puangsomlee, G. Coupland, 1997 Ds elements on all five Arabidopsis chromosomes and assessment of their utility for transposon tagging. Plant J. 11:145-148

[x)we, B., J. Mathem, S. Hake, 1992 Active Mutator elements suppress the knotted phenotype and increase recombination at the Knl-0 tandem duplication. Genetics 132:813- 822

Lucas, H., F. Feuerbach, K. Kunert, M. A. Grandbastien, M. Caboche, 1995 RNA-mediated transposition of the tobacco retrotransposon Tntl in Arabidopsis thaliana. EMBO J. 14:2364- 2373 43

Lyznik, L. A., J. C. Mitchell, L. Hirayama, T. K. Hodges, 1993 Activity of yeast FLP lecombinase in maize and rice protoplasts. Nucleic Acids Res. 21:969-975

Lyznik, L. A., L. Hirayama, K. V. Rao, A. Abad, T. K. Hodges, 1995 Heat-inducible expression of FLP gene in maize cells. Plant J. 8:177-86

Ly2aiik, L. A., K. V. Rao, T. K. Hodges, 1996 FLP-mediated recombination of FRT sites in the maize genome. Nucleic Acids Res. 24:3784-9

Mackay, T. F. C., 1986 Transposable element-induced fitness mutations in Drosophila meUmogaster. Genet. Res. 48:W-87

Malamy, M. H., 1966 Frameshift mutations in the lactose operon of E. coli. Cold Spring Harb. Symp. Quant Biol. 31:189-201

Malamy, M. H., 1970 Some properties of insertion mutations in the lac operon. In: Beckwith, J. R., Zipser, D.(eds) The lactose operon. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, pp 359-373

Malamy, M. H., M. Fiandt, W. Szybalski, 1972 Electron microscopy of polar insertions in the lac operon of Escherichia coli. Mol. Gen. Genet. 119:207-222

Mathem, J., and S. Hake, 1997 Mu element-generated gene conversions in maize attenuate the dominant knotted phenotype. Genetics 147:305-14

Mayerhofer, R., Z. Koncz-Kalman, C. Nawrath, G. Bakkeren, A. Crameri, K. Angelis, G. P. Redei, J. Schell, B. Hohn, C. Koncz, 1991 T-DNA integration: a mode of illegitimate recombination in plants. EMBO J. 10:697-704

McClintock, B. 1948 Mutable loci in maize. Carnegie Inst. Wash. Year Book 4,1:155-169

McClintock, B. 1949 Mutable loci in maize. Carnegie Inst. Wash. Year Book 48:142-154

McClintock, B. 1950 The origin and behavior of mutable loci in maize. Proc. Natl Acad. Sci. USA 36:344-355

McClintock, B. 1963 Further studies of gene-control system in maize. Carnegie Inst. Wash. Year Book 62:486-493

McClintock, B. 1964 Aspects of gene regulation in maize. Carnegie Inst. Wash. Year Book 63:592-602

McClintock, B. 1965 Components of action of the regulators Spm and Ac. Carnegie Inst. Wash. Year Book 6^:521-534 44

McClintock, B. 1984 The significance of responses of the genome to challenge. Science 226:792-801

McElroy, D., J. D. Louwerse, S. M. McElroy, P. G. Lemaux, 1997 Development of a simple transient assay for Ac/Ds activity in cells of intact barley tissue. Plant J. 11:157-65

Merckelbach, A., H. P. Doering, and P. Starlinger, 1986 The aberrant Ds element in the adhl-2Fll::Ds2 allele. Maydica 31:109-122

Medberry, S. L., E. Dale, M. Qin, D. W. Ow, 1995 Intra-chromosomal rearrangements generated by Cre-lox site-specific recombination. Nucleic Acids Res. 23:485-90

Meyerowitz, E. M., 1987 Arabidopsis thaliana. Amtu. Rev. Genet 21:93-112

Moore, G., M. D. Gale, N. Kurata, and R. B. EHaveU, 1993 Moleculat analysis of small grain cereal genomes: current status and propects. Bio/Technology 11:584-589

Muller_Neumann, M., J. I. Yoder, and P. Starlinger, 1984 The DNA sequence of the transposable element Ac of Zea mays L. MoL Gen. Genet. 198:19-24

Nacry, P., C. Camilleri, B. Courtial, M. Caboche, D. Bouchez, 1998 Major chromosomal rearrangements induced by T-DNA transformation in Arabidopsis. Genetics 149:641-50

Nelson, O. E., 1968 The waxy locus inmaize. n. The location of the controlling element alleles. Genetics 60:507-524

Nevers, P., and H. Saedler, 1977 Plant transposable elements. Adv. Bot Res. 12:102-203

Odell, J., P. Caimi, B. Sauer, S. Russell, 1990 Site-directed recombination in the genome of transgenic tobacco. MoL Gen. Genet. 223:369-78

O'Hare, K., and G. M. Rubin, 1983 Structure of P transposable elements and their sites of insertion ans excision in the Drosophila melanoganster genome. Cell 34:25-35

O'Hare, K., A. Driver, S. McGrath, D. M. Jonhnson-Schlitz, 1992 Distribution and structure of cloned P element from the Drosophila melanoganster P strain tcz- Genet. Res. Camb. 60:33-41

Ohba, T., Y. Yoshioka, C. Machida, Y. Machida, 1995 DNA rearrangement associated with the integration of T-DNA in tobacco: an example for multiple duplications of DNA around the integration target. Plant J. 7:157-64

Ohtsubo, E., and Y. Sekine, 1996 Bacterial insertion sequences. In: Saedler, H., Gierl, A. (eds) Transposable elements. Springer-Verlag Berlin Heidelberg New York, ppl-48 45

Okagaki, R. J., and C. F. Weil, 1997 Analysis of recombination sites within the maize waxy locus. Genetics 147:815-21

Osborne, B. L, U. Wirtz, B. Baker, 1995 A system for insertional mutagenesis and chromosomal rearrangement using the Ds transposon and CK-IOX. Plant J. 7:687-701

Patterson, G. I., K. M. Kubo, T. Shroyer, and V. L. Chandler, 1995 Sequence required for paramutation of the maize b gene map to a region containing the promoter and upstream sequences. Genetics 140:1389-1406

Peacock, W. J., E. S. Dennis, W. L. Gerlach, M. M. Sachs and D. Schwartz, 1984 Insertion and excision of Ds controlling elements in maize. Cold Spring Harbor Symp. Quant. Biol. 49:347-354

Peschke, V. M., R. L. Phillips, B. G. Gengenbach, 1987 Discovery of transposable element activity among progeny of tissue culture-derived maize plans. Science 238:804-807

Peterhans, A., H. Schlupmann, C. Basse, J. Paszkowski, 1990 Intrachromosomal recombination in plants. EMBO J. 9:3437-45

Peterson, P. A., 1953 A mutable pale green locus in maize. Genetics 38:682-683

Peterson, T., 1990 Intragenic transposition of Ac generates a new allele of the maize P gene. Genetics 126:469-476

Pohlman, R. F., N. V. Fedoroff, and J. Messing, 1984 The nucletide sequence of the maize controlling element Acftvator. Cell 37: 635-643

Preston, C. R., and W. R. Engels, 1996 f-element-induced male recombination and gene convexsion mDrosophila. Genetics 144:1611-1622

Preston, C. R., J. A. Sved, and W. R. Engels, 1996 EHanking duplications and deletions associated with P-induced male recombination in Drosophila. Genetics 144:1623-1638

Pruitt, R. E., and E. M. Meyerowitz, 1986 Characterization of the genome of Arabidopsis thaliana. J. MoL BoL 187:169-183

Puchta, H., B. Dujon, B. Hohn, 1993 Homologous recombination in plant cells is enhanced by in vivo induction of double strand breaks into DNA by a site-specific endonuclease. Nucleic Acids Res. 21:5034-40

Puchta, H., P. Swoboda, S. Gal, M. Blot, B. Hohn, 1995 Somatic intrachromosomal homologous recombination events in populations of plant siblings. Plant MoL Biol. 28:281- 92 46

Puchta, H., B. Dujon, B. Hohn, 1996 Two different bat related mechanisms are used in plants for ±e repair of genomic double-strand breaks by homologous recombination. Proc. Natl. Acad. ScL USA 93:5055-60

Puchta, H., 1998a Repair of genomic double-strand breaks in somatic plant cells by one­ sided invasion of homologous recombination. Plant J. 13:331-339

Puchta, H., 1998b Towards targeted transformation in plants. Trends Plant Sci. 3:77-78

Qin, M., C. Bayley, T. Stockton, D. W. Ow, 1994 Cre recombinase-mediated site-specific recombination between plant chromosomes. Proc. Natl. Acad Sci. f/5 A 91:1706-10

Qin, M., E. Lee, T. ZankeU D. W. Ow, 1995 Site-specific cleavage of chromosomes in vitro through Cre-lox recombination. Nucleic Acids Res. 23:1923-7 Ralston, E. J., J. J. English, H. K. Dooner, 1988 Sequence of three bronze alleles of maize and correlation with the genetic fine structure. Genetics 119:185-197

Redei, G. P, 1975 Arabidopsis as a genetic tooL Armu. Rev. Genet. 9:111-127

Rinehart, T., C. Dean and C. WeU, 1997 Comparative analysis of non-random DNA repair following Ac transposon excision in maize dsid Arabidopsis. Plant J. 12:1419-1427

Robertson, H. M., C. R. Preston, R. W. Phillis, D. Johnson-Schlitz, W. K. Benz, W. R. Engels, 1988 A stable genomic source of P-element transposase in Drosophila melanoganster. Genetics 118:461-470

Robbins, T. P., R. Carpenter, E. S. Coen, 1989 A chromosome rearrangement suggests that donor and recipient sites ate associated during Tam3 transposition in Antirrhinum majus. EMBO J. S:5-13

Ronunens, C. M. T., M. J. van Haaren, A. S. Buchel, J. N. Mol, A. J. van Tunen, H. J. Nijkamp, J. Hille, 1992 Transactivation of Ds by Ac-transposase gene fusions in tobacco. Mol. Gen. Genet. 231:433-441

Rubin, E., and A. A. Levy, 1997 Abortive gap repair: underlying mechanism for Ds element formation. Mol. Cell Biol. 17:6294-302

Russell, S. H., J. L. Hoopes, J. T. Odell, 1992 Directed excision of a transgene from the plant genome. Mol. Geru Genet. 234:49-59

Saedler, H., and P. Never, 1985 Transposition in plants: a molecular model EMBO J. 4:585- 590

Salomon, S., and H. Puchta, 1998 Capture of genomic and T-DNA sequences during double- strand break repair in somatic plant cells. EMBO J. 17:6086-95 47

Schmidt, R., and L. Willmitzer, 1989 The maize autonomous element Activator {Ac) shows a minimal germinal excision frequency of 0.2%-0.5% in transgenic Arabidopsis thaliana plants. MoL Gen. Genet. 220:17-24

Schmidt-Rogge, T., B. Weber, T. Bomer, E. Brandenburg, O. Schieder, M. Meixner, 1994 Transposition and behavior of the maize transposable element Ac in transgenic haploid Daturra innoxia Mill. Plant Set. 99:63-74

Schmidt R, J. West, K. Love, Z. Lenehan, C. Lister, H. Thompson, D. Bouchez, C. Dean, 1995 Physical map and organization of Arabidopsis thaliana chromosome 4. Science 270:480-3

Schwartz, D., and E. Dennis, 1986 Transposase acitivity of the Ac controlling element in maize is regulated by its degree of methylation. Mol. Gen. Genet. 205:476-482

Schwartz, D., 1989a Pattern of Ac transposition in maize. Genetics 121:125-128

Schwartz, D., 1989b Gene-contrlled cytosine demethylation in the promoter region of the Ac transposable element in maize. Proc. Natl. Acad. Sci. USA 86:2798-2793

Scofield, S. R., K. Harrison, S. H. Nurrish, J. D. G. Jones, 1992 Promoter fusions to the Activator transposase gene cause distinct pattern of Dissociation excision in tobacco cotyledons. Plant Cell 4:573-582

Scott, L., D. LaFoe and C. Weil, 1996 Adjacent sequences influence DNA repair accompanying transposon excision in maize. Genetics 142:237-246

Shalev, G., and A. A. Levy, 1997 The maize transposable element Ac induces recombination between the donor site and an homologous ectopic sequence. Genetics 146:1143-51

Shapiro, J. A., 1969 Mutations caused by insertion of genetic material into the galactose operon of Escherichia coli. J. Mol. BioL 40:93-105

Shinohara, A., and T. Ogawa, 1995 Homologous recombination and the roles of double- strand breaks. Trends Biochem. Sci. 20:387-91

Simmons, M. J., J. D. Raymond, N. Johnson, T. Fahey, 1984 A comparison of mutation rates for specific loci and chromosome regions in dysgenic hybrid males of Drosophila melanoganster. Genetics 106: 85-94

Smith DL, N. V. Fedoroff, 1995 LRPl, a gene expressed in lateral and adventitious root primordia of Arabidopsis. Plant Cell 7:735-45

Somerville, C. R., and E. M. Meyerowitz, 1994 Introduction. In: Meyerowitz, E. M. and Somerville, C. R. (eds) Cold Spring Harbor: Cold Spring Habor Laboratory Press, pp.1-6 48

Sonti, R. v., A. F. Tissier, D. Wong, J. F. Viret, E. R. Signer, 1995 Activity of the yeast FLP recombinase in Arabidopsis. Plant Mol. BioL 28:1127-32

Stuurman, J., M. J. de Vroomen, H. J. Nijkamp, M. J. van Haaren, 1996 Single-site manipulation of tomato chromosomes in vitro and in vivo using Cre-lox site-specific recombination. Plant Mol. Biol. 32:901-13

Styles, E. D., and O. Ceska, 1977 The genetic control of flavonoid synthesis in maize. Can. J. Genet CytoL 19:289-302

Styles, E. D., and O. Ceska, 1989 Pericarp flavonoids in genetic strains of Zea mays. Maydica 34:227-237

Sundaresan, V., P. Springer, T. Volpe, S. Haward, J. D. Jones, C. Dean, H. Ma, R. Martienssen, 1995 Patterns of gene action in plant development revealed by enhancer trap and gene trap transposable elements. Genes Dev. 9:1797-1810

Sutton, W. D., W. L. Gerlach, D. Schwartz, W. J. Peacock, 1984 Molecular analysis of Ds controlling element mutations at the Adhl locus of maize. Science 223:1265-1268

Sved, J. A., W. B. Eggleston, and W. R. Engels, 1990 Germline and somatic recombination induced by in vitro modified P elements in Drosophila melanogaster. Genetics 124:331-337

Swinburne, J., L. Balcells, S. J. Scofield, J. D. G. Jones, G. Coupland, 1992 Elevated levels of Activator transposase mRNA are associated with high frequency of Dissociation excision in Arabidopsis. Plant Cell 4:583-595

Swoboda, P., S. Gal, B. Hohn, H. Puchta, 1994 Intrachromosomal homologous recombination in whole plants. EMBO J. 13:484-9

Szostak, J. W., T. L. Orr-Weaver, R. J. Rothstein and F. W. Stahl, 1983 The double-strand break repair model of recombination. Cell 33:25-35

Takano, M., H. Egawa, J. E. Dceda, K. Wakasa, 1997 The structures of integration sites in transgenic rice. Plant J. 11:353-61

Takken, F. L., D. Schipper, H. J. Nijkamp, J. Hille. 1998 Identification and Ds-tagged isolation of a new gene at the Cf-4 locus of tomato involved in disease resistance to Cladosporium fulvum race 5. Plant J. 14:401-11

Tanksley, S. D., M. W. Ganal, J. P. Prince, M. C. de Vicente, M. W. Bonierbale, P. Broun, T. M. Fulton, J. J. Giovannoni, S. Grandillo, G. B. Martin, R. Messequer, J. C. Miller, L. Miller, A. H. Paterson, O. Pineda, M. S. Roder, R. A. Wing, W. Wu, and N. D. Young, 1992 High density molecular linkage maps of the tomato and potato genomes. Genetics 132:1141-60 49

Tinland, B., 1996 The integration of T-DNA into plant genomes. Trends Plant Sci. 1:178- 184

Hmmermans, M. C. P., O. Prem Das, and J. Messing, 1996 Characterization of a meiotic crossover in maize klentified by a restriction fragment length polymorphism-based method. Genetics 143:1771-1783

Timmermans, M. C. P., O. Prera Das, J. M. Bradeen,and J. Messing, 1997 Region-specific cis- and trans-hexing factors contribute to genetic variability in meiotic recombination in maize. Genetics 146:1101-1113 Tovar, J., and C Uchtenstein, 1992 Somatic and meiotic chromosomal recombination between inverted duplications in transgenic tobacco plants. Plant Cell 4:319-322

Tower, J. G. H. Karpen, N. Craig, A. C. Spradling, 1993 Preferential transposition in Drosophila P elements to nearby chromosomal sites. Genetics 133: 347-359

Tower, J., and R. Kurapati, 1994 Preferential transposition of a Drosophila P element to the corresponding region of the homologous chromosome. MoL Gen. Genet. 244:484-490

Van Sluys, M. A., J. Tempe, N. Fedoroff, 1987 Studies on the introduction and mobility of the maize Activator element in Arabidopsis thaliana and Daucus carota. EMBO J. 6:3881-9

Varagona, M., and S. R. Wessler, 1990 Implications for the cw-requirements for Ds transposition based on the sequence of the wxB4 Ds element. Mol. Gen. Genet. 220:414-418

Vergunst, A. C., and P. J. Hooykaas, 1998 Cre/lox-mediated site-specific integration of Agrobacterium T-DNA in Arabidopsis thaliana by transient expression of ere. Plant Mol. BioL 38:393-406

Voytas, D. F., and J. D. Boeke, 1992 Yeast retrotransposon revealed. Nature 358:717

Wang, L., M. Heinlein, R. Kunze, 1996 Methylation pattern of Activator transposase binding sites in maize endosperm. Plant Cell 8:747-758

Wang, L., R. Kunze, 1998 Transpsase binding site mehtylation in the epigeniticaUy inacivated Ac derivative Ds-cy. Plant J. 13:577-582

Weaver, D. T., 1995 What to do at an end: DNA double-strand-break repair. Trends Genet. 11:388-392

Weil, C. F., S. R. Wessler, 1992 Molecular evidence that chromosome breakage by Ds element is caused by aberrant transposition. Plant Cell 5:512-522

Wessler, S. R., and M. J. Varagona, 1985 Molecular basis of mutations at the waxy locus of maize: Correlation with fine structure genetic map. Proc. Natl. Acad Sci. USA 82:4177-4181 50

Wessler, S. R-, A. Tarpley, M. Purugganan, M. Spell, R. Okagaki, 1990 Filler DNA is associated with spontaneous deletions in maize. Proc. NatL Acad. ScL USA 87:8731-8735

Wessler, S. R., E. Thomas and S. E. White, 1995 LTR-retrotransposons and MTTEs: important players in the evolution of plant genomes. Curr. Opin, Genet Dev. 5:814-821

Williams, J. A. and J. B. Bell, 1988 Molecular organization of the vestigial region in Drosophila melanoganster. EMBO J. 7:1355-1363

Wirtz, U., B. Osborne, B. Baker, 1997 Ds excision from extrachromosomal geminivirus vector DNA is coupled to vector DNA replication in maize. Plant J. 11:125-35

Wu, D., D. A. Wright, C. Wetzela, D. F. Voytasb, and S. Rodermel, 1999 The IMMUTANS variegation locus of Arabidopsis defines a mitochondrial alternative oxidase homolog that functions during early chloroplast biogenesis. Plant Cell 11:43-56

Xiong, Y., and J. D. Boeke, 1990 Origin and evolution of retroelements based upon their reverse transcriptase sequences. EMBO J. 9:3353-3362

Xu, X., A. P. Hsia, L. Zhang, B. J. Nikolau, P. S. Schnable, 1995 Meiotic recombination break points resolve at high rates at the 5' end of a maize coding sequence. Plant Cell 7:2151-61

Yang, C-H., J. G. Ellis, R. W. Michelmore, 1993 Infrequent transposition of Ac in lettuce, Lactuca sativa. Plant Mol. Biol. 22:793-805

Yarmolinsky, M. B. and N. Sternberg, 1988 Bacteriophage PI. In: Calendar R (ed) The Bacteriophages, VoL 1 pp291-438. Plenum Publishing Corporation, New York.

Yoder, J. I., J. Palys, K. Alpert, M. Lassner, 1988 Ac transposition in transgenic tomato plants. MoL Gen. Genet. 213:291-296

Zhou, J-H., and A. Atherly, 1990 In situ detection of transposition of the maize controlling element (Ac) in transgenic soybean tissues. Plant Cell Rep. 8:542-545

Zou, S., Wright, D. A, and D. F. Voytas, 1995 The Saccharomyces Ty5 retrotransposon family is associated with origins of DNA replication at the telomeres and the silent mating locus HMR. Proc. Natl. Acad. Sci. USA 92:920-924

Zou, S., N. Ke, J. Kim, and D. F. Voytas, 1996 The Saccharomyces retrotransposon Ty5 integrates preferentially into regions of silent chromatin at the telomees and mating locL Genes Dev. 10: 634-645 51

CHAPTER 2. Ac INSERTION SITE AFFECTS THE

FREQUENCY OF TRANSPOSON-INDUCED HOMOLOGOUS

RECOMBINATION AT THE MAIZE F LOCUS

A paper to be submitted to Genetics

Yongli Xiao', Xianggan Li"*, Thomas Peterson**

Abstract

The maize P gene regulates the production of a red pigment in the pericarp, cob and other maize floral tissues. We reported previously that transposable element (Ac) insertions can induce homologous recombination between two 5.2 kb direct repeat sequences that flank the P gene coding region. Here we further study the effects of the Ac insertion site on the induction of recombination at the P locus. A collection of unique P gene alleles was used which carry Ac insertions at different sites in and near the P locus: outside of the direct repeats, within the direct repeat sequences, and between the direct repeats, in both orientations. Recombination frequency was estimated by the frequency of colorless sectors arising via homologous recombination at the P locus. The frequency of colorless sectors is significantly higher when the Ac insertion is between the direct repeats than when the Ac

* Interdepartmental Genetics Program, Department of Zoology and Genetics, Iowa State

University.

''Biotechnology and Genomic Center, Novartis Crop Protection, Inc.

"^Department of Agronomy, Iowa State University. 52 insertions are within the repeat sequences or outskle the repeats. The size of the colorless sectors of the two groups is also different. Rrom an allele with Ac inserted outside the direct repeat, 5 null alleles were obtained, but none were due to recombination at the P locus. From an allele with Ac inserted within the repeat sequences, 7 null alleles were obtained, but only one was due to homologous recombination between the flanking direct repeat sequences. In contrast, from 4 alleles with Ac inserted between the two direct repeats, we recovered a total of 84 null alleles, and 60 (72%) of these were due to the recombination frequency. In contrast, Ac orientation may not have a significant effect on homologous recombination at P locus. These results show that the position, but not the orientation, of Ac can significantly affect the frequency of homologous recombination at the maize P locus.

Introduction

It has been widely reported that transposable elements can induce genome rearrangements, such as deletions, duplications and inversions in eukaryotes and prokaryotes

(reviewed in Saedler and Gierl, 1996). In £1 coli, Tn7 transposition can create a hotspot for homologous recombination at the transposon donor site (Hagemann and Craig 1993). IS70 intermolecular transposition greatly stimulates and is coupled to homologous recombination between the donor and acceptor molecules at the transposition site (Eichenbaum and Livneh

1995). In Saccharomyces cerevisiae, homologous recombination between Ty elements produces deletions, inversions and translocations (reviewed in Boeke 1989). In Drosophila, the P element can significantly increase the recombination frequencies in male germline

(Hiraizumi 1971; Kidwell and Kidwell 1976) and somatic cells (Sved etal. 1990). P element transposition can also promote efficient gene conversion, which enables site-specific gene replacement and causes different chromosome rearrangements (Engels et al. 1990; Gloor et

oL 1991; Svoboda et al. 1995; Lankenau et aL 1996; E>reston and Engels 1996; Preston et al.

1996). In plants, one example of transposon-induced rearrangement has been associated with

insertion of a transposable element (Ac) at the maize P locus (Athma and Peterson, 1991).

The maize P locus is located on the short arm of chromosome 1 and is involved in the synthesis of a red flavonoid pigment in the pericarp, cob and other floral tissues (Styles and

Ceska 1977,1989). The P gene encodes a Myb-homologous transcriptional regulator of

flavonoid pigmentation in floral organs (Grotewold et al. 1994). The maize P locus was cloned by Ac tagging (Lechelt et aL 1989). The P locus has a unique structure, in which its coding region is flanked by two 5.2-kb direct repeats. These repeats serve as a good substrate

to study intrachromosomal recombination in plants, because recombination can be easily scored as a loss of P gene function as evidenced by colorless sectors on maize ears (Athma and Peterson, 1991). In a previous study, it was shown that the maize transposable element

Ac could induce homologous recombination between the direct repeats at the maize P locus and thereby cause large (ITkb) deletions including the P gene coding region (Athma and

Peterson, 1991).

Similarly, transposable element Mul can increase recombination rate about 100-2000 fold at the Knl-0 tandem duplication locus in maize (Lowe et aL 1992). In the absence of a transposon insertion, the homologous recombination rates arc very low in both cases. Recent studies of the Knl-0 locus further indicate that double strand breaks (DSBs) induced by Mu element excision stimulate meiotic recombination and gene conversion frequencies (Mathem and Hake 1997). In transgenic tobacco, the Ac element was reported to be able to induce somatic recombination between homologous ectopic sequences (Shalev and Levy 1997). In 54 transgenic Arabidopsis, we found that an active transposon can enhance intramolecular homologous recombination more than 1000 foM over the spontaneous recombination frequency (Xiao and Peterson submitted to Nature Genetics). Taken together, these results show that active transposable elements can induce homologous recombination in different organisms. The leading explanation of this effect is that the transient DNA double-strand breaks (DSBs) generated by excision of the transposable elements initiate homologous recombination (Szostak et oL 1983).

In contrast, some research showed that Ac or Ds insertions either reduce (McClintock

1953) or have no effect (Fradkin and Brink 1956) on crossing over in the region flanking the element. At the maize bzl locus, the insertion of a Ds element reduced the intragenic recombination frequency about 4 fold (Dooner et oL 1986). Also, an Ac insertion in wx

(Nelson 1976) and a Mul insertion in bz (Dooner and Ralston 1990) did not stimulate the intragenic meiotic recombination. In a study of meiotic recombination at the maize al locus, insertion of a Mul element reduced recombination rates in a nearby 377 bp interval by about

50% (Xu et aL 1995). Recently, Dooner and Martinez-Ferez reported that Ac did not stimulate meiotic recombination or homology-dependent repair at the bz locus. However, they found that Ac insertion could destabilize a tandem duplication in the maize bz locus

(Dooner and Martinez-Fere 1997). In addition, indirect evidence in plants suggest that a DSB is repaired by illegitimate recombination (Morton and Hoojdcaas 1995). Gene replacement experiments have also shown that illegitimate recombination occurs at a frequency of IC^ to

10^ times higher than homologous recombination in plants (Miao and Lam 1995; Morton and

Hooykaas 1995). Likewise, after transposon excision, the double-strand break at donor sites 55 usually is repaired by a non-homologous end-joining process (illegitimate recombination) and creates transposon footprints (Coen et al. 1989; Scott et al. 1996; Rinehart et oL 1997).

In this paper, we further analyzed Ac induced homologous recombination at the maize

P locus. We demonstrate that the Ac insertion site can strongly ai^ect recombination frequency. When Ac is inserted between the two 5.2 kb direct repeats, it promotes homologous recombination at significandy higher levels compared with Ac insertions outside the repeats, or within the repeat units. In contrast, the orientation of Ac insertion may not affect the recombination frequency. These results support the view that transposons can enhance the frequency of premeiotic homologous recombination in maize.

Materials and Methods

Terminology, maize stocics and analysis of mutants

The maize P gene encodes a transcription factor that regulates phlobaphene pigmentation of the pericarp, cob and other floral organs (Styles and Ceska, 1972, 1989;

Grotewold et al. 1994). The pericarp is the outer layer of the kernel; it is derived from the ovary wall, and hence is of maternal origin. P alleles are conventionally identified by a suffix that indicates their expression in pericarp and cob. P-rr specifies red pericarp and red cob, P- wr specifies white (colorless) pericarp and red cob, P-ww specifies white (colorless) pericarp and cob.

Six P alleles with Ac insertions at different sites in or near P locus were used (Figure

1). They 2iitP-rr-l1:666; P -9D47B; P-ovov-Val; P-9D36A; P-ovov-1114; P-ovov-12:l-l.

P-ovov-Val (Valentine, 1957), P-rr-11:666, P-ovov-1114 (Peterson, 1990) P-ovov-12:l-l were derived from P-w (Emerson, 1917). P-9D36A and P-9D47B were derived from P-ovov- 56

1114. The position of Ac insertion is shown in Hgure 2. Genetic crosses and mutant screening were performed as described previously (Athma and Peterson 1991).

Frequency of colorless sectors

The colorless sector frequency was calculated as the percentage of kernels with sectors regardless of the size of the sector. The sector size reflects the developmental stage at which a loss of function mutation occurs. Mutations occurring at an early stage of ear development give large colorless sectors, whereas mutations occurring at later stages give small colorless sector. The numbers of the kernels per ear was estimated as the row number per ear times the mean number of kernels per row. The average colorless sector frequencies were obtained by counting the numbers of kernels with colorless sectors divided by the total kernel number on 32 randomly picked ears for each allele.

DNA isolation, Soutiiem blot and PCR

Genomic leaf DNA was isolated from seedling leaves of individual plants as previously described (Cocciolone and Cone 1993). Genomic DNA (2 jig) was digested with restriction enzymes, electrophoresed through 0.75% agarose gels, and transferred to nylon membranes (Micron Separations Inc.). Probe labeling and Southern hybridizations were performed according to manufacturer's instructions (Oligolabelling Kit from Pharmacia

Biotech.) and standard protocols (Sambrook et oL 1989). Genomic DNA samples were amplified by PCR for 35 cycles as follows: denaturation at 94®C for 30 sec; annealing at

59°C for 30 sec; elongation for 1 rain at 72®C. PCR products were cloned into pTTBlue T- vector (Novagen) and sequenced at the ISU DNA Sequencing and Synthesis Facility. 57

Results

Ac insertion site of dilETerent P alleles

The approximate site of the Ac insertions in each allele was determined by genomic

Southern hybridization. Maize genomic DNA from each allele was digested with SaH. or

EcoBl and hybridized with P locus probe fragments 15 and 8B, respectively (Figure 2).

Together, these probes detect a 26 kb contiguous region of the P locus area. The exact Ac insertion sites were then determined by PCR amplification, using primers in the Ac sequence and a second primer homologous to P gene sequences. PCR products were sequenced to determine the precise insertion sites and orientations (Table 1). The P-rr-11:666 allele has Ac inserted outside the 5' end direct repeat of P locus at position 6757 bp upstream of the P gene transcription start site. The P-9D47B allele has Ac inserted within the 5' end of the 5.2 kb of

P-rr direct repeat at position 5024 bp upstream of the P gene transcription start site. The alleles P-avov-Val, P-9D36A, P-ovov-1114 and P-ovov-12:l-l contain Ac insertions at 4 sites between the two direct repeats of the P-rr gene. P-ovov-Val has Ac inserted at 49 bp upstream of the transcription start site. P-9D36A has Ac inserted in intron 1,473 bp downstream of transcription start site; P-ovov-1114 and P-ovov-12:l-l alleles both have Ac inserted in the intron 2, at positions 4331 and 441 Ibp, respectively, downstream of the transcription start site (Athma et al.1992). All six of these alleles allow substantial P gene function and specify red to orange pericarp pigmentation (Figure 1), hence colorless sectors are easily detected and quantised. 58

Comparison of coloriess sector frequent^ of different p alleles

Any somatic mutation that abolishes the expression of the P gene results in a colorless sector in the pericarp. Because Ac frequently transposes to linked sites (Greenblatt

1984; Dowe et oL 1990; Peterson 1990; Grotewold et al. 1991; Athma et al. 1992; Weil et al.

1992; Chen et aL 1992), some sectors may result from intragenic transpositions to other sites essential for P function. In a previous study, it was found that most colorless sectors arising from the P-ovov-1114 allele (49 out of 52 analyzed) were due to recombination between the long 5.2 kb direct repeats flanking the P-rr gene and the deletion of P gene coding sequence

(Athma and Peterson 1991). Thus, the colorless sector frequency of each allele provides an estimate of homologous recombination frequency. The frequency of colorless sectors observed for each allele is presented in Table 1.

In the absence of Ac at the P locus (JP-rr-4026) the colorless sector frequency is

0.00031 (Athma and Peterson 1991). In contrast, the colorless sector frequencies observed here with Ac insertions in and around the P locus range from 0.0164 to 0.0482. These results fiuther support the conclusion that Ac can induce homologous recombination at the maize P locus.

Significant differences in the colorless sector frequencies between alleles were analyzed by a T-test (Table 2). The T-test results indicate that the differences in colorless sector frequencies in P-ovov-Val, P-ovov-1114 and P-ovov-12:l-l alleles are not significant.

The colorless sector frequency of allele P-9D36A (-1.7%) is the second lowest frequency among all alleles. It shows significant differences with P-rr-11:666, P-ovov-Val, P-ovov-

1114 and P-ovov-12:l-l alleles, but not the P-9D47B allele. The colorless sector frequency of allele P-rr-11:^6 is significantly different from all other alleles except P-ovov-Val. 59

Additionally, colorless sector frequency of P-9D47B falls in the same statistical group as the

P-9D36A allele. Apparently, the relations of the six alleles are very complicated based on their frequencies of the colorless sector. However, if the alleles are grouped based on their insertion location, average colorless sector frequency is higher for Ac elements inserted between the two direct repeats (group I, ~3.5%) than for Ac elements inserted outside and within the repeats (group n, -2.0%). A T-test analysis shows that the frequencies of colorless sectors of the two groups are significantly different (P value = 2.48x10"^). Therefore, we concluded that Ac insertions between the two direct repeats induced a higher frequency of homologous recombination than insertions outside or within the repeats.

In this analysis, we also considered the size of the colorless sector, because the area available for mutation is slightly altered by the fact that once an area has mutated it is no longer available for mutation (Anderson and Eyster, 1928). Therefore, we compared the sizes of colorless sectors of different alleles (Table 3). We found that the larger sectors (> 1 kernel) were observed only in P-9D36A, P-ovov-Val., P-ovov-1114, and P-ovov-12:l-l alleles. These alleles all have Ac insertions between the two direct repeats, and they all give higher frequencies of colorless sectors. Thus, the potential complication of sector size actually did not affect the conclusion that the group I alleles with Ac inserted between the two direct repeats produces more colorless sectors than group II alleles with Ac inserted outside or within the direct repeat.

Comparison of homologous recombination firequeni^ of different alleles

After we recovered the P-ww homozygous alleles from different original P alleles, we did Southern hybridizations (data not shown) to screen the mutants to distinguish those 60 generated by homologous recombination from those produced by other mechanisms. These

results allowed us to compare the germinal homologous recombination frequencies of different alleles (Table 4). From P-rr-ll:666^ 5 P-ww/P-ww mutants were recovered, but

none were derived from homologous recombination. From the P-9D47B allele, 7 P-ww/P-ww

mutants were obtained, and only one resulted from recombination. In contrast, from the four alleles {P-ovov-Val, P-9D36A, P-ovov-1114, P-ovov-12:l-I) with Ac insertions between the two 5.2 kb direct repeats, 84 heritable P-ww mutants were obtained, 59 of which were deletions generated by recombination of the flanking repeats. The other 25 P-ww mutants were generated by other transposition-related rearrangements (data not shown). These results further supported the conclusion that the group I alleles give a significantly higher frequency of homologous recombination than the group n alleles.

Ac orientation effect

As shown in Table 1, the orientation of Ac insertions in P-9D47B and P-ovov-Val are the same as that of the P-w reference allele, in which the direction of transcription of the Ac element is the same as that of the P gene. The four other alleles studied here all have Ac insertions in the P-ovov orientation, in which the transcription direction of the Ac element is opposite to that of the P gene. From the colorless sector frequency results in Table 1 and the

T-test results in Table 2, there are no significant differences in recombination frequency between P-ovov-Val and P-ovov-1114, nor between P-ovov-Val and P-ovov-12:l-l.

However, there are significant differences between P-ovov-Val and P-9D36A, and between

P-rr-11:666 and P-9D47B. Similarly, if we group alleles based on their Ac orientations, average colorless sector frequency is about 2.9% of the alleles with Ac insertion in W 61 orientation (group W), and average colorless sector frequency of the alleles with Ac insertion in OVOV orientation (group OVOV) is about 3.0%. There is no significant difference in the colorless sector frequencies between group W and group OVOV (P value =

0.877). Additionally, the comparison of germinal homologous recombination frequencies given in Table 4 indicates that Ac insertion orientation had no significant effect. Therefore, the primary cause of the differences in recombination frequency is the position of Ac, whereas orientation of Ac has little or no effect.

Discussion

Mechanism of transposon-induced homologous recoinbination

In yeast, a DNA double-strand break (DSB) can initiate and stimulate meiotic recombination (Szostak etal. 1983; Sun etal. 1991; Stahl 1996). Many studies in yeast indicate that double-strand breaks provide efRcient substrates for mitotic recombination

(Haynes and Kunz 1981; Orr-Weaver etal. 1981; Strathem etal. 1982; Kostriken etal. 1983;

Orr-Weaver and Strathem 1983; Kostriken and Heffi-on 1984; Fekret et aL 1996). In

Drosophila, the P element can undergo precise excision in a homology-dependent process requiring P transposase (Engels et aL 1990). In C. elegans, the frequency of precise reversion

(without a footprint) after Tel element excision is much higher when heterozygous with a wild-type homologous chromosome (Plasterk 1991). Both of these cases suggest that the double-strand DNA breaks generated by transposon excision can be repaired using the homologous locus as template. In plants, the frequency of intrachromosomal homologous recombination can be enhanced by physical and chemical agents. Somatic crossover between homologous chromosomes was induced by DNA-damaging agents such as gamma-radiation 62

(Carlson 1974). Low doses of X-ray, gamma-ray and UV can increase intrachromosomal homologous recombination frequency in plants with artificial substrates (Tovar and

Lichtenstein 1992; Lebel et oL 1993; Puchta et oL 1995). Also, treatment with chemical agents that induce DSBs, such as methylmethanesulfonate (MMS) and mitomycin C, can enhance recombination rates (Puchta et al. 1995). Moreover, homologous recombination in plants is enhanced by in vivo induction of DNA double-strand breaks by a site-specific endonuclease (Puchta et al. 1993). In Arabidopsis, a DSB generated by HO endonuclease can enhance the frequency of somatic intrachromosomal homologous recombination about 10 fold (Chiurazzi et al. 1996).

The mechanism of Ac/Ds transposition is unknown, but it has been proposed to occur via a "cut and paste" mechanism (Greenblatt and Brink 1962; Chen et oL 1992). Thus, transposition of Ac/Ds element will potentially cause a transient DNA double-strand break upon excision. Because the common characteristic of the aforementioned factors that can promote homologous recombination is the DNA double-strand break, it is reasonable to postulate that double-strand breaks in DNA generated by transposon excision may play an important role in transposon-induced homologous recombination.

In plants, genomic DSBs can be repaired via two related pathways involving homologous recombination (Puchta et aL 1996; Puchta 1998a). One pathway, termed single strand annealing (SSA) (Lin et al. 1984), utilizes homologous sequences on both sides of the

DSB in a reaction similar to that proposed for the double strand break repair (DSBR) model

(Szostak et al. 1983). This pathway is thought to be the major pathway causing deletion of the internal sequence between direct repeats in yeast (Osman et al. 1996). The second pathway, termed the one-sided invasion (OSI) model, is postulated to involve homologous 63

recombination restricted to one side of the DSB (Belmaaza and Chartrand 1994). The one­

sided invasion (OSI) model appears to be the major pathway in plant somatic recombination

(Puchta 1998a). The transposon-induced homologous recombination at the maize P gene may

involve either SSA or OSI models, although our data cannot distinguish between them at this

time (Figure 2).

In addition to the importance of a DSB, transposon-induced recombination may involve the recruitment of host-factors by transposase. Our data from transgenic Arabidopsis shows that transposons can greatly increased intrachromosomal homologous recombination

(>1000 fold higher than control) by an active transposon (Xiao and Peterson submitted to

Nature Genetics). This frequency is 10 to 100 times higher than that observed for direct induction of a DSB (Chiurazzi et al. 1996). One possible explanation for this high level of enhancement is that ±e Ac transposase can recruit host factors that participate in the recombination process. Some lines of evidence indicate the host plant factors are involved in transposition. First, host proteins that bind subterminal regions of Ac elements were found in both tobacco and maize (Becker and Kunze 1996; Levy et al. 1996). Second, a recessive mutation found in Arabidopsis can increase the frequency of Ac transposition. Both of these cases support the idea that host factors may participate in the transposition reaction (Jarvis et al. 1997). Possibly, the Ac transposition process may recruit host factors that promote recombination.

An alternative explanation for transposon-induced recombination is that the intrachromosomal homologous recombination is affected by the transposition process.

Although the Ac transposition mechanism is not yet known, some evidence indicates that the transposase can bind the subterminal regions of Ac and promote the association of the 64

transposon ends (Coupland et aL 1988; Kunze and Starlinger 1989), as a prelude to

transposition (ftey et aL 1990; Gorbunova and Levy 1997b; reviewed in Saedler and Gierl

1996). Accordingly, this association of transposon ends may induce a topological change in

the neighboring chromatin. Such a topological change, in association with the generation of a

DSB, could enhance the association of the two direct repeats and lead to their recombination.

If the transposon is inserted within or outside of the repeats, the association of the homologous sequences may be less efficient. Further experiments will be required to elucidate the relative roles of DSBs, host factors and chromatin structure in transposon- induced recombination.

Ac insertion site affects recombination frequency

The results presented here demonstrate that the Ac insertion site can affect the frequency of intrachromosomal homologous recombination at maize P locus. In yeast, a system with two direct repeats separated by an internal sequence was used to study mitotic intrachromosomal recombination. When the DSB was induced in the internal region, the recombination frequency was >10 times higher than when the DSB was outside the repeats.

In both cases, >90% of the recombinants were of the deletion type, in which the internal sequence was deleted but one direct repeat was retained. Thus, the DSB located in the unique region flanked by direct repeats is repaired very efficiently via induced deletion (Prado and

Aguilera 1995). This recombination product is similar to what we observed at the maize P locus. Similar results were obtained in the yeast S. pombe: 99.8% recombinants were of the deletion type when the DSB was generated between the direct repeats. If the DSBs were generated within one repeat, the deletions were reduced to 77%. This type of deletion was 65 thought to be generated by the SSA pathway (Osman et aL 1996). The occurrence of a DSB within or outside of the repeat may lessen the chance for the 3' single stranded DNA generated by 5' to 3' exonucleolytic digestion of the DSB site to find its homologous sequence. Thus, repair of DBSs at these sites may occur predominantly via other mechanism, such as illegitimate recombination, which is the predominant mode of DSB repair in higher eukaryotes (review see Roth and Wilson 1988; Sergent et aL 1997; Gorbunova and Levy

1997a). In contrast, homologous recombination is predominant in yeast and lower prokaryotes (Leach 1996). In the maize P locus, because our screening method is based on loss function of P gene, we would not have detected other types of recombinants that retained

P gene function.

Frequency of colorless sectors in P-9D36A allele

Although the Ac insertion position in P-9D36A allele is between the two direct repeats, its colorless sector frequency is second lowest among all alleles. Neverthless, the germinal recombination frequency of this allele is similar to that of other alleles with Ac inserted between the repeats. The P-9D36A allele is also similar to the other alleles with Ac inserted between the repeats with regard to sector size, because large sectors (> 1 kernel) were found only in the group I alleles. As we mentioned above, any mutations that abolish the expression of P gene can cause pericarp colorless sectors. The lower colorless sector frequency of P-9D36A indicates a lower somatic mutation rate in this allele. This could result from a difference in the activity of the Ac transposon in this position. It has been demonstrated that Ac element activity can vary depending on Ac copy number and location

(McClintock 1964; Heilein 1995; review see Fedoroff and Chandler 1994). In our genetic 66 crosses, all these alleles were crossed to a rm-3 Ds testa:. If there is more than one copy of

Ac in P-9D36A genome, it should have been s^parent from the pattern of purple spots in the alenrone generated by Ds excision (Kermicle 1980; Schwartz 1984). A number of studies have shown that there is an inverse correlation between Ac activity and its extent of methylation (Schwartz and Dermis 1986; Chomet et oL 1987; Schwartz 1989; Brutnel and

Dellaporta 1994). The upstream Sail site adjacent to the transcription start site of the P-rr gene is methylated (Athma and Peterson 1991). However, the P-ovov-Val allele with Ac inserted just 49 bp upstream of the P gene transcription start site shows a high frequency of colorless sectors. Moreover, the intron 1 region has been shown to be hypomethylated (Prem

Das and Messing 1994; Chopra et oL 1998). Therefore, the low frequency of colorless sectors in P-9D36A alleles cannot be attributed to proximity to a hypermethylated region of the P locus. It has been reported that a dominant mutation in a trans-acting product can suppress the germinal reversion frequency at the maize waxy gene with a Ds insertion (Eisses et al. 1997). However, the basis for the anomalous somatic sector frequency of P-9D36A remains to be determined.

References

Anderson, E. D., and W. H. Eyster, 1928 Pericarp studies in maize. HI. The frequency of mutation in variegated maize pericarp. Genetics 13:111-120

Athma, P and T. Peterson, 1991 Ac induces homologous recombination at the maize P locus. Genetics 128, 163-173

Athma, P., E. Grotewold, T. Peterson, 1992 Insertional mutagenesis of the maize P gene by intragenic transposition of Ac. Genetics 131:199-209

Becker, H-A., and R. Kunze, 1996 Binding sites for maize nuclear proteins in the subterminal regions of the transposable element Acirvoior. MoL Gen. Genet 251:428-35 67

Belmaaza, A., P. Chartrand, 1994 One-sided invasion events in homologous recombination at doable-strand breaks. Mutat Res. 314:199-208

Boeke, R. A., 1989 Transposable elements in Saccharomyces cerevisiae, pp. 335-374 in Mobile DMA, edited by D. E. Breg and M. M. Howe. American Sockty for Microbiology, Washington, D.C.

Brutnel, T. P., and S. L. Dellaporta, 1994 Somatic inactivation and reactivation of Ac associated with changes in cytosine methylation and transposase expression. Genetics 138:213-225

Carlson, P. S., 1974, Mitotic crossing-over in a higher plant. Genet. Res. Comb. 24:109-112

Chen, J., I. M. Greenblatt and S. L. Dellaporta, 1992 Molecular analysis of Ac transposition and DNA replication. Genetics 130: 665-676

Chiurazzi, M., A Ray, J-F. Viret, R. Perera, X-H. Wang, A M. Lioyd, E. S. Signer, 1996 Enhancement of somatic intrachromosomal homologous recombination in Arabidopsis by the HO endonuclease. Plant Cell 8,2057-2066

Chomet, P.S., S. Wessler, S. L. Dellaporta, 1987 Inactivation of the maivet transposable element Activator (Ac) is associated with its DNA modification. EMBO J. 6:295-302

Chopra, S., P. Athma, X-G. Li, T. Peterson, 1998 A maize Myb homolog is encoded by a multicopy gene complex. Mol. Gen. Genet. 260:372-380

Cocciolone, S. M., and K. Cone, 1993 Pl-Bh, an anthocyanin regulatory gene of maize that leads to variegated pigmentation. Genetics 135:575-588

Coen, E. S., T. P. Robbins, J. Almeida, A Hudson and R. Carpenter, 1989 Consequences and mechanisms of transposition m Antirrhinum majus. In: Berg, D.E., Howe, M. M.(eds) Mobile DNA. American Society for Microbiology, Washington DC, pp. 413-436 in Mobile DNA,

Coupland, G., B. Baker, J. Schell, P. Starlinger, 1988 Characterization of the maize transposable element Ac by internal deletion. EMBO J. 7:3653-3659 Dooner. H. K., and J. L. Kermicle, 1986 The transposable element Ds affects the pattern of intragenic recombination at the bzl and r loci in maize. Genetics 113:135-143

Das, P., and J. Messing, 1994 Variegated phenotype and development methylation changes of a maize allele originating from epimutation. Genetics 136: 1121-1141

Dooner, H. K., and E. J. Ralston, 1990 Effect of theMul insertion on intragenic recombination at the bzl locus in maize. Maydica 35:333-337 68

Dooner, H. K., and L M. Martinez-Ferez, 1997 Germinal excisions of the maize transposon Activator do not stimulate meiotic recombination or homology-dependent repair at the tocus. Genetics 147,1923-1932

Dowe, M. J. jr., G. W. Roman, A. S. Klein, 1990 Excision and transposition of two Ds transposons from the bronze mutable 4 derivative 6856 allele of Zea mays L. Mol. Gen. Genet. 221:475-485

Eichenbaum, Z and Z. Livneh, 1995 Intermolecular transposition of IS 10 causes coupled homologous recombination at the transposition site. Genetics 140: 861-874

Eisses J.F., D. Lafoe, L. A. Scott, C. F. Weil, 1997 Novel, developmentally specific control of Ds transposition in maize. MloL Gen. Genet 256:158-68

Emerson, R. A., 1917 Genetical studies of variegated pericarp in maize. Genetics 2:1-35

Engels, W. R., D. M. Johnson-Schlitz, W. B. Eggleston and J. Sved, 1990 High-frequency P element loss in Drosophila is homolog dependent. Cell 62:515-525

Fedoroff, N. V., and V. Chandler, 1994 Inactivation of maize transposable elements In: J. Paszkowski (eds) Homologous Recombination and Gene Silencing in Plants. Dordrecht: Kluwer Academic Publishers, pp. 349-385

Gloor, G. B., N. B. Nassif, D. M. Johnson-Schlitz, C. R. Preston and W. R. Engels, 1991 Targeted gene replacement in Drosophila via P element-induced gap repair. Science 253: 1110-1117

Gorbunova, V., and A. A. Levy, 1997a Non-homologous DNA end joining in plant cells is associated with deletions and filler DNA insertions. Nucleic Acids Res. 25:4650-7

Gorbunova, V., and A. A. Levy, 1997a Circularized Ac/Ds transposons: Formation, Structure and Fate. Genetics 145: 1161-1169

Greenblatt, 1. M. and R. A. Brink, 1962 Twin mutations in medium variegated pericarp maize. Genetics 47: 489-501

Greenblat, L M., 1984 A Chromosomal replication pattern deduced from pericarp phenotypes resulting from movements of the transposable element. Modulator, in maize. Genetics 108:471-485

Grotewold, E., P. Athma, T. Peterson, 1991 A possible hot spot fori4c insertion in the maize P gene. MoL Gen.Genet. 230:329-331 69

Grotewold, E., B. Drummond, B. Bowen and T. Peterson, 1994 The wQ^^homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene subset Cell 76: 543-553

Haynes, R. H., and B. A. Kunz, 1981 DNA repair and mutagenesis in yeast, pp. 371-414 in The molecular biology of the Yeast Saccharomyces: Life Cycle and Inheritance, edited by J. N. Strathem, E. W. Jones and J. R. Broach. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Hagemann, A. T. and N. L. Craig, 1993 Tn7 transposition creates a hotspot for homologous recombination at the transposon donor site. Genetics 133: 9-16

Heinlein, M., 1995 Variegation patterns caused by excision of the maize transposable element Dissociation (Ds) are autonomously regulated by allele-specific Activator (Ac) elements and are not due to trans-acting modifier genes. Mol Gen. Genet. 246:1-9

Hiraizumi, Y., 1971 Spontaneous recombination in Drosophila melanogaster males. Proc. Natl. Acad. Set USA 68: 268-270

Jarvis, P., F. Belzile, T. Page, C. Dean, 1997 Increased Ac excision (iae): Arabidopsis thaliana mutations affecting Ac transposition. Plant J. 11:907-19

Kermicle, J. L., 1980 Probing the component structure of a maize gene with transposable elements. Science 208:1457-1459

Kidwell, M. G., and J. F. Kidwell, 1976 Selection for male recombination in Drosophila melanogaster. Genetics 84:333-351

Kunze, R., and P. Starlinger, 1989 The putative transposase of transposable element Ac from Zea mays L. interacts with subterminal sequences of Ac. EMBO J. 8:3177-3185

Lankenau, D. H., V. G. Corces, W. R. Engels, 1996 Comparison of targeted gene replacement frequencies in Drosophila melanogaster at the forked and white loci Mol Cell. Biol. 16:3535-44

Leach, D. R. F. 1996 Genetic recombination. Blackwell Science Ltd. Carlton Victoria, Australia.

Lebel, E. G., L Masson, A. Bogucki, and J. Paszkowski, 1993 Stress-induced intrahomologous recombination in plant somatic cells. Proc. Natl. Acad. Sci. USA 90:422- 426

I^helt, C., T. Peterson, A. Laird, J. Chen, S. L. Dellaporta, E. Dennis, W. J. Peacock, and P. Starlinger, 1989 Isolation and molecular analysis of the maize P locus. MoL Gen. Genet. 219:225-234 70

Levy, A. A., M. ErMlender, U. H. Rubin, Y. Sitrit, 1996 Binding of Nicotiana nuclear proteins to the subterminal regions of the Ac transposable element. Mol. Gen. Genet. 251:436-41

Levy, A. & G. Shalev, 1997 The maize transposable element Ac induces recombination between the donor site and an homologous ectoptic sequence. Genetics 146,1143-1151

T in, H., K. Skerle and N. Sternberg, 1984 Model for homologous recombination during transfer of DNA into mouse L cells: role for DNA ends in the recombination process. Mol. Cell Biol. 4:1020-1034

Lowe, B., J. Marthem and S. Hake, 1992 Active Mutator elements suppress the knotted phenotype and increase recombination at the Knl-0 tandem duplication. Genetics 132,813- 822

Mathem, J., and S. Hake, 1997 Mu element-generated gene conversions in maize attenuate the dominant knotted phenotype. Genetics 147:305-14

McClintock, B., 1964 Aspects of gene regulation in maize. Carnegie Inst. Wash. Year Book 63:592-602

Miao, Z-H., and E. Lam, 1995 Targeted disruption of the TGA3 locus in Arabidopsis thaliana. Plant J. 7:359-365

Morton, R., and P. J. J. Hooykaas, 1995 Gene replacement. Mol. Breed. 1: 123-132

Orr-Weaver, T. L., J. W. Szostak and R. J. Rothsten, 1981 Yeast transformation: a model system for the study of recombination. Proc. Natl. Acad. Set USA 78: 6354-6358

Orr-Weaver, T. L., and J. W. Szostak, 1983 Yeast recombination: the association between double-stand gap repair and crossing over. Proc. Natl. Acad. Sci. USA 80: 4417-4421

Osman, F., E. A. Fortunato and S. Subramani, 1996 Double-strand break-induced intrachromosomal recombination in the fission yeast Schizosaccharomycesprombe. Genetics 142:341-357

Peterson, T., 1990 Intragenic transposition of Ac generates a new allele of the maize P gene. Genetics 126:469-476

Plasterk, R. H., 1991 The origin of footprints of the Tel transposon of Caenorhabditis elegans. EMBO J. 10: 1919-1925

Prado, F., and A. Aguilera, 1995 Role of reciprocal exchange, one-ended invasion crossover and single-strand annealing on inverted and direct repeat recombination in yeast: different requirements for the RADl, and RADIO, and RAD52 genes. Genetics 139: 109-123 71

Preston, C. R. and W. R., Engels, 1996 P-element-induced male recombination gene conversion in drowpw/a. Genetics 144: 1611-1622

Preston, C. R., J. A. Sved, and W. R. Engels, 1996 Flanking duplications and deletions associated with P-induced male recoxchmaiion 'xiiDrosophila. Genetics 144:1623-1638

Puchta, H., B. Dujon, B. Hohn, 1993 Homologous recombination in plant cells is enhanced by in vivo induction of double strand breaks into DNA by a site-specific endonuclease. Nucleic Acids Res. 21:5034-40

Puchta, H., P. Swoboda, S. Gal, M. Blot, B. Hohn, 1995 Somatic intrachromosomal homologous recombination events in populations of plant siblings. Plant Mol. BioL 28:281- 92

Rinehart, T., C. Dean and C. Weil, 1997 Comparative analysis of non-random DNA repair following Ac transposon excision in maize and Arabidopsis. Plant J. 12:1419-1427

Roth, D., and J. Wilson, 1988 Illegitimate recombination in mammalian cells. In: R. Kucherlapati and G. R. Smith (eds) Genetic Recombination. American Society for Microbiology, Washington, DC. pp. 621-653

Saedler, H., and A. Gierl, 1996 Transposable elements Springer-Verlag Berlin Heideberg New York.

Sambrook, J., E. F. Fritsch, T. Maniatis, Molecular Cloning : A Laboratory Manual (CoU Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 1989)

Schwartz, D., 1984 Analysis of the Ac transposable element dosage effect. Mol. Gen. Genet. 196:81-84

Schwartz, D., and E. Dennis, 1986 Transposase activity of the Ac controlling element in maize is regulated by its degree of methylation. Mol. Gen. Genet. 205:476-482

Schwartz, D., 1989 Gene-controlled cytosine demethylation in the promoter region of the Ac transposable element in maize. Proc. Natl. Acad Sci. USA 86:2798-2793

Scott, L., D. LaFoe and C. Weil, 1996 Adjacent sequences influence DNA repair accompanying transposon excision in maize. Genetics 142:237-246

Sergent, R. G., M. A. Brenneman, and J. H. Wilson, 1997 Repair of site-specific double- strand breaks in a mammalian chromosome by homologous and illegitimate recombination. Mol Cell BioL \T261-ni Shalev, G., and A. A. Levy, 1997 The maize transposable element Ac induces recombination between the donor site and an homologous ectopic sequence. Genetics 146:1143-51 72

Styles, E. D. and O. Ceska, 1972 Flavonoids pigments in genetic strains of maize. Pkytochenustry 11: 3019-3021

Styles, E. D., and O. Ceska, 1977 The genetic control of flavonoid synthesis in maize. Can. J. Genet CytoL 19:289-302

Styles, E. D. and O. Ceska, 1989 Pericarp flavonokl in genetic strains of Zea mays. Maydica 34: 227-237

Sved, J. A., W. B. Eggleston, and W. R. Engels, 1990 Germline and somatic recombination induced by in vitro modified P elements in Drosophila melanogaster. Genetics 124:331-337

Svoboda, Y., M. Robson and J. Sved, 1995 P element-induced male recombination can be produced in Drosophila melanogaster by combining end-deficient element in trans. Genetics 139: 1601-1610

Szostak, J. W., T. L. Orr-Weaver, R. J. Rothstein, and F. W. Stahl, 1983 The double-strand break repair model for recombination. Cell 33:25-35

Tovar, J., and C. Lichtenstein, 1992 Somatic and meiotic chromosomal recombination between inverted duplications in transgenic tobacco plants. PUmt Cell 4:319-322

Valentine, F. A., 1957 Orange variegated, a mutant originating from variegated pericarp in maize. Unpublished Ph.D. thesis. University of Wisconsin Library. Madison.

Weil, C. F., S. R- Wessler, 1992 Molecular evidence that chromosome breakage by Ds element is caused by aberrant transposition. Plant Cell 5:512-522

Xu, X., A-P. Hsia, L. Zhang, B. J. Nikolau, P. S. Schnable, 1995 Meiotic recombination break points resolve at high rates at the 5' end of a maize coding sequence. Plant Cell 7:2151-2156 73

Table 1. Ac insertion positions, orientations and the frequencies of colorless sectors in

different maize P gene alleles.

Alleles Ac position Ac orientation Number of Frequency of kernels'^ colorless sectors

P-rr-ll:666 Outside 5' 5.2 kb w" 21858 0.0234 repeats ±0.0098"

P-9D47B Within 5' 5.2 kb ovov'' 21635 0.0164 repeats ±0.0052

P-ovov-Val Between two w 22462 0.0353 5.2 kb repeats ±0.0231

P-9D36A Between two ovov 20572 0.0173 5.2 kb repeats ±0.0065

P-ovov-1114 Between two ovov 19837 0.0482 5.2 kb repeats ±0.0162

P-ovov-l2:l- Between two ovov 10010 0.0374 1 5.2 kb repeats ±0.0103 a: Ac in w orientation, transcription direction of the Ac element is the same as the P gene b: Ac in avov orientation, transcription direction of the Ac element is opposite to P gene c; number of kernels examined for sectors d; average deviation 74

Table 2. P-values from T-tests of the colorless sector frequency between different alleles.

Alleles P*-9D47B P-ovov-Val P*-9D36A P-ovov-1114 P-ovov-12:l-l

P-rr-ll:666 0.0023 0.1880 0.0157 0.0000 0.0000

P-9D47B 0.0000 0.5353 0.0000 0.0000

P-ovov-Val 0.0434 0.1759 0.8665

P-9D36A 0.0000 0.0000

P-ovov-1114 0.1092

Table 4. The frequencies of transposon-induced homologous recombination in different alleles.

Alleles Total numbers Total number Number of P-ww Recombination of independent of P-ww mutants from frequency'' events ' mutants recombination

P-rr-ll:666 60 5 0 0

P-9D47B 54 7 1 0.143

P-ovov-Val 73 23 19 0.828

P-9D36A 71 29 18 0.652

P-ovov-1114 83 23 16 0.739

P-ovov-12:l- 33 9 6 0.667 1 a: Number of kernels with colorless sectors from different P alleles tested b: Germinal recombination frequency = (the recombination mutant number)/(the total number of P-ww/P-ww mutant) Table 3. The sizes of the colorless sectors in different P alleles

Number of sectors of indicated size

Alleles 6 kernel kernel kernel kernel

P-rr- 444 25 43 0 0 0 0 0 0 11:666

P- 313 9 33 1 0 0 0 0 0 9D47B

P-ovov- 642 39 49 1 0 0 1 0 1 Val

P- 298 27 59 2 1 0 0 2 0 9D36A

P-ovov- 880 28 35 4 3 0 1 1 4 1114

P-ovov- 332 9 31 0 0 0 1 0 1 12:1-1 76

Figure Legends

Figure 1. Ear phenotypes of P alleles used in this study.

I: P-rr:ll:666; 2: P-9D47B;3: P-ovov-Val;4: P-9D36A; 5: P-ovov-1114;

6: P-ovov-I2:I-l

Figure 2. Upper, Ac insertion sites in different maize P gene alleles. Lower, schematic

Hii^gram showing Ac-induced homologous recombination.

5.2 kb direct repeats; —•: P gene transcription start site;\/: Ac insertion; •: Ac transcription direction; §; fragment 15: fragment 8B;H: exons; II and 12: intron 1 and intron 2; S: SaH site; S*; methylated Soli site; 1: P-rr:11:666', 2: P-9D47B; 3: P-ovov-Val; 4:

P-9D36A; 5: P-ovov-1114-, 6: P-ovov-12:l-l

Figure 3. Model for transposon-induced homologous recombination.

Red lines represent the inserted transposon; green lines, homologous direct repeats; thick black lines, sequences internal to the direct repeats; thin black lines, other genomic sequences, (a) Transposase binds to the terminal and subterminal region of transposon causing the topological change of surrounding chromatin and generating a DNA double- strand break, (b) Exonuclease degrades from 5' to 3' at the DSB site and generates 3' single- strand DNA. The transient DSB is repaired by one of two pathways. Single Strand Annealing

SSA (c-d) or One-sided Invasion OSI (e-h). (c) The 5' to 3' degradation reaches the homologous region and two 3' single strand homologous sequences pair with each other, (d)

Heterologous DNA is digested by exonuclease and gaps are ligated. (e-£) The 3' end invades 77 the homologous repeat copy. The heterologous DNA at the 3' end is removed by endonaclease. (g) D-loop is nicked at red arrow, and DNA synthesis follows to generate

Holiday junction, (h) Resolution of the junction generates the deletion. 78

Figure 1 Homologous recombination induced by Ac insertion

Figure 2 80

.3*

3* 5' i

i

1 i' 3sz i g

1

Figure 3 81

CHAPTER 3. INTRACHROMOSOMAL HOMOLOGOUS

RECOMBINATION IN ARABIDOPSIS INDUCED BY A

MAIZE TRANSPOSON

A paper reviewed by Nature Genetics

Yongli Xiao' and Thomas Peterson*^

Abstract

In plants, the frequency of spontaneous intrachromosomal homologous recombination is low. Here, we show that a maize transposable element greatly stimulates intrachromosoraal homologous recombination between direct repeat sequences in Arabidopsis. Plants were transformed with a construct (GU-Ds-US) containing a Ds {Dissociation) transposable element inserted between two partially deleted GUS reporter gene segments. Homologous recombination between the overlapping GUS fragments generates clonal sectors visible upon staining for GUS activity. Plants containing the GU-Ds-US construct and a source of Ac

(Activator) transposase had a >1,000 fold higher incidence of recombination than plants containing the same construct but lacking transposase. Transposon-induced recombination was observed in vegetative and floral organs, and several germinal-transmitted events were

'Interdepartmental Genetics Program, Department of Zoology and Genetics, Iowa State

University.

Department of Agronomy, Iowa State University. 82

recovered. Transposon-induced recombinatioii appears to be a general phenomenon in plants,

and thus may have contributed to genome evolution by inducing deletions between repeated

sequences.

Results and Discussion

Homologous recombination plays an important role in the generation of allelic

diversity and the preservation of genetic information in living organisms. In general, the

frequency of spontaneous intrachromosomal homologous recombination in plants is low

(Athmaef al. 1991; Lowe etal. 1992; Swoboda etal. 1994). However, it has been observed

that transposable element Activator (Ac) insertions between directly repeated sequences in the

maize P locus can induce homologous recombination (Athmaef al. 1991). Ac may also

destablize a tandem duplication in the maize bz locus (Dooner and Martinez-Ferez 1997),

albeit at a much lower frequency than observed for the maize P locus. To test the generality of

transposon-induced recombination, we asked whether a maize Ds transposable element could

induce recombination between overlapping segments of a bacterial gene (uidA) in the

dicotyledenous plant Arabidopsis.

We inserted a Ds element (courtesy of V. Sundaresan) between two partially

overlapping non-fimctional segments of the P-glucuronidase gene (Jefferson et al. 1987)

(GUS; courtesy of H. Puchta) to generate a binary plant transformation vector termed GU-

Ds-US (Figiu« 1). The homologous direct repeat sequences are 618 bp in length, and the distance between them is 6.3 kb including the 4.6 kb Ds element. Arabidopsis thaliana ecotype Columbia was transformed with the GU-Ds-US construct by vacuum infiltration 83

(Bechtold et oL 1993). Starter lines homozygous for a single copy of GU-Ds-US were selected and crossed with lines expressing Ac transposase, and with non-Ac control lines {No-

O, Landsberg). The progeny plants were grown to full rosette stage and stained with X-gluc

reagent (Rgure 2). Blue sectors, indicative of restoration of the GUS coding sequence, were observed in all plant parts examined, including roots, hypocotyls, cotyledons, petioles, leaves, siliques and seeds (Figure 2). The GUS+ sectors ranged in size from <10 cells, to occasional large sectors that encompassed ¥z or more of an entire leaf (Hgure 2b). These results indicate

that transposon-induced recombination events can occur in both vegetative and floral tissues, and at most or all stages of plant development.

As shown in Table 1, plants in the control group (genotype GU-Ds-US/+, no Ac) had zero or few blue sectors (average of 0.6 blue sectors per plant), whereas plants in the experimental group commonly had hundreds of blue sectors (average of 700 blue sectors per plant). These results were obtained from three independently transformed GU-Ds-US lines

(DsI5, DsI6, Dsn?), in crosses with three different lines expressing Ac transposase (CS8045,

CS8537, CS8538). Based on the average numbers of blue sectors shown in control group plants, the calculated spontaneous recombination frequency of the GU-Ds-US transgene in the absence of Ac transposase is approximately 1.99 x 10"' to 5.40 x 10"* events/genome

(Swoboda et al. 1994), which is determined by relating the number of recombination events

(sectors) to the number of genomes present per plant at the plant staining stage. This frequency is similar to that reported by others for spontaneous recombination of a similar

GUMS transgene (Swoboda et al. 1994, 1995; Chiurazzi et al. 1996). In the presence of the sAc transposase source, ±e average recombination frequency is increased >1,(X)0 fold. 84

We determined the structure of the GU-Ds-US transgene in the presence or absence of the Ac transposase source (xAc) using PGR amplification of genomic DNA (Hgure 3). A band predicted to arise from the restored GUS gene was obtained using DNA from plants containing the GU-Ds-US construct together with sAc (Hgure 3, lane 6), but not from plants lacking sAc (Figure 3, lane 11). The PGR band from the presumptive recombination product was sequenced and found to contain a precisely restored GUS gene (not shown). Similarly, a

PGR product predicted to arise from Ds excision from the GU-Ds-US construct was found only in plants containing sAc (Hgure 3, lane 5), but not in plants lacking sAc (Hgure 3, lane

10). The sequence of the presumptive Ds excision product showed that it contained a typical

Ds excision footprint (not shown).

Among the progeny of the variegated GUS+ plants, we detected several plants with uniform GUS+ expression. To test for germinal transmission of a recombined GUS transgene, we analyzed the genomic DNA from plants with uniform GUS expression by Southern hybridization. Hybridization with GUS-specific probe "U" (Figure 1) detected two bands (7.3 kb and 4.7 kb) in i/mdlll-digested DNA from a plant of genotype GU-Ds-US/-, sAc/- (Figiu^

4a, lane 2), whereas the GUS-specific probe detected only one band of 5.0 kb in DNA from two plants with uniform GUS expression (Figure 4a, lanes 3 and 4). Similar results were obtained from Xfeol-digested DNA hybridized with "U" probe (Figure 4b). The "U" probe detected one large band (12 kb) from a plant of genotype GU-Ds-US/-, sAc/- (Figure 4b, lane

1), and a small band (5.2 kb) in two plants with uniform GUS expression (Figure 4b, lanes 3 and 4). These results are consistent with recombination between the homologous regions of the GU-Ds-US construct, because there is no Xhol site in the construct. Additionally, we 85 detected the simple Ds excision band (7.4 kb) in DNA from the plant of genotype GU-Ds-

US/GU-US, sAc/- (Rgure 4b, lane 2). To verify that the recombinant GUS+ plants were derived from the original GU-Ds-US transformants, additional Southern hybridizations were performed using enzymes that cleave in the DNA flanking the transgene insertion. Genomic

DNA from plants of genotype GU-Ds-US, sAc and the uniform GUS+ plants were digested with EcoRV and hybridized with probe "S" specific for the 3' end of the GU-Ds-US construct

(Figure 1). The "S" probe hybridizes to the same 4.2 kb band in the GU-Ds-US progenitor plants and the uniform GUS+ plants (Hgure 4c). This result indicates that the two GUS+ plants could not have arisen by seed or pollen contamination, but did in fact originate by recombination of the GU-Ds-US transgene locus.

A recent study indicates that Ac transposon insertions do not stimulate meiotic recombination at the maize bronze locus (Dooner and Martinez-Ferez 1997). In contrast, Ac elements can induce premeiotic recombination between 5.2 kbp direct repeat sequences in the maize P locus. Additionally, Ac is reported to induce low levels of somatic recombination between ectopic sites in transgenic tobacco (Shalev and Levy 1997). Here, we show that Ds, a maize transposon, stimulates intrachromosomal homologous recombination between directly- repeated sequences mArabidopsis. The sectors of GUS+ cells we detected were clearly of premeiotic origin, whereas the uniform GUS-t- seedlings may have resulted from either premeiotic or meiotic recombination. Plants lack a germ line, and hence premeiotic recombination events could be transmitted to the next generation if a GUS+ clonal sector contributes to the gametophytic lineage. Induction of recombination is not unique to the

Ac/Ds transposon families, as the Mutator transposon also promotes recombination between 86 direct repeat sequences in the maize Knotted locus (Lowe et oL 1992). Therefore, transposon- induced homologous recombination may be a general phenomenon in plants, and possibly other organisms (Thompson-Stewart et al. 1994). All plant genomes studied to date contain transposon-like elements and repetitive sequences, and many contain duplicated genes. Our results suggest that, in addition to increasing genome size by generating local sequence duplications (Zhang and Peterson accepted by Genetics), transposable elements can also reduce genome size by inducing deletions between directly repeated sequence elements.

The mechanism of transposon-induced recombination remains to be determined, but one possibility is that recombination is stimulated by DNA double strand breaks (DSBs) generated by transposcn excision. DNA double strand breaks are known to initiate recombination in fungi (Szostak et al. 1983). JnArabidopsis, generation of DSBs by HO endonuclease increased the frequency of somatic intrachromosomal homologous recombination about 10 fold (Chiurazzi etal. 1996). In contrast, we observe a >1000x enhancement in recombination over the spontaneous frequency. This high recombination rate suggests that the action of Ac transposase may not be explained solely by induction of DSBs, but could possibly reflect a heretofore unknown effect of Ac transposase, such as to mediate the pairing of homologous sequences, to recruit host recombination factors, or both.

Alternatively, because Ac/Ds transposition is thought to occur predominantly or exclusively following DNA replication (Chen et al. 1992), transposon-generated DSBs may occur at a particular time of the cell cycle in which recombination is enhanced relative to simple transposon excision. 87

Transposon-induced recombination may be nsefiil to enhance the frequency of certain homology-dependent gene manipulations in plants. The Arabidopsis and maize genomes are currently being saturated with Ac/Ds insertions (Long et al. 1997) and it may be possible to induce recombination between endogenous sequence duplications that carry Ac/Ds insertions.

Such recombination events would generate interstitial deletions that could simplify the analysis of multicopy gene clusters such as are frequendy associated with disease resistance genes

(Welin et al. 1995; Capel et al. 1997; Takken et al. 1998). Transposon-induced recombination might also be used to delete undesirable sequences from integrated transgenes, or to delete multiple transgene copies that are commonly generated in many transformation protocols

(Kwok et al. 1985; Klein et al. 1989). Of greatest benefit would be the development of an efficient gene targeting system. Targeted gene disruption by homologous recombination in

Arabidopsis was recentiy reported (Kempin et al. 1997), but gene targeting remains difScult in plants due to the low frequency of homologous recombination. Here we unambiguously demonstrate that Ac/Ds transposons can stimulate recombination between two homologous sequences in cis. However, it remains to be determined, whether transposon-induced recombination may also enhance recombination in trans, and thereby facilitate the development of a workable gene-targeting system in plants.

Methods

Construction of binary yector GU'Ds-US. Vector pWS31 (Sundaresan etaL 1995) from Dr. V. Sundaresan was digested with Sail to remove the GUS gene fragment, then leligated to form pWS31 Y which contains a Ds element with a NPTII selection marker. 88

Plasmid pWSSlY was cleaved with Sad to release the 4.7 kb band containing Ds, to which was Hgated SacI-PstI linker fragments (synthesized by the ISU Nuclei Acid Facility). Plasmid pGU.US (Tinland et oL 1994) was cleaved with PstI and ligated to the Ds element with attached SacI-PstI linkers to generate GU-Ds-US. Restriction enzyme digestions, ligations and plasmid preparations were performed according to standard protocols and manufacturer's instructions (Sambrook et aL 1989)

Plant transformations and histochemical assays. Arabidopsis thaliana ecotype

Columbia was transformed by vacuum infiltration (Bechtold et ai 1993) with Agrobacterium strain ASE (obtained from E. Meyerowitz) containing the binary vector GU-Ds-US, and transformed seeds were selected by growth on agar media containing 30 |J.g/ml kanamycin.

Kanamycin resistant lines were further screened by progeny testing and Southern hybridization to identify three independent lines (DsI5, DsI6, DsII?) that carried a single integrated GU-Ds-

US transgene. Ac transposase lines (CS8037, CS8038, CS8045) were obtained from

Arabidopsis Biological Resource Center (ABRC). Plants were grown as described (Knocz et al. 1992). Histochemical staining of leaf samples or whole plants at the fiill rosette stage was performed as described (Swoboda et al. 1994; Jefferson et al. 1987). X-Gluc (5-bromo- chloro-3-indolyl-P-D-glucoronide) was from Rose Scientific Ltd. Canada.

PGR and Southern blot hybridizations. Genomic DNA samples were amplified by

PCR for 35 cycles as foUows: denaturation at 94°C for 30 sec; aimealing at 57°C for 30 sec; elongation for 1 min at 72°C for 35 cycles. PCR products were cloned into pTTBlue T-vector 89

(Novagen) and sequenced at the ISU DNA Sequencing and Synthesis Facility. Probe preparations and Southern blot hybridizations were performed as described.

References

Athma, P., E. Grotewold, T. Peterson, 1992 Insertional mutagenesis of the maize P gene by intragenic transposition of Ac. Genetics 131:199-209

Bechtold, N., J. EDis, and G. Pelletier, 1993 In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. C.R. Acad. Sci. 316:1194-1199

Capel, J., J. A. Jarillo, J. Salinas, J. M. Martinez-Zapater, 1997 Two homologous low- temperature-inducible genes from Arabidopsis encode highly hydrophobic proteins. Plant Physiol. 115:569-76

Chen, J., I. M. Greenblatt, S. L. Dellaparta, 1992 Molecular analysis of Ac transposition and DNA replication. Genetics 130:665-676

Chiurazzi, M., A Ray, J. F. Viret, R. Perera, X-H. Wang, A. M. Lloyd, E. R. Signer, 1996 Enhancement of somatic intrachromosomal homologous recombination in Arabidopsis by the HO endonuclease. Plant Cell 8:2057-66

Dellaporta, S. L., Wood, J., Hicks, J. B. A plant DNA minpreparation: version n. Plant Mol. Biol Rep. 1, 19-21 (1983)

Dooner, H. K. and I. M. Martinez-Ferez, 1997 Germinal excisions of the maize transposon Activator do not stimulate meiotic recombination or homology-dependent repair at the bz locus. Genetics 147:1923-1932

Jefferson, R.A., T.A. Kavanagh, and M.W. Bevan, 1987 GUS fusions: ^-Glucuronidase as a sensitive and versatile gene marker in higher plants. EMBO J. 6:3901-3907

Kempin, S. A., S. J. Liljegren, L. M. Block, S. D. Rounsley, M. F. Yanofisky, E. Lam, 1997 Targeted disruption in Arabidopsis. Nature 389:802-803

Klein, T. M., L. Komstein, J. C. Sanford, and M. E. Fromm, 1989 Genetic transformation of maize cells by particle bombardment. Plant Physiol. 91:440-444

Knocz, C., Chua, N-H. & Schell, J. Methods in research. (World Scientific, Singapore, 1992) 90

Kwok, W. W., E. W. Nester, and M. P. Gordon, 1985 Unusual plasmid DNA organization in an octopine crown gall tumor. Nucleic Adds Res. 13,459-71

Long, D., J. Goodrich, K. Wilson, E. Sundberg, M. Martin, P. Puangsomlee, G. Coupland, 1997 Ds elements on all five Arabidopsis chromosomes and assessment of their utility for transposon tagging. Plant J. 11:145-148

Lowe, B., J. Mathem, S. Hake, 1992 Active Mutator elements suppress the knotted phenotype and increase recombination at the Knl-0 tandem duplication. Genetics 132:813- 822

Puchta, H., P. Swoboda, S. Gal, M. Blot, B. Hohn, 1995 Somatic intrachromosomal homologous recombination events in populations of plant siblings. Plant Mol. Biol. 28:281-92

Sambrook, J., Fritsch, E. E, Maniatis, T. Molecular Cloning : A laboratory ManuaL (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 1989)

Shalev, G., and A. A. Levy, 1997 The maize transposable element Ac induces recombination between the donor site and an homologous ectopic sequence. Genetics 146:1143-51

Sundaresan, V., P. Springer, T. Volpe, S. Haward, J. D. G. Jones, C. Dean, H. Ma, and R. Martienssen, 1995 Patterns of gene action in plant development revealed by enhancer trap and gene trap transposable elements. Gene and Dev. 9:1797-1810

Swoboda, P., S. Gal, B. Hohn, H. Puchta, 1994 Intrachromosomal homologous recombination in whole plants. EMBO J. 13:484-9

Szostak, J. W., T. Orr-weaver, R. Rothstein, F. Stahl, 1983 The double-strand-break repair model for recombination. Cell 33:25-35

Takken, F. L., D. Schipper, H. J. Nijkamp, J. Hille, 1998 Identification and D^-tagged isolation of a new gene at the Cf-4 locus of tomato involved in disease resistance to Cladosporium fulvum race 5. Plant J. 14:401-11

Thompson-Stewart, D., G. H. Karpen, A. C. Spradling, 1994 A transposable element can drive the concerted evolution of tandemly repetitious DNA. Proc. Natl. Acad. ScuUSA 91:9042-9046

Tinland, B., B. Hohn, and H. Puchta, 1994 Agrobacterium tumefaciens transfers single- stranded transferred DNA (T-DNA) into the plant cell nucleus. Proc. NatL Acad. Set USA 91:8000-8004 91

Welin, B.V., A. Olson, E. T. Palva, 1995 Structure and organization of two closely related low-temperature-induced dhn/lea/rab-like genes mArabidopsis thalicma. Plant Mol. Biol. 29:391-5

Zhang, J., T. Peterson, 1999 Genome rearrangements by non-linear transposons in maize. Genetics, accepted.

Acknowledgements

We thank Holger Puchta for the GU.US plasmid and helpfiil suggestions, and V.

Sundaresan for the pWS31 plasmid. This work was supported by a grant from the Iowa Com

Promotion Board. 92

Table I. Frequencies of GUS+ blue sectors in plants containing GU-Ds-US transgene

GU-Ds-US lines Control Lines Ac Transposase Number of Number of Blue (no Ac) Lines Plants Spots

DsI5 Landsberg — 9 3

No-0 — 10 11

CS8045 10 3310

CS 8537 11 2467

CS 8538 7 3152

DsI6 No-0 — 10 3

CS 8537 11 11956

Dsn? No-0 — 10 7

CS 8537 10 5465

CS 8538 10 7984

DsI5, DsI6 and DsII? are independent GU-Ds-US transgenic lines; Landsberg and No-0 are control wild type lines; CS8045, CS8537 and CS8538 are three lines which express Ac transposase. Blue sectors were visualized under a dissecting microscope at 5x magnification. 93

Figure Legends

Figure 1. Structure of the GU-Ds-US construct and recombination products, a. Upper, map of the GU-Ds-US construct integrated into the plant genome. RB and LB, T-DNA right border and left border sequences, respectively; P, 35S promoter of CaMV; T, nopaline synthase terminator; GU and US indicate the partially overlapping GUS gene fragments; triangle, Ds element containing NFITI gene. Lower, map of GUS gene restored by homologous recombination between the direct repeat sequences. Restriction sites for HiivSBl,

Xhol and EcoRV are indicated, mm, plant genome DNA; —•, primers used in Rgure 3; ssm and , U and S probes used in Hgure 4.

Figure 2. GUS activity stain of plants transformed with GU-Ds-US and crossed with Ac transposase source, a, frequent small blue sectors in leaves; b, leaf with Vi blue sector, indicating an early recombination event; c, blue sectors in cotyledons; blue sector encompassing new leaves, indicating a recombination event in meristem; d, siliques containing blue seeds; e, isolated blue seeds; f, uniform blue F3 seedlings.

Figure 3. PCR analysis of genomic DNA from GU-Ds-US transformant plants, lane 1, MW standards (Ikb ladder, BRL); lane 2, PCR negative control (primers G1 + H3, using dH20 instead of plant DNA); lanes 3-7, DNA from plants of genotype GU-Ds-US/-, sAc/-; Lanes

8 - 12, DNA from plants of genotype GU-Ds-US/-, no Ac. Lanes 3 and 8, primers H2 + Dl; lanes 4 and 9, primers G1 + H3; lanes 5 and 10, primers HI + H2; lanes 6 and 11, primers PI

+ Si; lanes 7 and 12, primers X and Y (specific for Ac). Primer sequences are: 94

PI. GAAGACTCAGACTCAGACT; Gl, GGTGGGAAAGCGCGTTACAAG;

H3, CGTCTGGACCGATGGCTGTG; H2, TTCGGGGCAGTCCTCGG;

HI, GATGTAGGAGGGCGTGG; Dl, GATCCGGTTCTCTCCAAATG;

SI, CrGTCTGGCTTTTGGCTGTG; X, GGATATrCTGCAACCCTTCCCCTCC;

Y, CTCGCAGGTATGTTTGTCTC

Figure 4. Southern blot analysis of recombination in the GU-Ds-US construct a, DNA was digested with Hmdin and hybridized probe "U". Lane 1, DNA from wild type

Arabidopsisy lane 2, DNA from variegated GUS+ plants of genotype GU-Ds-US/- sAc/-; lanes

3 and 4, DNA from uniform GUS+ plants, derived by recombination of the GU-Ds-US construct, b, DNA was digested with Xhol and hybridized with probe "U". Lane 1, DNA from variegated GUS+ plants of genotype GU-Ds-US/- sAc/-; Lane 2, DNA from variegated

GUS+ plants of genotype GU-Ds-US/GU-US sAd-, lanes 3 and 4, DNA from uniform GUS+ plants, derived by recombination of the GU-Ds-US construct, c, DNA was digested with

£coRV and hybridized with probe "S". Lanes are loaded as in panel a. 4.7 kb 7.3 kb

Hind ni 4.2 kb

NPTI Hind ni EcoR V Hind ni EcoR V

y/" RB P G U U S T LB 4

PI G1 \H3 H2 HI SI Xhol Xhol S Homologous \ 1/1\o recombination \

\ \ / / Xhol \ V ' Xhol ^ / \ / /

RB P G U S T LB vh "7n — 1 Hind ni U EcoRW Hindm EcoRV

5.0 kb

Figure 1 96

Figure 2 97

GU-Ds-US/-.sAc/- GU-Ds-Uy^-. no Ac 3 4 5 6 7 8 9 10 II 12

Figure 3 98

Figure 4 99

CHAPTER 4. GENERAL SUMMARY

Transposable elements were first identified by Barbara McClintock as genetic elements that can transpose to new chromosomal locations and cause chromosome breakage.

McClintock named them "controlling elements" for their ability to alter the expression of nearby genes (McClintock 1948, 1949, 1956). Later, different transposable elements were discovered in a number of organisms and studied at the molecular level (see reviews in

Saedler and Gierl 1996). Transposable elements can induce deletions, inversions, duplications and other rearrangements, and thereby contribute to genome evolution

(Ginzburg et al. 1984; Mackay 1986; Finnegan 1989; Kidwell and Lisch 1997). The transposition process involves several steps, including cutting DNA at the donor site, repair of the empty donor site and insertion of the transposon at the new site (Saedler and Nevers

1985). The transposition reaction likely involves host recombination factors because the repair of the empty donor site is thought to occur in plants via illegitimate recombination

(non-homologous end joining) (Coen et al. 1989; Baran G et al. 1992; Scott et aL 1996;

Rinehart et aL 1997; Gorbunova and Levy 1997).

Many lines of evidence show that transposons can, in addition, affect the host homologous recombination pathway. In E. coli, Tn7 transposition creates a hotspot for homologous recombination at the transposition donor site (Hagemann and Craig 1993). ISIO intermolecular transposition is able to greatly stimulate, and is coupled to, homologous recombination between the donor and acceptor molecules at the transposition site

(Eichenbaum and Livneh 1995). In Drosophila, the P element has been shown to increase 100 male recombination frequency (Hiraizumi 1971; Svoboda et al. 1995; Preston and Engels

1996) and to promote efficient gene conversion, which allows site-specific gene replacement and chromosome rearrangement (Engels et al, 1990; Gloor etal. 1991; Lankenau et al. 1996;

Preston and Engels 1996). In plants, the maize transposable element Ac can induce homologous recombination between direct repeat sequences at the maize P locus and cause large (17 kb) deletions including the P gene coding region, and hence give rise to colorless sectors on maize ears (Athma and Peterson, 1991). Another maize transposon, Mul, can also increase the recombination rate 100-2000 fold at the KnI-0 tandem duplication in maiy/^

(Lowe et oL 1992). Mul element also increases the meiotic recombination and gene conversion rates at Knl locus (Mathem and Hake 1997). In contrast, in the absence of a transposon insertion, the homologous recombination rates are very low in both P and Knl gene. In transgenic tobacco, the Ac element was reported to be able to induce somatic recombination between homologous ectopic sequences (Shalev and Levy 1997).

The maize P gene is located on the short arm of chromosome 1 and encodes a transcription activator of genes involved in the synthesis of a red flavonoid pigment in the pericarp, cob and other floral tissues (Styles and Ceska 1977, 1989; Grotewold et al. 1991,

1994). The maize P gene was cloned by Ac tagging (Lechelt et al. 1989). The P gene has a unique structure, in which the coding region is flanked by two 5.2-kb directed repeats. This structure and the non-essential visual pigmentation conferred by the P gene, make the P gene a good natural substrate to study intrachromosomal recombination in plants.

In Chapter Two of this dissertation, we used genetic and molecular procedures to further analyze transposon-induced homologous recombination at the maize P gene. The aim of this study was to test the effects of position of Ac insertion on the recombination 101 frequency. A collection of six P gene alleles was available. Each allele carries an Ac insertion at a different site in and around the P gene: outside of the direct repeats, within the direct repeat, and between the direct repeats, in both possible orientations. Colorless kernel pericarp sectors generated by candidate homologous recombination events were counted and examined. The frequencies of colorless sectors produced by alleles with Ac insertions between the direct repeats (group I) were signi^cantly higher than by alleles with Ac insertions within or outside the repeats (group II). Large colorless sectors (>1 kernel) were only observed in the group I alleles. Null alleles (P-ww/P-ww) recovered from each Ac insertion allele were analyzed by Southern hybridization. Among 84 null mutants derived from group I alleles, 59 (average 72%) resulted from homologous recombination between the two repeats. In contrast, only 13 null mutants were recovered from group n alleles, and only one of the 13 was generated by recombination at the P locus. Taken together, these results indicate that Ac insertion sites located between the direct repeats at the P locus can give higher homologous recombination frequencies than Ac insertion sites located outside or within the repeats. In contrast, the orientation of the Ac insertion may not affect the transposon-induced recombination frequency at P locus.

Chapter Three presents the results of experiments designed to test whether transposon-induced homologous recombination can also occur on an artiflcial recombination substrate in transgenic Arabidopsis. The recombination substrate (GU-Ds-US) contained two overlapping nonfunctional GUS gene fragments with a Ds element inserted between. The

GUS fragments in the construct were incomplete and hence could not encode active GUS protein. The construct was transformed into Arabidopsis, and plants containing the GU-Ds-

US construct were crossed to lines expressing Ac transposase. We found that plants 102 containing the transposase gave rise to >1000 times more blue spots after staining with GUS substrate than plants lacking transposase. The blue spots represent restoration of GUS function. The mechanism was demonstrated by molecular analysis to have occurred via homologous recombination between the two GUS fragments.

Taken together, these results show that active transposons can induce intrachromosomal homologous recombination. They also suggest that transposon-induced homologous recombination could be a general phenomenon in plants and thus play an important role in genome evolution (Thompson-Stewart et aL 1994). Although homologous recombination in plants is less frequent than illegitimate recombination, it is an important research area because it will likely be essential for gene targeting and site specific recombination in plants (Chiurazzi et al. 1996; Puchta et aL 1993, 1996, 1998a, Puchta

1998b; Shalev and Levy 1997). Thus, it may be possible to use widely existing transposable elements to enhance the frequency of certain homology-dependent gene manipulations in plants. For example, recombination events in multicopy gene clusters, such as are frequently associated with disease resistance genes (McDowell et al. 1998; Takken et al. 1998), could be used to generate interstitial deletions that could simplify the analysis of the cluster.

Second, transposon-induced recombination might also be used to delete undesirable sequences from integrated transgenes, or to delete multiple transgene copies that are commonly generated in many transformation protocols (Kwok et al. 1985; Klein et al. 1989).

Finally and most importantly, transposon-induced recombination could provide a new approach for efHcient gene targeting system in plants. Targeted gene disruption by homologous recombination in Arabidopsis was recently reported (Kempin et al. 1997), but gene targeting remains difficult in plants due to the low frequency of homologous 103 recombination. Here we unambiguously demonstrate \haxAc/Ds transposons can stimulate recombination between two homologous sequences in cis. However, it remains to be determined, whether transposon-induced recombination may also enhance recombination in trans, and thereby facilitate the development of a workable gene-targeting system in plants.

References

Athma, P and T. Peterson, 1991 Ac induces homologous recombination at the maize P locus. Genetics 128,163-173

Baran, G., C. Echt, T. Bureau, S. Wessler, 1992 Molecular analysis of the maize wx-B3 allele indicates that precise excision of the transposable Ac element is rare. Genetics 130:377- 84

Boeke, R. A., 1989 Transposable elements in Saccharomyces cerevisiae, pp. 335-374 in Mobile DNA, edited by D. E. Breg and M. M. Howe. American Society for Microbiology, Washington, D.C.

Qiiurazzi, M., A. Ray, J. F. Viret, R. Perera, X-H. Wang, A. M. Lloyd, E. R. Signer, 1996 Enhancement of somatic intrachromosomal homologous recombination in Arabidopsis by the HO endonuclease. Plant Cell 8:2057-66

Coen, E. S., T. P. Robbins, J. Almeida, A. Hudson and R. Carpenter, 1989 Consequences and mechanisms of transposition in Antirrhinum majus. In: Berg, D.E., Howe, M. M.(eds) Mobile DNA. American Society for Microbiology, Washington DC, pp. 413-436 in Mobile DNA,

Eichenbaum, Z and Z. Livneh, 1995 Intermolecular transposition of IS10 causes coupled homologous recombination at the transposition site. Genetics 140: 861-874

Engels, W. R., D. M. Johnson-Schlitz, W. B. Eggleston and J. Sved, 1990 High-frequency P element loss in Drosophila is homolog dependent. Cell 62:515-525

Rnnegan, D. J., 1989 Eukaryotic transposable elements and genome evolution. Trends Genet. 5:103-107

Ginzburg, L R., P. M. Bingham, and S. Yoo, 1984 On the theory of speciation by transposable elements. Genetics 107:331-341 104

Gloor, G. B., N. B. Nassif, D. M. Johnson-Schlitz, C. R. Preston and W. R. Engels, 1991 Targeted gene replacement in Drosophila via P element-induced gap repair. Science 253: 1110-1117

Gorbunova, V., and A. A. Levy, 1997 Non-homologous DNA end joining in plant cells is associated with deletions and filler DNA insertions. Nucleic Acids Res. 25:4650-7

Grotewold, E., P. Athma, T. Peterson, 1991b Alternatively spliced produced of the maize P gene encodes proteins with homology to DNA binding domain of Myb-like transcription factors. Proc. Natl. Acad. Sci. USA 88:4578-4591

Grotewold, E., B. Drununond, B. Bowen, T. Peterson, 1994 The myb-homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene subset. Cell 76:543-553

Hagemann, A. T. and N. L. Craig, 1993 Tn7 transposition creates a hotspot for homologous recombination at the transposon donor site. Genetics 133: 9-16

Hiraizumi, Y., 1971 Spontaneous recombination in Drosophila melanogaster males. Proc. Natl. Acad Sci. USA 68: 268-270

Kempin, S. A., S. J. Liljegren, L. M. Block, S. D. Rounsley, M. F. Yanofsky, E. Lam, 1997 Targeted disruption in Arabidopsis. Nature 389:802-803

Kidwell, M. G. and D. Lisch, 1997 Transposable elements as sources of variation in animals and plants. Proc. Natl. Acad Sci. USA 94:7704-7711

Klein, T. M., L. Komstein, J. C. Sanford, and M. E. Fromm, 1989 Genetic transformation of maize cells by particle bombardment. Plant Physiol. 91:440-444

Kwok, W. W., E. W. Nester, and M. P. Gordon, 1985 Unusual plasmid DNA organization in an octopine crown gall tumor. Nucleic Acids Res. 13:459-71

Lankenau, D. H., V. G. Corces, W. R. Engels, 1996 Comparison of targeted gene replacement frequencies in Drosophila melanogaster at the forked and white loci Mol. Cell. Biol. 16:3535-44

Lechelt, C., T. Peterson, A. Laird, J. Chen, S. L. Dellaporta, E. Dennis, W. J. Peacock, and P. Starlinger, 1989 Isolation and molecular analysis of the maize P locus. Mol. Gen. Genet. 219:225-234

Lowe, B., J. Marthem and S. Hake, 1992 Active Mutator elements suppress the knoned phenotype and increase recombination at the KnI-0 tandem duplication. Genetics 132, 813- 822 105

Mackay, T. F. C., 1986 Tramposable element-induced fitness mutations in Drosophila melanogaster. Genet. Res. 48:77-87

McDowell, J. M., M. Dhandaydham, T. A. Long, M. G. Aarts, S. Goff, E. B. Holub, J. L. Dangl, 1998 Intragenic recombination and diversifying selection contribute to the evolution of downy mildew resistance at the RPP8 locus of Arabidopsis. Plant Cell 10:1861-74

Mathem, J., and S. Hake, 1997 Mu element-generated gene conversions in maize attenuate the dominant knotted phenotype. Genetics 147:305-14

McClintock, B. 1948 Mutable loci in maize. Carnegie Inst. Wash. Year Book 47:155-169

McClintock, B. 1949 Mutable loci in maize. Carnegie Inst. Wash. Year Book 48:142-154

McClintock, B. 1956 Controlling elements and the gene. Cold Spring Harbor Symp. BioL 21:197-216

Preston, C. R. and W. R., Engels, 1996 P-element-induced male recombination gene conversion in Genetics 144: 1611-1622

Puchta, H., B. Dujon, B. Hohn, 1993 Homologous recombination in plant cells is enhanced by in vivo induction of double strand breaks into DNA by a site-specific endonuclease. Nucleic Acids Res. 21:5034-40

Puchta, H., B. Dujon, B. Hohn, 1996 Two different but related mechanisms are used in plants for the repair of genomic double-strand breaks by homologous recombination. Proc. Natl. Acad Sci. C/5 A 93:5055-60

Puchta, H., 1998a Repair of genomic double-strand breaks in somatic plant cells by one­ sided invasion of homologous recombination. Plant J. 13:331-339

Puchta, H., 1998b Towards targeted transformation in plants. Trends Plant Sci. 3:77-78

Rinehart, T., C. Dean and C. Weil, 1997 Comparative analysis of non-random DNA repair following Ac transposon excision in maize itsvl Arabidopsis. Plant J. 12:1419-1427

Saedler, H., and P. Nevers, 1985 Transposition in plants: a molecular modeL EMBO J. 4:585-590

Saedler, H., and A. Gierl, 1996 Transposable Elements. Springer-Verlag, Berlin.

Scott, L., D. LaFoe and C. Weil, 1996 Adjacent sequences influence DNA repair accompanying transposon excision in maize. Genetics 142:237-246 106

Shalev, G., and A. A. Levy, 1997 The maize transposable element Ac induces recombination between the donor site and an homologous ectopu: sequence. Genetics 146:1143-51

Styles, E. D. and O. Ceska, 1972 Flavonoid pigments in genetic strains of maize. Phytochemistry 11: 3019-3021

Styles, E. D., and O. Ceska, 1977 The genetic control of flavonoid synthesis in maize. Can. J. Genet CytoL 19:289-302

Svoboda, Y., M. Robson and J. Sved, 1995 P element-induced male recombination can be produced in Drosophila melanogaster by combining end-deficient element in trans. Genetics 139: 1601-1610

Takken, F. L., Schipper, D., Nijkamp, H. J., Hille, J. Identification and D^-tagged isolation of a new gene at the Cf-4 locus of tomato involved in disease resistance to Cladosporium fulvum race 5. Plant J. 14,401-11 (1998)

Thompson-Stewart, D., G. H. Karpen, A. C. Spradling, 1994 A transposable element can drive the concerted evolution of tandemly repetitious DNA. Proc. Natl. Acad. Sci. USA 91:9042-9046 107

ACKNOWLEDGEMENTS

First of all, I would like to thank my major professor Dr. Thomas Peterson for his excellent guidance in my research project, for his great patience in reading and editing my drafts, also for his encouragement and help during my entire graduate program. He provided me not only scientific knowledge but also about good attitude, good perception which will influence me for the rest of my Ufe. I wish to thank Dr. Alan Atherly, Dr. Benjamin Bowen,

Dr. Charlotte Bronson, Dr. Steve Rodermel and Dr. Dan Voytas for serving as my graduate committee members and giving me advice and comments.

I would like to express my thanks to Dongying Wu, and David Wright. They both gave me great help on my Arabidopsis project.

I would like to extend my appreciation to Dr. Suzy Cocciolone, Dr. Surinder Chopra,

Dr. Xianggan Li, Dr. Luda Sidorenko, Jianbo Zhang and Peifen Zhang, for their friendship and assistance in the lab. It is very lucky for me to meet and know all of you in my life.

I want to express my heartfelt gratitude to my parents, Guirong Wang and Pingan

Xiao, for their love, sacrifice and support since I came to this world. Abundant support and help from my sisters aU the time is greatly appreciated.

I wish to thank my wife. Dr. Yuxing Li, for her love, understanding and always being

±ere with me. She has been giving me continuous support and encouragement throughout my graduate study. I could not accomplish my study without her. Finally, I am especially gratefril to my daughter. Amy, for giving me more enjoyable life. IMAGE EVALUATION

150mm

IIWIGE. Inc 1653 East Main Street Roctiester, NY 14609 USA Ptnne: 716/482-0300 Fax: 716/288-5989