Absence of ST7 Gene Alterations in Human Cancer

Absence of ST7 Gene Alterations in Human Cancer

Vol. 8, 2939–2941, September 2002 Clinical Cancer Research 2939 Absence of ST7 Gene Alterations in Human Cancer Seung Myung Dong and David Sidransky1 (15, 16). These findings suggest the presence of a broad range Department of Otolaryngology-Head and Neck Surgery, Head and TSG on human chromosome 7q31-q31.2. Neck Cancer Research Division, Johns Hopkins University School of In search of a TSG in the 7q31 critical region, LOH and Medicine, Baltimore, Maryland 21205-2196 microcell fusion studies narrowed the region, and a positional cloning strategy identified a candidate suppressor gene, named ST7, that is involved in a variety of human cancers (17). More- ABSTRACT over, somatic mutations of ST7 were reported in human cell The ST7 gene was cloned and mapped to chromosome lines derived from breast cancer and primary colon carcinomas. 7q31.1-q31.2, a region suspected of containing a tumor sup- Breast tumor cell lines (MDA-MB435s, T-47-D, and MDA- pressor gene involved in a variety of human cancers. Sub- MB231) and 40% of primary colon carcinomas with LOH of sequent investigation described the presence of ST7 muta- D7S522/D7S677 were reported to harbor mutations predicted to tions in human cell lines derived from breast tumors and yield a truncated ST7 protein. primary colon carcinoma. Introduction of the ST7 cDNA Because we (18) and others (12, 19–21) found evidence of into a prostate cancer-derived cell line abrogated in vivo LOH 7q31, we investigated a series of primary HNSCCs, inva- tumorigenecity in nude mice. To clarify the role of the ST7 sive DCB, and adenocarcinomas of the colon in search of ST7 gene in cancer, we scrutinized primary head and neck squa- mutations. mous cell carcinomas, invasive ductal carcinomas of the breast, and adenocarcinomas of the colon. Loss of heterozy- gosity of D7S522/D7S677 was detected in 24% (4 of 17) of MATERIALS AND METHODS head and neck squamous cell carcinomas, 17% (2 of 12) of Samples and DNA Extraction. A series of 17 primary invasive ductal carcinomas of the breast, and 33% (8 of 24) HNSCCs, 12 invasive DCB, and 24 colon primary carcinomas of adenocarcinomas of the colon, but no somatic mutations were obtained for ST7 screening. Seventeen primary HNSCCs were found in any of these specimens. We then searched for were selected that showed LOH of 7q22-q31 region from our mutations in breast cancer cell lines and found a complete previous study (18). Twelve primary breast carcinomas were wild-type sequence in all, including cell lines previously obtained from the Department of Pathology, University campus reported to harbor mutations. We believe that the ST7 gene BioMedico (Rome, Italy), and 24 primary colon carcinomas is not a primary target of inactivation in most human can- were obtained from Johns Hopkins Hospital (Baltimore, MD). cers with loss of heterozygosity at 7q31.1-q31.2. We also tested three breast tumor-derived cell lines reported to harbor mutations of ST7 (MDA-MB435s, T-47-D, and MDA- INTRODUCTION MB231), purchased from American Type Culture Collection. Tumor tissue was selected from an area with greater than 75% Genetic alterations of the human chromosomal region 7q malignant cells. DNA was purified by phenol-chloroform ex- are common in human cancer (1). LOH2 of the 7q31-q32 region traction and ethanol precipitation and dissolved in 50 ␮lof has been reported in breast, prostate, pancreatic, ovarian, gastric, distilled water, as described previously (22). colon, and head and neck cancer, as well as uterine leiomyomas Microsatellite Analysis. DNA from tumor and normal and malignant myeloid disease (2–13). Furthermore, the intro- control was examined for LOH by PCR-based microsatellite duction of an intact copy of human chromosome 7 into immor- analysis. Markers D7S522 and D7S677 were used to identify talized human fibroblasts cell lines with LOH/allelic imbalance alterations 7q31.1. PCR conditions and criteria for LOH and at 7q31-q32 restore programmed senescence to the cells (14). In homozygous deletion were described previously (23). addition, transfer of human chromosome 7 inhibits tumorigene- Sequence Analysis. We carried out manual genomic se- city in most tumor explants and complete suppression in others quencing. We designed intronic primers that included the intron/ exon boundary for sequence analysis of the ST7 gene [GenBank accession no. AC009152 (cDNA), AC106873 (exon 1), AC002542 (exons 2–15), and AC003987 (exon 16); Table 1]. Received 1/16/02; revised 5/30/02; accepted 6/3/02. After detection of a PCR product, direct PCR sequencing reac- The costs of publication of this article were defrayed in part by the tions were performed using the Amplicycle Sequencing Kit payment of page charges. This article must therefore be hereby marked (Perkin-Elmer, Branchburg, NJ) and sequenced on a Genomyx advertisement in accordance with 18 U.S.C. Section 1734 solely to electrophoresis apparatus. We carried out both manual and indicate this fact. 1 To whom requests for reprints should be addressed, at Department of fluorescent DNA sequencing for exons 3, 5, and 12 of ST7 in the Otolaryngology B Head and Neck Surgery, Division of Head and Neck three breast cancer cell lines. We further performed thermal Cancer Research, The Johns Hopkins University School of Medicine, cycling, followed by cloning of PCR products, with The Orig- 818 Ross Research Building, 720 Rutland Avenue, Baltimore, MD inal TA Cloning Kit (Invitrogen, Carlsbad, CA). After purifica- 21205-2196. E-mail: [email protected]. 2 The abbreviations used are: LOH, loss of heterozygosity; TSG, tumor tion of clones containing ST7 exons, they were analyzed by the suppressor gene; HNSCC, head and neck squamous cell carcinoma; Sequence Analysis Facility of The Johns Hopkins University to DCB, ductal carcinoma(s) of the breast. independently confirm our results in the cell lines. Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2002 American Association for Cancer Research. 2940 Absence of ST7 Gene Alterations in Human Cancer Table 1 PCR primer sequences for sequencing ST7 Sense Antisense Exon 1 5Ј-81948CCGGCTCATCTCTTCACTCT81967-3Ј 5Ј-82103AGCAGAGAAGTGGGATCCAT82084-3Ј Exon 2 5Ј-63573TCCTTGTTCTTCTCCCTTTCTC63594-3Ј 5Ј-63722TTTAAATGAGAAGGACTCCACCA63700-3Ј Exon 3 5Ј-83382CCATAAACACGCTTATTTTTCTGT83405-3Ј 5Ј-83605GCAAATAATATTGCAAACTGAAG83582-3Ј Exon 4 5Ј-93561AGGAAGGGTGTTTTGCTGAA93580-3Ј 5Ј-93729CCATTTGTTTCCCAAGCTGT93710-3Ј Exon 5 5Ј-94292TTGCTTTTCTCTCTCAAAAGTGTC94313-3Ј 5Ј-94492CCTCCCATTCAGAAGGATGT94472-3Ј Exon 6 5Ј-95699TGGATTGACTTGGTGTTTTCTC95720-3Ј 5Ј-95832AGCAAGATTTTCCCCCACTT95813-3Ј Exon 7 5Ј-97888CCCTGAACTCCGAAAATGACA97907-3Ј 5Ј-98065CACCCAACAGGTTCTTGACTT98045-3Ј Exon 8 5Ј-99888CCTTGGCTTTGTAATTGATGG99908-3Ј 5Ј-100108CATCAACCTGCAGGAAACCT100089-3Ј Exon 9 5Ј-102211AGGCAAATGGGCCTCTGTAT102240-3Ј 5Ј-102416AAGCCACTGATCCCAAACAC102397-3Ј Exon 10 5Ј-134691CCTTGGTTTCTTCTGCCCTA134710-3Ј 5Ј-134884CAGGGAAAATACATCAAAAGAGG134862-3Ј Exon 11 5Ј-153117TTGCTCTTTGTTACCTGCAAA153127-3Ј 5Ј-153276GCATTAGTACCGCGCAAACT153257-3Ј Exon 12 5Ј-154650CCACCTGGATGGTTTTTGTC154679-3Ј 5Ј-154819TAACGAGTTCCTGTGGGGAT154800-3Ј Exon 13 5Ј-137606AACACAAGTGTGTCCTGCTTTTT173628-3Ј 5Ј-173843CATTTTAGCACCTTTTCATGCTC173821-3Ј Exon 14 5Ј-182872TGCAGTTGGGAAGTTATGACA182892-3Ј 5Ј-183069TTTCACCACACACCCTCACT183050-3Ј Exon 15 5Ј-185752CCCTTTTGGTCTTCTCCACA185771-3Ј 5Ј-185972GCTTTTATGCCCTTGGCTTT185955-3Ј Exon 16 5Ј-4997TGGGTGGAGAGGTTTGTTTT5016-3Ј 5Ј-5195GGTGAGGTGAGTGGAGGACA5176-3Ј ST7 gene. The frequency of LOH of DCB and HNSCCs was somewhat lower than previous reports (17). In search of ST7 gene mutations, we sequenced all of the 53 primary tumors. None of the tumors displayed any changes in the coding regions or intron/exon boundaries. Any of these primary tumors were previously found to harbor point mutations in other TSGs (18, 24, 25). We then investigated the breast tumor cell lines MDA-MB435s, T-47-D, and MDA-MB231 to confirm previous reports of ST7 gene alterations (17). We did not find any mutations in these cell lines (Fig. 1) by manual sequencing or automated sequencing. We further cloned the PCR products and sequenced 10 clones containing the exons where mutations were previously reported. Again, the wild-type sequence was confirmed in all three cell lines. The majority of previously reported mutations in the ST7 gene were identified as single base pair deletions or insertions predicted to form truncated proteins. Little is still known about ST7 function, but true truncation mutations would be expected to abrogate suppressor function. We have found that automated sequence analysis can both underestimate mutation frequency and also results in false positives, especially if not confirmed by sequence analysis in both directions (26). At this writing, two other recent reports support the absence of ST7 alterations in 128 human tumors (27, 28). Fig. 1 ST7 DNA sequence in tumor-derived cell lines. Exons encom- passing the reported mutations in these cell lines were PCR amplifica- The complete absence of mutations in our series of primary tion from genomic DNA with intron-specific primers. Representative tumors and absence of putative mutations in breast cell lines DNA sequence data for AY009152 nt 456–477 of MDA-MB435s (A), argue against a prominent role of ST7 in these tumor types. nt 683–705 of T-47-D (B), and nt 1354–1375 of MDA-MN231 (C). The However, our work does not exclude a tumor suppressor role for arrows indicate the positions of the purported mutations (466insT in ST7 based on the reported functional studies. Other mechanisms MDA-MB435s,

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    4 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us