DOCSLIB.ORG

Absence of ST7 Gene Alterations in Human Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Absence of ST7 Gene Alterations in Human Cancer Vol. 8, 2939–2941, September 2002 Clinical Cancer Research 2939 Absence of ST7 Gene Alterations in Human Cancer Seung Myung Dong and David Sidransky1 (15, 16). These findings suggest the presence of a broad range Department of Otolaryngology-Head and Neck Surgery, Head and TSG on human chromosome 7q31-q31.2. Neck Cancer Research Division, Johns Hopkins University School of In search of a TSG in the 7q31 critical region, LOH and Medicine, Baltimore, Maryland 21205-2196 microcell fusion studies narrowed the region, and a positional cloning strategy identified a candidate suppressor gene, named ST7, that is involved in a variety of human cancers (17). More- ABSTRACT over, somatic mutations of ST7 were reported in human cell The ST7 gene was cloned and mapped to chromosome lines derived from breast cancer and primary colon carcinomas. 7q31.1-q31.2, a region suspected of containing a tumor sup- Breast tumor cell lines (MDA-MB435s, T-47-D, and MDA- pressor gene involved in a variety of human cancers. Sub- MB231) and 40% of primary colon carcinomas with LOH of sequent investigation described the presence of ST7 muta- D7S522/D7S677 were reported to harbor mutations predicted to tions in human cell lines derived from breast tumors and yield a truncated ST7 protein. primary colon carcinoma. Introduction of the ST7 cDNA Because we (18) and others (12, 19–21) found evidence of into a prostate cancer-derived cell line abrogated in vivo LOH 7q31, we investigated a series of primary HNSCCs, inva- tumorigenecity in nude mice. To clarify the role of the ST7 sive DCB, and adenocarcinomas of the colon in search of ST7 gene in cancer, we scrutinized primary head and neck squa- mutations. mous cell carcinomas, invasive ductal carcinomas of the breast, and adenocarcinomas of the colon. Loss of heterozy- gosity of D7S522/D7S677 was detected in 24% (4 of 17) of MATERIALS AND METHODS head and neck squamous cell carcinomas, 17% (2 of 12) of Samples and DNA Extraction. A series of 17 primary invasive ductal carcinomas of the breast, and 33% (8 of 24) HNSCCs, 12 invasive DCB, and 24 colon primary carcinomas of adenocarcinomas of the colon, but no somatic mutations were obtained for ST7 screening. Seventeen primary HNSCCs were found in any of these specimens. We then searched for were selected that showed LOH of 7q22-q31 region from our mutations in breast cancer cell lines and found a complete previous study (18). Twelve primary breast carcinomas were wild-type sequence in all, including cell lines previously obtained from the Department of Pathology, University campus reported to harbor mutations. We believe that the ST7 gene BioMedico (Rome, Italy), and 24 primary colon carcinomas is not a primary target of inactivation in most human can- were obtained from Johns Hopkins Hospital (Baltimore, MD). cers with loss of heterozygosity at 7q31.1-q31.2. We also tested three breast tumor-derived cell lines reported to harbor mutations of ST7 (MDA-MB435s, T-47-D, and MDA- INTRODUCTION MB231), purchased from American Type Culture Collection. Tumor tissue was selected from an area with greater than 75% Genetic alterations of the human chromosomal region 7q malignant cells. DNA was purified by phenol-chloroform ex- are common in human cancer (1). LOH2 of the 7q31-q32 region traction and ethanol precipitation and dissolved in 50 ␮lof has been reported in breast, prostate, pancreatic, ovarian, gastric, distilled water, as described previously (22). colon, and head and neck cancer, as well as uterine leiomyomas Microsatellite Analysis. DNA from tumor and normal and malignant myeloid disease (2–13). Furthermore, the intro- control was examined for LOH by PCR-based microsatellite duction of an intact copy of human chromosome 7 into immor- analysis. Markers D7S522 and D7S677 were used to identify talized human fibroblasts cell lines with LOH/allelic imbalance alterations 7q31.1. PCR conditions and criteria for LOH and at 7q31-q32 restore programmed senescence to the cells (14). In homozygous deletion were described previously (23). addition, transfer of human chromosome 7 inhibits tumorigene- Sequence Analysis. We carried out manual genomic se- city in most tumor explants and complete suppression in others quencing. We designed intronic primers that included the intron/ exon boundary for sequence analysis of the ST7 gene [GenBank accession no. AC009152 (cDNA), AC106873 (exon 1), AC002542 (exons 2–15), and AC003987 (exon 16); Table 1]. Received 1/16/02; revised 5/30/02; accepted 6/3/02. After detection of a PCR product, direct PCR sequencing reac- The costs of publication of this article were defrayed in part by the tions were performed using the Amplicycle Sequencing Kit payment of page charges. This article must therefore be hereby marked (Perkin-Elmer, Branchburg, NJ) and sequenced on a Genomyx advertisement in accordance with 18 U.S.C. Section 1734 solely to electrophoresis apparatus. We carried out both manual and indicate this fact. 1 To whom requests for reprints should be addressed, at Department of fluorescent DNA sequencing for exons 3, 5, and 12 of ST7 in the Otolaryngology B Head and Neck Surgery, Division of Head and Neck three breast cancer cell lines. We further performed thermal Cancer Research, The Johns Hopkins University School of Medicine, cycling, followed by cloning of PCR products, with The Orig- 818 Ross Research Building, 720 Rutland Avenue, Baltimore, MD inal TA Cloning Kit (Invitrogen, Carlsbad, CA). After purifica- 21205-2196. E-mail: [email protected]. 2 The abbreviations used are: LOH, loss of heterozygosity; TSG, tumor tion of clones containing ST7 exons, they were analyzed by the suppressor gene; HNSCC, head and neck squamous cell carcinoma; Sequence Analysis Facility of The Johns Hopkins University to DCB, ductal carcinoma(s) of the breast. independently confirm our results in the cell lines. Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2002 American Association for Cancer Research. 2940 Absence of ST7 Gene Alterations in Human Cancer Table 1 PCR primer sequences for sequencing ST7 Sense Antisense Exon 1 5Ј-81948CCGGCTCATCTCTTCACTCT81967-3Ј 5Ј-82103AGCAGAGAAGTGGGATCCAT82084-3Ј Exon 2 5Ј-63573TCCTTGTTCTTCTCCCTTTCTC63594-3Ј 5Ј-63722TTTAAATGAGAAGGACTCCACCA63700-3Ј Exon 3 5Ј-83382CCATAAACACGCTTATTTTTCTGT83405-3Ј 5Ј-83605GCAAATAATATTGCAAACTGAAG83582-3Ј Exon 4 5Ј-93561AGGAAGGGTGTTTTGCTGAA93580-3Ј 5Ј-93729CCATTTGTTTCCCAAGCTGT93710-3Ј Exon 5 5Ј-94292TTGCTTTTCTCTCTCAAAAGTGTC94313-3Ј 5Ј-94492CCTCCCATTCAGAAGGATGT94472-3Ј Exon 6 5Ј-95699TGGATTGACTTGGTGTTTTCTC95720-3Ј 5Ј-95832AGCAAGATTTTCCCCCACTT95813-3Ј Exon 7 5Ј-97888CCCTGAACTCCGAAAATGACA97907-3Ј 5Ј-98065CACCCAACAGGTTCTTGACTT98045-3Ј Exon 8 5Ј-99888CCTTGGCTTTGTAATTGATGG99908-3Ј 5Ј-100108CATCAACCTGCAGGAAACCT100089-3Ј Exon 9 5Ј-102211AGGCAAATGGGCCTCTGTAT102240-3Ј 5Ј-102416AAGCCACTGATCCCAAACAC102397-3Ј Exon 10 5Ј-134691CCTTGGTTTCTTCTGCCCTA134710-3Ј 5Ј-134884CAGGGAAAATACATCAAAAGAGG134862-3Ј Exon 11 5Ј-153117TTGCTCTTTGTTACCTGCAAA153127-3Ј 5Ј-153276GCATTAGTACCGCGCAAACT153257-3Ј Exon 12 5Ј-154650CCACCTGGATGGTTTTTGTC154679-3Ј 5Ј-154819TAACGAGTTCCTGTGGGGAT154800-3Ј Exon 13 5Ј-137606AACACAAGTGTGTCCTGCTTTTT173628-3Ј 5Ј-173843CATTTTAGCACCTTTTCATGCTC173821-3Ј Exon 14 5Ј-182872TGCAGTTGGGAAGTTATGACA182892-3Ј 5Ј-183069TTTCACCACACACCCTCACT183050-3Ј Exon 15 5Ј-185752CCCTTTTGGTCTTCTCCACA185771-3Ј 5Ј-185972GCTTTTATGCCCTTGGCTTT185955-3Ј Exon 16 5Ј-4997TGGGTGGAGAGGTTTGTTTT5016-3Ј 5Ј-5195GGTGAGGTGAGTGGAGGACA5176-3Ј ST7 gene. The frequency of LOH of DCB and HNSCCs was somewhat lower than previous reports (17). In search of ST7 gene mutations, we sequenced all of the 53 primary tumors. None of the tumors displayed any changes in the coding regions or intron/exon boundaries. Any of these primary tumors were previously found to harbor point mutations in other TSGs (18, 24, 25). We then investigated the breast tumor cell lines MDA-MB435s, T-47-D, and MDA-MB231 to confirm previous reports of ST7 gene alterations (17). We did not find any mutations in these cell lines (Fig. 1) by manual sequencing or automated sequencing. We further cloned the PCR products and sequenced 10 clones containing the exons where mutations were previously reported. Again, the wild-type sequence was confirmed in all three cell lines. The majority of previously reported mutations in the ST7 gene were identified as single base pair deletions or insertions predicted to form truncated proteins. Little is still known about ST7 function, but true truncation mutations would be expected to abrogate suppressor function. We have found that automated sequence analysis can both underestimate mutation frequency and also results in false positives, especially if not confirmed by sequence analysis in both directions (26). At this writing, two other recent reports support the absence of ST7 alterations in 128 human tumors (27, 28). Fig. 1 ST7 DNA sequence in tumor-derived cell lines. Exons encom- passing the reported mutations in these cell lines were PCR amplifica- The complete absence of mutations in our series of primary tion from genomic DNA with intron-specific primers. Representative tumors and absence of putative mutations in breast cell lines DNA sequence data for AY009152 nt 456–477 of MDA-MB435s (A), argue against a prominent role of ST7 in these tumor types. nt 683–705 of T-47-D (B), and nt 1354–1375 of MDA-MN231 (C). The However, our work does not exclude a tumor suppressor role for arrows indicate the positions of the purported mutations (466insT in ST7 based on the reported functional studies. Other mechanisms MDA-MB435s,
Load more

Recommended publications
  • REVIEW ARTICLE the Genetics of Autism
    REVIEW ARTICLE The Genetics of Autism Rebecca Muhle, BA*; Stephanie V. Trentacoste, BA*; and Isabelle Rapin, MD‡ ABSTRACT. Autism is a complex, behaviorally de- tribution of a few well characterized X-linked disorders, fined, static disorder of the immature brain that is of male-to-male transmission in a number of families rules great concern to the practicing pediatrician because of an out X-linkage as the prevailing mode of inheritance. The astonishing 556% reported increase in pediatric preva- recurrence rate in siblings of affected children is ϳ2% to lence between 1991 and 1997, to a prevalence higher than 8%, much higher than the prevalence rate in the general that of spina bifida, cancer, or Down syndrome. This population but much lower than in single-gene diseases. jump is probably attributable to heightened awareness Twin studies reported 60% concordance for classic au- and changing diagnostic criteria rather than to new en- tism in monozygotic (MZ) twins versus 0 in dizygotic vironmental influences. Autism is not a disease but a (DZ) twins, the higher MZ concordance attesting to ge- syndrome with multiple nongenetic and genetic causes. netic inheritance as the predominant causative agent. By autism (the autistic spectrum disorders [ASDs]), we Reevaluation for a broader autistic phenotype that in- mean the wide spectrum of developmental disorders cluded communication and social disorders increased characterized by impairments in 3 behavioral domains: 1) concordance remarkably from 60% to 92% in MZ twins social interaction; 2) language, communication, and and from 0% to 10% in DZ pairs. This suggests that imaginative play; and 3) range of interests and activities.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2016/0289762 A1 KOH Et Al
    US 201602897.62A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0289762 A1 KOH et al. (43) Pub. Date: Oct. 6, 2016 (54) METHODS FOR PROFILIING AND Publication Classification QUANTITATING CELL-FREE RNA (51) Int. Cl. (71) Applicant: The Board of Trustees of the Leland CI2O I/68 (2006.01) Stanford Junior University, Palo Alto, (52) U.S. Cl. CA (US) CPC ....... CI2O 1/6883 (2013.01); C12O 2600/112 (2013.01); C12O 2600/118 (2013.01); C12O (72) Inventors: Lian Chye Winston KOH, Stanford, 2600/158 (2013.01) CA (US); Stephen R. QUAKE, Stanford, CA (US); Hei-Mun Christina FAN, Fremont, CA (US); Wenying (57) ABSTRACT PAN, Stanford, CA (US) The invention generally relates to methods for assessing a (21) Appl. No.: 15/034,746 neurological disorder by characterizing circulating nucleic acids in a blood sample. According to certain embodiments, (22) PCT Filed: Nov. 6, 2014 methods for S. a Nial disorder include (86). PCT No.: PCT/US2O14/064355 obtaining RNA present in a blood sample of a patient Suspected of having a neurological disorder, determining a S 371 (c)(1), level of RNA present in the sample that is specific to brain (2) Date: May 5, 2016 tissue, comparing the sample level of RNA to a reference O O level of RNA specific to brain tissue, determining whether a Related U.S. Application Data difference exists between the sample level and the reference (60) Provisional application No. 61/900,927, filed on Nov. level, and indicating a neurological disorder if a difference 6, 2013.
    [Show full text]
  • The Protein Arginine Methyltransferase PRMT5 Regulates Proliferation
    The Protein Arginine Methyltransferase PRMT5 Regulates Proliferation and the Expression of MITF and p27Kip1 in Human Melanoma DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University by Courtney Nicholas Graduate Program in Molecular, Cellular, and Developmental Biology The Ohio State University 2012 Dissertation Committee: Gregory B. Lesinski, PhD, Advisor Jiayuh Lin, PhD Amanda E. Toland, PhD Susheela Tridandapani, PhD Copyright by Courtney Nicholas 2012 Abstract The protein arginine methyltransferase-5 (PRMT5) enzyme is a Type II arginine methyltransferase that can regulate a variety of cellular functions. We hypothesized that PRMT5 plays a unique role in regulating the growth of human melanoma cells. Immunohistochemical analysis indicated significant upregulation of PRMT5 in human melanocytic nevi (88% of specimens positive for PRMT5), malignant melanomas (90% positive) and metastatic melanomas (88% positive) as compared to normal epidermis (5% of specimens positive for PRMT5; p<0.001, Fisher’s exact test). Furthermore, nuclear PRMT5 was significantly decreased in metastatic melanomas as compared to primary cutaneous melanomas (p<0.001, Wilcoxon rank sum test). Human metastatic melanoma cell lines in culture expressed PRMT5 predominantly in the cytoplasm. PRMT5 was found to be associated with its enzymatic cofactor Mep50, but not associated with STAT3 or cyclin D1. However, histologic examination of tumor xenografts from athymic mice revealed a heterogeneous pattern of nuclear and cytoplasmic PRMT5 expression. siRNA-mediated depletion of PRMT5 inhibited proliferation in a subset of melanoma cell lines, while it accelerated the growth of others. Loss of PRMT5 also led to reduced expression of MITF (microphthalmia-associated transcription factor), a melanocyte-lineage specific oncogene, and increased expression of the cell cycle regulator p27Kip1.
    [Show full text]
  • Reverse Transcriptase Genes Are Highly Abundant and Transcriptionally Active in Marine Plankton Assemblages
    The ISME Journal (2016) 10, 1134–1146 © 2016 International Society for Microbial Ecology All rights reserved 1751-7362/16 OPEN www.nature.com/ismej ORIGINAL ARTICLE Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages Magali Lescot1, Pascal Hingamp1, Kenji K Kojima2, Emilie Villar1, Sarah Romac3,4, Alaguraj Veluchamy5,11, Martine Boccara5, Olivier Jaillon6,7,8, Daniele Iudicone9, Chris Bowler5, Patrick Wincker6,7,8, Jean-Michel Claverie1 and Hiroyuki Ogata10 1Information Génomique et Structurale, UMR7256, CNRS, Aix-Marseille Université, Institut de Microbiologie de la Méditerranée (FR3479), Parc Scientifique de Luminy, Marseille, France; 2Genetic Information Research Institute, Los Altos, CA, USA; 3CNRS, UMR 7144, team EPEP, Station Biologique de Roscoff, Place Georges Teissier, Roscoff, France; 4Sorbonne Universités, UPMC Univ Paris 06, Station Biologique de Roscoff, Place Georges Teissier, FR-Roscoff, France; 5Ecole Normale Supérieure, PSL Research University, Institut de Biologie de l’Ecole Normale Supérieure (IBENS), Paris, France; 6CEA-Institut de Génomique, GENOSCOPE, Centre National de Séquençage, Evry Cedex, France; 7Université d’Evry, Evry Cedex, France; 8Centre National de la Recherche Scientifique (CNRS), Evry Cedex, France; 9Laboratory of Ecology and Evolution of Plankton, Stazione Zoologica Anton Dohrn, Naples, Italy and 10Bioinformatics Center, Institute for Chemical Research, Kyoto University, Gokasho, Uji, Kyoto, Japan Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (45 μm), where they reached a maximum of 13.5% of the total gene abundance.
    [Show full text]
  • The MER41 Family of Hervs Is Uniquely Involved in the Immune-Mediated Regulation of Cognition/Behavior-Related Genes
    bioRxiv preprint doi: https://doi.org/10.1101/434209; this version posted October 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The MER41 family of HERVs is uniquely involved in the immune-mediated regulation of cognition/behavior-related genes: pathophysiological implications for autism spectrum disorders Serge Nataf*1, 2, 3, Juan Uriagereka4 and Antonio Benitez-Burraco 5 1CarMeN Laboratory, INSERM U1060, INRA U1397, INSA de Lyon, Lyon-Sud Faculty of Medicine, University of Lyon, Pierre-Bénite, France. 2 University of Lyon 1, Lyon, France. 3Banque de Tissus et de Cellules des Hospices Civils de Lyon, Hôpital Edouard Herriot, Lyon, France. 4Department of Linguistics and School of Languages, Literatures & Cultures, University of Maryland, College Park, USA. 5Department of Spanish, Linguistics, and Theory of Literature (Linguistics). Faculty of Philology. University of Seville, Seville, Spain * Corresponding author: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/434209; this version posted October 3, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. ABSTRACT Interferon-gamma (IFNa prototypical T lymphocyte-derived pro-inflammatory cytokine, was recently shown to shape social behavior and neuronal connectivity in rodents. STAT1 (Signal Transducer And Activator Of Transcription 1) is a transcription factor (TF) crucially involved in the IFN pathway.
    [Show full text]
  • Somatic Mutation Analysis of P53 and ST7 Tumor Suppressor Genes in Gastric Carcinoma by DHPLC
    P.O.Box 2345, Beijing 100023,China World J Gastroenterol 2003;9(12):2662-2665 Fax: +86-10-85381893 http://www.paper.edu.cn World Journal of Gastroenterology E-mail: [email protected] www.wjgnet.com Copyright © 2003 by The WJG Press ISSN 1007-9327 • GASTRIC CANCER • Somatic mutation analysis of p53 and ST7 tumor suppressor genes in gastric carcinoma by DHPLC Chong Lu, Hui-Mian Xu, Qun Ren, Yang Ao, Zhen-Ning Wang, Xue Ao, Li Jiang, Yang Luo, Xue Zhang Chong Lu, Hui-Mian Xu, Zhen-Ning Wang, Laboratory of cells in gastric tumor specimens is enough to form Medical Genomics, Oncology Department, the First Affiliated heteroduplex with mutant alleles for DHPLC detection. ST7 Clinical College, China Medical University, Shenyang, 110001, gene may not be the target gene of inactivation at 7q31 site Liaoning Province, China in gastric carcinoma. Qun Ren, Yang Ao, Xue Ao, Li Jiang, Yang Luo, Laboratory of Medical Genomics, China Medical University, Shenyang, 110001, Lu C, Xu HM, Ren Q, Ao Y, Wang ZN, Ao X, Jiang L, Luo Y, Liaoning Province, China Zhang X. Somatic mutation analysis of p53 and ST7 tumor Xue Zhang, Laboratory of Medical Genomics, China Medical suppressor genes in gastric carcinoma by DHPLC. World J University, Shenyang, 110001, Liaoning Province, China. Laboratory Gastroenterol 2003; 9(12): 2662-2665 of Genetics, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing, 100021, China http://www.wjgnet.com/1007-9327/9/2662.asp Supported by National Science Fund for Distinguished Young Scholars, No. 30125017, and the Major State Basic Research Development Program of China (973 Program), No.
    [Show full text]
  • Mutations in the ST7/RAY1/HELG Locus Rarely Occur in Primary Colorectal, Gastric, and Hepatocellular Carcinomas
    British Journal of Cancer (2003) 88, 1909 – 1913 & 2003 Cancer Research UK All rights reserved 0007 – 0920/03 $25.00 www.bjcancer.com Mutations in the ST7/RAY1/HELG locus rarely occur in primary colorectal, gastric, and hepatocellular carcinomas 1,5 1,5 ,1 1 1 1 1 1 S Yoshimura , T Yamada , S Ohwada* , T Koyama , K Hamada , K Tago , I Sakamoto , I Takeyoshi , T Ikeya2, F Makita3, Y Iino4 and Y Morishita1 1 2 Second Department of Surgery, Gunma University Faculty of Medicine, 3-39-15, Showa-machi, Maebashi, Gunma 371-8511, Japan; Maebashi Red 3 Cross Hospital, 3-21-36, Asahi-cho, Maebashi, Gunma 371-0014, Japan; National Nishi-Gunma Hospital, 2854, Kanai, Shibukawa, Gunma 377-8511, Japan; 4Department of Emergency and Critical Care Medicine, Gunma University Faculty of Medicine, 3-39-15, Showa-machi, Maebashi, Gunma 371-8511, Japan Human cancers frequently show a loss of heterozygosity on chromosome 7q31, which indicates the existence of broad-range tumour-suppressor gene(s) at this locus. Truncating mutations in the ST7 gene at this locus are seen frequently in primary colon cancer and breast cancer cell lines. Therefore, the ST7 gene represents a novel candidate gene for the tumour suppressor at this locus. However, more recent studies have reported that ST7 mutations are infrequent or absent in primary cancer and cell lines. To ascertain the frequency of mutations of the ST7 gene in cancer cells, we examined mutations in the ST7 coding sequence in 48 colorectal, 48 gastric, and 48 hepatocellular carcinomas using polymerase chain reaction–single-strand conformational polymorphism and direct sequencing.
    [Show full text]
  • Lack of Mutations Within ST7 Gene in Tumour-Derived Cell Lines and Primary Epithelial Tumours
    British Journal of Cancer (2002) 87, 208 – 211 ª 2002 Cancer Research UK All rights reserved 0007 – 0920/02 $25.00 www.bjcancer.com Short Communication Lack of mutations within ST7 gene in tumour-derived cell lines and primary epithelial tumours VL Brown1, CM Proby1, DM Barnes2 and DP Kelsell*,1 1Centre for Cutaneous Research, Barts and The London, Queen Mary’s School of Medicine and Dentistry, 2 Newark Street, Whitechapel, London E1 2AT, UK; 2Hedley Atkins/Cancer Research UK Breast Pathology Laboratory, Guy’s Hospital, Thomas Guy House, St. Thomas Street, London SE1 9RT, UK ST7 is a candidate tumour suppressor gene at human chromosome locus 7q31.1. We have performed mutational analysis of ST7 in a wide-range of cell lines and primary epithelial cancers and detected only one missense change in a breast cancer cell line. Other mutations previously found in cell lines and primary tumours were not evident in our analysis. These results imply that another tumour suppressor gene at this locus may be more important than ST7 in carcinogenesis. British Journal of Cancer (2002) 87, 208 – 211. doi:10.1038/sj.bjc.6600418 www.bjcancer.com ª 2002 Cancer Research UK Keywords: ST7 gene; mutation; tumour suppressor gene Many strands of evidence point to an important tumour To explore this further, we have performed mutational analysis suppressor gene (TSG) on human chromosome 7q31. Frequent of ST7 exons 3, 5 and 12 in a variety of cell lines (cancerous and deletions within 7q in cytogenetic analyses and a high rate of non-cancerous) and primary epithelial cancer tissues.
    [Show full text]
  • ST7 Polyclonal Antibody
    For Research Use Only ST7 Polyclonal antibody Catalog Number:11945-1-AP 1 Publications www.ptgcn.com Catalog Number: GenBank Accession Number: Recommended Dilutions: Basic Information 11945-1-AP BC030954 WB 1:500-1:2000 Size: GeneID (NCBI): IHC 1:50-1:500 700 μg/ml 7982 Source: Full Name: Rabbit suppression of tumorigenicity 7 Isotype: Calculated MW: IgG 63 kDa Purification Method: Observed MW: Antigen affinity purification 63 kDa Immunogen Catalog Number: AG2547 Applications Tested Applications: Positive Controls: IHC, WB,ELISA WB : HeLa cells; mouse brain tissue, Jurkat cells, PC-3 Cited Applications: cells WB IHC : human liver cancer tissue; human pancreas tissue Species Specificity: human, mouse Cited Species: human Note-IHC: suggested antigen retrieval with TE buffer pH 9.0; (*) Alternatively, antigen retrieval may be performed with citrate buffer pH 6.0 Human ST7 (suppressor of tumorigenicity 7) gene, also called FAM4A1, HELG or RAY1, maps to a region on Background Information chromosome 7 identified as an autism-susceptibility locus. ST7 has been proposed to be a tumor suppressor gene with highest expression in heart, liver and pancreas. The product of this gene is a multi-pass membrane protein belonging to the ST7 family, full-length ST7 cDNA has been cloned and verified in cancer cell lines, recent result suggests that ST7 may mediate tumor suppression through the regulation of the genes involved in maintaining the cellular structure of the cell and involved in oncogenic pathways. Notable Publications Author Pubmed ID Journal Application Fengting Yan 24453002 Cancer Res WB Storage: Storage Store at -20ºC. Stable for one year after shipment.
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]
  • Gene Amplifications at Chromosome 7 of the Human Gastric Cancer Genome
    225-231 4/7/07 20:50 Page 225 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 20: 225-231, 2007 225 Gene amplifications at chromosome 7 of the human gastric cancer genome SANGHWA YANG Cancer Metastasis Research Center, Yonsei University College of Medicine, 134 Shinchon-Dong, Seoul 120-752, Korea Received April 20, 2007; Accepted May 7, 2007 Abstract. Genetic aberrations at chromosome 7 are known to Introduction be related with diverse human diseases, including cancer and autism. In a number of cancer research areas involving gastric The completion of human genome sequencing and the cancer, several comparative genomic hybridization studies subsequent gene annotations, together with a rapid develop- employing metaphase chromosome or BAC clone micro- ment of high throughput screening technologies, such as DNA arrays have repeatedly identified human chromosome 7 microarrays, have made it possible to perform genome-scale as containing ‘regions of changes’ related with cancer expression profiling and comparative genomic hybridizations progression. cDNA microarray-based comparative genomic (CGHs) in various cancer models. The elucidation of gene hybridization can be used to directly identify individual target copy number variations in several cancer genomes is generating genes undergoing copy number variations. Copy number very informative results. Metaphase chromosome CGH and change analysis for 17,000 genes on a microarray format was the recent introduction of BAC and especially cDNA micro- performed with tumor and normal gastric tissues from 30 array-based CGHs (aCGH) (1) have greatly contributed to patients. A group of 90 genes undergoing copy number the identification of chromosome aberrations and of amplified increases (gene amplification) at the p11~p22 or q21~q36 and deleted genes in gastric cancer tissues and cell lines (2-9).
    [Show full text]
  • Genetic Resistance to Diet-Induced Obesity in Mice
    GENETIC RESISTANCE TO DIET-INDUCED OBESITY IN MICE By LINDSAY CATHERINE BURRAGE Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Thesis Advisors: Dr. Joseph H. Nadeau Dr. Colleen M. Croniger Department of Genetics CASE WESTERN RESERVE UNIVERSITY August, 2006 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of ______________________________________________________ candidate for the Ph.D. degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. Copyright © 2006 by Lindsay Catherine Burrage All rights reserved 1 TABLE OF CONTENTS 2 LIST OF TABLES. 4 LIST OF FIGURES. 8 ACKNOWLEDGEMENTS . 12 LIST OF ABBREVIATIONS. 14 ABSTRACT. 19 CHAPTER I: INTRODUCTION AND SUMMARY OF RESEARCH AIMS. 21 A. Obesity: An introduction. 22 1. Historical perspective. .22 2. Definition and prevalence of human obesity. 22 3. Causes of human obesity. 26 4. Pathological consequences of obesity. 28 5. Physiologic control of energy balance and body weight. 32 6. Treatment of human obesity. 35 B. Genetics of obesity. 36 1. An introduction to obesity genetics. 36 2. Genetic forms of obesity. 37 C. Methods for investigating the genetics of obesity. 42 1. Genetic studies of obesity in humans. 42 2. Genetic studies of obesity in mouse. 43 D. C57BL/6J and A/J inbred strains: Mouse models for obesity. 52 1. Differential susceptibility to diet-induced obesity in C57BL/6J and A/J male mice. 52 2. Energy metabolism in C57BL/6J and A/J male mice.
    [Show full text]