Evolutionary Perspective of Nicotine to Nornicotine Conversion, Its Regulation and Characterization of Ein2 Mediated Ethylene Signaling in Tobacco

University of Kentucky UKnowledge

University of Kentucky Doctoral Dissertations Graduate School

2010

EVOLUTIONARY PERSPECTIVE OF NICOTINE TO NORNICOTINE CONVERSION, ITS REGULATION AND CHARACTERIZATION OF EIN2 MEDIATED ETHYLENE SIGNALING IN TOBACCO

Manohar Chakrabarti University of Kentucky, [email protected]

Right click to open a feedback form in a new tab to let us know how this document benefits ou.y

Recommended Citation Chakrabarti, Manohar, "EVOLUTIONARY PERSPECTIVE OF NICOTINE TO NORNICOTINE CONVERSION, ITS REGULATION AND CHARACTERIZATION OF EIN2 MEDIATED ETHYLENE SIGNALING IN TOBACCO" (2010). University of Kentucky Doctoral Dissertations. 88. https://uknowledge.uky.edu/gradschool_diss/88

This Dissertation is brought to you for free and open access by the Graduate School at UKnowledge. It has been accepted for inclusion in University of Kentucky Doctoral Dissertations by an authorized administrator of UKnowledge. For more information, please contact [email protected]. ABSTRACT OF DISSERTATION

MANOHAR CHAKRABARTI

The Graduate School University of Kentucky 2010 EVOLUTIONARY PERSPECTIVE OF NICOTINE TO NORNICOTINE CONVERSION, ITS REGULATION AND CHARACTERIZATION OF EIN2 MEDIATED ETHYLENE SIGNALING IN TOBACCO

ABSTRACT OF DISSERTATION

A dissertation submitted in partial fulfillment of the requirements for the Doctor of Philosophy in Plant Physiology in the College of Agriculture at the University of Kentucky

By Manohar Chakrabarti Lexington, Kentucky

Director: Dr. Sharyn E. Perry, Associate Professor of Plant and Soil Sciences Lexington, Kentucky 2010

ABSTRACT OF DISSERTATION

EVOLUTIONARY PERSPECTIVE OF NICOTINE TO NORNICOTINE CONVERSION, ITS REGULATION AND CHARACTERIZATION OF EIN2 MEDIATED ETHYLENE SIGNALING IN TOBACCO

Nicotine, nornicotine, anabasine and anatabine are four major alkaloids in tobacco, of which nicotine is predominant. In many tobacco cultivars and also in other Nicotiana species, nicotine is converted to nornicotine, which in turn gives rise to potent carcinogen NNN. Nicotine to nornicotine conversion via nicotine-N-demethylation is mediated by the CYP82E family of P450 enzymes. Tobacco (Nicotiana tabacum) converts in senescing leaves, while its diploid progenitors N.tomentosiformis and N.sylvestris convert in both green and senescing and only in senescing leaves, respectively. Previously it has been shown that N.tomentosiformis has different active conversion loci in green and senescing leaves. The green leaf conversion enzyme CYP82E3 is inactivated in tobacco by a single amino acid substitution, while the senescing leaf converter enzyme CYP82E4 is active in tobacco, which gave tobacco a ‘senescing leaf converter’ phenotype. In nonconverter tobacco, CYP82E4 shows transcriptional silencing. The nicotine-N-demethylase gene NsylCYP82E2 involved in nicotine to nornicotine conversion in senesced leaves of N. sylvestris was isolated. NsylCYP82E2 is active in N. sylvestris, but it has become inactivated in tobacco through mutations causing two amino acid substitutions. The conversion factor from N.sylvestris was characterized and a model for the alkaloid profile evolution in the amphidiploid N.tabacum from its diploid progenitors was proposed. Regulation of conversion phenomenon was tested under different spatio-temporal conditions and various stresses. The promoter region for NtabCYP82E4 was isolated and promoter-reporter construct was used to determine that NtabCYP82E4 is specifically induced only during senescence. This pattern correlates with the nornicotine accumulation as measured by alkaloid profiling. Thus the regulatory regions of NtabCYP82E4 represent a senescence specific promoter. In another project functional characterization of tobacco EIN2 (NtabEIN2) was undertaken. EIN2 from tobacco and N.sylvestris were cloned, their genomic structure was deduced and NtabEIN2 was silenced using RNAi approach. Silenced plants showed significant delay in petal senescence and abscission; as well as anther dehiscence, pod maturation, pod size, seed yield and defense against tobacco hornworm. Mechanism of delayed petal senescence phenotype, including possible cross-talk with Auxin Response Factor 2 and potential involvement of tasiRNA3 were also investigated.

KEYWORDS: Nicotine to nornicotine conversion, Polyploidy and gene silencing, Senescence- associated-genes, Ethylene, EIN2

Manohar Chakrabarti

February, 2010

EVOLUTIONARY PERSPECTIVE OF NICOTINE TO NORNICOTINE CONVERSION, ITS REGULATION AND CHARACTERIZATION OF EIN2 MEDIATED ETHYLENE SIGNALING IN TOBACCO

Manohar Chakrabarti

Dr. Sharyn E. Perry Director of Dissertation

Dr. Arthur G. Hunt Director of Graduate Studies

February, 2010

RULES FOR THE USE OF DISSERTATIONS Unpublished dissertation submitted for the Doctor’s degree and deposited in the University of Kentucky Library are as a rule open for inspection, but are to be used only with due regard to the rights of the authors. Bibliographical references may be noted, but quotations or summaries of parts may be published only with the permission of the author, and with the usual scholarly acknowledgements.

Extensive copying or publication of the dissertation in whole or in part also requires the consent of the Dean of the Graduate School of the University of Kentucky.

A library that borrows this dissertation for the use by its patrons is expected to secure the signature of each user.

Name Date

DISSERTATION

Manohar Chakrabarti

The Graduate School University Of Kentucky 2010 EVOLUTIONARY PERSPECTIVE OF NICOTINE TO NORNICOTINE CONVERSION, ITS REGULATION AND CHARACTERIZATION OF EIN2 MEDIATED ETHYLENE SIGNALING IN TOBACCO

DISSERTATION

A dissertation submitted in partial fulfillment of the requirements for the Doctor of Philosophy in Plant Physiology in the College of Agriculture at the University of Kentucky

By Manohar Chakrabarti Lexington, Kentucky

Director: Dr. Sharyn E. Perry, Associate Professor of Plant and Soil Sciences, Lexington, Kentucky 2010

DEDICATION This dissertation is dedicated to the memory of two very special people, who have significant influence in my life- my grandfather Sri Gour Chandra Chakrabarti and my teacher Dr. Pranab Kumar Gayen

ACKNOWLEDGEMENTS My journey at the University of Kentucky would not have become fruitful without the advice and assistance of some special persons. I am really indebted to Dr. Balazs Siminszky for providing me an opportunity to pursue my doctoral research in his lab and for his constant support for helping me to have a grasp of basic molecular biology and to develop the ability to think independently. I am grateful to Dr. Sharyn Perry for her untiring support both before and after I joined her lab.

Special thanks to Dr. Perry for accommodating me in her lab, when I was in need. I would like thank Dr. Lowell Bush for his advice and suggestion regarding my projects and also I would like to acknowledge his lab’s generous help with the alkaloid analysis. I am grateful to my committee members Dr. David Hildebrand and Dr. Subba Reddy Palli for their valuable suggestions on my research. I am thankful to Dr. Carol Baskin for agreeing to serve as external examiner for my defense. I would like to thank Dr. Guiliang Tang and his lab for helping me to gain some expertise on small RNA research. I would like to acknowledge the help from Dr. Ralph Dewey’s lab at

North Carolina State University. Thanks to Dr. Robert Geneve and his lab for helping me with microscopy and ethylene experiments, and Plant Disease Diagnostic Lab for assisting with the pathogen identification. I am grateful to Dr. Michael Barrett and William Witt for allowing me to use the weed science lab and greenhouse space. I would like to thank all my lab members, including Lily Gavilano, Nicholas Coleman, Karen Meekins and Brittany Swatzel from Siminszky lab, and Yumei Zheng and Kate Mitchell from Perry lab. I am grateful to the Department of Plant and Soil Sciences for providing me graduate research assistantship and for funding my research. I would like to thank all my teachers, staffs of the Department of Plant and Soil Sciences and my friends at UK for their help during my tenure at UK.

Special thanks to Dr. Sitakanta Pattanaik for his constant support both in professional and personal spheres. I learned a lot from him, which will help me to evolve as a better researcher in future.

Finally, I would like to thank my parents, sister and brother-in-law for their constant support for all through these years. Without their help I could not even think of making up to this level today.

iii

Table of Contents

Acknowledgements………………………………………………………………………………... iii Table of contents……………………………………………………………………………………iv List of tables……………………………………………………………………………...... vii List of figures……………………………………………………………………………………. viii List of files………………………………………………………………………………………… x Chapter 1. Literature Review………………………………………………………………………. 1 1.1. Tobacco alkaloids……………………………………………………………………..1 1.1.1. Alkaloid profile in the genus Nicotiana…………………………………………. 1 1.1.2. Biosynthesis of nicotine and nicotine related alkaloids…………………………. 2 1.1.3. Tobacco and health issues………………………………………………………. 4 1.1.4. Early years of nicotine to nornicotine conversion research…………...... …… 6 1.1.5. Biochemical and molecular characterization of N demethylation of nicotine...... 8 1.1.6. Cytochrome P450s in alkaloid biosynthesis…………………………………….10 1.1.7. Spatio-temporal distribution of nicotine to nornicotine conversion…………… 13 1.2. Ethylene: biosynthesis, signaling and responses…………………………………….13 1.2.1. Biosynthesis of ethylene………………………………………………………...13 1.2.2. Role of ethylene in developmental and physiological responses…………….....15 1.2.3. Ethylene signaling………………………………………………………………20 Chapter 2. Inactivation of CYP82E2 by Degenerative Mutations was a Key Event in the

Evolution of the Alkaloid Profile of Modern Tobacco……………………………………………24 2.1. Introduction………………………………………………………………………...... 25 2.2. Materials and methods…………………………………………………………….....26 2.2.1. Plant materials and alkaloid analysis……………………………………………..26 2.2.2. Isolation of the NsylCYP82E2 cDNA…………………………………………….27 2.2.3. Isolation of the genomic clones of the CYP82E2 orthologs………………………27 2.2.4. Site-directed mutagenesis and expression of CYP82E2 variants in yeast………..28 2.2.5. Evaluation and kinetic analysis of CYP82E2-mediated nicotine

metabolism………………………………………………………………………………28 2.2.6. Allele-specific PCR……………………………………………………………….29 2.2.7. Quantitative Real Time-PCR analysis…………………………………………….29 2.3. Results……………………………………………………………………………….. 29 2.3.1. Alkaloid analysis of plant samples……………………………………………….29 2.3.2. Isolation of the NsylCYP82E2 cDNA…………………………………………….31 iv

2.3.3. The NsylCYP82E2 cDNA encodes a functional NND…………………………….32 2.3.4. Isolation of the genomic NsylCYP82E2 clone……………………………………33 2.3.5. NsylCYP82E2 is associated with the senescing-leaf converter phenotype of N.

sylvestris…………………………………………………………………………………33 2.3.6. Expression of NsylCYP82E2 and NtabCYP82E2 is induced in the senescing

leaf……………………………………………………………………………………….35 2.4. Discussion……………………………………………………………………………36 2.5. Summary……………………………………………………………………………. 40 Chapter 3. CYP82E4-mediated nicotine to nornicotine conversion in tobacco is regulated by a senescence-specific signaling pathway…………………………………………. 41 3.1. Introduction…………………………………………………………………………. 42 3.2. Materials and methods……………………………………………………………… 43 3.2.1. Isolation of CYP82E4 promoter region…………………………………………. 43 3.2.2. Generation of the CYP82E4:GUS and the promoter less GUS constructs………44 3.2.3. Generation of transgenic plants…………………………………………………. 45 3.2.4. Plant treatments…………………………………………………………………. 45 3.2.5. Histochemical and fluorometric GUS activity assays and alkaloid analysis…….47 3.3. Results………………………………………………………………………………. 48 3.3.1. Generation of transgenic CYP82E4:GUS tobacco lines…………………………48 3.3.2. Expression of the CYP82E4 promoter is differentially regulated in various organs…………………………………………………………………………..49 3.3.3. Expression of the CYP82E4 promoter in converter and nonconverter

tobacco……………………………………………………………………………...... 53 3.3.4. Expression of the CYP82E4 in leaves is senescence-specific……………………53 3.4. Discussion……………………………………………………………………………57 3.5. Summary……………………………………………………………………………. 61 Chapter 4. Functional characterization of EIN2 mediated ethylene signaling in tobacco………...62 4.1. Introduction………………………………………………………………………… 63 4.2. Materials and methods……………………………………………………………… 64 4.2.1. Isolation of tobacco EIN2……………………………………………………….. 64 4.2.2. Data mining and Phylogenetic analysis………………………………………….65 4.2.3. Generating EIN2RNAi transgenic lines…………………………………………. 65 4.2.4. Collection of phenotypic data…………………………………………………… 66 4.2.5. Measuring electrical conductivity and DNA laddering…………………………. 67

4.2.6. Identification of the pathogen responsible for early plant death…………………67 4.2.7. Insect bioassay……………………………………………………………………67 4.2.8. Quantitative real time PCR………………………………………………………68 4.3. Results………………………………………………………………………………. 68 4.3.1. Isolation of tobacco EIN2……………………………………………………….. 68 4.3.2. Generation of EIN2 silenced tobacco lines and expression of NtabEIN2 in

wild type and EIN2 silenced lines………………………………………………………70 4.3.3. NtabEIN2 regulates adventitious root formation, petal senescence, anther

dehiscence and abscission………………………………………………………………72 4.3.4. Reduction in ion leakage, DNA laddering and expression of peroxidase in EIN2RNAi background……………………………………………………………...... 75 4.3.5. Silencing of NtabEIN2 delays pod maturation, adversely affect pod and

seed development……………………………………………………………………….77 4.3.6. NtabEIN2 silencing has negative impact on plant defense………………………78 4.3.7. EIN2-ARF2 cross-talk during senescence………………………………………78 4.4. Discussion………………………………………………………………………...….79 4.5. Summary……………………………………………………………………………. 85 Chapter 5. Future directions…………………………………………………………………….... 86 Appendices……………………………………………………………………………………….. 88 References…………………………………………………………………………………………95 VITA……………………………………………………………………………………………. 117

List of tables Table 2.1. Alkaloid profiles of the green and cured leaves of Nicotiana plants used in the study…………………………………………………………………… 30 Table 2.2. Polymorphic variations of the CYP82E2 orthologs in N. sylvestris

and various tobacco genotypes……………………………………………………. 32 Table 2.3. NND activity of CYP82E2 variants……………………………………………….. 33 Table 2.4. Absolute quantification of the CYP82E2 cDNA derived from the green and cured leaves of N.sylvestris and DH98-325-5 and DH98-325-6 tobacco by qRT-PCR analysis…………………………………………………….. 34

vii

List of figures Figure 1.1. Biosynthetic pathway of nicotine and related alkaloids…………………………….. 2 Figure 1.2. An illustration of Mann et al (1964)’s work………………………………………… 8 Figure 1.3. Structure of the heme group of P450s (in reduced state)…………………………… 11 Figure 1.4. Structural backbone of benzylisoquinoline and indole alkaloids…………………… 12 Figure 1.5. Biosynthetic pathway of ethylene…………………………………………………… 14 Figure 1.6. Ethylene signaling network…………………………………………………………. 23 Figure 2.1. Allele-specific amplification of the CYP82E2 orthologs from the genomic DNA of Nicotiana sylvestris and various tobacco genotypes………………….. 34 Figure 2.2. Proposed model for the evolution of the alkaloid profile of tobacco………………. 38 Figure 3.1. Senescence-induced activation of GUS activity in the leaves of 3-month-old

DH98-325-6 tobacco line carrying the CYP82E4:GUS construct……………………… 49 Figure 3.2. Illustrations of leaf and flower phenotypes at different stages of development and histochemical localization of GUS activity in various organs………... 50 Figure 3.3. Fluorometric analysis of GUS activity in the root of CYP82E4:GUS-

transformed DH98-325-6 plants at different developmental stages……………………... 51 Figure 3.4. Senescence-induced activation of GUS activity in the tobacco flowers…………… 52 Figure 3.5. Fluorometric analysis of GUS activity in the green and artificially cured leaf of

CYP82E4:GUS-transformed nonconverter and converter tobacco……………………… 53 Figure 3.6. GUS activity, nicotine conversion and chlorophyll content at different

developmental stages of the leaves 48 and 96 hrs after ethylene treatment……………... 54 Figure 3.7. GUS activity, nicotine conversion and chlorophyll content in the leaf 15 hrs

and 96 hrs after the heat shock-induced systemic TMV infection………………………. 55 Figure 3.8. GUS activity and nicotine conversion in the leaf following various stresses

and signaling molecule treatments………………………………………………………. 57 Figure 4.1. Characteristics of NtabEIN2 and its comparison with other EIN2s………………... 69 Figure 4.2. Map of the EIN2RNAi construct and Petal senescence data from T0

generation……………………………………………………………………………...... 70 Figure 4.3. Expression analysis of EIN2 by quantitative real time PCR……………………….. 71 Figure 4.4. Diverse effects of silencing NtabEIN2……………………………………………... 73 Figure 4.5. Silencing NtabEIN2 delays petal senescence………………………………………. 74 Figure 4.6. Solute leakage, DNA fragmentation and expression of peroxidase………………... 76 Figure 4.7. Role of NtabEIN2 in pod and seed development………………………………… 77 Figure 4.8. Role of NtabEIN2 in insect herbivory……………………………………………… 78

viii

Figure 4.9. Cross-talk between EIN2 and ARF2……………………………………………….. 79 Figure 4.10. Model integrating EIN2 and ARF2 mediated pathways to regulate

senescence………………………………………………………………………………... 85

List of files ManoharPhD.pdf………………………………………………………………….5.6 MB

Chapter 1. Review of literature 1.1. Tobacco alkaloids 1.1.1. Alkaloid profile in the genus Nicotiana Plant secondary metabolites play an important role in plants’ response to the environment and in plant defense. Secondary metabolites are also important for generating natural products, which are used to develop medicines, food additives, cosmetics, etc. Alkaloids are an important class of secondary or specialized metabolites, which have been studied for a long time. Alkaloids are important in terms of plant defense against pathogens and herbivores and have been used as medicines. Since, the discovery of first plant alkaloid, morphine from Opium poppy, more than 1500 alkaloids have been characterized (Kutchan, 1995). Alkaloid metabolism of tobacco (Nicotiana tabacum) has been an active area of research for years. Nicotiana was named after the French diplomat Jean Nicot, who popularized tobacco in Europe during the mid sixteenth century (Hakkinen and Oksman-Caldentey, 2004). Alkaloid profiling of 64 different species of the genus Nicotiana reveal distinct patterns among various species (Sisson et al., 1990). In the majority of the species, a single alkaloid is predominant over others. Four major alkaloids are nicotine, nornicotine, anabasine and anatabine. Proportions of species accumulating either nicotine or nornicotine as the major alkaloid are close. Anabasine predominates in four species: N. noctiflora, N. petunioides, N. debneyi and N. glauca. Besides, the major alkaloid, a secondary alkaloid constitutes the bulk portion of the remainder. Combination of nicotine as the primary and nornicotine as the secondary alkaloid is most abundant and the close runner up is the nornicotine as primary and nicotine as secondary alkaloid. Nicotine- anabasine is also found in some species. Alkaloid content can also vary with the development or treatments. In eleven species nicotine was accumulated in the green leaves, while nornicotine accumulated in the air-cured leaves. Out of the 64 species included in the study, 47% accumulate nornicotine in both green and cured leaves, 17 % accumulate nicotine in the green leaves and nornicotine in the cured leaves, 31 % accumulate nicotine in both green and cured leaves and 5 % accumulate anabasine. Interestingly, nicotine is also found in other solanaceous plants and also in lycopods and horsetails (Flores et al., 1991). Solanaceous crops like tomato, potato contain nicotine in the range of 2-7 µg/kg of fresh fruits and in tomato nicotine content decreases with ripening. In the same study both black and green tea are also reported to contain nicotine higher than the solanaceous fruits (Siegmund et al., 1999).

1.1.2. Biosynthesis of nicotine and related alkaloids Putrescine is a key component in the nicotine biosynthetic pathway (biosynthetic pathway of nicotine and related alkaloids is presented in Figure 1.1). Putrescine is derived from ornithine, where the reaction is catalyzed by ornithine decarboxylase (ODC). Arginase (AS) is involved in the conversion between arginine and ornithine. Again, arginine decarboxylase (ADC) catalyzes formation of agamatine from arginine; agamatine is converted to N-carbamoyl putrescine by agamatine iminohydrolase (AIH), and finally putrescine is formed by the action of N- carbamoylputrescine amidohydrolase (NCPAH). The ODC pathway was suggested to be important for growth and the ADC pathway is possibly important for supplying putrescine for the pyrrolidine alkaloid biosynthesis in tobacco (Hashimoto and Yamada, 1986; Tiburcio and Galston, 1986; Hakkinen and Oksman-Caldentey, 2004).

Figure 1.1. Biosynthesis of nicotine and related alkaloids. ADC, arginine decarboxylase; AS, arginase; AIH, agamatine iminohydrolase; ODC, ornithine decarboxylase; PMT, putrescine N- methyltransferase; MPO, N-methylputrescine oxidase; QPRTase, quinolinate phosphoribosyltransferase; LDC, lysine decarboxylase; CYP82E, Cytochrome P450s belonging to the 82E subfamily; NNN, N΄-nitrosonornicotine.

Both alkaloid biosynthesis and polyamine biosynthesis pathways involve putrescine, suggesting putrescine as a key branching point. In the polyamine biosynthesis pathway, putrescine forms spermidine by spermidine synthase (SMDS), and spermidine generates spermine via spermine synthase (SMS). The amino acid methionine is a key component in these pathways. Methionine forms S-adenosylmethionine (SAM) by S-adenosylmethionine synthase (SAMS) and in the following reaction SAM is decarboxylated to decarboxylated SAM (dSAM) by S- adenosylmethionine decarboxylase (SAMDC). Decarboxylated SAM supplies the aminopropyl moiety to putrescine for the formation of spermidine, spermine and also during the formation of N- methyl putrescine from putrescine catalyzed by putrescine methyltransferase (PMT) (Ghosh, 2000; Shoji et al., 2000). The reaction catalyzed by the PMT is the first committed step in the alkaloid biosynthetic pathway, which drives the flux of nitrogen from polyamine biosynthesis to alkaloid biosynthesis (Robins et al., 1994). N-methylputrescine is converted into N-methylaminobutanal by diamine oxidase (DAO) or N-methylputrescine oxidase (MPO) (Mizusaki et al., 1972; McLauchlan et al., 1993). MPO also catalyzes the oxidation of cadaverine to ∆'–piperideine, which upon condensation with nicotinic acid forms anabasine. Cadaverine is derived from L-lysine by lysine decarboxylase (LDC). Thus, both the formation of nicotine and anabasine compete for MPO and hence, MPO regulates the proportion of nicotine and anabasine in the genus Nicotiana (Walton et al, 1987b). MPO catalyzes oxidative deamination of N-methylputrescine, which is critical for both tropane alkaloid and pyridine alkaloid biosynthesis. Using a homology based approach, a full length tobacco MPO1 cDNA was cloned (Heim et al., 2007). N-methylaminobutanal undergoes a spontaneous cyclization to form 1-methyl-∆-pyrrolinium, which is condensed with nicotinic acid to form nicotine (Leete, 1980; Friesen and Leete, 1990). Aspartate and glycerol generate quinolinate, which forms nicotinic acid via quinolinate cycle and by the action of quinolinate phosphoribosyltransferase (QPRTase). Nicotinic acid is a key component in the biosynthesis of all the pyridine alkaloids (Wagner and Wagner, 1985). Nicotine was reported to be converted into nornicotine via a demethylation reaction (Dawson, 1945). Using microsomal preparations of leaf tissues, it was shown that in vitro nicotine demethylation in N. otophora requires NADPH as a reducing element and also needs oxygen (Chelvarajan et al., 1993). It took more than half a century to identify the molecular mechanism underlying nicotine demethylation and a group of cytochrome P450 enzymes is found to be responsible for the demethylation of nicotine to nornicotine (Siminszky et al., 2005). Nornicotine can generate myosmine through an irreversible reaction. However, it was reported that with increment in nicotine demethylation level of myosmine does not go up,

3 suggesting that myosmine is possibly converted into other substances. Experiments with labeled myosmine suggest that it can be used as a precursor for the nicotinic acid synthesis (Griffith et al., 1960; Leete and Chedekel, 1974). Anabasine is formed through condensation of nicotinic acid and ∆'–piperideine (Leete, 1980). Anatabine is suggested to be generated through a dimerisation reaction of nicotinic acid metabolite and it is suggested to be the precursor of anatalline on the basis of structural similarity between the anatalline with that of anabasine (Leete and Slattery, 1976; Goossens et al., 2003). Methyl jasmonate elicited BY2 tobacco cell culture showed increased accumulation of nicotine and anatabine after 12 hours, while anabasine and anatalline start accumulating after 24h. Besides nicotine, other related alkaloids are not detected in the nonelicited cells. In comparison to the tobacco plants, which accumulate either nicotine or nornicotine as predominant alkaloid, BY2 cells accumulate anatabine and anatalline as major alkaloids, with low level of nicotine and no nornicotine accumulation. Except nicotine and nornicotine, genes involved in the biosynthesis of other nicotinic acid-derived alkaloids are still not known (Goossens et al., 2003).

1.1.3. Tobacco and health issues Nicotine, the major alkaloid in tobacco is responsible for addiction to tobacco usage. It was reported that binding of nicotine to the nicotinic acetylcholine receptors (nAChRs) regulates the neurotransmitter release. The addiction to tobacco is possibly due to selective activation of the mesolimbic dopamine system, as a result of binding of nicotine to the brain nAChRs (Stolerman and Shoaib, 1991; Hakkinen and Oksman-Caldentey, 2004). Because, of their role in releasing various neurotransmitters, nAChR receptors are being studied extensively as possible therapeutic targets for neurological diseases, like Parkinson’s and Alzheimer’s disease (Benowitz, 1996; Wonnacott, 1997; Salminen et al., 1999). Every year more than a million people die from cancer caused by tobacco usage. Smoking is responsible for 30% of all cancer related deaths in developed countries and for the developing countries the figure is 13% (IARC monographs, 2004a; IARC monograph, 2004b). The predominant form of cancer caused by smoking is lung cancer, including squamous cell carcinoma, small cell carcinoma, adenocarcinoma and large cell carcinoma and out of these adenocarcinoma predominates. Cigarette smoking was reported to be responsible for various other types of cancers, e.g. liver, pancreas, stomach, urinary bladder, esophagus, etc. (IARC monograph, 2004b). Cigarette smoke was reported to contain 62 compounds found to be carcinogenic to laboratory animals and 15 of these compounds are shown to be carcinogenic to humans. Total

4 carcinogen exposure for a smoker is approximately 1.4 - 2.2 mg/cigarette. Stronger carcinogens in tobacco smoke are polycyclic aromatic hydrocarbons (PAH), N-nitrosamines and aromatic amines, whereas weaker carcinogens include aldehydes and isoprenes. Stronger carcinogens are present in low amounts, while weaker carcinogens occur in higher amounts (IARC monograph, 2004b). Tobacco N-nitrosamines show carcinogenicity to more than 30 animal species, and two of the most potent N-nitrosamines in tobacco smoke are NNK [N-nitrosamine – 4 - (methylnitrosamino) – 1 – (3 – pyridyl) – 1 – butanone] and NNN [N'- nitrosonornicotine]. NNK causes lung, pancreatic and liver cancers (Preussmann and Stewart, 1984; Hecht and Hoffmann, 1988; Hoffmann et al., 1994). Nitrosamines are reported to be effective hepatocarcinogens (Hecht, 1998). NNK and its metabolite NNAL are the only pancreatic carcinogens present in tobacco smoke (Prokopczyk et al., 2002). Tobacco nitrosamines are derived by nitrosation of tobacco alkaloid during curing and processing steps (Hecht, 1988; Williams, 1999; Bush, 2001). NNN is generated by N-nitrosation of nornicotine (Bush, 2001). Nornicotine was also reported to induce aberrant protein glycation and also to react with common steroidal drugs, like prednisone and thus reduces the efficacy of the drugs (Dickerson and Janda, 2002). Nornicotine has also been implicated in age-related macular degeneration (AMD), one of the major causes of blindness throughout the world (Brogan et al., 2005). Retinoids (Vitamin A) are responsible for light absorption for vision and also play a role in gene regulation during growth and development. Nornicotine catalyzes the Z to E- alkene isomerization of unsaturated aldehydes and ketones, including retinal. In the eye, product of this isomerization E-retinal acts as biosynthetic precursor of N-retinylidene -N-retinyl ethanolamine, which is a characteristic of age- related macular degeneration (AMD). Thus, in the context of harm reduction of cigarette smoking research on nicotine to nornicotine conversion takes a vital position. Also, there are reports of nornicotine adversely affecting the smoking quality. Smoking panels preferentially select nicotine-accumulating tobacco over nornicotine-accumulating tobacco. Pyrolysis of nornicotine generates myosmine and other substituted pyridines, which create objectionable flavors, like an alkaline taste and mousy aroma in cigarette smoke (Roberts, 1988). Thus, nicotine to nornicotine conversion through N-demethylation plays a crucial role both in terms of smoking quality and harm reduction of tobacco products and as a consequence entails active research in this field.

1.1.4. Early research on nicotine to nornicotine conversion The first report suggesting that, nornicotine is derived from nicotine by N΄- demethylation, was published more than half a century ago (Dawson, 1945a; Dawson, 1945b). In a subsequent study Dawson showed that, nornicotine can be produced from the feeding of different nicotine homologs and analogs (e.g., l-nicotine, d, l-nicotine and d, l-N΄-ethylnornicotine) to the N. glutinosa leaves. This low specificity of nornicotine formation suggests that, this process does not depend on specific interaction between nicotine and a specific dealkylating or alkyl transferring enzymes, rather some general cellular property, such as oxidation-reduction potential may be important (Dawson, 1951). Inheritance of nicotine to nornicotine conversion was also an active area of research for a long time. Valleau et al (1949) first reported that, the conversion process is controlled by a genetic factor. Experiments by Griffith et al (1955) first demonstrated that the conversion process is governed by a single, dominant gene. In their experiment, Griffith et al crossed a low nicotine- accumulating true-breeding converter line with a high nicotine-accumulating true breeding nonconverter line. In F1, F2 generations and in backcross with parental lines, ratios of converter and nonconverter progenies match as expected in case of a single, dominant gene. Development of a rapid paper chromatography based detection system of nicotine alkaloids, allowed them to screen large numbers of progeny necessary for a robust genetic experiment. As the nicotine-accumulating tobacco is found to be more desirable in terms of smoking quality as compared to the nornicotine- accumulating tobacco, much effort has been invested in breeding and genetic studies to understand the conversion phenomenon (Mann et al., 1964). Burk and Jeffrey (1958) again supported the idea that, a single dominant gene is regulating the nicotine to nornicotine conversion process, and they further investigated the instability of the conversion locus. Both Griffith et al (1955) and Burk and Jeffrey (1958) reported the presence of some converter (nornicotine accumulating) plants in the nonconverter (predominantly nicotine accumulating) varieties. This phenomenon of nonconverter tobacco producing converter progenies in the subsequent generations still remains an enigma in this field. Tobacco (N. tabacum) is an allotetraploid derived from two diploid ancestors, N. tomentosiformis and N. sylvestris (Goodspeed, 1954; Gerstel, 1961). The primary alkaloid accumulated in the cured leaves of tobacco is nicotine, whereas, both the ancestral species accumulate nornicotine (Jeffrey, 1959; Sisson, 1990). Mann and Weybrew (1958) reported that an early generation allotetraploid (N. otophora X N. sylvestris) harbors conversion factors from both parent in unaltered, dominant condition. Whereas, allotetraploid derived from (N. sylvestris X N. tomentosiformis) and maintained by self pollination for 20 generations, consists only one

6 conversion factor, indicating the inactivation of other conversion factor. This suggests the role of gene silencing after the polyploidization event in the evolution of polyploid species. In another elegant genetic experiment, Mann et al (1964) put forward the conversion phenomenon in an evolutionary context. An illustration of Mann et al’s work is shown in Figure 1.2. In this experiment it was shown that all the converter tobacco varieties tested deviate from the nonconverter tobacco line SC58 by a single, dominant factor. They further showed that the conversion factor is common to all of the tobacco varieties. Using tester lines (where conversion factors from N. tomentosiformis or N. sylvestris were introgressed into nonconverter SC58 background) they checked the origin of the converter locus in the tobacco. When a converter tfr syl tobacco ‘Cherry Red 401’ is crossed to C1 c2 (introgressed line where the conversion factor was derived from N. tomentosiformis), all the progeny in the subsequent generations produce only converter plants, showing that the conversion factors of converter tobacco and the introgressed line do not segregate in future generations. However, the cross between converter tobacco ‘Cherry tfr syl Tobacco 401’ and c1 C2 (introgressed line where the conversion factor was derived from N. sylvestris) shows a 15:1 (Converter : Nonconverter) segregation ratio in the F2 and a 3:1 (Converter : Nonconverter) segregation ratio in the test cross progenies, indicating that conversion factor from the converter tobacco and the introgressed line having converter locus from N. sylvestris segregate in the future generations. Thus, they proposed that, the conversion factor in tobacco possibly arises from N. tomentosiformis, and they also hypothesized that the nonconverter nicotine-accumulating tobacco originated by the mutation of two dominant conversion factors from the parental species (Mann et al., 1964).

tfr syl Figure 1.2. An illustration of Mann et al (1964)’s work. C1 and C2 are conversion loci from N. tomentosiformis and N. sylvestris, respectively. C, converters; NC, nonconvetres.

1.1.5. Biochemical and molecular characterization of N'-demethylation of nicotine Conversion of nicotine to nornicotine is theoretically possible either by a transmethylation or by oxidative demethylation (Stepka and Dewey, 1961). There is not much experimental support for the transmethylation theory. However, a small increase in nornicotine was reported, when nicotine was incubated with tobacco tissue homogenate and ethanolamine. In the absence of ethanolamine no conversion was recorded (Bose et al, 1956). More experimental evidence supports the idea of oxygen dependent demethylation. Il’in et al (1958) showed that nicotine demethylation is associated with increased uptake of oxygen. Egri (1957) reported that, infiltration of nicotine-1΄-oxide into tobacco leaves increases nornicotine level. However, Stepka and Dewey (1961) did not see any radiolabeled nicotine-1'-oxide when C14 labeled nicotine was fed. Their experiment also indicated that conversion of nicotine to nornicotine is associated with the

oxidation of methyl group of nicotine to CO2, and they proposed that the methyl group may be

8 first oxidized to the level of formaldehyde, then transferred to a carrier molecule and then further oxidized to CO2. The first evidence indicating the involvement of a cytochrome P450 in the nicotine demethylation process came from Chelvarajan et al (1993). Cytochrome P450s and their role in alkaloid biosynthesis in plants are described in the next subchapter. In this experiment, in vitro properties of nicotine demethylation were characterized using microsomes of N. otophora. They showed that nicotine demethylation is oxygen dependent, NADPH is the preferred reducing element and in a subsaturating concentration of NADPH, NADH enhances demethylation. A partial inhibition of nicotine demethylation is observed when an inhibitor of cytochrome P450, tetcyclasis was added. Carbon monoxide treatment also can inhibit cytochrome P450s and light of 450 nm can reverse this inhibition (Donaldson and Luster, 1991). A partial reduction of nicotine demethylation by carbon monoxide was reported by Chelvarajan et al in leaf lamina microsomes, but not in pith microsomes. They further reported that, when a polyclonal antiserum raised in rabbit against Helianthus tuberosus NADPH-dependent cytochrome P450 reductase was added to the nicotine demethylase assay, an inhibition of nicotine demethylation was noticed with increasing concentration of the antiserum, indicating involvement of cytochrome P450 in nicotine demethylation. Even after half a century of active research, there were a lot of unknowns in this arena. A major question was the molecular identity of the conversion factor in tobacco. Since, the conversion process in tobacco was reported to be governed by a single dominant locus, the question remained, what was the fate at the molecular level, of each conversion locus contributed by the two parental species. A major breakthrough in this field was the identification of a group of cytochrome P450 genes, encoding the active nicotine demethylase enzymes in tobacco (Siminszky et al., 2005). In this experiment, a group of P450 genes (Designated as CYP82E2, CYP82E3 and CYP82E4) was found to be differentially regulated between converter and nonconverter tobacco. Ectopic expression of CYP82E4 in tobacco and yeast mediate nicotine N-demethylation. Silencing of CYP82E gene subfamily inhibits the nicotine to nornicotine conversion. Altogether these findings suggest a role of CYP82E4 in N-demethylation of nicotine to nornicotine and open the door for the reduction of nornicotine content of tobacco varieties, which is desirable both in terms of smoking quality and harm reduction of smoking tobacco. Mann et al (1964) showed that the conversion factor active in tobacco come from N. tomentosiformis, which converts nicotine to nornicotine in both green and cured leaves. On the contrary, converter tobacco only converts in the cured / senesced leaves. It was puzzling how a senescing leaf converter tobacco arises from a green & senescing leaf converter parent. Gavilano

9 et al (2007) addressed the role of conversion factor from N. tomentosiformis in modifying the alkaloid profile in tobacco. They reported that, N. tomentosiformis has two conversion factors,

CYP82E3 and CYP82E4, which corresponds to the conversion locus (CT) of N. tomentosiformis. In N. tomentosiformis, CYP82E3 and CYP82E4 are active in green and senescing leaves, respectively, justifying the green and senescing leaf conversion phenotype in N. tomentosiformis. Whereas, in tobacco CYP82E3 was found to be inactivated by a W330C amino acid substitution and a transcriptional silencing of CYP82E4 resulted in nicotine-accumulating nonconverter tobacco. However, the molecular identity of the conversion locus donated by the other parent (N. sylvestris) still remained elusive. In the current study (Chapter 2), the molecular characterization of the conversion factor of N. sylvestris was undertaken and how it was inactivated in tobacco was investigated. Overall, this experiment along with the previous studies will present an evolutionary perspective of alkaloid profile modification in modern-day tobacco.

1.1.6. Cytochrome P450s in alkaloid biosynthesis Cytochrome P450s are the representatives of one of the largest and oldest gene superfamilies and are present in all biological kingdoms. Cytochrome P450s are hemoproteins, whose reduced CO-bound complex shows characteristic absorption maxima at 450 nm. Structure of the heme group of the P450s is shown in Figure 1.3. Their enzyme activity is reduced by CO and it can be reversed by the light of 450 nm (Chapple, 1998). Cytochrome P450 names begin with CYP (which stands for cytochrome and pigment), which is followed by a number representing the family (Proteins having > 40% sequence similarity constitute a family), followed by a letter representing subfamily (Proteins with >55% sequence identity remain in the same subfamily). The subfamily designation is followed by a number representing individual gene within a subfamily (Nelson et al., 1993; Nelson et al., 1996). Cytochrome P450s can catalyze a wide array of reactions, including hydroxylation, alkene epoxydation, alkyne oxygenation, oxidative deamination, oxidative dehalogenation, dehydrogenation, dehydration, dealkylation of N, O, S; oxidation of N, S; isomerization, etc. Most of the P450s are monooxygenase, i.e. they catalyze incorporation of one O atom to the substrate

and reducing the second O atom to H2O (Chapple, 1998). A general reaction catalyzed by P450 monooxygenase can be as follows: + + RH + O2 + NAD(P)H + H ROH + H2O + NAD(P) (Reduced substrate)

Figure 1.3. Structure of the heme group of P450s (in reduced state). FxxGxxxCxG is the P450 signature motif, where F, G, C are standard amino acid codes and x represents any amino acids.

In a majority of the reactions, P450s do not directly use NADPH, rather they use a flavoprotein known as P450 reductases, which transfer electrons to the P450 from the reducing element (i.e. the nicotinamide cofactor). Although in certain classes of P450s, electrons can be transferred directly to the P450s from the reducing element without the involvement of P450 reductase (for a detailed review on the classification of cytochrome P450s based on the electron transfer system, check Hannemann et al., 2007). In plants, P450s are involved in the biosynthesis of glucosinolate and auxin, phenyl propanoid pathway, flavonoid biosynthetic pathway, formation of cyanogenic glucosides, lipid metabolism, plant defense, etc. (Chapple, 1998). P450s are also involved in the biosynthesis of plant hormones, including IAA, GA, brassinosteroids, jasmonic acid and ABA (role of P450s in phytohormone biosynthesis was reviewed by Kim et al., 2002). Cytochrome P450s regulate the biosynthesis of two important classes of alkaloids: indole alkaloids and benzylisoquinoline alkaloids (Morant et al., 2003; Bolwell et al., 1994). General structures of benzylisoquinoline and indole alkaloids are shown in Figure 1.4. In Catharanthus roseus 16-hydroxylation of bis-indole alkaloid precursor tabersonine was reported to be catalyzed by a P450 and later CYP71D12 was found to encode the enzyme tabersonine16-hydroxylase (St- Pierre and De Luca, 1995; Schroder et al., 1999). Oxidative cleavage of loganin to convert into

11 secologanin was reported to be catalyzed by secologanin synthase, encoded by CYP72A1.This conversion of loganin to secologanin is a potential rate limiting step in indole alkaloid biosynthesis (Yamamoto et al., 2000; Irmler et al., 2000; Contin et al., 1999). In Lonicera japonica cell cultures, 7-hydroxylation of 7-deoxyloganin into loganin is catalyzed by 7-deoxyloganin-7- hydroxylase, which was found to be a P450 (Katano et al., 2001). CYP76B6 acts as geraniol 10- hydroxylase, which catalyzes the hydroxylation of geraniol at C-10 position, and this is the first committed step in the formation of iridoid monoterpenoid. Further metabolism of iridoid monoterpenoid leads to the formation of diverse monoterpenoid alkaloids(Collu et al., 2001).

Figure 1.4. Structural backbone of benzylisoquinoline and indole alkaloids. A. Benzylisoquinole, B. Indole ring of indole alkaloids.

P450s also regulate biosynthesis of benzylisoquinoline alkaloid. In the isolated microsomes of Papaver somniferum, involvement of P450s in morphine biosynthesis was investigated using P450 inhibitor. In morphine biosynthesis, salutaridine synthase, which catalyzes conversion of reticuline to salutaridine, was reported to be a P450 enzyme (Gerardy and Zenk 1993; Zenk et al., 1989). In Berberis stolonifera, berbamunine synthase, a P450 enzyme, catalyzes the coupling of two molecules of N-methylcoclaurine to generate dimeric berbamunine (Stadler and Zenk 1993). Synthesis of stylopine from reticuline involves two P450 enzymes: cheilanthifoline synthase and stylopine synthase (Bauer and Zenk 1989; Bauer and Zenk 1991). Synthesis of 12-hydroxy- dihydrochelirubine from reticuline also involved at least six P450s (Bolwell et al., 1994). In the pyridine alkaloid biosynthesis nicotine is converted to nornicotine through demethylation

12 involving P450 catalyzed reaction and this process was shown to be catalyzed by P450 enzymes belonging to the CYP82E subfamily (Chelvarajan et al., 1993; Siminszky et al., 2005).

1.1.7. Spatio-temporal distribution of nicotine to nornicotine conversion. Wada (1956) studied conversion phenomenon in ‘Cherry Red’ (converter) and ‘Red Free’ (nonconverter) selections of flue-cured tobacco. In the ‘Cherry Red’ selections, nornicotine level increases with curing and this was also accompanied by red coloration of the leaves, hence they were named as ‘Cherry Red’. Nicotine was reported to be synthesized in tobacco roots and then translocated to the leaves (Dawson, 1942). Hall et al (1965) studied time and site of nicotine to nornicotine conversion using grafting techniques in tobacco and N. sylvestris. In their experiment, Hall et al used ‘Cherry Red’, ‘Red Free’ tobacco and hybrids of N. sylvestris X ‘Cherry Red’ or ‘Red Free’. They reported that converter scions grown on a nonconverter stocks display nicotine to nornicotine conversion, but nonconverter scions grown on converter stocks do not display conversion ability, suggesting that leaf is the site of nicotine to nornicotine conversion. Further experiments were carried out by Wernsman et al (1968) to investigate the location and time of conversion using lines harboring converter gene from N. tabacum, N. sylvestris and N. tomentosiformis. They also employed reciprocal grafting experiments using ‘Cherry Red’ (Converter), SC58 (Nonconverter flue cured tobacco), 402-T and 402-S (Introgressed lines with conversion factor from N. tomentosiformis and N. sylvestris, respectively). Their experiment showed that, conversion ability depends on the type of the scions used (i.e. whether it is converter or nonconverter) not on the type of stock. Also, when 402-T was used as a scion, considerable amounts of nornicotine are detected in both green and cured leaves, whereas in tobacco and 402-S lines nornicotine level only increased during curing. Overall, all these experiments indicate that nicotine to nornicotine conversion is restricted to the leaves. In case of nicotine to nornicotine conversion only there are reports of induction of conversion during ethylene (Fannin and Bush, 1992) and sodium bicarbonate (Shi et al., 2003) treatments. In Chapter 3 spatio-temporal distribution of nicotine to nornicotine conversion was carried out to gain a better understanding of the regulation of the conversion process. 1.2. Ethylene: biosynthesis, responses and signaling 1.2.1. Biosynthesis of ethylene Ethylene is produced through a relatively simple pathway starting from methionine (reviewed by Kende, 1993). Biosynthetic pathway of ethylene is presented in Figure 1.5. Methionine is converted to S-adenosyl L-methionine (Adomet or SAM), catalyzed by Ado-Met synthase (ATP: methionine-S-adenosyl transferase). Adomet generates ACC (1-

13 aminocyclopropane-1-carboxylic acid), and the reaction is catalyzed by ACC synthase (S- adenosyl-L-methionine methylthioadenosine lyase). This is the first committed step in ethylene biosynthetic pathway and besides ACC this also generates 5΄-deoxy-5΄-methyl thioadenosine, which recycles back to methionine again, thus allowing formation of ethylene synthesis even if the free methionine level is low (Yu et al., 1979). ACC is further oxidized to ethylene by ACC oxidase (2ACC + O2 → 2C2H4 + 2CO2 + 2HCN + 2H2O). Here, ethylene is generated from the C-2

and C-3 and CO2 is generated from carboxyl carbon and HCN from C-1 carbon. HCN is further metabolized to β-cyanoalanine, which can be metabolized to either asparagines or γ–glutamyl-β- cyanoalanine , and this process helps to get rid of toxic HCN (Peiser et al., 1984; Yip and Yang, 1988). ACC can be conjugated with malonyl ACC to form MACC (1-malonylamino cyclopropane-1-carboxylic acid). In tobacco leaf discs, high levels of MACC induce formation of ACC from MACC. Thus, malonylation serves as a means of regulating the level of ACC and ethylene biosynthesis (Jiao et al., 1986; Jiao et al., 1987).

Figure 1.5. Biosynthetic pathway of ethylene. SAM, S-adenosyl L-methionine; ACC, 1- aminocyclopropane-1-carboxylic acid; MACC, 1-malonylamino cyclopropane-1-carboxylic acid; AOA, aminooxyacetic acid; AVG, aminoethoxyvinylglycine; HCN, hydrocyanic acid.

ACC synthase belongs to a multigene family in most plants, and expression of these ACC synthases varies based on environmental and developmental factors. In Arabidopsis the ACC synthase gene family has eight members (Liang et al., 1992; Liang et al., 1995; Yamagani et al., 2003). ACC synthase was first identified in the homogenates of ripening tomato fruit pericarps (Boller et al., 1979; Yu et al., 1979). ACC synthase proteins can act both as homodimers or

14 heterodimers (Tarun and Theologis, 1998). ACC oxidase belongs to a family of non-heme iron containing enzymes, which has a characteristic 2-histidine-1-carboxylic acid iron binding motif (Hegg and Que, 1997). Ethylene biosynthesis increases during different developmental processes and under different stresses. Biosynthesis of ethylene induces during seed germination, leaf and flower senescence, abscission and fruit ripening (Abeles et al., 1992; Matto and Suttle, 1991). Wounding from mechanical injury or herbivory induces ethylene production by increasing the ACC synthase level (Tsuchisaka and Theologis, 2004). Jasmonic acid (JA) is critical in wounding response, and it was reported that JA-inducible and wound-inducible gene PDF 1.2 is also regulated by ethylene (Penninkx et al., 1998). JA can also form conjugates with ACC, thus playing a role in ethylene homeostasis. Overall, these results suggest some degree of cross-talk between ethylene and JA (Staswick and Tiryaki, 2004). Ethylene both has autocatalytic and autoinhibitory effects on its biosynthesis. At the vegetative stage, ethylene inhibits its biosynthesis, whereas during fruit ripening and senescence it has an inducing effect on its biosynthesis (Barry et al., 2000; Giovannoni et al., 2001; Alexander and Grierson, 2002). ACC synthase is subjected to a rapid proteolytic degradation by the 26S proteosomal machinery. The C-terminal region of ACC synthase is particularly important for proteolytic regulation. It was found that the ethylene over-producing mutants eto2 and eto3 have mutations in the sequences encoding C-terminal regions of in ACS 5 and ACS 9 (ACS, ACC synthase), respectively, and these mutants have an increased half life of ACS 5 and ACS 9 as compared to the wild type (Woeste et al., 1999; Chae et al., 2003). ETO1 encodes an E3 ligase, which binds to two types of ACS proteins and regulates their degradation by the 26S proteosomal machinery (Wang et al., 2004; Yoshida et al., 2005; Yoshida et al., 2006). It was reported that phosphorylation also plays a critical role in determining the stability of ACS proteins. Phosphorylation of type 1 and type 2 ACS proteins inhibits the binding of ETO1 and EOL to ACS proteins, and thus preventing their ubiquitination and subsequent degradation by the 26S proteosome (Grosskopt et al., 1990; Spanu et al., 1994; Sebastia et al., 2004; Argueso et al., 2007).

1.2.2. Role of ethylene in developmental and physiological processes 1.2.2.1. Fruit ripening Ethylene regulates developmental processes throughout the plants’ life cycle, going from seed germination to organ senescence. Climacteric fruits, like apple, banana and tomato at the green mature stage show a characteristic induction of ethylene synthesis and respiration. At the

15 time of ripening, a number of physiological changes take place, e.g. loss of chlorophyll, developing pigments, synthesizing compounds responsible for flavor, aroma, softening of fruits and finally abscission of ripe fruits. These changes are important from plants’ perspective, as these processes are essential for successful seed dispersal. Fruit ripening is also important from the agricultural standpoint (Bleecker and Kende, 2000). On the otherhand, nonclimacteric fruits, like strawberry, citrus and grape do not show any increment in respiration and ethylene synthesis (Lin et al, 2009). In the climacteric fruits, transcript level of both the ethylene biosynthetic genes, ACS and ACO are high during ripening and are reported to be induced by ethylene during ripening, suggesting an autocatalytic role of ethylene of its synthesis at this stage (Barry et al., 2000). The role of ethylene in climacteric fruit ripening was also supported by antisense suppression of ACS2 and ACO1, which delayed fruit ripening (Oeller et al., 1991; Picton et al., 1993). Currently, the ethylene perception inhibitor 1-MCP is used extensively in apple industries to delay fruit ripening and efforts are continuing to commercialize this approach to delay fruit ripening in other important crops, like banana, avocado, pear, peaches, nectarines, plums and tomato (Watkins, 2006).

1.2.2.2. Sex determination Ethylene plays a vital role in sex determination in monoecious plants. In cucurbits, high GA level promotes maleness, whereas treatment with ethylene induces femaleness and two ethylene biosynthetic genes CsACS2 and CsACS1G are reported to be linked with female flower development (Iwahori et al., 1970; Trebitsh et al., 1997; Yamasaki et al., 2001). In bromeliads (e.g. pineapple) application of ethylene induces floral development and synchronized flowering (Lieberman et al., 1979). Certain bacteria and fungi are also reported to synthesize ethylene. Zygote formation in the cellular slime mold Dictyostelium mucoroides also involves ethylene, thus, ethylene might has evolutionary conserved role in reproduction and sex determination (Amagai et al., 2007; Lin et al., 2009).

1.2.2..3. Flower development In Arabidopsis, APETALA1 (AP1) and AGAMOUS (AG) regulate the identity of stamens and carpels, respectively. Ectopic expression of the tomato ortholog of AG, TAG1 produces fruit-like organs in place of sepals and application of ethylene inhibitor 1-MCP was reported to reduce the expression of TAG1 (Pnueli et al., 1994; Bartley and Ishida, 2007). Also, the over-expression of transcription factor LeHB-1 in tomato, generates fruit-like organs in place of sepals and LeHB-1 was reported to bind at the promoter of ethylene biosynthetic gene LeACO1, suggesting that regulation of ethylene level may plays a role in floral organogenesis (Lin et al., 2008).

There is a report suggesting ethylene’s role in regulating flowering time (Achard et al., 2007). It was shown that the bioactive GA level declines with the activated ethylene signaling and results in enhanced accumulation of DELLAs. This enhanced DELLA accumulation further delays flowering by negatively affecting floral meristem identity genes LEAFY (LFY) and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1).

1.2.2.4. Root growth and development Arabidopsis mutant screening for plants resistant to auxin polar transport inhibitors NPA and TIBA, led to isolation of pir1 and pir2 and pir2 was found to be allelic to the ethylene signaling mutant ein2. These mutants show defective root elongation, suggesting possible linkage between ethylene and auxin polar transport in regulating root development (Fujita and Syono, 1996). Further studies also suggested a role of ethylene and auxin interaction in regulating root hair development (Pitts et al., 1998; Rahman et al., 2002). Over-expression of NAC family transcription factor AtNAC2 in Arabidopsis increased lateral root formation and AtNAC2 was reported to be regulated by ethylene and auxin signaling, indicating their role in lateral root development (He et al., 2005). There are reports showing adverse effects of increased ethylene level on the root gravitropic response through alteration in flavonoid synthesis (Buer et al., 2006).

1.2.2.5. Adventitious root formation Formation of adventitious root in wetland plants is a key adaptation to survive in a low oxygen condition. Adventitious roots allow formation of air channels connecting to the shoot, thus facilitating shoot to root air diffusion (Justin and Armstrong, 1987). Under flooded conditions hypoxic roots begin to produce high levels of ethylene (Voesenek et al., 1990; Brailsford et al., 1993). In Rumex palustris and Rumex thyrsiflorus, inhibition of ethylene biosynthesis and auxin polar transport adversely affects adventitious root formation (Visser et al., 1995; Visser et al., 1996a). It was suggested that in the flooded plants elevated ethylene synthesis results in increased sensitivity of root forming tissues to the endogenous auxin level, thereby regulating the initiation of adventitious roots (Visser et al., 1996b).

1.2.2.6. Plant defense Ethylene by interacting with other plant hormones plays a role in the defense response (reviewed by Adie et al., 2007; von Dahl and Baldwin, 2007). Ethylene mediates different kinds of defense responses against pathogen attacks. Ethylene stimulates the production of hydroxyproline rich glycoprotein (HRGP) that is found to be linked with resistance against pathogen invasion

(Esquerre-Tugaye et al., 1979). Ethylene is reported to regulate the induction of phytoalexins. It induces the transcription of β-1, 3-endoglucanase in soybean (Takeuchi et al., 1990), β-thujaplicin in Mexican cypress (Zhao et al., 2004) and sakuranetin in rice leaves. (Nakazato et al., 2000). The role of ethylene in triggering the pathogenesis related (PR) proteins is also well documented. It is reported to regulate PR-2 (β-1, 3- glucanases), PR-3 (basic-chitinases), PR-4 (hevein-like) and PR- 12 (plant defensins, PDFs) (Broglie et al., 1989; Samac et al., 1990; Penninckx et al., 1996; Thomma et al., 1992; Thomma et al., 2002; van Loon et al., 2006). Ethylene insensitive Tetr tobacco (where Arabidopsis dominant mutant etr1-1 allele was expressed under constitutive 35S promoter), showed increased susceptibility to Pythium and Colletotrichum destructivum (Knoester et al., 1998; Chen et al., 2003). Constitutive expression of ERF1 (Ethylene Response Factor 1) in Arabidopsis provides resistance against various necrotrophic fungi including Botrytis cinerea, Plectosphaerella cucumerina and Fusarium oxysporum, but increased susceptibility to biotrophic bacteria Pseudomonas syringae (Berrocal-Lobo et al., 2002; Berrocal-Lobo and Molina, 2004). There are reports of ethylene emission during herbivory attack in different plant species (reviewed by von Dahl et al., 2007). Ethylene insensitive Arabidopsis etr1 mutant showed no difference from wild type against the generalist aphid Myzus persicae and specialist aphid Brevicoryne brassicae (Mewis et al., 2005). However Arabidopsis mutants hls1-1 (hookless 1-1) and ein2 displayed resistance against generalist herbivore Spodoptera littoralis, but not against specialist to Plutella xylostella (Stotz et al., 2000). In contrast, in maize it was reported that ethylene signaling is required for resistance against Spodoptera frugipedra (Harfouche et al., 2006).

1.2.2.7. Senescence Role of ethylene in senescence is widely studied. At the onset of senescence, expression of ethylene biosynthetic genes ACC synthase and ACC oxidase increases. This results in a concomitant enhancement in ethylene synthesis (Van der Graaff et al., 2006). Ethylene signal perception mutants etr1 and ein2 also show a delayed senescence phenotype (Bleecker et al., 1988; Oh et al., 1997). EDR1 (Enhanced Disease Resistance 1) was reported to be a negative regulator of ethylene dependent senescence (Tang et al., 2005). Constitutive overproduction of ethylene in tomato and Arabidopsis does not show any early senescence phenotype, indicating that besides ethylene, there are other age-dependent factors regulating senescence. Ethylene alone is not sufficient for the onset of senescence (Lim et al., 2007). Arabidopsis old1 mutant was reported to show early age-dependent senescence and this can be hastened further with ethylene treatment. However, the double mutant of old1 etr1 that can not perceive ethylene due to etr1 also shows

18 early age-dependent senescence, but it does not display further ethylene dependence, suggesting that the OLD1 can negatively regulate the ethylene response of leaf senescence (Jing et al., 2002; Jing et al., 2005). In comparison to leaf senescence, petal senescence can be either ethylene sensitive (e.g. Petunia, carnation, tobacco, etc) or ethylene insensitive (e.g. Iris, Alstroemeria, etc) (Van Doorn, 2001). Petal senescence was reviewed extensively by Van Doorn and Woltering, 2008. The picture of hormonal regulation of the ethylene insensitive petal senescence is not quite clear, but the ultrastructure of the dying cells in both ethylene sensitive and insensitive petals is similar, suggesting some common age-dependent signals for the cell death process (Van Doorn and Woltering, 2008). Though the role of ethylene in petal senescence is known for some time, the molecular explanations have been elucidated only in recent years. Downstream transcription factors of the ethylene signaling cascade EIN3 and EILs (EIN3-like) are proposed as key factors regulating gene expression during senescence of carnation petals (Iordachescu and Verlinden, 2005; Hoeberichts et al., 2007). One of the targets of EIN3/EIL transcription factors is the ERF2 (ethylene response factor 2) transcription factor and there are reports of upregulation of DAFSAG9, a ERF2-like gene in the senescing petals of daffodil (Hunter et al., 2002; Hunter et al., 2004). Similar to the onset of fruit ripening, during pollination there is also an upregulation of ethylene synthesis. Some signal after pollination causes ethylene synthesis to increase, although the exact nature of the responsible signal is not clear (reviewed by O’Neill, 1997) It was reported that ethylene produced in the gynoecium results in an autocatalytic increase of ethylene synthesis in the petal tissues and removal of gynoecium results in delayed petal senescence in carnation, suggesting a key role for the gynoecium in pollination-induced petal senescence (Shibuya et al., 2000; Nukui et al., 2004). Genes involved in ethylene biosynthetic process, like SAM synthase, ACC synthase and ACC oxidase show increased mRNA abundance during petal senescence in ethylene-sensitive petals (Jones and Woodson, 1999; Hoeberichits et al., 2007). Silencing ACC oxidase by the antisense approach increases the shelf life of cut carnation flowers (Savin et al., 1995; Kosugi et al., 2002). Transgenics with mutated ethylene receptors also displayed delayed petal senescence, e.g. mutated ers in Petunia (Shaw et al., 2002), mutated etr1 in carnation and Petunia (Bovy et al., 1999; Wilkinson et al., 1997). Application of exogenous sugars delays petal senescence in both ethylene sensitive and insensitive species, however, the effect is much pronounced in ethylene-sensitive species (Van Doorn, 2004). At a higher sugar level, an increased proteolytic degradation of EIN3 was noticed, suggesting a negative role of high sugar level on the ethylene signaling, thereby delaying petal senescence process (Yanagisawa et al., 2003).

Senescence involves a programmed breakdown of macromolecules and remobilization of nutrients to the developing fruits. It involves degradation of nucleic acids, sugars, proteins, fatty acids, phospholipids and components of cell walls and their transport from the senescing petals to the developing fruits (Van Doorn and Woltering, 2008). Although ethylene is known for its senescence promoting effects, its precise role in the above mentioned processes is being investigated only recently. There are reports of ethylene’s involvement in regulating cysteine protease, nucleic acid degradation and remobilization of phosphate by controlling the expression of phosphate transporters (Jones et al., 2005; Langston et al., 2005; Chaplin and Jones, 2009).

1.2.2.8. Abscission Ethylene plays an important role in controlling floral organ abscission (reviewed by Van Doorn and Stead, 1997). The ethylene biosynthetic inhibitor AOA (amino oxyacetic acid) and signal perception inhibitors 1-MCP and STS (silver thiosulphate) reduce flower abscission in many species (Furutani et al., 1989; Serek et al., 1995; Cameron and Reid, 1981). Effects of treatments which increase abscission, like darkness or shade (Jiang and Egli, 1993) and elevated temperature (Monterroso and Wien, 1990) were shown to be counteracted by the application of ethylene action inhibitor STS, suggesting a role for ethylene in altering abscission during these treatments (Hoyer, 1985; Aloni et al., 1995). In Arabidopsis ethylene signal perception mutants etr1 and ein2 displayed delayed abscission; however they do abscise after a certain time. In both etr1-1 and ein2 mutant backgrounds, Chitinases promoter driven β-glucoronidase expression was tested. Since the chitinase expresses specifically during abscission, the reporter expression serves as a marker for abscission. In both cases reporter expression is delayed as compared to wild type, but GUS accumulation is observed at a later point. These findings suggest that although ethylene plays an important role in regulating abscission, it alone is not sufficient to control this process, thus indicating the involvement of a more complex network in regulating abscission (Chen and Bleecker, 1995; Bleecker and Patterson, 1997).

1.2.3. Ethylene Signaling Among different phytohormones signaling pathway of ethylene is most widely investigated (ethylene signaling network is shown in Figure 1.6). Screening for ethylene signaling mutants was relatively straight forward with the utilization of the typical ‘triple response phenotype’, where etiolated seedlings early in the development (3 days post germination) display inhibition of hypocotyl elongation, radial swelling of the hypocotyl and formation of exaggerated apical hook (Guo and Ecker, 2004). In Arabidopsis ethylene is sensed by five membrane bound receptors:

ETR1 (Ethylene Response 1), ETR2, ERS1 (Ethylene Response Sensor 1), ERS2 and EIN4 (Ethylene Insensitive 4) (Chang et al., 1993; Sakai et al., 1998; Hua et al., 1995; Hua et al., 1998a). Based on the sequence similarity and structural organization, these receptors are classified in to two groups: ETR1 and ERS1 constitute ‘subfamily-I’ and they contain three N-terminal ethylene binding transmembrane domains, followed by a conserved histidine kinase domain. ETR1 also has a C-terminal receiver domain. Subfamily-II (ETR2, ERS2 and EIN4) contains four ethylene binding transmembrane domains, followed by less conserved kinase domains lacking characteristics features required for histidine kinase activity, both ETR2 and EIN4 have a C- terminal receiver domain (Hua et al., 1998; Hua and Meyerowitz, 1998). ERS1 and members of ‘subfamily-II’ also have serine/threonine kinase activity (Moussatche and Klee, 2004). Ethylene possibly binds with the receptors through a copper cofactor, which is possibly supplied by copper transporters RAN1 (Response to Agonist 1) (Hirayama et al, 1999). Cu (I) cofactor is located at the electron rich hydrophobic pocket formed by the transmembrane domains, where Cys65 and His69 residues serve as ligand for Cu (I) cofactor and play an important role in the interaction between ethylene and receptors. Binding of ethylene with Cu (I) changes the coordination chemistry of Cu (I) and results in conformational changes in the binding site (Rodriguez et al, 1999). Gain-of-function mutations (in the wild type in the presence of ethylene, receptors remain in an ‘inactive’ state, thus cannot activate CTR1; in the GOF mutants even in the presence of ethylene receptors remain in an ‘active’ state and as a result can activate CTR1) of all five individual receptors are ethylene insensitive, suggesting that all of them participate in ethylene signaling. Individual loss-of-function mutants still respond to ethylene, indicating functional overlap of the receptors. Triple and quadruple loss-of-function mutants show constitutive ethylene response due to lack of activation of CTR1 and resulting de-repression of downstream signaling pathway (Hua and Meyerowitz, 1998; Zhao et al., 2002; Cancel and Larsen, 2002; Wang et al., 2003). Genetic screens for constitutive ethylene response identified eto mutants (these are defective in ethylene biosynthesis) and also the ctr1 mutant. CTR1 encodes a Raf-like Ser/Thr kinase. As it displays a constitutive ethylene response like the LOF mutants, it negatively regulates ethylene response. Epistatic interactions place CTR1 downstream of the receptors (Kieber et al., 1993). CTR1 was shown to interact with ethylene receptors using yeast two-hybrid assays (Clark et al., 1998). Localization of CTR1 in ER was again shown with sucrose density gradient fractionation (Gao et al., 2003). In the same experiment it was also shown that in the double or triple LOF mutants of receptors and in a mutant ctr1 that eliminates its interaction with ETR1, ER localization of the CTR1 is lost, suggesting that CTR1’s interactions with the receptors are essential for its ER

21 localization. In vitro pull down assays revealed that CTR1 binds with the C-terminal part of ETR1, while the histidine kinase domain is not essential for the interaction. Furthermore, in vivo interaction between ETR1 and CTR1 was demonstrated using affinity co-purification (Gao et al., 2003). Although CTR1 showed homology to Raf-like MAPKKK, the evidence showing involvement of a MAP kinase cascade in the ethylene signaling remained elusive for long time. The first strong biochemical evidence for the involvement of a MAP kinase cascade was presented by Ouaked et al (2003). It was shown that two Medicago MAPKs, Arabidopsis MAPK6 and a Medicago MAPKK are induced by ethylene and MAPK6 activation requires ETR1, CTR1, but not EIN2, EIN3. Constitutive overexpression of Medicago MAPKK displays ctr1-like phenotypes. All these indicate the presence of a MAP Kinase cascade in the ethylene signaling pathway downstream of CTR1 (Ouaked et al., 2003). Recently, presence of a bifurcated MAP kinase cascade involved in the regulation of downstream transcription factor EIN3 was established (Yoo et al., 2008). Components downstream of CTR1 have also been isolated, including EIN2, which acts as a positive regulator of ethylene signaling. EIN2 is critical for ethylene signaling, and it has N- terminal transmembrane domains having homology with NRAMP metal ion transporters. However, no metal ion transporter activity of EIN2 has been shown. The C-terminal region of EIN2 bears no homology with other known proteins (Alsonso et al., 1999). Mutant screening for resistance to auxin polar transport, cytokinins and delayed senescence led to the isolation of alleles of ein2, suggesting EIN2 as a nodal point in hormonal cross-talk (Fujita and Syono, 1996; Su and Howell, 1992; Oh et al., 1997). Despite being critical for ethylene signaling, very little information is available about EIN2. It is still not clear how EIN2 receives signals from its upstream components, how it interacts with the downstream transcription factor EIN3, or how the N- terminal transmembrane domains function in ethylene signaling. Recent findings provided evidence for the regulation of EIN2 level by proteolytic degradation (Qiao et al., 2009). Two F- box proteins ETP1 (Ethylene Targeting Protein 1) and ETP2 were found to interact with the C- terminal domain of EIN2 and mediate rapid proteolytic degradation of EIN2. It was also shown that ethylene down regulates these F-box proteins, thereby positively controlling EIN2 protein accumulation (Qiao et al., 2009). In another recent development, EIN2 was shown to regulate leaf senescence by controlling miRNA164 (micro RNA164) level (Kim et al., 2009). Recently, EIN2 was shown to be localized in ER membrane and an unexpected interaction between ETR1 and EIN2 was proposed (Bisson et al., 2009). The ethylene signaling pathway at the downstream of EIN2 involves transcription factors EIN3 and EILs (EIN3-like) (Chao et al., 1997; Solano et al., 1998). EIN3 was reported to be

22 regulated by two F-box proteins (act as E3 ubiquitin ligase), EBP1 and EBP2, which target EIN3 for proteosomal degradation by 26S proteosome mediated pathway (Guo et al., 2003; Binder et al., 2007). Arabidopsis EIN3, EIL1 and EIL2 bind at the EIN3-binding site (EBS) in the promoter regions of ERF1 (member of Ethylene Response Factor family), EBP2 and other primary ethylene responsive genes and ERF1 transcription factor further binds at the GCC elements in the promoter regions of other secondary ethylene responsive genes (Solano et al., 1998).

Figure 1.6. Ethylene signaling network (adapted from Yoo et al., 2009).

Chapter 2. Inactivation of CYP82E2 by Degenerative Mutations was a Key Event in the Evolution of the Alkaloid Profile of Modern Tobacco

(Published as: Chakrabarti, M., K.M. Meekins., L.B. Gavilano and B. Siminszky. 2007. New Phytologist. 175: 565-574. Author of the dissertation duly acknowledges the role of K.M. Meekins in yeast expression, microsomal protein isolation, role of L.B. Gavilano in some of the cloning steps and contribution of B. Siminszky in conceiving the project idea.)

2.1. Introduction The production of pyridine alkaloids, such as nicotine, nornicotine, anabasine and anatabine, is a characteristic feature of all species of the genus Nicotiana (L.). Alkaloid production is induced by plant tissue damage (Baldwin, 1988; Baldwin & Ohnmeiss, 1993; Baldwin et al., 1994b) and serves as a defense against herbivore attack (Baldwin et al., 1994a; Steppuhn et al., 2004). Wounding-induced accumulation of alkaloids in the leaf is regulated by jasmonic acid and auxin signaling (Baldwin et al., 1994b; Baldwin et al., 1996; Baldwin, 1998; Imanishi et al., 1998; Shi et al., 2006). While pyridine alkaloids were detected in all observed species of Nicotiana, the number and abundance of the different alkaloids are highly variable within the genus (Sisson & Severson, 1990). In N. tomentosiformis (Goodspeed), for example, nornicotine is the most abundant alkaloid, in contrast to N. glauca (Graham) where anabasine predominates. In the green leaves of N. sylvestris (Spegazzini and Comes) the primary alkaloid is nicotine, but almost the entire nicotine content of the leaf is metabolized into nornicotine during senescence. Interestingly, the alkaloid profile of the majority of cultivated tobacco (N. tabacum L.), an allotetraploid species derived from the hybridization of ancestral N. tomentosiformis and N. sylvestris (Goodspeed, 1954; Bogani et al., 1997; Murad et al., 2002; Yukawa et al., 2006), is different from that of its two progenitors. In most tobacco, nicotine represents about 95% of the total alkaloid pool in both the green and senescing leaves (Saitoh et al., 1985; Sisson & Severson, 1990). In a portion of tobacco plants, however, the alkaloid composition is similar to that found in N. sylvestris in that nicotine predominates only in the green leaf, and a large percentage of the nicotine content is converted into nornicotine once the leaves senesce (Burk & Jeffrey, 1958). Tobacco plants that contain nicotine in both the green and senescing leaves and those individuals that convert nicotine to nornicotine in the senescing leaves are termed “nonconverters” and “converters”, respectively. Tobacco conversion, the process whereby a nonconverter individual gives rise to a converter progeny, is thought to be mediated by the activation of an unstable conversion locus that is present in most, if not all, tobacco plants (Mann et al., 1964). Because N. tomentosiformis and N. sylvestris convert nicotine to nornicotine in the green and senescing leaves, respectively, the evolution of nicotine-accumulating modern tobacco required the inactivation of conversion factors inherited from the two ancestral parents. Mann et al (1964) proposed that nicotine-retaining phenotype of nonconverter tobacco is a result of loss- of-function mutations that inactivated the conversion loci derived from N. tomentosiformis (CT)

and N. sylvestris (CS).

Previously, the isolation of a group of closely related tobacco cytochrome P450 (P450) genes, designated the CYP82E2 gene subfamily was reported (Siminszky et al., 2005). Ectopic expression of NtabCYP82E4, one of the members of the CYP82E2 gene subfamily, mediated the N-demethylation of nicotine in yeast and tobacco (Siminszky et al., 2005; Xu et al., 2007) and expression analysis of the gene demonstrated that the transcription of NtabCYP82E4 is strongly upregulated in the senescing leaves of converter tobacco (Gavilano et al., 2007; Xu et al., 2007). In contrast to NtabCYP82E4, other members of the CYP82E2 gene subfamily, such as NtabCYP82E2 and NtabCYP82E3, did not encode nicotine N-demethylase (NND) activity (Siminszky et al., 2005). NtabCYP82E4 and NtabCYP82E3 were found to originate from the N. tomentosiformis genome located on a chromosomal fragment defined by the CT locus (Gavilano et al., 2007). Unlike NtabCYP82E3, the N. tomentosiformis ortholog NtomCYP82E3 exhibited high NND activity (Gavilano et al., 2007). Previous results showed that NtabCYP82E3 was inactivated by the W330C knock-out mutation and NtabCYP82E4 was silenced by transcriptional suppression leading to the inactivation of the CT locus in nonconverter tobacco (Gavilano et al., 2007). Current study extended our investigation to the molecular characterization of the conversion factor donated by N. sylvestris to tobacco. A NND gene was isolated, designated NsylCYP82E2, from a senescing leaf cDNA library of N. sylvestris. It was demonstrated that the presence and expression of NsylCYP82E2 are correlated with NND activity in the senescing leaves of N. sylvestris, but in tobacco the orthologous NtabCYP82E2 gene is silenced by two

knock-out mutations. Findings of this project indicate that NsylCYP82E2 is located within the CS locus and the inactivation of NtabCYP82E2 played a major role in the evolution of the alkaloid profile of modern tobacco.

2.2. Materials and Methods 2.2.1. Plant materials and alkaloid analysis

The SC58(CSCS) tobacco line was developed by crossing the nonconverter Flue-cured SC58 tobacco cultivar with N. sylvestris followed by 8 cycles of backcrossing of the interspecific hybrid to the SC58 recurrent parent (Mann et al., 1964). In each backcross cycle, senescing-leaf converter individuals were selected and used in the subsequent cross with SC58. To identify th homozygous plants for the CS converter locus, the product of the 8 backcross was self-pollinated and the progeny was screened for individuals that no longer segregated for the senescing-leaf converter phenotype (Mann et al., 1964); Ramsey Lewis, personal communication). Seed of N. sylvestris was obtained from the tobacco germplasm collection of North Carolina State

University. Other tobacco lines used in the studies were the DH98-325-5 (nonconverter) and DH98-325-6 (converter) double haploid, full-sib Burley lines. All plants were grown in a greenhouse under a 14/10 hour light/dark cycle, fertilized with Professional All Purpose Plant Food (20-20-20) fertilizer (Spectrum Brands Inc., Madison, WI) once a week and watered daily as needed. For alkaloid and quantitative real time-PCR (qRT-PCR) analyses, leaves of about 1 m tall plants were collected. Senescent leaves were obtained by dipping detached green leaves into a 2% ethephon solution for 30 sec and curing them in the dark in a plastic bag until they turned yellow. Alkaloid analysis of the leaves was performed by gas chromatography as previously described (Gavilano et al., 2007).

2.2.2. Isolation of the NsylCYP82E2 cDNA Total RNA was isolated from senescing N. sylvestris leaves using the TRIzol reagent following the manufacturer’s instructions (Invitrogen, Life Technologies, Carlsbad, CA). cDNA was generated by reverse transcription from 0.2 µg total RNA using the StrataScript® First-Strand Synthesis System (Stratagene, La Jolla, CA). cDNAs of putative NND genes were amplified by a standard PCR reaction containing 10 ng cDNA template, 2 µM each primer, 200 µM each of

dNTP, and 1.5 mM MgCl2 in a 50 µl final reaction volume. The conditions for the PCR amplification were as follows: initial denaturing at 95°C for 3 min, followed by 30 cycles of denaturing at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 90 sec. The nucleotide sequences of the primers used in the reaction (E2cDNA_F and E2cDNA_R) are listed in Supplemental Table S1.

2.2.3. Isolation of the genomic clones of the CYP82E2 orthologs NtabCYP82E2 upstream promoter sequence was isolated using the Universal GenomeWalkerTM kit (Clonetech, Palo Alto, CA). Genomic DNA isolated from tobacco with the Plant DNAzol reagent (Invitrogen) was digested with the DraI restriction enzyme and ligated with blunt end adapters supplied by the Universal Genome Walker kit. PCR amplification was carried out by the manufacturer’s protocols using adapter- and NtabCYP82E2-specific primers (E2Prom_R1 and E2Prom_R). Full-length NtabCYP82E2 and NsylCYP82E2 genomic clones were amplified with forward (E2Gen_F) and reverse (E2Gen_R) primers complementary to the CYP82E2 upstream promoter element and 3' untranslated regions, respectively, using 100 ng genomic DNA as template and standard PCR conditions described above. To determine the DNA sequence of the CYP82E2 orthologs in various tobacco tester lines, plant genomic DNA was extracted by homogenizing 100 mg fresh leaf tissue in 500 ml homogenization buffer (100 mM

Tris-HCl, pH 8.8, 1 M KCl, 10 mM EDTA) using the FastPrep FP120 Cell Disrupter (Qbiogene, Inc. Carlsbad, CA). A CYP82E2 fragment was amplified using primers specific to the CYP82E2 intron (E2Ex2_F) and second exon (E2Ex2_R) and 1 µl of leaf extract as a template. In all sequencing experiments, PCR products were cloned into the pGEM®-T Easy cloning vector (Promega Corp., Madison, WI) and sequenced according to the dideoxy method using synthetic oligonucleotides as primers (Sanger et al., 1977).

2.2.4. Site-directed mutagenesis and expression of CYP82E2 variants in yeast CYP82E2 sequence variants were generated according to the protocol of the QuikChangeTM site-directed mutagenesis kit (Stratagene) using the NtabCYP82E2 gene as a template. The intended nucleotide changes were verified by DNA sequencing. Constructs assembled by cloning the CYP82E2 variants into the pYeDP60 yeast expression vector were introduced into the WAT11 yeast strain by the method of (Gietz et al., 1992). Yeast culturing and the induction of gene expression with galactose were performed as described by (Pompon et al., 1996).

2.2.5. Evaluation and kinetic analysis of CYP82E2-mediated nicotine metabolism Measurements of nicotine N-demethylation by CYP82E2 variants were performed using yeast microsomes overexpressing the corresponding cDNA. Yeast microsomes were isolated by mechanical disruption of the cell wall according to the protocol of (Pompon et al., 1996). Microsomal protein concentration was determined by the Bradford method (Bio-Rad Laboratories, Hercules, CA). NND activity was assayed in a 150 µl reaction mixture containing 50 mM phosphate buffer (pH 7.1), 500 µg of microsomal protein, 2.45 µM [pyrrolidine-2-14C] nicotine (Moravek Biochemicals, Brea, CA), and 0.75 mM NADPH. After 45 min incubation at 23°C, the reactions were arrested with 50 µl of acetone, the reaction mixture was centrifuged at 16,000 X g for 2 min and 50 l of the supernatant was spotted on a 250 µm Whatman K6F silica plate. 14C-labeled nicotine and nornicotine were separated in a chloroform/methanol/ammonia (60:10:1) (vol vol-1) solvent system. The locations of the radiolabeled traces were determined with a Bioscan (Washington, DC) System 400 imaging scanner. The relative abundance of the parent molecule to the demethylated metabolite was assessed by integration of each radioactive peak in the profile. The components of the nicotine metabolism assay for the kinetic analysis of NsylCYP82E2 were the same as those listed above, except the reaction mixture contained 90 µg microsomal protein and nicotine concentration was adjusted with non-radiolabeled nicotine in the range of 0.6 to 197 µM. Kinetic parameters were calculated for partially purified NsylCYP82E2 extracts as previously described (Gavilano et al., 2007).

2.2.6. Allele-specific PCR Genomic DNA was isolated from N. sylvestris and the various tobacco genotypes using the DNAzol reagent. Allele-specific PCR was performed in two consecutive PCR reactions with nested primers (Supplemental Table S1). In the first round of amplification, CYP82E2-specific primers (E2As_F1 and E2As_R1) were selected that perfectly matched the nucleotide sequence of both the N. sylvestris and tobacco orthologs of CYP82E2. The product of the first PCR reaction was diluted 50 times and 1 µl of the dilution was used as a template in the second PCR. Amplification of the NsylCYP82E2 and NtabCYP82E2 fragments was achieved using a CYP82E2-specific forward primer (E2As_F2) and allele-specific reverse primers (NsE2As_R2 and NtE2As_R2) that differed by a single base at the 3' end (Supplemental Table S1). The composition and conditions of the PCR reactions were the same as those described above for isolating the NsylCYP82E2 cDNA, except 64°C annealing temperature was used in the second round of amplification.

2.2.7. Quantitative Real Time-PCR analysis Total RNA was isolated from 100 mg leaf tissue using the TRIzol reagent. Genomic DNA was removed from the samples by treatment with TURBO DNA-free DNase (Ambion, Austin, TX). First strand cDNA was synthesized from 5 µg of total RNA using the StrataScript® First- Strand Synthesis System. cDNA samples were subjected to SYBR Green I chemistry-based qRT-PCR analysis as previously described (Gavilano et al., 2007), except the annealing temperature was adjusted to 59°C and CYP82E2-specific primers (E2Rt_F and E2Rt_R) were used (Supplemental Table S1). DNA sequence of the 229 bp RT-PCR products was confirmed by ligating the amplicons into the pGEM®-T Easy vector and sequencing 20 randomly selected clones.

2.3. Results 2.3.1. Alkaloid analysis of plant samples To confirm the nornicotine phenotype of the plant material used in this study, the nicotine and nornicotine levels in N. sylvestris and tobacco genotypes SC58, SC58(CSCS), DH98-325-5 and DH98-325-6 were determined. The rate of nicotine to nornicotine conversion was low (< 3%) in the nonconverter tobacco cultivars SC58 and DH98-325-5, while high percentage (>91%) of nicotine was metabolized into nornicotine in the senescing leaves of N. sylvestris, DH98-325-6 converter tobacco and the SC58(CSCS) introgression line (Table 2.1).

Table 2.1. Alkaloid profiles of the green and cured leaves of Nicotiana plants used in the study. Plant Phenotype % % % Nicotinea Nornicotinea Conversionb Green Curedc Green Cured Green Cured N. sylvestris SLC 1.10 d 0.04 0.02 1.15 1.6 97.5 ( 0.40)e ( 0.04) (0.01) (0.35) (0.04) (2.60) SC58 NC 0.95 1.53 0.02 0.04 2.1 2.7 (0.63) (0.55) (0.01) (0.02) (1.04) (0.59)

SC58(CSCS) SLC 1.03 0.01 0.04 1.39 3.5 99.4 (0.52) (0.004) (0.04) (0.77) (2.56) (0.28) DH98-325-5 NC 2.28 1.33 0.05 0.04 2.2 3.0 (0.34) (0.64) (0.01) (0.02) (0.08) (0.32) DH98-325-6 SLC 2.03 0.15 0.10 1.55 4.5 91.6 (1.14) (0.13) (0.08) (0.16) (0.93) (7.30) aPercentage of leaf dry weight. b[% nornicotine (% nicotine + % nornicotine)-1] X 100. cLeaves were treated with ethephon and cured until they turned yellow. dMean over the alkaloid content of three plants. eValues in parenthesis represent standard deviation. Abbreviations: NC, nonconverter; SLC, senescing-leaf converter.

Cultivar SC58(CSCS) was developed by crossing N. sylvestris with the nonconverter Flue- Cured tobacco cultivar SC58 and the product of the cross was subjected to 8 cycles of backcrosses with the recurrent parent, cultivar SC58 (Mann et al., 1964). In each backcross generation, senescing-leaf converter individuals were selected and used in the next cross with the

recurrent parent. After 8 generations of selective backcrosses, cultivar SC58(CSCS) is estimated to contain less than 0.5% of the haploid N. sylvestris genome including the CS converter locus. Because the senescing-leaf converter trait of DH98-325-6 tobacco is conferred by an unstable converter locus derived from N. tomentosiformis (Gavilano et al., 2007), in contrast to N.

30 sylvestris and SC58(CSCS) tobacco where nicotine conversion is mediated by the stable CS converter locus (Mann et al., 1964), these results demonstrate that the two conversion loci confer similar, senescence-inducible nornicotine phenotypes.

2.3.2. Isolation of the NsylCYP82E2 cDNA Nornicotine production in N. sylvestris is a senescence-inducible process (Sisson &

Severson, 1990) mediated by the dominant CS conversion locus (Mann et al., 1964). Because our earlier studies demonstrated that nicotine to nornicotine conversion is catalyzed by NtabCYP82E4 in converter tobacco (Siminszky et al., 2005; Gavilano et al., 2007) and by NtomCYP82E3 and NtomCYP82E4 in N. tomentosiformis (Gavilano et al., 2007), it was hypothesized that the gene(s) located at the CS locus also belong to the CYP82E2 gene subfamily. To isolate putative NND cDNAs from N. sylvestris, PCR was performed using a N. sylvestris senescing leaf cDNA library as a template in conjunction with forward and reverse primers complementary to the respective 5' and 3' terminal cDNA regions conserved among the members CYP82E2 gene subfamily (Supplemental Table S1). The identical DNA sequence of ten randomly selected clones suggested that a large percentage of the amplicons were amplification products of a single cDNA sequence (data not shown). BLAST homology searches against the non-redundant nucleotide databases deposited in GeneBank indicated that the DNA sequence of the isolated cDNAs shared 99.8 % identity with NtabCYP82E2. Due to its close sequence similarity to NtabCYP82E2, the isolated cDNA was named NsylCYP82E2. DNA sequence alignments between NsylCYP82E2 and NtabCYP82E2 cDNAs detected three nucleotide polymorphisms at positions 1123, 1243 and 1265 where NsylCYP82E2 contained G, T and G and NtabCYP82E2 contained A, C and T bases, respectively (Table 2.2). The nucleotide polymorphisms located at positions 1123 and 1265 of the NsylCYP82E2 cDNA predicted the respective K375E and L422W amino acid substitutions, while the nucleotide polymorphism at position 1243 did not encode changes in amino acid residues relative to the NtabCYP82E2 cDNA (Table 2.2). The nucleotide sequence of the NsylCYP82E2 coding region is 94 % identical to that of both NtabCYP82E3 and NtabCYP82E4, while the predicted amino acid sequence of NsylCYP82E2 is 92.7 and 93.4 % identical to that of NtabCYP82E3 and NtabCYP82E4, respectively.

Table 2.2. Polymorphic variations of the CYP82E2 orthologs in N. sylvestris and various tobacco genotypes. Plant Phenotype N1123(AA375) N1243(AA415) N1265(AA422) CYP82E2 ortholog N. sylvestris SLC G (Glu) T (Leu) G (Trp) NsylCYP82E2

SC58(CSCS) SLC G (Glu) T (Leu) G (Trp) NsylCYP82E2 SC58 NC A (Lys) C (Leu) T (Leu) NtabCYP82E2 DH98-325-5 NC A (Lys) C (Leu) T (Leu) NtabCYP82E2 DH98-325-6 SLC A (Lys) C (Leu) T (Leu) NtabCYP82E2 Abbreviations: AA, amino acid; N, nucleotide; NC, nonconverter; SLC, senescing-leaf converter.

2.3.3. The NsylCYP82E2 cDNA encodes a functional NND To determine whether NsylCYP82E2 possesses NND activity, the NsylCYP82E2 cDNA was expressed in yeast. Microsomal fractions isolated from yeast cells that expressed the NsylCYP82E2 cDNA under the transcriptional control of the galactose-inducible GAL10-CYC1 promoter actively catalyzed the conversion of nicotine to nornicotine (Table 2.3). In contrast, microsomes of yeast transformed by the empty control plasmid or the NtabCYP82E2 cDNA exhibited no NND activity (data not shown). Because the amino acid sequence of NtabCYP82E2 differs only at positions 375 and 422 from that of NsylCYP82E2, the catalytic roles of the Glu375 and Trp422 residues of NsylCYP82E2 in nicotine N-demethylation were checked. Using site- directed mutagenesis, a series of NsylCYP82E2 cDNA mutants encoding either the E375K or W422L mutation, were engineered. Expression of the mutant NsylCYP82E2 cDNAs in yeast revealed that either of the two mutations abolished NND activity to the NsylCYP82E2 variants (Table 2.3). These results demonstrated that the amino acid polymorphisms between NsylCYP82E2 and NtabCYP82E2 at positions 375 and 422 account for the differential NND activity of the two CYP82E2 orthologs. NND activity of NsylCYP82E2 is conferred by the Glu375 and Trp422 residues, but nicotine N-demethylation is inactivated by the Lys375 and Leu422 substitutions in NtabCYP82E2 .

Table 2.3. NND activity of CYP82E2 variants. Protein AA375 AA422 NND activity NtabCYP82E2 Lys Leu No NsylCYP82E2 Glu Trp Yesa CYP82E2* Glu Leu No CYP82E2* Lys Trp No a The vmax and Km values for NsylCYP82E2-mediated nicotine N-demethylation were 4.3 ± 0.11 nmol min-1 mg protein-1 and 15.0 ± 1.54 M (mean ± standard error), respectively. *Artificial mutant variant. Abbreviations: AA, amino acid; NND, nicotine N-demethylase.

2.3.4. Isolation of the genomic NsylCYP82E2 clone Due to the high sequence conservation within the CYP82E2 gene subfamily, selective amplification of a single, full-length subfamily member from genomic DNA can be problematic. The difficulties associated with allele-specific PCR amplification were circumvented by isolating a 206 bp promoter fragment of NsylCYP82E2, a region where sequence homology among the closely-related subfamily members is relatively low. Using a forward and reverse primer complementary to the 5' upstream and 3' untranslated region of NsylCYP82E2, respectively, a full-length genomic NsylCYP82E2 clone was isolated. DNA sequence analysis revealed that NsylCYP82E2 was composed of a 1245 bp intron and a 1554 bp coding region which was divided into a 939 bp and a 615 bp exon. The nucleotide sequence of NsylCYP82E2 was deposited in the GenBank database under accession number EF472002. Compared to NtabCYP82E2, the NsylCYP82E2 intron contains 5 nucleotide differences (99.6 % identity) and shares 64.4 and 66.7 % identity with the NtabCYP82E3 and NtabCYP82E4 introns, respectively. The 206 bp upstream sequence of NsylCYP82E2 is 86.4% identical to the corresponding region of NtabCYP82E4 (Xu et al., 2007).

2.3.5. NsylCYP82E2 is associated with the senescing-leaf converter phenotype of N. sylvestris The observations that the N. sylvestris ortholog of CYP82E2 encodes a functional NND while the N. tabacum ortholog of the gene is inactivated by two point mutations led us to the hypotheses that NsylCYP82E2 represents a key conversion factor within the CS converter locus of N. sylvestris and the inactivation of this gene in tobacco played an important role in the evolution of the alkaloid profile of modern tobacco. To test these hypotheses, it was examined whether an

33 association can be found between NsylCYP82E2 and the senescing-leaf converter phenotype of N. sylvestris. Co-segregation of NsylCYP82E2 with the senescence-inducible converter trait was

evaluated using tobacco cultivar SC58 (CSCS).

If NsylCYP82E2 is located within the CS converter locus, the gene should be present in genome of tobacco cultivar SC58(CSCS). To determine whether the CYP82E2 locus found in

SC58(CSCS) encodes the N. sylvestris or the tobacco ortholog of CYP82E2, the second exon of

the CYP82E2 gene was amplified from SC58(CSCS), N. sylvestris, and several pure tobacco genotypes, such as SC58, DH98-325-5 and DH98-325-6. The three polymorphic nucleotide residues located in the second exon of NsylCYP82E2 and NtabCYP82E2 at positions 1123, 1243 and 1265 were used to distinguish between the two CYP82E2 orthologs (Table 2.2). DNA

sequence analysis revealed that the CYP82E2 locus isolated from both SC58(CSCS) and N. sylvestris encoded NsylCYP82E2, while all tested tobacco genotypes contained the NtabCYP82E2 ortholog (Table 2.2). The identity of the CYP82E2 locus in the tester lines was confirmed by allele-specific PCR amplification. Allele-specific reverse primers were designed based on sequence divergence at nucleotide position 1265 to distinguish between the NsylCYP82E2 and NtabCYP82E2 genotype. Amplification products were observed in the PCR reactions when

genomic DNA isolated from N. sylvestris or SC58(CSCS) was amplified with a NsylCYP82E2- specific primers or when genomic DNA of pure tobacco was used in conjunction with a NtabCYP82E2-specific primer (Figure 2.1). No PCR product was detected when the primers were reversed (Figure 2.1). Collectively, these results suggest that NsylCYP82E2 is allelic to

NtabCYP82E2 and demonstrate that NsylCYP82E2 found in SC58(CSCS) is derived from the N. sylvestris donor parent.

Figure 2.1. Allele-specific amplification of the CYP82E2 orthologs from the genomic DNA of Nicotiana sylvestris and various tobacco genotypes. G and T letters indicate the polymorphic nucleotides located at position 1265 of NsylCYP82E2 and NtabCYP82E2, respectively. Lanes 1, 2 and 3, 4 show the PCR products generated by the amplification of purified CYP82E2 templates. Abbreviation: 325-6, DH98-325-6.

2.3.6. Expression of NsylCYP82E2 and NtabCYP82E2 is induced in the senescing leaf Because nornicotine production is strongly induced in the cured leaves of N. sylvestris, the expression of genes responsible for nicotine to nornicotine conversion are expected to be senescence-inducible. To investigate the transcriptional regulation of the NsylCYP82E2 and NtabCYP82E2, expression profiles of the CYP82E2 orthologs in the green and cured leaves of N. sylvestris, and converter (DH98-325-6) and nonconverter (DH98-325-5) tobacco were analyzed by allele-specific qRT-PCR analysis. The results showed that the expression of CYP82E2 variants was low in the green leaves of all plants, but the transcription of the CYP82E2 orthologs was dramatically upregulated in the cured leaves (Table 2.4). The fold-induction of CYP82E2 expression in cured versus green leaves was 5031, 304 and 430 in N. sylvestris and DH98-325-5 and DH98-325-6 tobacco, respectively. These results indicate that the transcriptional regulation of the NsylCYP82E2 NND gene is consistent with the senescence-inducible nornicotine phenotype of N. sylvestris and SC58(CSCS) tobacco. Furthermore, the results show that fold- induction of CYP82E2 in N. sylvestris is about 12 times higher than that in tobacco.

Table 2.4. Absolute quantification of the CYP82E2 cDNA derived from the green and cured leaves of N. sylvestris and DH98-325-5 and DH98-325-6 tobacco by qRT-PCR analysis.

Sample Green Cured Fold- (pg) (pg) inductiona N. sylvestris b Mean 0.106 544.19 5031ac STD (0.031) (216.87) (633)

DH-98-325-5

Mean 0.042 10.96 304b STD (0.023) (3.18) (149) DH-98-325-6

Mean 0.028 12.51 430b STD (0.008) (4.18) (37) aCured Green-1. bMeans are for 1 leaf of 3 independent plants, 3 cDNA measurements per sample (n = 9). cNumbers followed by different letters are significantly different according to Fisher’s protected LSD (0.05). Abbreviations: qRT-PCR, quantitative real time-polymerase chain reaction; STD, standard deviation.

2.4. Discussion

To investigate the molecular structure of the CS conversion locus, member of the CYP82E2 gene subfamily was isolated from a cDNA library derived from the senescing leaf of N. sylvestris. With the exceptions of the K375E and L422W substitutions, the predicted amino acid sequences of 10 randomly selected cDNAs were identical to that of NtabCYP82E2, a P450 isoform that exhibits no NND activity. Interestingly, NND activity assays of transgenic yeast microsomes revealed that the NsylCYP82E2 cDNA encodes a functional NND enzyme and both the Glu375 and Trp422 residues were required for NND activity (Table 2.3). Amino acid alignments of P450s isolated from a wide range of organisms including bacteria, plants and animals reveal a highly conserved glutamate and aromatic amino acid residue at positions homologous to Glu375 and Trp422 of NsylCYP82E2, respectively. Glu375 is the first amino acid of the strictly conserved EXXR motif that is located in the K helix of most P450 polypeptides where it is thought to stabilize the association with the heme prosthetic group (Hasemann et al., 1995). Substitution of either the glutamate or arginine residues of the EXXR motif has been shown to impair the enzymatic actions in several P450s (Shimizu et al., 1991; Chen & Zhou, 1992; Hatae et al., 1996). Trp422 of NsylCYP82E2 is homologous to the conserved aromatic amino acid residues found at the K'-meander region of P450s (Hasemann et al., 1995). The strict conservation of glutamate in the EXXR motif and the aromatic amino acid residue located between the K helix and meander region of P450 proteins suggest that the E375 K and W422L substitutions resulted in the nonfunctionalization rather than the neofunctionalization of NtabCYP82E2. DNA sequence and allele-specific PCR analyses of the CYP82E2 locus in N. sylvestris and

tobacco tester lines SC58 and SC58(CSCS) revealed that the presence of NsylCYP82E2 is correlated with nornicotine production in the senescing leaves and demonstrates that

NsylCYP82E2 is located on a chromosomal fragment defined by the CS conversion locus (Table 2.2, Figure 2.1). Expression analysis of the CYP82E2 orthologs showed that the transcription of both NsylCYP82E2 and NtabCYP82E2 were sharply upregulated in the senescing versus green leaves (Table 2.4). Given the senescing-leaf converter phenotype of N. sylvestris, the strong

senescence-specific upregulation and relatively high vmax value of NsylCYP82E2 provide additional evidence that NsylCYP82E2 plays a central role in nicotine to nornicotine conversion in N. sylvestris. Although the expression of both orthologs of CYP82E2 were induced by senescence, the fold-induction of NsylCYP82E2 was about 12 times higher than that of NtabCYP82E2 suggesting that the transcription of the CYP82E2 locus was suppressed after the emergence of amphiploid tobacco. Interestingly, similar reduction was observed in the

36 transcription of the N. tomentosiformis-derived NtabCYP82E3 and NtabCYP82E4 compared to the expression of their N. tomentosiformis orthologs (Gavilano et al., 2006). The alkaloid profile of cultivated tobacco is strongly influenced by the activity of an unstable conversion locus, derived from the progenitor species N. tomentosiformis, which mediates the N-demethylation of a high percentage of nicotine in the senescing leaves (Wernsman & Matzinger, 1968). In theory, this conversion locus could encode a NND gene or an upstream regulator of NND expression. It was proposed previously that the unstable conversion locus represents the N. tomentosiformis-derived NtabCYP82E4 (Gavilano et al., 2007). Data in this report is consistent with this prediction showing that the senescence-induced expression of NtabCYP82E2 in nonconverter plants is similar to the transcriptional regulation of the NtabCYP82E4 in converter tobacco (Table 2.4 and Gavilano et al., 2007). Because the similarities in transcriptional regulation and the close phylogenetic relationship between NtabCYP82E2 and NtabCYP82E4 suggest that the expression of these genes is controlled by the same trans-acting factors, the apparent functioning of the NtabCYP82E2-associated trans-acting factors in nonconverter tobacco provides additional support that the unstable mutation associated with the transcriptional control of NtabCYP82E4 targets the NtabCYP82E4 locus. The strong sequence and regulatory conservation between NsylCYP82E2 and NtomCYP82E4 also suggest that these genes are orthologous, and the duplication of the gene ancestral to NsylCYP82E2 and NtomCYP82E4 occurred in a common progenitor of N. sylvestris and N. tomentosiformis. Taken together, these results extend our previously proposed model for the evolution of the alkaloid profile of modern tobacco (Gavilano et al., 2007) to also include the molecular characterization of the CS converter locus (Figure 2.2). The allotetraploid genome of tobacco is originated from the hybridization of the ancestral S and T genomes of N. sylvestris and N. tomentosiformis, respectively. Both N. sylvestris and N. tomentosiformis contain a conversion

locus, respectively designated CS and CT, which convert nicotine to nornicotine in the senescing leaves of N. sylvestris and in the green and senescing leaves of N. tomentosiformis. The

chromosomal fragment defined by the CT conversion locus contains at least two NND genes: NtomCYP82E3 and NtomCYP82E4. The expression of NtomCYP82E3 is specific to the green leaves while NtomCYP82E4 is preferentially transcribed in the senescing leaves of N. tomentosiformis. The CS locus of N. sylvestris encodes NsylCYP82E2, a likely ortholog of NtomCYP82E4, which also mediates the conversion of nicotine to nornicotine in the senescing leaves. Because ancestral tobacco had most likely inherited the dominant CT and CS conversion alleles, these plants accumulated nornicotine as the predominant alkaloid in the green and yellow leaves alike.

Figure 2.2. Proposed model for the evolution of the alkaloid profile of tobacco. Predominant alkaloid is shown in the green (upper region) and senescing (lower region) leaf. The order of the mutations may have been different. Abbreviations: CS and cS, dominant and recessive alleles of the CS conversion locus derived from N. sylvestris; CT and cT, dominant and recessive alleles of the CT conversion locus derived from N. tomentosiformis; lf, leaf; Nic, nicotine; Nornic, nornicotine.

Several molecular events involving the duplicated NND genes shaped the evolution of the alkaloid profile of tobacco from its ancestral form to its present phenotype. The stable E375K and W422L loss-of-function mutations inactivated the N. sylvestris-derived NtabCYP82E2 and the W330C amino acid replacement silenced the N. tomentosiformis-derived NtabCYP82E3 gene. In addition, transcriptional silencing reduced the expression of several members of the CYP82E2 gene subfamily including NtabCYP82E2, NtabCYP82E3 and NtabCYP82E4. Silencing the transcription of NtabCYP82E4 eliminated the third major converter factor of tobacco. Another homolog of NtabCYP82E4 was isolated recently, named as NtabCYP82E5v2, which originates from the N. tomentosiformis and expresses at low level in both green and senescing leaves of both converter and nonconverter tobacco. NtabCYP82E5v2 is possibly involves in the basal level of conversion in the green and senescing leaves of nonconverter and green leaves of converter

38 tobacco (Gavilano et al, 2007). The inactivation of the duplicated NND genes by knock-out mutations and the transcriptional silencing of NtabCYP82E4 led to the emergence of nonconverter tobacco, while the reactivation of NtabCYP82E4 gave rise to the converter phenotype. This model is consistent with a large body of observations that polyploidization is followed by nonfunctionalization by degenerative mutations and extensive changes in expression of redundant genes (reviewed in Wendel, 2000; Adams & Wendel, 2005b; Adams & Wendel, 2005a). Transcriptional silencing of a significant portion of the transcriptome has been observed in a number of natural and synthetic allopolyploid plants and recent studies have demonstrated that several molecular processes including epigenetic changes, transposon activation, small RNA- and RNAi-mediated interactions are involved in reestablishing gene expression patterns in the duplicated genome (reviewed in Liu & Wendel, 2003; Adams & Wendel, 2005a). Therefore, one possibility is that the nonfunctionalization of NtabCYP82E genes was triggered by the merger of the N. sylvestris and N. tomentosiformis genomes. This scenario is also reminiscent of the recent proposal of Morant et al (2007) that shows evidence for the elimination of the duplications of the CYP98A gene involved in the biosynthesis of lignin precursors in hexaploid wheat (Morant et al., 2007). It is interesting to note that the alkaloid compositions of N. rustica and N. arentsii, two other allopolyploid species of the Nicotiana genus, are also different from that observed in at least one of their respective progenitors. N. rustica retains nicotine in the green and senescing leaves (Sisson & Severson, 1990), while N. paniculata and N. undulata, the two species most closely- related to the ancestral parents (Goodspeed, 1954; Matyasek et al., 2003), metabolize nicotine to nornicotine in the senescing leaves (Sisson & Severson, 1990). Similar to N. rustica and nonconverter tobacco, N. arentsii also exhibits a nonconverter phenotype (Sisson & Severson, 1990), in contrast to one of its putative progenitors, N. undulata (Goodspeed, 1954; Lim et al., 2004), a senescing-leaf converter species. These observations support the notion that the evolution of alkaloid content through inactivation of the NND genes is not restricted to tobacco, but also occurs in other Nicotiana. Nonfunctionalization of NND genes raises some intriguing questions about the evolution of the nicotine alkaloid biosynthetic pathway in the Nicotiana genus. It is widely believed that secondary metabolites evolve to enhance the fitness of the producer (reviewed in Wink, 2003). If NND activity and the resulting conversion of nicotine to nornicotine arose to provide an adaptive advantage to an early Nicotiana ancestor, what changes in the environment produced the selection pressure needed for the reemergence of the nicotine-retaining trait in the descendant species? A

39 possible answer involves the differential insecticidal activity of nicotine and nornicotine in various insects. While the toxicity of nicotine is higher than that of nornicotine to most observed herbivores (Siegler & Bowen, 1946; Yamamoto et al., 1968; Riah et al., 1997), the potency of the two chemicals is reversed in other species (Soloway, 1976). Therefore, the acquisition of NND activity in some ancestral Nicotiana and the loss of nicotine conversion in the related polyploids may have been driven by consumer adaptation to nicotine alkaloids. Emergence of the nicotine- retaining phenotype of tobacco could have been also aided by artificial selection, as man shows preference to nicotine-containing plants (Wernsman & Matzinger, 1968). However, given our current understanding that the evolution of nonconverter tobacco required inactivation of at least three conversion loci, planned breeding is unlikely to have acted as the only selective force. In summary, it was shown that the molecular changes associated with inactivation of the nicotine conversion loci in allopolyploid tobacco involved degenerative mutations and transcriptional silencing. Nonfunctionalization of three NND genes led to a transition of the alkaloid profile of tobacco from a high nornicotine to a high nicotine phenotype, and reactivation of the unstable NtabCYP82E4 locus appears to be responsible for the reversion of the ancestral nornicotine phenotype in the senescing leaves. Due to differences in the insecticidal spectrum of nicotine and nornicotine, the changes in alkaloid composition in Nicotiana may represent an adaptive response to a shift in sensitivity of herbivores to these compounds.

2.5. Summary • A putative NND gene was isolated from N. sylvestris • This gene showed 99.8% identity to NtabCYP82E2 and was designated as NsylCYP82E2 • NsylCYP82E2 is functionally active (i.e. shows NND activity) • NtabCYP82E2 has E375K and W422L mutations as compared to NsylCYP82E2, which makes it functionally inactive

• NsylCYP82E2 is the CS locus of N. sylvestris, which is responsible for the ‘senescing leaf conversion’ phenotype of N. sylvestris. • Transcription of both NsylCYP82E2 and NtabCYP82E2 are senescence inducible. • Collectively with our previously published data, these results show that inactivation of NND genes by degenerative mutations and/or transcriptional suppression played a key role in the evolution of the alkaloid profile of modern tobacco.

Chapter 3. CYP82E4-mediated nicotine to nornicotine conversion in tobacco is regulated by a senescence-specific signaling pathway

(Published as: Chakrabarti, M., S.W. Bowen., N.P. Coleman., K.M. Meekins., R.E. Dewey and B. Siminszky. 2008. Plant Molecular Biology. 66: 415-427. Author of the dissertation duly acknowledges the roles of S.W. Bowen and R.E. Dewey in screening tobacco BAC library, roles of N.P. Coleman and K.M. Meekins in some of the cloning steps and role of B. Siminszky in conceiving the project idea.)

3.1. Introduction In cultivated tobacco (Nicotiana tabacum L.) nicotine is the most abundant alkaloid, typically constituting more than 90 % of the total alkaloid pool. The remaining proportion of the alkaloid profile is primarily made up of secondary alkaloids, such as nornicotine, anatabine and anabasine (Sisson and Severson 1990). Nornicotine, the most abundant secondary alkaloid, represents about 3-5 % of the total alkaloid content (Saitoh, et al. 1985). In most tobacco populations, however, individual plants can be identified in which a large percentage of the nicotine is metabolized into nornicotine in the senescing leaves. Plants that accumulate nicotine as their primary alkaloid are referred as “nonconverters”, while individuals that convert a large portion of their nicotine content to nornicotine during senescence and curing are named “converters”. The transition of tobacco plants from the nonconverter to the converter phenotype is termed “conversion”, a process that can occur in a single generation as nonconverter plants can give rise to converter progeny (Mann, et al. 1964). Conversion of tobacco is controlled by an unstable conversion locus which is derived from the N. tomentosiformis progenitor of tobacco (Mann, et al. 1964). The molecular identity of the conversion locus has not been unambiguously identified, but indirect evidence suggests that the locus encodes the nicotine N-demethylase gene CYP82E4 (Chakrabarti, et al. 2007, Gavilano, et al. 2007, Siminszky, et al. 2005). Nicotine is predominantly produced in the roots of tobacco and translocated through the xylem to aerial parts of the plant (Dawson 1942, Hashimoto and Yamada 1994) where it is secreted by trichomes (Thurston, et al. 1966). Using reciprocal grafts of converter and nonconverter scions and stocks, (Wernsman and Matzinger 1968) showed that nicotine to nornicotine conversion mainly occurs in the senescing leaves and only low levels of nornicotine are produced in the roots. Similar to nicotine, nornicotine was also detected in trichome secretions (Thurston, et al. 1966). Nornicotine is formed through the oxidative N-demethylation of nicotine, a reaction primarily catalyzed by CYP82E4 in the senescing leaves (Gavilano, et al. 2006, Siminszky, et al. 2005, Xu, et al. 2007) and by CYP82E5v2 in the green leaves of tobacco (Gavilano and Siminszky 2007). Transcript accumulation of CYP82E4 is very low in the green leaves of converter and nonconverter tobacco and is sharply upregulated in the senescing leaves of converter tobacco demonstrating that the expression of CYP82E4 is regulated at the level of transcription (Gavilano, et al. 2006, Gavilano, et al. 2007, Siminszky, et al. 2005). The strong induction of CYP82E4 by senescence and the relatively high catalytic competence of the encoded protein were consistent with the senescence-dependent high nornicotine phenotype of converter tobacco suggesting that CYP82E4 plays a key role in nicotine to nornicotine conversion in converter plants.

Beyond the observations that nicotine to nornicotine conversion is induced by senescence, ethephon (Fannin and Bush 1992) and sodium bicarbonate (Shi, et al. 2003), little is known about the spatial, temporal, hormonal and stress-mediated regulation of the process. Senescence is a complex physiological process that occurs in response to aging and can be accelerated by various biotic and abiotic stresses, such as drought, darkness and pathogen attack, in addition to the hormones abscisic acid (ABA) and ethylene (reviewed in (Lim, et al. 2007, Yoshida 2003). Genes whose transcription is upregulated during senescence (i.e. senescence-associated genes, SAGs) can be either directly or indirectly regulated by stress or hormonal treatments. If the response of the SAG is rapid or if it is elicited in the young, green tissues, a direct regulatory role can be inferred for these factors. In contrast, a slow SAG response or a response that is restricted to the older leaves indicates an indirect effect of the inducer on SAG regulation (Weaver, et al. 1998). In this report, a fusion construct between the CYP82E4 promoter and the β-glucurodinase (GUS) reporter gene was used to further investigate the molecular identity of the locus responsible for nicotine conversion. The tissue- and organ-specific transcriptional regulation of the CYP82E4 promoter was examined, and the effects of signaling molecules, such as ethylene, jasmonic acid (JA), salicylic acid, ABA and hydrogen peroxide; infection with viruses; and abiotic stresses including drought and wounding on the stimulation of CYP82E4 promoter activity were tested. Results showed that the CYP82E4 promoter directs reporter gene expression to the aerial parts of the plant, and the activity of the promoter is induced by a senescence-specific pathway in the leaves. They also provide further evidence that the CYP82E4 gene itself represents the unstable converter locus responsible for the spontaneous occurrence of converter plants within nonconverter tobacco populations.

3.2. Materials and methods 3.2.1. Isolation of CYP82E4 promoter region To characterize the sequences immediately upstream of the CYP82E4 reading frame, a 33P- labeled fragment of the CYP82E4 cDNA was used as a hybridization probe to screen a tobacco BAC library generated through the North Carolina State University Tobacco Genome Initiative (www.tobaccogenome.org). Diagnostic restriction digests were subsequently used to distinguish BAC clones containing CYP82E4 from clones possessing other P450s of the CYP82E subfamily that cross-hybridized to the probe. Partial DNA sequence information from a BAC encompassing CYP82E4 was obtained by SeqWright DNA Technology Services (www.seqwright.com) using a

43 random shotgun sequencing approach. Sequence alignments revealed a contig containing CYP82E4 together with approximately 2.5 kb of 5΄ flanking sequence. To isolate a fragment of the upstream regulatory region of CYP82E4 from tobacco genomic DNA, a nested PCR approach was employed. Genomic DNA was isolated from three-month-old tobacco leaves using the Plant DNAzol reagent as described by the manufacturer (Invitrogen Life Technologies, Carlsbad, CA). Due to the complex repeat structure of the CYP82E4 locus, several primers had to be tested to obtain a single amplification product. A single, 3325 bp amplicon was produced when the CYP82E4 promoter-specific 5΄-TGGAAAAGATGGCCGATTAC-3΄ forward primer and the CYP82E4 intron-specific 5΄-GGGAAGAGCCACACTCCAAT-3΄ reverse primer were used in the first PCR reaction, and the nested 5΄-GAGGTTAGGCCGGCATTTA-3΄ forward and the 5΄-GGGGTATGATGCAGACAACA-3΄ reverse primers were added to the second PCR. The first PCR reaction contained 100 ng genomic DNA template, 2 µM each primer, 200 µM

each of dNTP, and 1.5 mM MgCl2 in a 50 µl final reaction volume. The conditions for the PCR amplification were as follows: initial denaturing at 95°C for 3 min, followed by 30 cycles of denaturing at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 90 sec. In the nested PCR, the same conditions were used, except 1µl of the10-fold diluted product of the first PCR was used as a template. The final amplicon was ligated into the pGEM-T Easy T/A cloning vector (Promega Corp., Madison, WI).

3.2.2. Generation of the CYP82E4:GUS and the promoter less GUS constructs Because the 3325 bp CYP82E4 cloned fragment contained not only 2172 bp of sequence corresponding to the CYP82E4 promoter region, but also a portion of the intron and the entire first exon of the gene, an additional PCR was used to extract the 2172 bp putative regulatory region from the clone. Amplification of the 2.2 kb promoter fragment was achieved by PCR using the primers 5΄-GGATCCTATGGATTTTTAGATAAGAAGTTGAGAA-3΄ (forward) and 5΄-AAGCTTGAGGTTAGGCTCGGCATTTA-3΄ (reverse) primers that were included HindIII and BamHI restriction enzyme recognition sites to facilitate ligation into the pBI121 plant expression vector. The DNA sequence of 2.2 kb promoter region was deposited into the GenBank under the accession number EU338375. The CYP82E4:GUS construct was created by replacing the CaMV 35S promoter of the pBI121 vector with the 2.2 kb upstream regulatory region of CYP82E4. The promoterless GUS construct was developed by excising the CaMV 35S promoter from pBI121, filling the 5’ overhangs of the linearized vector with Klenow DNA polymerase and ligating the blunt ends. Consensus sequence analysis of the cis-regulatory elements was performed using the PLACE database (Higo, et al. 1999).

3.2.3. Generation of transgenic plants CYP82E4:GUS and the promoterless GUS constructs were introduced into Agrobacterium tumifaciens strain LBA 4404 and excised leaf tissue of tobacco lines DH98-325-6 and DH98- 325-5 were transformed by the method of (Horsch, et al. 1985). Transgenic plantlets were transplanted to soil and kept in a growth chamber at 24°C with a 16/8 hr light/dark cycle for 30 days until transferred into a greenhouse. In the greenhouse, plants were maintained in a 14 /10 hr light / dark cycle and were fertilized twice a week with Professional All Purpose Plant Food (20-

20-20) fertilizer (Spectrum Brands Inc, Madison, WI, USA) until seed maturation. Transgenic T1 generation plants were selected on MS-based phytoagar medium containing 100 mg/L of kanamycin. Kanamycin-resistant seedlings were grown in a growth chamber for 45 days, and thereafter in a greenhouse for an additional 45 days, and maintained as described above until treatment. With the exception of ethylene, JA and TMV, all treatments were applied to the 3rd leaf from the apex.

3.2.4. Plant treatments All treatments were administered in the greenhouse with the exception of ethylene and JA treatments that were performed in a growth chamber under conditions already described.

Senescence Naturally senescent leaves at different developmental stages were directly taken from 3 month old plants. To artificially induce and accelerate senescence, the 5th leaf (from the apex) was harvested and cured in the dark in a plastic bag at 24°C until it turned yellow. Chlorophyll measurements were taken with a SPAD-502 chlorophyll meter (Konica Minolta Sensing Inc, Osaka, Japan). A SPAD unit is defined as the ratio of optical density at 650 nm and 940 nm transmitted through the leaf (Chernikova, et al. 2000). Flower senescence was measured at different developmental stages defined by Koltunow, et al. (1990). According to this system, Stages 1, 10, 12, and 13 represent budding; opening of corolla limb, petal tips pink; fully open flower with fully expanded, deep pink corolla limb; and senesced flower, respectively.

Ethylene Plants were placed into air tight, 3.9 L Mason jars fitted with septa. Ethylene gas was injected into the jars to obtain a 100 ppm final concentration, and plants were incubated for either 48 or 96 hours (Butt, et al. 1998). Control plants were also placed in similar chambers, but

without ethylene treatment. After each day the jars were opened to eliminate the build up of CO2

45 and refilled with ethylene. Ethylene concentrations in the chambers were verified at the beginning and end of the treatment periods by gas chromatography using a Buck Scientific gas chromatograph (model 910; Buck Scientific Inc, East Norwalk, CT) equipped with a flame ionization detector (155 °C) and an alumina column (125 °C, nitrogen flow rate: 1 ml/min). For alkaloid and fluorometric GUS activity analysis, samples were taken from the 2nd and the 5th leaves (from the apex).

Wounding Mature green leaves (3rd from the apex) were pierced multiple times with a scalpel (Feather Disposable Scalpel No.10, Feather Safety Razor Co. LTD, Japan) and unwounded plants were used as a control. Samples were taken 48 and 72 hours after treatment.

Drought Drought –treatment involved withholding water for six days; regularly watered plants were used as controls. At the time of sample collection, drought-treated plants showed visible wilting, whereas control plants appeared normal. ABA A solution containing 0.1 mM ABA [(± )-abscisic acid, Sigma-Aldrich, St Louis, MO] and 0.02% Tween-20 or 0.02% Tween-20 only was sprayed on the ABA-treated and control plants, respectively, until the solution ran off the foliage. Samples were taken 24 hours after treatment (Weaver, et al. 1998). Jasmonic acid Jasmonic acid was dissolved in small amount of ethanol and then diluted to 100 µM using distilled water. Plants were sprayed with jasmonic acid solution until the solution ran off the leaves. After spraying, the plants were transferred to an enclosed chamber, and samples were taken 48 hours later (Kimura, et al. 2001). Control plants were sprayed with water only.

Salicylic acid Leaf discs were floated on a solution containing 5 mM and 20 mM salicylic acid dissolved in 0.1 M phosphate buffer (pH 7.0). Samples were taken 24 hours after treatment (Yin, et al. 1997). Control leaves were floated on 0.1 M phosphate buffer.

Yeast extract Leaf discs were placed into Petri dishes lined with blotting papers that were soaked in 1% and 5% sterile yeast extract, and the leaf discs were incubated for 8 or 21 hours. Control leaves were placed on blotting paper soaked with water (Pasquali, et al. 1999).

Tobacco mosaic virus infection Because tobacco cultivar DH98-325-6 carries the tobacco mosaic virus (TMV) resistance gene (termed N gene), TMV infection does not produce systemic infections at temperatures below 28 °C, but rather, it induces the appearance of localized, necrotic spots, also known as hypersensitive response (Whitham, et al. 1994). The TMV resistance trait is temperature dependent, because the N gene-mediated hypersensitive response is suppressed by elevated temperatures (above 28 °C) and becomes reactivated once the plants are returned to permissive (below 28°C) conditions (Samuel 1931). Thus, the temperature-dependent function of the N gene product provides a facile means of infecting a large number of cells in TMV-resistant plants. Exposing TMV-infected plants to high temperatures and then returning them to a cooler environment causes a systemic viral infection and the widespread occurrence of necrotic lesions. To induce TMV infections in a large area of the inoculated leaf, we took advantage of the temperature sensitivity of the TMV-elicited hypersensitive response. TMV-infected leaf tissues of the TMV-susceptible TN86 tobacco cultivar were homogenized in 5 mM phosphate buffer, pH 7.0, and the transgenic DH98-325-6 plants were inoculated with the leaf extract using carborundum as an abrasive. Infected plants were incubated at 32°C for three days for systemic infection and then transferred to 22°C for nine hours to induce hypersensitive response. Control plants were rubbed with carborundum and kept under the same temperature regime as the TMV infected plants (Yang, et al. 1999).

3.2.5. Histochemical and fluorometric GUS activity assays and alkaloid analysis For the histochemical localization of GUS activity, tissues were incubated in GUS staining solution (100 mM phosphate buffer, pH 7.0; 2 mM X- Gluc (5-bromo-4-chloro-3-indolyl-beta-D- glucuronic acid, cyclohexylammonium salt); 10 mM EDTA and 0.1 % Triton-X) at 37 °C overnight, and destained with 95 % ethanol. To determine GUS activity using the MUG (4- methylumbelliferyl β-D-glucuronide) fluorescent assay (MUG assay), 150 mg plant tissue was homogenized in 650 µl GUS extraction buffer (50 mM NaHPO4, pH 7.0; 10 mM DTT; 10 mM EDTA; 0.1 % sarcosyl; 0.1 % Triton-X and 1 % PVPP) and centrifuged for 10 min at 16,000 rcf. The supernatant was transferred in a fresh Eppendorf tube, centrifuged for 5 min at 16,000 rcf and

47 the supernatant was passed through a 650 µl Sephadex column. Ten µl plant extract was mixed with 130 µl assay buffer (1 mM MUG in the GUS extaction buffer) and incubated for 15 min. To arrest the reaction, a 10 µl aliquot of the mixture was mixed with 190 µl stop buffer (0.2 M

Na2CO3). Conversion of 4-MUG to 4- MU (4-methyl umbelliferone) was measured using an excitation wavelength of 365 nm, an emission wavelength of 445 nm in a SpectraMax M2 microplate reader (Molecular Devices Corporation, Sunnyvale, CA). Protein concentration was determined by using the Bio-Rad protein assay according to the manufacturer’s instructions (Bio- Rad Laboratories, Hercules, CA). Alkaloid analysis of tobacco leaves was performed by gas chromatography as previously described (Gavilano, et al. 2006).

3.3. Results 3.3.1. Generation of transgenic CYP82E4:GUS tobacco lines To investigate the gene expression pattern conferred by the putative CYP82E4 promoter, tobacco was transformed with a fusion construct between the 2.2 kb 5΄ flanking region of the tobacco CYP82E4 and the GUS reporter gene. The construct was introduced into the full-sib tobacco cultivars DH98-325-6 (converter) and DH989-325-5 (nonconverter), and 17 and 13 independently transformed plants were regenerated, respectively. Histochemical assay of GUS activity revealed that upon senescence, eight, five and four plants in the DH98-325-6 background and seven, two and four plants in the DH98-325-5 background exhibited high, intermediate and low GUS activity, respectively (data not shown). To determine whether the CYP82E4 promoter confers the same expression pattern in independently transformed transgenic lines, a small-scale, preliminary experiment was conducted using the eight highly-expressing DH98-325-6 primary transformants. The plants were exposed to all the experimental treatments used in the study (see Material and Methods) and GUS activity was measured by histochemical staining. The results showed identical pattern of GUS expression in all eight transgenic lines demonstrating that the positional effect frequently associated with independent transgene integration events did not

influence the spatial and developmental regulation of the CYP82E4 promoter. As a result, the T1 progenies of the CYP82E4:GUS_59 lines were used, which exhibited high levels of GUS expression in the DH98-325-6 converter background, for all the experiments unless otherwise indicated.

3.3.2. Expression of the CYP82E4 promoter is differentially regulated in various organs Leaves To confirm that the transcriptional control of the CYP82E4:GUS reporter gene construct recapitulates the senescence-inducible regulation of the native CYP82E4 gene, GUS activity in tobacco leaves was measured at five developmental stages ranging from young leaves with dark green color to mature, artificially cured leaves that reached complete senescence (Figure 3.1). The chlorophyll content of the leaves was measured with a SPAD meter and the degree of yellowing was correlated with GUS activity. GUS activity, as measured by the MUG assay, was equally low in the green or slightly yellow leaves of the CYP82E4:GUS and negative control (promoterless GUS; data not shown) plants, but GUS activity rapidly increased once the leaves reached the later stages senescence (Figure 3.1). In addition to the experiments that evaluated the expression pattern conferred by the CYP82E4 promoter in naturally senescent leaves, GUS activity was also measured in detached leaves that were artificially cured in the dark. The results showed that the expression of the CYP82E4 promoter was strongly induced in both the naturally and artificially senesced leaves, but GUS activities reached higher levels in detached leaves cured in the dark (Figure 3.1). Senescence-inducible GUS activity was confirmed by histochemical staining of green and senescent leaf tissues. Similar to the MUG assays, the results showed little or no GUS activity in the tissues of the green leaf , while high levels of GUS expression were apparent once the leaves turned yellow (Figures 3.2B,C) indicating that the expression directed by the CYP82E4 promoter is tightly correlated with the progression of leaf senescence. A more detailed analysis of the tissue-specific localization of GUS activity revealed that the CYP82E4 promoter was expressed in the epidermis and both the palisade parenchyma (Figure 3.2E) and the spongy mesophyll (Figure 3.2F), and strong GUS activity was apparent in the trichomes (Figure 3.2D). Similar to the lamina, GUS activity was weak in the petiole of a green leaf (Figure 3.2G) and strongly upregulated in that of the senescing leaf (Figure 3.2H).

Figure 3.1. Senescence-induced activation of GUS activity in the leaves of 3-month-old DH98-325-6 tobacco line carrying the CYP82E4:GUS construct. An illustration of the leaf colors at the different stages of development is shown in Figure 2A. Stages 1-4 and 5 represent stages of natural and artificially-induced, complete senescence, respectively. Each data point represents four independent lines measured in two independent replications. Error bars denote standard error of the mean.

Stem GUS histochemical analysis revealed that CYP82E4 promoter regulated gene expression is directed to the pith and cortex regions of the stem (Figures 3.2I-K). In contrast to the leaf and flower where the CYP82E4 promoter was preferentially expressed in senescing tissues, CYP82E4 promoter-regulated GUS activity was observed throughout the pith and cortex of both young, green (Figure 3.2I) and mature, senescing stems (Figure 3.2J).

Figure 3.2. Illustrations of leaf and flower phenotypes at different stages of development and histochemical localization of GUS activity in various organs. Pictures show tissues of the CYP82E4:GUS_59 line, unless otherwise noted. (A) from left to right, leaf phenotypes at four stages of natural senescence and at artificially-induced, complete senescence. GUS activity in the (B) green leaf (C) senescing leaf (D) trichomes; (E, F) cross sections of senescing leaves; (G) cross section of petioles of a young, green and (H) a senescing leaf; (I) stem cross section of a young, a (J) mature CYP82E4:GUS_59 plant and (K) a young, promoterless GUS-transformed plant; (L) flowers at stage 1, (M) stage 10, (N) stage 13; (O) stamens and pistil. (P) illustration of the stages of flowering, from left to right, stages 1, 10, 12 and 13 are shown. Abbreviations: c, cortex; ca, cambium; cu, cuticle; e:epidermis; m, mesophyll; p, palisade parenchyma; pi, pith; v, vascular bundle; x, xylem.

Roots GUS activity was measured in fresh and stored root tissues collected from young (2 month- old) and mature (flowering) plants grown under the conditions already described (see “Generation of the transgenic plants” section). Regardless of the plant’s age from which the root was harvested or the length of root storage, GUS activity in the roots was very low (Figure 3.3).

Figure 3.3. Fluorometric analysis of GUS activity in the root of CYP82E4:GUS- transformed DH98-325-6 plants at different developmental stages. GUS activity was measured in the roots of 2 month-old, young (Y) and flowering, mature (M) plants after 0 (0 d), 10 (10 d) and 20 (20 d) days of post-harvest storage. Bars represent the GUS activity mean of two independent lines, four independent replications each. GUS activity in the cured leaves (CL) and stage 13 flowers (FL-13) of the same transgenic lines from which the roots were harvested are shown as comparisons. Error bars denote standard error of the mean.

Flowers Expression of the CYP82E4 promoter in the flowers was also induced by senescence. GUS activity measurements taken at four different stages of flower development (F1, F10, F12 and F13) showed CYP82E4 promoter activity was low at stages F-1 and F-10, intermediate at stage F- 12 and sharply increased to high levels at stage F-13 (Figure 3.4). Histochemical staining of the flowers also demonstrated that the expression of the CYP82E4 promoter was regulated by a senescence-dependent pathway in these tissues. Negligible and low levels of staining was observed at stages F-1 and F-10, respectively, however, GUS activity dramatically increased in the senescing tissues at stage F-13 (Figures 3.2L-N). In the flower, the highest levels of GUS activity were localized in the sepal, petal, stigma and the anther (Figure 3.2O). Collectively, these results indicate that the CYP82E4 promoter is preferentially activated in the aerial parts of the plant where it induces gene expression in the senescing tissues of the leaves and flowers and in the young and senescing tissues of the stem. Figure 3.4. Senescence-induced activation of GUS activity in the tobacco flowers. An illustration of the flowers at the different developmental stages is shown in Figure 2P. Plants transformed with the promoterless GUS construct were used as controls. The values show the mean of three independent replicates, error bars represent standard error of the mean.

3.3.3. Expression of the CYP82E4 promoter in converter and nonconverter tobacco The conversion of tobacco from the nonconverter to the converter phenotype is controlled by an unstable mutation targeting a yet unidentified conversion locus that mediates the transcriptional suppression and activation of the CYP82E4 gene in nonconverter and converter plants, respectively. To investigate whether the converter locus encodes CYP82E4 per se, as opposed to an upstream regulator of the gene, expression patterns of the CYP82E4:GUS construct in converter and nonconverter tobacco were compared. Functional expression of GUS in converter tobacco and the lack of GUS expression in nonconverter tissues would indicate that the converter locus is a distinct gene that regulates CYP82E4 in trans. Alternatively, detection of strong GUS expression in the senescing leaves of both converter and nonconverter plants would demonstrate that the transcriptional activators of CYP82E4 are functional regardless of the nornicotine phenotype of the genetic background and suggest that the unstable mutation targets the CYP82E4 locus. The results of our experiments were consistent with the second scenario. High levels of GUS activity were observed in the senescing leaves of converter and nonconverter plants alike (Figure 3.5), providing additional evidence that the CYP82E4 gene likely constitutes the conversion locus.

Figure 3.5. Fluorometric analysis of GUS activity in the green and artificially cured leaf of CYP82E4:GUS-transformed nonconverter and converter tobacco. DH98-325-5 and DH98- 325-6 are nonconverter and converter, respectively. Bars represent the mean GUS activity of five independent lines measured in two independent replications. Error bars denote standard error of the mean.

3.3.5. Expression of the CYP82E4 in leaves is senescence-specific Expression analysis of the CYP82E4 promoter GUS activity measurements demonstrated that the CYP82E4 promoter confers senescence- induced gene expression in the leaf. Because senescence is controlled by a complex regulatory

53 network that integrates stress responses and includes several signaling molecules and hormones, we sought to determine whether the hormones and stresses that accelerate the onset of senescence exert a direct effect on the expression of the CYP82E4. The plant hormones and signaling molecules employed in the study were ABA, ethylene, JA, salicylic acid, yeast extract and the stresses included drought, wounding and TMV infection. After 48 or 96 hours of treatment with ethylene, the 5th (older) leaf of tobacco showed more visible yellowing than the 2nd (younger) leaf of the treated plants and all the leaves of the control plants that were exposed to air (Figure 3.6C). In the yellowing 5th leaves of the ethylene-treated plants, CYP82E4 promoter-mediated GUS activity was upregulated compared to the air treated control, in contrast to the green 2nd leaf of the same plant where the rate of GUS activity was not significantly different from that of the controls (Figure 3.6A). Figure 3.6. GUS activity (A), nicotine conversion (B) and chlorophyll content (C) at different developmental stages of the leaves 48 and 96 hrs after ethylene treatment. Bars represent the mean values of six individuals of the CYP82E4:GUS_59 line measured in two independent experiments. Error bars denote standard error of the mean. Abbreviations: L2, 2nd leaf from the apex (younger leaf); L5, 5th leaf from the apex (older leaf).

Similar results were obtained from the experiments in which tobacco leaves were infected with TMV. Relative to the mock-treated control, the hypersensitive response elicited by TMV infection did not cause visible signs of senescence 15 hours after the heat treatment, but the TMV-treated leaves were more yellow than the control 96 hours after the heat shock (Figure 3.7C). Accordingly, GUS activity was not significantly different between the TMV-treated and control leaves 15 hr after heat shock, whereas the leaves measured 96 hours after heat shock showed greatly enhanced levels of both GUS activity and nicotine conversion (Figure 3.7A and B). These results indicate that ethylene and infection by TMV can enhance the expression of the CYP82E4 promoter, but the stimulation can only be detected once the leaves begin to senesce suggesting that the inducing effect of these factors on the expression of CYP82E4 is associated with their ability to accelerate senescence. Figure 3.7. GUS activity (A), nicotine conversion (B) and chlorophyll content (C) in the leaf 15 hrs and 96 hrs after the heat shock-induced systemic TMV infection. Bars represent the mean values of measurements taken from the treated, nonsenescing leaf (3rd leaf from the apex) of six CYP82E4:GUS_59 individuals in two independent experiments. Mock-treated leaves of the same position were used as controls. Error bars denote standard error of the mean. Abbreviation: TMV, tobacco mosaic virus.

Because resistance traits to several pathogens including Phytophthora parasitica var. Nicotiana, Pseudomonas syringae pv. tabaci, and Thielaviopsis basicola have been incorporated into the elite tobacco cultivars DH98-325-5 and DH98-325-6, evaluation of the effects of common tobacco pathogens on the expression of the CYP82E4 promoter was not feasible. To simulate pathogen attack, we treated the green leaves with yeast extract, a complex fungal preparation that induces the production of phytoalexins, compounds that serve as key components in the plant’s defense against phytopathogenic microorganisms (Szabo, et al. 1999). GUS activity in both the yeast extract-treated and untreated control leaves was very low, comparable to the levels obtained from leaves transformed with the promoterless GUS construct (Figure 3.8A). Similarly, the pattern of gene expression from the CYP82E4 promoter in green leaf tissue did not increase significantly in response to other treatments, such as wounding, drought, salicylic acid, ABA and JA (Figure 3.8A). Of all treatments tested, senescence was the only factor to which increased CYP82E4 promoter expression could be consistently correlated. These results therefore suggest that the expression of the CYP82E4 promoter in tobacco leaves is senescence-specific.

Alkaloid analysis Previous studies suggested that a strong positive correlation exists between the rates of CYP82E4 transcription and nicotine conversion in the senescing leaves of tobacco (Gavilano, et al. 2007, Siminszky, et al. 2005). To further investigate the effects of various signaling molecules and stresses in CYP82E4 expression, changes in nornicotine content of the leaves were measured in response to the same biological factors already described. The results showed that the patterns of the CYP82E4 promoter driven GUS expression and nicotine production were very similar. Relative to the air-treated controls, nicotine conversion in the 5th leaf, but not the 2nd leaf, was significantly induced following 48 or 96 hours of ethylene treatment (Figure 3.6B). Similar to GUS activity, nicotine conversion did not change significantly in the TMV-infected versus control leaves 15 hr after heat shock, but it was significantly upregulated compared to the control in the infected leaves 96 hours after the heat treatment (Figure 3.7B). Also in agreement with the results of the GUS activity assay, the remaining treatments did not significantly induce nornicotine production (Figure 3.8B), confirming the notion that senescence is a major trigger of nornicotine production in converter tobacco.

Figure 3.8. GUS activity (A) and nicotine conversion (B) in the leaf following various stresses and signaling molecule treatments. Bars represent the mean values of measurements taken from the treated, nonsenescing leaf (3rd leaf from the apex) of six CYP82E4:GUS_59 individuals in two independent experiments. Mock-treated leaves located at the same position were used as controls. Error bars denote standard error of the mean. Abbreviations: ABA, abscisic acid; C, control; D, drought; H, hour; Proml, promoterless; SA, salicylic acid; W, wounding; YE, yeast extract.

3.4. Discussion Nornicotine production in converter tobacco is primarily catalyzed by the senescence- inducible nicotine N-demethylase gene CYP82E4 (Gavilano, et al. 2006, Siminszky, et al. 2005, Xu, et al. 2007). To provide new insights into the regulation of CYP82E4, we created a fusion construct between the 2.2 kb upstream regulatory region of CYP82E4 and the GUS reporter gene and analyzed the temporal and spatial patterns of gene expression conferred by the promoter. The

57 results indicated that the CYP82E4 promoter is differentially regulated in various plant organs. Substantial levels of promoter activity were observed in the green, young stems; in contrast, significant GUS activity was only evident in the leaves and flowers during senescence (Figures 3.1, 3.2 and 3.4), and no GUS expression was detected in the roots regardless of the plant’s age or the length of storage in the dark prior to analysis (Figure 3.3). In the stem, expression from the CYP82E4 promoter was localized to the cortex and pith regions, but no GUS activity was observed in the xylem (Figures 3.2 I, J). The lack of CYP82E4 promoter activity in the root and the xylem is consistent with the observations that nicotine is produced in the root and transported through the xylem to the leaves without undergoing N-demethylation at the site of its production or en route to the leaves (Wernsman and Matzinger 1968). The expression pattern of the CYP82E4 promoter in the tissues of the young, green stem stands in contrast to that observed in other aerial organs of tobacco, such as the leaves and flowers, where CYP82E4 promoter activity was only detected in the senescing tissues. A possible explanation for this discrepancy could be provided based on our current understanding that the loss of the content of the conductive cells of the vessels and tracheids, a process that occurs during the formation of xylem tracheary elements, involves programmed cell death (reviewed in Fukuda 2000). According to this hypothesis, the expression of the CYP82E4 promoter in young stem may also be related to senescence, as the vessel and tracheid tissues undergo programmed cell death during tracheary element differentiation. This theory, however, is not supported by the relatively uniform expression pattern of the CYP82E4 promoter in the cortex and pith regions of the stem (Figure 3.2I) or the work of other investigators who found no indications for the existence of common mechanistic elements in programmed cell death that occurs during leaf senescence and the vacuole collapse-dependent programmed cell death that takes place during tracheary element differentiation (reviewed in Fukuda 2000, Ye and Droste 1996, Ye and Varner 1996). These two lines of evidence, therefore, strongly suggest that the expression of the CYP82E4 promoter in the stem tissues is not senescence-dependent. Interestingly, the expression patterns of CYP82E4 and the Brassica napus LSC54 gene that encodes a metallothionein (Buchanan-Wollaston 1994) are similar in that the expression of both genes is induced by senescence in the leaves, and they are also expressed in the nonsenescent stem and inflorescence meristem, respectively. To enhance our understanding about the regulatory network that controls nicotine conversion, effects of senescence, plant hormones and biotic and abiotic stresses on the rate of nornicotine production and the expression of the CYP82E4 promoter in tobacco leaves were tested. Of all the treatments tested, leaf senescence elicited the largest increase in CYP82E4

58 promoter expression (Figure 3.1). Because previous studies have suggested that artificial senescence upregulates more genes than natural senescence (Becker and Apel 1993, Weaver, et al. 1998), the effects of artificial air-curing and natural senescence on nornicotine production and CYP82E4 promoter driven GUS expression were examined. Although sharp upregulation of CYP82E4 expression and nicotine conversion were observed in response to both treatments, the stimulating effect of artificial senescence was greater (Figure 3.1). These results are consistent with the findings of Weaver et al. (1998) who reported that dark detachment-induced senescence was the most effective treatment of the factors tested to induce the transcript accumulation of ten out of eleven senescence-associated genes. Expression of the reporter gene was strong in the senescing leaves of both the converter and nonconverter tobacco backgrounds confirming our previously proposed model (Gavilano, et al. 2007) that the unstable mutation that controls tobacco conversion from the nonconverter to the converter phenotype directly alters the CYP82E4 locus rather than an upstream regulator of the gene (Figure 3.5). Because sequence analysis of CYP82E4 in several different converter and nonconverter backgrounds revealed no polymorphisms (including the promoter region described here), an epigenetic mechanism of gene activation is likely. Besides natural senescence, only exposure to ethylene and the hypersensitive response to TMV infection induced nornicotine production and the expression of GUS from the CYP82E4 promoter in the leaves (Figures 3.6 and 3.7). However, both of these treatments accelerated leaf senescence, and increases in nicotine conversion and GUS expression were only detected in the visibly yellowing leaves of the ethylene-treated plants or in the yellowing TMV-treated lamina. Induction of nornicotine production or GUS activity was not apparent in the ethylene- or TMV- treated green leaves (Figures 3.6 and 3.7). The observations that ethylene and the TMV infection-elicited hypersensitive response promote leaf senescence are in agreement with a large body of evidence that demonstrate the important roles of these factors in the induction of senescence-associated programmed cell death (reviewed in Buchanan-Wollaston 1997, Lim, et al. 2007). The findings that CYP82E4 expression was only stimulated in the older, yellowing leaves indicate that effects of ethylene and TMV infection on CYP82E4 expression are either indirectly exerted through downstream components of the ethylene- and TMV-induced senescence signaling pathway, or that the effects of these agents are direct but require the action of additional factors uniquely present in older leaves (Butt, et al. 1998). The existence of such age-specific factors that control ethylene-induced senescence is supported by previously reported data demonstrating that the senescence-promoting effect of ethylene is much greater on the older than the younger leaves of the plant (Grbic and Bleecker 1995).

Nicotine conversion and CYP82E4 promoter-driven GUS expression analyses revealed that a variety of chemical and stress treatments generated similar response profiles of both variables (Figures 3.6-3.8). These results suggest that the 2.2 kb CYP82E4 promoter region used in the reporter construct contains all the cis-acting regulatory elements necessary for the authentic recapitulation of the regulatory attributes of the native CYP82E4 gene. The results also showed that the very low levels of CYP82E4 expression in the green leaves was not affected by the remaining treatments used in the study, such as wounding, drought, salicylic acid, ABA, yeast extract and JA (Figure 3.8) confirming the notion that regulation of CYP82E4 is senescence- specific in these tissues. In contrast to the induction pattern of nornicotine production, the synthesis of nicotine has been shown to be triggered by wounding and JA treatments in several Nicotiana species (Baldwin and Ohnmeiss 1993, Baldwin, et al. 1994, Halitschke and Baldwin 2003) suggesting that nicotine and nornicotine production are controlled by at least partially non- overlapping signal transduction pathways in Nicotiana. The observation that several cis-acting ABA and drought response motifs (e.g. drought response elements, MYB and MYC recognition sequences) are located in the CYP82E4 promoter (data not shown), yet induction of CYP82E4 by ABA and drought was not evident in current experiments reaffirm the widely reported finding that only a small portion of transcription factor binding sites influence transcription (reviewed in Latchman 1998, Weinzierl 1999). Alternatively, some of these motifs are likely to lie in regions of the 2.2 kb fragment that are not part of the functional promoter. For the same reasons, other binding sites present in the CYP82E4 promoter that have been shown to play important roles in regulating gene expression during senescence (e.g. W-boxes; Eulgem, et al. 2000, Miao, et al. 2004) potentially, but not necessarily, represent key regulatory elements for the senescence- inducible expression of CYP82E4. Further work will be required to define the specific bounds of the CYP82E4 promoter and the relevance of the specific motifs located therein. Based on the classification system proposed by Gan and Amasino (1997), SAGs that are exclusively expressed during senescence, and those whose expression is low in the nonsenescent tissues and increases in response to senescence are termed Class I and Class II SAGs, respectively. According to its regulatory properties in the leaves, CYP82E4 belongs with the group of Class I SAGs. The relatively few reports published on the isolation of Class I SAGs suggest that the number of genes that display the regulatory attributes of Class I SAGs is low in the plant genome. Examples of Class I SAGs include the cysteine proteinase SAG12 isolated from Arabidopsis (Lohman, et al. 1994, Weaver, et al. 1998), and NtCP1 a putative cysteine proteinase derived from tobacco (Beyene, et al. 2006). Strong, leaf senescence-specific promoters can be employed as powerful tools in genetic engineering senescence-related

60 processes. For example, Gan and Amasino (1995) showed that delaying the onset of programmed cell death by overexpressing a rate-limiting cytokinin biosynthetic gene under the transcriptional control of the SAG12 promoter extended the photosynthetically active lifespan of the leaf. Other potentially valuable applications of senescence-specific promoters include the plant-based production of high-value natural products and pharmaceuticals that exhibit phytotoxic properties. Restricting the production of these compounds to the senescing leaves can prevent injury to the tissues during the plants’ growth period. While current experimental data strongly suggest that the expression of CYP82E4 is senescence-specific, the function of the CYP82E4 protein in senescence or in the physiological processes linked to senescence remains unclear. The functions of the SAG-encoded proteins are commonly associated with biochemical processes related to cellular degradation, nutrient translocation, protection from senescence-induced cell damage and pathogen response (reviewed in Buchanan-Wollaston 1997). Although formally not tested, visible differences are not apparent in the morphology, growth and development of converter versus nonconverter tobacco suggesting that nornicotine production has no major direct role in senescence or any other developmental processes. Given the differential insecticidal properties of nicotine and nornicotine (Riah, et al. 1997, Siegler and Bowen 1946, Yamamoto, et al. 1968), one possibility is that senescence-specific conversion of nicotine to nornicotine facilitates the defense of the structurally weakened, senescing leaf tissue against herbivore attack. Ultimately, more research is needed on the differential toxicity of nicotine alkaloids in various insects to elucidate the individual roles of nicotine and nornicotine in plant defense and senescence.

3.5. Summary • The unstable mutation may correspond to CYP82E4 itself and not to any upstream regulator. • CYP82E4 is expressed at high levels in both detached and in planta senesced leaves. • CYP82E4 expression is high in senesced flowers, but does not express in roots. • CYP82E4 expression was not induced by any other treatments tested. • CYP82E4 was induced by ethylene and TMV infection, but CYP82E4 inductions were coincided with the onset of senescence. • CYP82E4 is an example of a ‘Class І’ SAG.

Chapter 4. Functional characterization of EIN2 mediated ethylene signaling in tobacco

4.1. Introduction Ethylene regulates an array of plant developmental processes, ranging from seed germination, seedling emergence, leaf and root development to flower senescence, abscission and fruit maturation. It also plays a pivotal role in plant responses to abiotic stresses, including cold, salt, flooding and biotic stresses like pathogen or insect attack (Kieber et al, 1997; Adie et al, 2007). It is intriguing how this chemically simple molecule can modulate such widespread responses. The ethylene signaling network is a multitier system that has been well characterized in Arabidopsis. At the first level of the signaling cascade there are five membrane bound, bacterial two component histidine kinase-like receptors: ETR1 (Ethylene Response 1), ETR2, ERS1 (Ethylene Response Sensor 1), ERS2 and EIN4 (Ethylene Insensitive 4) (Chang et al, 1993; Sakai et al, 1998; Hua et al, 1995, 1998a). These membrane bound receptors act as negative regulators of ethylene response (Hua and Meyerowitz, 1998) through a Raf-like MAP kinase kinase kinase (MKKK), called CTR1 (Kieber et al, 1993). In the absence of ethylene these receptors constitutively activate CTR1, which triggers MAP kinase cascades and negatively regulates downstream EIN2, ultimately resulting in the phosphorylation of EIN3 and EIL at Thr 592 and Thr 546 residues, respectively. These modifications increase EIN3/EIL interaction with two F-box proteins EBF1 and EBF2, leading to proteolytic degradation of EIN3 and EIL by 26S proteosome and thus shut down ethylene signaling. When ethylene is bound to the receptors, CTR1 is not activated, a different MAP kinase cascade involving MKK9 and MAPK3/MAPK6 is triggered, resulting in the phosphorylation of EIN3 and EIL at T174 and T176, respectively, which results in a decreased interaction between EIN3 and F-box proteins EBF1/EBF2, thus stabilizing EIN3 (Guo et al, 2003; Potuschak et al, 2003; Gagne et al, 2004; Yoo et al, 2008). EIN2 plays a vital role in the accumulation of transcription factors EIN3 and EILs (EIN3-like), but it is not known how EIN2 regulates EIN3 at the molecular level (Alonso et al, 1999; Chao et al, 1997). EIN3 and EILs bind at the promoter region of Ethylene Response Factor 1 (ERF1) and other primary targets; ERF transcription factors in turn can bind at the GCC cis elements present in the promoter regions of ethylene responsive genes (Solano et al, 1998). Both Arabidopsis etr1-1 and ein2 mutants show delayed leaf senescence (Bleecker et al, 1988; Guzman et al, 1990; Grbic et al, 1995). Constitutive heterologous expression of the Arabidopsis dominant mutant etr1-1 with the 35S promoter displayed delayed petal senescence, abscission, fruit ripening and reduced adventitious root formation in tomato and petunia (Wilkinson et al, 1997; Clark et al, 1999). Other documented phenotypes included increased sensitivity to pathogens in Tetr tobacco (Tobacco transgenic lines harboring Arabidopsis

63 dominant mutant etr1-1 driven by the 35S promoter) (Knoester et al, 1998) and delayed leaf senescence in Nicotiana sylvestris (Yang et al, 2008). Knock out mutants of EIN2 displayed complete ethylene insensitivity, indicating that EIN2 plays a central role in ethylene signaling (Roman et al, 1995; Chen et al, 1995). EIN2 is similar to NRAMP metal ion transporters; although no metal ion transporting activity of EIN2 has been demonstrated. The N-terminal part of EIN2 is predicted to form membrane spanning domains, while the C-terminal region does not show any homology with other known proteins. Expression of C-terminal part of EIN2 showed constitutive ethylene response in an ein2 mutant background, suggesting a critical role in ethylene signaling (Alonso et al, 1999). Silencing EIN2 in petunia showed delayed petal senescence (Shibuya et al, 2004), but the mechanism by which this occurs remains largely unknown. In Arabidopsis, screening for the mutants resistant to auxin polar transport inhibitor (Fujita et al, 1996), cytokinin (Su et al, 1992) or for delayed senescence (Oh et al, 1997), led to isolation of alleles of ein2, whereas no other mutant relating to the ethylene signaling was recovered from these screens (Alonso et al, 1999). Furthermore, EIN2 regulates salt and osmotic stress by interacting with the abscisic acid response pathway (Wang et al, 2007). These findings indicate a possible role of EIN2 in cross-talk with other signaling pathways to regulate processes including senescence. Given the functional importance of EIN2, we have isolated a tobacco (Nicotiana tabacum) ortholog of EIN2 and silenced it using an RNA interference (RNAi) based approach. The effect of reduction of EIN2 was assessed in diverse array of processes, with special emphasis on dissecting its role in regulating petal senescence and its possible cross-talk with other phytohormonal response to modulate petal senescence.

4.2. Materials and methods 4.2.1. Isolation of tobacco EIN2 Available EIN2 protein sequences for Arabidopsis, Petunia and tomato were retrieved from NCBI. Two sets of degenerate primers were designed using the CODEHOP program utilizing amino acid sequence conservation among these sequences (Rose et al, 1998). Tobacco floral meristem cDNA library was used as template in all the PCR reactions to amplify a fragment of tobacco EIN2. PCR conditions were as follows: initial denaturation at 94°C for 5 min; followed by 10 cycles of denaturation at 94°C for 30 sec - annealing at 42°C for 30 sec - extension at 72°C for 1 min; followed by 30 cycles of denaturation at 94°C for 30 sec - annealing at 60°C for 30 sec - extension at 72°C for 1 min; followed by 72°C for 7 min. For the primary PCR reaction, two degenerate primers EIN/For-1 and EIN/Rev-1 were used as forward and

64 reverse primers, respectively. For the nested PCR reaction, EIN/For2 and EIN/Rev-2 were used as forward and reverse primers, respectively. Amplified PCR product was gel purified and ligated into pGEM-T Easy cloning vector, independent colonies were sequenced and a 269 bp fragment of tobacco EIN2 (NtabEIN2) was obtained. This 269 bp fragment was blasted against tobacco genomic sequence data at NCBI and a 2908 kb contig was assembled and EIN2_F2 and EIN2_R2 primers were used to amplify 2747 bp fragment from the 2908 bp assembled contig. Additional 5´ region of the 2747 bp fragment was amplified using degenerate primer EIN2-5´_deg3 and gene specific primer EIN2-5´_rev1, which resulted in additional 1442 bp fragment at the 5´ end of the 2747 bp fragment. Remaining 5´ end of the NtabEIN2 was amplified using Genome walker Kit (BD Biosciences, CA, USA) with two primers EIN2-GW-1 and EIN2-GW-2 (PCR was performed according to the manufacturer’s specified condition). Full length EIN2s were amplified from the cDNA and genomic DNA of N. tabacum and N. sylvestris using EIN2Full F5 and EIN2Full-R2/ EINFull-R3.

4.2.2. Data mining and Phylogenetic analysis Sequence alignments were done using the ClustalW tool available at the EMBL database. Transmembrane domains were predicted using HMMTOP (Tusnady et al, 1998). For the phylogenetic analysis, EIN2 protein sequences for Arabidopsis (NM_120406), poplar (XM_002326149), Medicago (EU709495), tomato (AY566238), Petunia (AY353249), rice (AY396568), maize (AY359584) and an EIN2-like sequence from Chlamydomonas reinhardtii (XM_001700741) were obtained from NCBI. These sequences along with the EIN2 sequences from tobacco and N. sylvestris (isolated as a part of this project) were aligned using ClustalX (2.0.12 version) with gap opening and gap extend value of 10 & 0.1 for pair wise alignment and 10 & 0.2 for multiple alignment. Distance matrix was calculated using neighbor-joining method with 1000 bootstrap trials and output was saved as phylip format tree (.phb) file and this tree file is loaded into NJPLOT (Perriere et al, 1996) to view the generated Phylogenetic tree.

4.2.3. Generating EIN2RNAi transgenic lines The sense arm of EIN2RNAi construct was amplified by PCR using forward primer, EIN2:RNAi/P1 and reverse primer, EIN2:RNAi/P2, which add HindIII site at the 5´ end and XhoI site at the 3´ end, respectively. The antisense arm of EIN2RNAi construct was amplified with forward primer, EIN2:RNAi/P3 and reverse primer, EIN2:RNAi/P4, which add SacI site at the 5´ end and XbaI site at the 3´ end, respectively. Both sense and antisense arms were cloned into pGEM T Easy vector and transformed into E.coli cells for multiplication, plasmid DNA was

65 isolated and sense and antisense arms were cloned into pKYLX80I vector, where sense and antisense arms were separated by a 151 bp soybean ω-3 fatty acid desaturase intron. RNAi cassette from the pKYLX80I was digested with HindIII and XbaI and cloned into expression vector pKYLX71 (Schardl et al, 1987), where EIN2RNAi construct was driven by 35S2 promoter (35S promoter with duplicated enhancer region). The 35S:EIN2RNAi construct was introduced into the tobacco cultivar SR1 (Petite Havana) to generate transgenic lines with reduced EIN2 level (These lines will be designated as EIN2RNAi in the text) using standard Agrobacterium mediated transformation (Horsch et al, 1985). Transformed explants were placed on MS medium supplemented with 100 mg/L of kanamycin and phytohormones (BAP and NAA) and were kept in a growth room at 25°C with a 16/8 h light/dark cycle. Small shoots were transferred to hormone depleted rooting medium. Regenerated plants were subsequently transferred to soil and were initially kept in a growth chamber with 16/8 h light/dark cycle at 25°C for 15 days and after that they were moved to a greenhouse with a 14/10 h light/dark cycle. All plants were fertilized twice a week with Professional All Purpose Plant Food (20-20-20) fertilizer (Spectrum Brands Inc, Madison, WI). A total of 33 independent transgenic lines were generated. Seeds of T0 plants were germinated in MS medium supplemented with 100 mg/l of kanamycin and resistant plants were transferred to soil and grown as above.

4.2.4. Collection of phenotypic data To study the petal senescence, flowers at the day before anthesis were emasculated (to avoid any possible self pollination) and were then pollinated. Four independent EIN2RNAi lines (EIN2RNAi-73, 41, 54 and 22-1), wild type (SR1) were used for the pollination induced petal senescence study. Six plants per line and 10 flowers per plant were pollinated for this study. Pod maturation, pod weight and seed weight were also measured on these hand pollinated flowers. Reciprocal crosses were made between wild type tobacco and two independent EIN2RNAi lines (EIN2RNAi-73 and 41). Two plants per line and five flowers per plant were used for this experiment. Crosses were performed a day before anthesis and number of days until petal senescence was recorded. For petal senescence in emasculated flowers two independent EIN2RNAi lines (EIN2RNAi-73 and 41) and wild type tobacco were used. Flowers were emasculated and number of days for petal senescence was recorded. Data were taken from four plants per line and five flowers per plant. Induction of adventitious roots was checked by keeping two month old wild type and EIN2RNAi plants in water logged condition for five days.

4.3.5. Measuring electrical conductivity and DNA laddering Petal tissues were collected from flowers a day before anthesis (0 DAP) and three days after pollination (3 DAP) from wild type and EIN2RNAi plants. Petals from four flowers were placed in 40 ml MilliQ water and were incubated at 25°C with gentle shaking for 2h. Electrical conductivity (EC) was measured (EC-A) using Conductivity meter (Selectro Mark Analyzer, Model 4505, Markson Science Inc., CA, USA). Samples were then heated at 95°C for 1 h and then cooled to 25°C and EC value were recorded again (EC-B). Ion leakage was represented as (EC-A/EC-B %). For DNA fragmentation analysis genomic DNA was isolated from flower petals of wild type and EIN2RNAi lines at 0 DAP and 3 DAP and 2 µg of genomic DNA was separated in 2 % (w/v) agarose gel and stained with ethidium bromide. For both ion leakage and DNA laddering experiments, wild type and EIN2RNAi-73 line were used and experiments were repeated twice.

4.2.6..Identification of the pathogen responsible for early plant death Tissue samples from the wilted plants were collected and were submitted to the Disease Diagnostic Laboratory at University of Kentucky for developing pure culture of the pathogen. Genomic DNA was isolated from the mycelia and was used as template for the PCR. ITS1 and ITS4 primers were used to amplify the ITS region and the amplified PCR products were directly sequenced and the resultant sequence was blasted at NCBI to identify the Pythium species responsible for premature death.

4.2.7. Insect bioassay Eggs of tobacco hornworm (Manduca sexta) were hatched by incubating at 26°C and then kept on an artificial diet for three days (Carolina Biological supply Company, NC, USA). Four larvae were placed on each wild type and EIN2RNAi tobacco leaf (fifth leaf from the top). Leaf and larval weights were recorded at the beginning of the experiment and four days after feeding. Leaf weight reduction without any insect feeding was recorded to calculate leaf weight loss only due to desiccation. Four plants of each EIN2RNAi line (EIN2RNAi-73, 41, 54, 22-1) and eight plants of SR1 wild type and empty vector control were used for the insect bioassay and experiments were repeated twice. Percentage of leaf consumption and percentage of larval weight gain variables were combined into a single variable (um), which is the minimum variance estimator of the average of the other two variables. A one way ANOVA was done (Using SAS version 9.2) to check any significant difference between EIN2RNAi and controls against insect herbivory.

4.2.8. Quantitative real time PCR Total RNA was isolated using Trizol reagent (Invitrogen, CA, USA) and RNA was treated with Turbo DNA Free (Ambion, TX, USA) to remove any genomic DNA contamination. Total RNA (1µg) was used to make cDNA using random primers with Multiscribe Reverse Transciptase (Applied Biosystems, CA, USA). For tobacco tasiRNA3 D7 (Ntabtas3D7) reverse transcription was done using stem loop primer Tobacco-tas3-D7-RT. Quantitative real time PCR was performed in an Applied Biosystems Step One Real Time PCR System using SYBR Green chemistry. PCR reactions were performed in a 12 µl reaction with 20 ng cDNA, final primer concentration of 800 nM each and 6 µl SYBR Green Supermix (Biorad, CA, USA). Primers used for real time were: EIN2-RT_FOR & EIN2-RT_REV (for NtabEIN2), NtabARF2-FP & NtabARF2-RP (for tobacco ARF2: NCBI accession number DQ340258, designated as NtabARF2 in the text), NtabPer-FP & NtabPer-RP (for tobacco Peroxidase: NCBI accession number AB027752: designated as NtabPer in the text) and GAPDPH-FP & GAPDPH-RP for the internal control gene Glyceraldehyde-3-phosphate-dehydrogenase. Primers used for Ntabtas3D7 (Tobacco tas3 D7: NCBI accession number FJ804751) were Tobacco-tas3-D7-RT & RT- common-RP (all primer sequences were provided in Supplemental Table S2). Experiments were repeated at least twice using independent tissue samples.

4.3. Results 4.3.1. Isolation of tobacco EIN2 NtabEIN2s (Tobacco EIN2) were cloned from tobacco genomic DNA and cDNA. NtabEIN2 cDNA consists of 3972 nucleotides and is predicted to produce a protein with 1323 amino acids with a molecular mass of 143 kD. NtabEIN2 showed significant homology with EIN2 isolated from other species both at the nucleotide level [Arabidopsis (59%), rice (53%), petunia (90%), and tomato (89%)] and at the amino acid level [Arabidopsis (49%, 66%), rice (40%, 56%) petunia (88%, 92%) and tomato (87%, 91%); numbers within the parenthesis represent amino acid sequence identity and similarity, respectively.] (Supplemental Figure S3: Predicted EIN2 protein sequence comparison). Comparison between genomic and cDNA sequence of NtabEIN2 revealed the genomic organization of NtabEIN2, consisting of seven exons and six introns. Comparison between tomato EIN2, Arabidopsis EIN2 and NtabEIN2 showed that the number of exons and introns, their relative positions and exon sizes are conserved between these species (Figure 4.1A). We were also able to amplify EIN2 from Nicotiana sylvestris (one of the diploid ancestors of amphidiploid N. tabacum, designated as NsylEIN2), which showed single amino acid substitution at two positions (A to V at 77th and G to A at 491th position of NtabEIN2)

68 and one amino acid deletion (S at 1001 position of NtabEIN2). NtabEIN2 is predicted to have 12 transmembrane domains, which is similar to the number of predicted trans-membrane domains of petunia, tomato, rice and Arabidopsis and in all cases trans-membrane domains are clustered within the 1st 466 amino acids at the N-terminal regions (Figure 4.1B), suggesting that the topology of EIN2 proteins are highly conserved across the species and thus indicating its functional importance in ethylene signaling. Phylogenetic analysis of known EIN2 proteins (Figure 4.1C) put NtabEIN2 and NsylEIN2 close to other solanaceous species tomato and petunia EIN2. Monocot EIN2s (rice and maize) were found to be in a different clade than the EIN2s from dicot species and an EIN2-like sequence from Chlamydomonas was found to be distantly related to both monocot and dicots. Figure 4.1. Characteristics of NtabEIN2 and its comparison with other EIN2s. (A) Comparison of genomic organization of tobacco, tomato and Arabidopsis EIN2. Exons and introns are depicted as solid rectangles and lines, respectively. (B) Comparison of organization of transmembrane domains of predicted EIN2 proteins of tobacco, tomato, petunia, rice and Arabidopsis. Solid bars denote transmembrane domains. (C) Phylogenetic analysis of EIN2. NCBI accessions for protein sequences included in the phylogenetic analysis are Chlamydomonas reinhardtii (XM_001700741), Arabidopsis (NM_120406), Medicago (EU709495), Poplar (XM_002326149), Tomato (AY566238), Petunia (AY353249), N. sylvestris (this study), Tobacco (this study), Maize (AY359584) and Rice (AY396568).

4.3.2. Generation of EIN2 silenced tobacco lines and expression of NtabEIN2 in wild type and EIN2 silenced lines In order to characterize the function of EIN2 mediated ethylene signaling in tobacco, tobacco transgenic lines with reduced EIN2 levels were generated using RNA interference (RNAi). RNAi construct assembly is shown in Figure 4.2A. At T0, 33 independent transgenic lines were generated, out of which eight plants died prematurely. Eighty percent of the remaining plants showed on an average a four-fold delay in petal senescence as compared to the wild type (Figure 4.2B). For further studies in the T1 generation, four independent transgenic lines showing single copy transgene integration (EIN2RNAi -73, 41, 54 and 22-1) were selected. Figure 4.2. Map of the EIN2RNAi construct and Petal senescence data from T0 generation. (A) Sense and anti sense arms of inverted repeat are separated by Soybean ω-3 Fatty Acid Desaturase (FAD) intron and the construct is driven by Cauliflower mosaic virus 35S promoter with duplicated enhancer (CaMV35S2). (B) Petal senescence in T0 generation. Data generated from 20 independent EIN2RNAi lines and 10 wild type tobacco plants. Data represented as (Mean ± SE). Unpaired t-test was performed. Asterisk (*) denotes significant difference from wild type at P < 0.0001. DAP, Days after pollination.

B 14 * 12 10 8 6

2 Petal senescence (DAP) 0 Wt EIN2RNAi In order to investigate the transcript level expression of EIN2 in green and senescing tissues quantitative real time PCR was performed. A two fold increase of NtabEIN2 transcript was observed in senesced tobacco leaves as compare to the green leaves. Expressions of EIN2 in the petals of immature flowers (Stage-7) and open flowers (Stage-12) were found to be less than the green leaves (nomenclature of tobacco flower stages were according to Koltunow et al, 1990). Interestingly, EIN2 transcript level was also found to be increased in senescing petal (Stage-13) as compare to non senescing petals (Figure 4.3A). EIN2 transcript levels were also checked in the EIN2RNAi lines. Transcript accumulation of EIN2 was found to be significantly reduced in all four EIN2RNAi lines selected for further experiments (Figure 4.3B). Figure 4.3. Expression analysis of EIN2 by quantitative real time PCR. (A) Endogenous EIN2 transcript level in leaf and petal tissues. Wt-GL, Wild type green leaf; Wt-SL, Wild type senescing leaf; Wt-FL-S7, Wild type immature flower; Wt-FL-S12, Fully open flower; Wt-FL- S13, Senescing flower (Flower stages are designated according to Koltunow et al, 1990). (B) EIN2 transcript level in wild type and EIN2RNAi tobacco. Four independent EIN2RNAi lines, 54, 73, 41 and 22-1 were used. Experiments were repeated twice and data represented as (mean± SE). RQ, Relative quantitation. A 3.5 3 2.5 2 RQ 1.5 1 0.5 0 Wt-GL Wt-SL Wt-FL-S7 Wt-FL-S12 Wt-FL-S13

B 10

54 73 41 22-1

0.1

RQ 0.01

0.001

0.0001

4.3.3. NtabEIN2 regulates adventitious root formation, petal senescence, anther dehiscence and abscission To check if NtabEIN2 regulates adventitious root formation, wild type and EIN2RNAi plants were kept in flooded condition, as it is known that flooding induces adventitious root formation (Visser et al, 1996)). After six days of flooding treatment, wild type plants produced adventitious roots, but EIN2RNAi plants did not generate adventitious roots (Figure 4.4K and 4.4L). Pollination induced petal senescence was examined in four independent EIN2RNAi lines. Wild type tobacco flowers typically senesce by three days after pollination (3 DAP). A significant delay in petal senescence was observed in EIN2RNAi lines (Figure 4.4A and 4.5A). A five to seven fold delay in petal senescence was observed in EIN2RNAi lines and in extreme cases we saw more than twenty days delay in petal senescence, where petals remain fully turgid even when the developing ovary ruptures the petal tube (Figure 4.4C). Anther dehiscence was also delayed in EIN2RNAi lines. Wild type tobacco flowers usually dehisce anthers just after opening of the flowers, but the EIN2RNAi flowers do not dehisce even in the fully open flowers (Figure 4.4B). In order to determine any contribution of pollen related issues (e.g. defects in pollen germination, pollen tube growth, etc.) in delaying petal senescence, reciprocal crosses were made between EIN2RNAi lines and wild type tobacco. A delay in petal senescence was observed when wild type pollen was used to pollinate EIN2RNAi flowers. However, wild type flowers senesced at 3 DAP even when pollinated with EIN2RNAi pollen (Figure 4.5B). There was also a delay in petal senescence in EIN2RNAi flowers as compared to the wild type flowers, even when flowers were emasculated (Figure 4.4D, 4.4E and 4.5C).

The pattern of corolla senescence differed between wild type and EIN2RNAi flowers. Tobacco flowers at the onset of senescence first start wilting, followed by drying of petal tissues (van Doorn et al, 2001). In comparison EIN2RNAi flowers did not wilt even when the distal part of the petal started drying (Figure 4.4A). After wilting and drying tobacco floral organs abscise from the developing pods, but in almost every case EIN2RNAi floral organs never abscise, even when the pod is fully developed (Figure 4.4F). Thus, silencing NtabEIN2 completely abolishes the abscission of floral organs. Interestingly, EIN2RNAi inflorescence was found to contain more flowers as compared to the wild type (Figure 4.4G).

Figure 4.4. Diverse effects of silencing NtabEIN2. (A) Delayed petal senescence and pattern of petal senescence: Wild type flowers at 0, 3 and 5 DAP (Left three) and EIN2RNAi flowers at 0, 3 and 22 DAP (Right three). 0 DAP represent flowers a day before anthesis. (B) Delayed anther dehiscence: Wild type flowers (upper row) and EIN2RNAi flowers (bottom row). (C) EIN2RNAi flower at 19 DAP: developing ovary ruptures the petal tube. (D) Emasculated EIN2RNAi flowers at 5 DAP. (E) Emasculated wild type flowers at 3 DAP. (F) Pod maturation: Wild type pod at 21 DAP (Left) and EIN2RNAi pods at 26 DAP (Right). Also note that the floral organs are not abscised in the EIN2RNAi flowers. (G) Inflorescence size: Wild type (1st and 4th from the left) and EIN2RNAi (2nd and 3rd from the left). (H) Pod size: Wild type (bottom row) and EIN2RNAi (upper row). (I) Pythium infected EIN2RNAi plants. (J) Insect bioassay against tobacco hornworm (Manduca sexta): Wild type leaves (bottom row) and EIN2RNAi leaves (upper row). (K) Adventitious root formation in wild type after 6 days of flooding. (L) No adventitious root formation in EIN2RNAi plant after 6 days of flooding. DAP, days after pollination.

Figure 4.5. Silencing NtabEIN2 delays petal senescence. (A) Pollination induced petal senescence: EIN2RNAi (1st four) and control (Last two). Data generated from 4 independent transgenic lines and wild type tobacco (Wt), with 6 plants per line and 10 flowers per plant. (B) Petal senescence during reciprocal crossing: In each cross left and right individuals are female and male, respectively. Experiment includes two independent transgenic lines and wild type tobacco, two plants per line and five flowers per plant. (C) Petal senescence in emasculated flowers: Experiment includes two independent transgenic lines and wild type tobacco, 4 plants per line and 5 flowers per plant. All data are represented as (Mean ± SE). One way ANOVA was done and in the case of a significant ANOVA test Tukey’s multiple comparison test was performed using WINKS SDA software (Texasoft, Cedar Hill, TX). Asterisks (*) denote significant difference at α = 0.05 significance level as compared to wild type for (A) and (C) and Wt X 35S:41 for (B). A 25 * * 20 * * 15

5 Petal Senescence (DAP) 0 35S:54 35S:73 35S:22-1 35S:41 Wt 74

30 B * * 20

Senescence (DAP)

0 35S: 73 X Wt 35S: 41 X Wt Wt X 35S:73 Wt X 35S:41

C 30

20 * *

Senescence (DAP) 0 35S:73 35S:41 SR1 (wt)

4.3.4. Reduction in ion leakage, DNA laddering and expression of peroxidase in EIN2RNAi background Electrical conductivity (EC) of the wild type and EIN2RNAi petal tissues after pollination was measured to have a picture of membrane damage and subsequent solute leakage. An increase in EC was observed by 3 DAP in wild type flowers, but EIN2RNAi flowers did not show significant increase within that period (Figure 4.6A). DNA degradation correlates with senescence in other floral tissues (Shibuya et al, 2009). We observed increased DNA fragmentation, as evidenced by increased DNA laddering in the wild type flowers by 3 DAP, but not in the EIN2RNAi flowers, suggesting that nucleic acid degradation takes place in wild type flowers by 3 DAP, but not in EIN2RNAi flowers (Figure 4.6B). To check any possible role of reactive oxygen species (ROS) scavenging enzymes in delayed petal senescence in EIN2RNAi plants, we checked the transcriptional expression of a tobacco class III peroxidase (Figure 4.6C). In wild type tobacco, transcript level of peroxidase increased significantly by 3 DAP, but in EIN2RNAi lines peroxidase transcript level did not change by 3 DAP.

Figure 4.6. Solute leakage, DNA fragmentation and expression of peroxidase. (A) EC conductivity measurement as an indication of ion leakage. The experiment was repeated twice using independently collected petal tissues. Data represented as (Mean ± SE). Wt-0D, 3D and RNAi-0D, 3D represent petal tissues in wild type and EIN2RNAi tobacco at a day before anthesis and 3 days after pollination. (B) DNA laddering analysis: 2µg of genomic DNA isolated from petal tissues were separated in 2 % (w/v) agarose gel. Wt-0D, 3D and RNAi-0D, 3D represent petal tissues in wild type and EIN2RNAi tobacco at a day before anthesis and 3 days after pollination. (C) Transcript level of a tobacco class III peroxidase was determined with quantitative real time PCR. The experiment was repeated twice with independently collected petal tissues and data represented as (Mean ± SE). Flowers at 0D and 3D represent flowers a day before anthesis and 3 days after pollination, respectively. 50 A 40

Ion leakage(%) 10

0 Wt-0D Wt-3D RNAi-0D RNAi-3D B

W-0D W-3D R-0D R-3D

Wt-0D Wt-3D RNAi-0D RNAi-3D C 25

RQ 10

5 0 Wt-0D Wt-3D 73-0D 73-3D 76

4.3.5. Silencing of NtabEIN2 delays pod maturation, adversely affect pod and seed development A significant delay was noticed in pod maturation in EIN2RNAi lines as compared to the wild type plants (Figure 4.4F and 4.7A). At the same time a drastic reduction in the pod size was observed in EIN2RNAi lines as compared the wild type tobacco (Figure 4.4H and 4.7B). Total seed weight was also significantly reduced in the EIN2RNAi lines compare to the wild type tobacco (Figure 4.7C).

Figure 4.7. Role of NtabEIN2 in pod and seed development. (A) Delayed pod maturation, (B) Pod weight and (C) Seed weight. In all cases data are generated from 4 independent EIN2RNAi lines and wild type tobacco (Wt), 6 plants per line and 10 pods per plant. Data represented as (Mean ± SE). One way ANOVA was done and in the case of a significant ANOVA test Tukey’s multiple comparison test was performed using WINKS SDA software (Texasoft, Cedar Hill, TX). Asterisks (*) denote significant difference at α = 0.05 significance level as compared to wild type. A 35 30 * * * * 25 20 15 10

Pod maturation (DAP) Pod maturation 5 0 35S:54 35S:73 35S:22-1 35S:41 Wt B 3

1 * * * *

Pod (g) Weight 0 35S:54 35S:73 35S:22-1 35S:41 Wt C 2 1.6 1.2 0.8 * * * 0.4 * Total Seed Weight (g) 0 35S:54 35S:73 35S:22-1 35S:41 Wt

4.3.6. NtabEIN2 silencing has negative impact on plant defense Nearly 24% of the EIN2RNAi plants died prematurely in the T0 generation. Most of the plants died at the onset of flowering or after that (Figure 4.4I). Dying plants at first showed wilting of the leaves and flowers, followed by rotting at the basal portion of the stems. Tissue samples were collected from the diseased plants and pure culture of the causal pathogen were developed. Amplification of the ITS region from the genomic DNA of the mycelia revealed the presence of Pythium myriotylum in the diseased samples. On the contrary, none of the wild type plants died during same period. Performance of EIN2RNAi lines against insect herbivory was also tested. Insect bioassay, where detached leaves of wild type and EIN2RNAi lines were fed to the newly hatched larvae of tobacco hornworm (Manduca sexta), showed higher leaf consumption in the EIN2RNAi lines (Figure 4.4J and 4.8).

Figure 4.8. Role of NtabEIN2 in insect herbivory. Insect herbivory by tobacco hornworm after four days of feeding was tested and represented by combined variable um. Experimental data was generated from 4 independent EIN2RNAi lines, control plants (Wild type), with 4 plants per line and experiment was repeated twice. Data represented as (Mean ± SE). Asterisks (*) denote significant difference at α = 0.04 significance level as compared to the control. 18 16 * 14 12 10 8 6 4

Insect herbivory(um) 2 0 RNAi Control

4.3.7. EIN2-ARF2 cross-talk during senescence Previous studies showed that Arabidopsis arf2 mutant (auxin response factor 2) displayed delayed senescence and abscission similar to ein2 mutant plants (Okushima et al, 2005). In order to examine possible cross talk between EIN2 mediated ethylene signaling and ARF2, we checked the transcript accumulation of ARF2 in the petal tissues before and after pollination in the wild type and EIN2RNAi background.

In wild type flowers, the ARF2 transcript level increased significantly by 3 DAP as compared to the level before pollination (0 DAP). ARF2 transcript level did not show any significant change in EIN2RNAi petals between before pollination and by 3 DAP (Figure 4.9A). Trans-acting siRNAs (taSiRNAs) have been shown to be involved in the regulation of ARF2 (Williams et al, 2005). ARF2 was shown to be targeted by trans-acting siRNA3 (tas3). In order to check if a differential regulation of tas3 level by EIN2 was responsible for the pollination induced induction of ARF2 level, the transcript level of tobacco tas3 (Ntabtas3 D7) was checked. Ntabtas3 D7 sequence and its putative target site in tobacco ARF2 (NtabARF2) is shown in Supplemental Figure S4. By 3 DAP, Ntabtas3 D7 level decreased more in the wild type petals as compare to the EIN2RNAi petals (Figure 4.9B).

Figure 4.9. Cross-talk between EIN2 and ARF2. Transcript level expression of (A) tobacco ARF2 and (B) Ntabtas3D7 were determined with quantitative real time PCR. Wt-0D, 3D and RNAi-0D, 3D represent petal tissues from wild type and EIN2RNAi tobacco at a day before anthesis and 3 days after pollination. RQ, Relative quantitation. 80 A

RQ 40

0 Wt-0D Wt-3D RNAi-0D RNAi-3D 1.2 B 1 0.8 RQ 0.6 0.4 0.2

0 Wt-0D Wt-3D RNAi-0D RNAi-3D 4.4. Discussion Ethylene signaling has long been known to be involved in flower senescence, abscission, fruit maturation, adventitious and lateral root formation and in plant defense. Expression of Arabidopsis dominant negative etr1-1 allele under 35S promoter have shown delayed senescence in leaves and flowers in heterologous systems, like Petunia, carnation and Nicotiana sylvestris (Wilkinson et al, 1997; Bovy et al, 1999; Yang et al, 2008). EIN2 is an essential component of

79 ethylene signaling (Alonso et al, 1999) and silencing of petunia EIN2 resulted in delayed petal senescence (Shibuya et al, 2004). However, possible reasons for the delayed petal senescence phenotype in reduced EIN2 background and the role of EIN2 in cross-talk with other phytohormone response in regulating petal senescence process are still underexplored. Our results deal with functional characterization of NtabEIN2 in a wide range of processes, with special emphasis on its role in petal senescence and its possible cross-talk with ARF2 in modulating petal senescence process. Sequence analysis of NtabEIN2 revealed significant homology with other known EIN2s both at the nucleotide level and at the amino acid level. Number of exons, exon size and their relative positions are highly conserved among tobacco, Arabidopsis and tomato EIN2s (Figure 4.1A). Also prediction of trans-membrane domains (TM) of NtabEIN2 protein showed similar number of TM domains as other EIN2s and in all cases TM domains are clustered towards the N- terminal region of the predicted proteins (Figure 4.1B). These high level of structural conservation at the genomic and protein level across different plant species emphasized the functional importance of N-terminal region of EIN2 in ethylene signaling. Overexpression of C- terminal region of EIN2 in an ein2 mutant background generates constitutive ethylene response, suggesting possible role of N-terminal region in regulating the function of C-terminal region (Alonso et al, 1999). Arabidopsis and rice EIN2 were shown to be not induced by ethylene treatment, whereas with ethylene treatment petunia EIN2 was reduced in petal limbs and petal tubes, but not in the seedlings (Alonso et al, 1999; Jun et al, 2004; Shibuya et al, 2004). Since, ethylene is known to be a positive regulator of senescence; we tested the expression of NtabEIN2 both during leaf and petal senescence. Expression of NtabEIN2 was found to be higher in leaves as compared to flowers and interestingly, we have seen induction of NtabEIN2 both during leaf and petal senescence (Figure 4.3A) and this trend matches with the expression pattern of Arabidopsis EIN2 as visualized with the Genevestigator database (Zimmermann et al, 2005). This indicates increased transcript abundance of NtabEIN2 during senescence. Petunia EIN2 silencing was shown to delay petal senescence significantly (Shibuya et al, 2004). Our data showed that the silencing of NtabEIN2 also significantly delays the petal senescence (Figure 4.4A, 4.4C and 4.5A). We further tested possible reasons for the delayed senescence phenotype. Delayed anther dehiscence could be a cause for delayed petal senescence and indeed we saw delayed anther dehiscence in EIN2RNAi lines (Figure 4.4B). Earlier, ethylene insensitive Tetr tobacco (expressing Arabidopsis mutant etr1-1 driven by 35S promoter) also showed delayed anther dehiscence (Rieu et al, 2003). In the current project, flowers were

80 emasculated a day before anthesis and then artificially pollinated in order to nullify any effect of delayed anther dehiscence on the delay of petal senescence. It is well known that compatible pollination acts as a cue for petal senescence (Reid et al, 1992; Stead et al, 1992). Reciprocal crosses were made between wild type and EIN2RNAi tobacco to test if there are any defects in pollens contributing to the delayed petal senescence in the EIN2RNAi lines (Figure 4.5B). Delayed senescence was observed only when EIN2RNAi flowers were pollinated with wild type pollen, but not when wild type flowers were pollinated with EIN2RNAi pollen. We also saw delayed petal senescence in emasculated, unpollinated flowers of EIN2RNAi plants as compared to wild type plants (Figure 4.4D, 4.4E and 4.5C). These findings indicate that the delay in petal senescence is intrinsic to the petal tissues. Membrane damage, subsequent ion leakage and DNA fragmentation are the hallmarks of the onset of programmed cell death (PCD) during petal senescence (Xu et al, 2000 and Shibuya et al, 2009).We saw significant increases in ion leakage and DNA degradation after pollination in the petal tissues of wild type plants, but not in EIN2RNAi plants (Figure 4.6A and 4.6B). Earlier ethylene insensitive transgenic petunia showed delayed ion leakage and DNA degradation (Langston et al, 2005). These suggest that disruption of ethylene signaling might affect the cell death process, which may be responsible for the delayed petal senescence in EIN2RNAi plants. Any involvement of reactive oxygen species (ROS) scavenging enzymes in delaying petal senescence in EIN2RNAi lines was checked. Expression of a class III peroxidase increases significantly with pollination in wild type petals, but not in EIN2RNAi petals (Figure 4.6C). Class III peroxidases are targeted to extracellular locations or to the vacuole and have been known to have functions in plant defense (Welinder et al, 2002). Peroxidase activity was shown to increase in response to ethylene and this increase was less in Arabidopsis etr mutant (Bleecker et al, 1988). Arabidopsis delayed leaf senescing ore1 (oresara1), ore3 and ore9 mutants showed enhanced tolerance to oxidative stress and reduced level of antioxidant enzymes (Oh et al, 1997; Woo et al, 2004). This suggests that pollination induced elevation of ethylene level may be responsible for the induction of peroxidase level in the wild type petals after pollination. Reduced peroxidase level in the EIN2RNAi petals signifies higher resistance to oxidative stress and thus a lesser requirement of antioxidant enzymes. Higher resistance to oxidative stress can potentially delay cell death process and results in a delayed petal senescence phenotype. Based on flower senescence and abscission, flowering plants can be classified in three major groups: ethylene sensitive petal wilting followed by abscission, ethylene insensitive petal wilting followed by abscission and ethylene sensitive abscission of turgid petals (van Doorn et al, 2001) and tobacco belongs to the group showing ethylene dependent wilting followed by

81 abscission of petals. We noticed distinct difference in the pattern of senescence between wild type and EIN2RNAi petals (Figure 4.4A). In the EIN2RNAi flowers wilting phase at the onset of senescence is almost abolished and petals started directly drying from the distal part, while petal part proximal to the petiole still remain turgid; whereas wild type flowers first wilted, followed by drying and abscission. A key aspect of petal senescence is the remobilization of nutrients from the senescing petals to the developing fruits. Microarray data from the experiment using wild type and ein2 mutant leaves showed up-regulation of several transporters (e.g. sugar, amino acid, peptide, cation transporters and ABC transporters) during senescence, while senesced leaves of ein2 mutant showed significantly lower level of expression of the transporters than that of wild type (Buchanan-wollaston et al, 2005). Up-regulation of the transporters could possibly be involved in nutrient remobilization from the senescing petals to the developing pods. Decrease in solute concentration increases the solute potential and thereby results in a higher water potential in the senescing petal tissue. Higher water potential can leads to loss of water from the senescing petals, resulting in wilting of senescing petals. On the contrary, down regulation of these transporters in EIN2RNAi lines can eliminate this wilting phase during senescence and directly move into a cell death phase, manifested by drying of petal tissues. Abscission of floral organs was also abolished in the EIN2RNAi plants (Figure 4.4F). Mining of microarray data from previous experiments (Buchanan-Wollaston et al, 2005; De Paepe et al, 2004) showed a lower expression of cell wall modifying enzymes, e.g., endo- polygalacturonases, pectin esterases, exo-polygalacturonases and expansins in ein2 mutant as compare to wild type Arabidopsis. As these cell wall hydrolytic enzymes play vital role in petal abscission (Patterson et al, 2001), the reduced level of these enzymes could account for the lack of abscission of floral organs in EIN2RNAi plants. Our results also showed a delay in pod maturation in EIN2RNAi lines, suggesting an overall delay in the aging process (Figure 4.4F and 4.7A). Interestingly, both pod weight and seed weight per pod decreased significantly in the EIN2RNAi plants as compare to the wild type plants (Figure 4.4H, 4.7B and 4.7C). Recent findings (Wuriyanghan et al, 2009) showed that, ETR2 over-expressing ethylene insensitive rice plant display reduced effective panicles and seed set. Ethylene insensitive lines also showed higher accumulation of starch granules in the internodes as compared to the wild type, indicating defects in starch mobilization towards developing seeds. If transporter gene expression is reduced in response to ein2 loss of function as it is in Arabidopsis, it could help to explain the reason behind the altered starch mobilization. Thus, reduced expression of transporters and subsequent impediment in nutrient remobilization in the ethylene insensitive lines can be involved in regulating pod and seed development. Increased number of

82 flowers in the EIN2RNAi plants were observed as compared to the wild type, which can be an adaptive response of these plants to compensate for the reduced total seed yield (Figure 4.4G). EIN2RNAi plants were found to be more susceptible to the pathogen and insects. Ethylene insensitive Tetr tobacco was reported to show increased susceptibility to Pythium (Knoester et al, 1998) and EIN2 silenced lines of petunia also displayed premature death (Shibuya et al, 2004). Our EIN2RNAi plants also showed premature plant death and presence of Pythium myriotylum in the diseased tissue, in agreement with other results showing the role of EIN2 mediated ethylene signaling in pathogen defense (Figure 4.4I). Reports of involvement of ethylene in insect defense have been contradictory. Arabidopsis ein2 mutant showed increased resistance to generalist insect Spodoptera litoralis (Egyptian cotton boll worm) (Bodenhausen et al, 2007) and no effect against specialist insects Plutella xylostella (Diamond back moth) (Stotz et al, 2000). Inhibition of ethylene biosynthesis and signaling in maize resistant lines were resulted in increased susceptibility towards Spodoptera frugipedra (armyworm) (Harfouche et al, 2006). Ethylene insensitive RNAi lines of Tomato Protein Kinase 1b (TPK1b) showed enhanced susceptibility to Manduca sexta (tobacco hornworm) (AbuQamar et al, 2008). Current results also showed increased susceptibility of EIN2RNAi plants to tobacco hornworm (Figure 4.4J and 4.8). These suggest that the role of ethylene in insect herbivory depends on the interaction between specific plant species and the type of the insect. Recently a link between EIN2, microRNA164 (miR164) and a NAC family transcription factor ORE1 has been established (Kim et al, 2009). ORE1 is responsible for the aging process and increases during senescence. ORE1 is up regulated by EIN2 and down regulated by miR164. EIN2 in turn down regulates miR164 during aging, leading to an up regulation of ORE1. But, ore1 ein2 double mutants showed a stronger effect in delaying senescence than either ore1 or ein2 single mutants, suggesting the presence of additional EIN2 regulated pathway, which does not involve ORE1 for controlling senescence or aging process (Kim et al, 2009). Auxin Response Factor 2 (ARF2) is a transcription factor involved in mediating auxin response is also known to have role in senescence and abscission (Ellis et al, 2005). Arabidopsis arf2 shows delayed leaf senescence, floral organ abscission and silique ripening. Phenotypic similarity between ein2 and arf2 mutants suggests possible cross talk between EIN2 and ARF2. Prior works demonstrated that the delayed senescence effect of ein2 arf2 double mutant in Arabidopsis is higher than the individual single mutants. This additive effect led to the conclusion that, senescence pathways regulated by EIN2 and ARF2 are not linked (Ellis et al, 2005). However, the delayed senescence effect shown was partially additive in nature and thus, does not eliminate the possibility of at least a certain level of cross talk between EIN2 and ARF2 regulated

83 senescence pathways. To test this possibility, I checked the change in ARF2 expression with pollination in wild type and EIN2RNAi background. Experimental data showed a strong induction of ARF2 transcript level in the wild type petals by 3 DAP, but EIN2RNAi petals did not show any significant change, indicating that pollination induced ethylene burst (documented in tobacco by De Martinis et al, 2002 and Sanchez et al, 2002 ) may trigger the ARF2 transcription, whereas ethylene insensitivity does not allow induction of ARF2 in EIN2RNAi flowers (Figure 4.9A). Overall this suggests that, in addition to the independent pathways, EIN2 and ARF2 also regulate senescence through a cross linked pathway. ARF2 was also shown to be a target of trans- acting siRNA3 (tasiRNA3) (Williams et al, 2005). This prompted me to check whether EIN2 regulates ARF2 via tasiRNA3 to modulate senescence. In the current experiment, with pollination tasiRNA3 level decreases more in wild type in comparison to the EIN2RNAi petals (Figure 4.9B). Thus, with pollination tasiRNA3 transcript accumulation inversely correlates with the ARF2 transcript accumulation. However, the changes in tasiRNA3 transcript level is much smaller as compared to the changes in the ARF2 transcript level. Thus, either small change in the tasiRNA3 may be sufficient to cause a large change in ARF2 transcript accumulatiom or possibly, tasiRNA3 plays a minor role and other undiscovered pathway may be involved through which EIN2 mediated ethylene signaling is regulating ARF2 to modulate petal senescence. Adding another layer of complexity an arf2 mutant was shown to diplay transcriptional reduction of ethylene biosynthesis gene ACC synthase, showing regulation of ethylene biosynthesis by ARF2 (Okushima et al, 2005), suggesting cross-talk between ethylene and auxin response in both directions. Taken together these indicate the operation of a complex, highly regulated, programmed network having multiple branches with cross-talk at several points during senescence (Figure 4.10). In summary the current study reports functional characterization of NtabEIN2 in a diverse array of processes. Isolated tobacco EIN2 showed conserved genomic structure and transmembrane domain topology with respect to previously known EIN2s from other species, pointing towards funtional importance of EIN2. Transgenics with reduced EIN2 level showed delayed anther dehiscence, delayed petal senescence, change in the pattern of senescence, abolishes floral organ abscission, affect pod and seed development and compromises plant defense. Experimental data also showed that the delayed petal senescence in the EIN2 silenced lines is mostly due to the delayed cell death process. Finally, I proposed possible cross talk between EIN2 mediated ethylene signaling and ARF2 in modulating the petal senescence process and in future it will be worthwhile to investigate at which level EIN2 mediated ethylene signaling interacts with ARF2 to regulate the senescence process.

Figure 4.10. Model integrating EIN2 and ARF2 mediated pathways to regulate senescence (Interactions denoted by ‘a’ are based on the model by Kim et al, 2009 and ‘b’ and ‘c’ are based on the data reported by Okushima et al, 2005 and Ellis et al, 2005, respectively).

4.5. Summary • Tobacco EIN2 was isolated, showed conserved sequence, genomic organization and transmembrane domains. • Silencing EIN2 delays anther dehiscence, petal senescence, pod maturation. • Delayed senescence is possibly because of delayed cell death process. • EIN2 silencing changes the pattern of petal senescence and abolishes floral organ abscission. • Silencing EIN2 affect pod size and seed yield and compromises plant defense. • EIN2 mediated ethylene signaling possibly interacting with ARF2 in modulating petal senescence.

Chapter 5. Future Directions A putative nicotine N-demethylase gene, designated as NsylCYP82E2 was isolated from N. sylvestris, which was found to be responsible for the ‘senescing leaf converter’ phenotype of N. sylvestris. NsylCYP82E2 codes for a functional enzyme in N. sylvestris, but became inactive in tobacco due to two point mutations (chapter 2). A senescence specific expression of the tobacco conversion locus NtabCYP82E4 was also demonstrated. Data presented here also suggests that the unstable transcriptional silencing in the nonconverter tobacco corresponds to the NtabCYP82E4 locus itself, not to any upstream regulator. As mentioned in chapter 3, nonconverter tobacco lines can produce converter tobacco in subsequent generations and one possible explanation for the unstable transcriptional silencing of the conversion locus can be epigenetic modification of the NtabCYP82E4 locus in the nonconverter tobacco. Epigenetic modifications, like DNA and histone methylation, acetylation, deacetylation can lead to chromatin modifications and can affect the binding of transcriptional machinery to the promoter region, thereby causing transcriptional silencing. It would be interesting to investigate if any such epigenetic regulation is involved in the transcriptional silencing of the tobacco conversion locus NtabCYP82E4. A senescence specific expression of NtabCYP82E4 was presented in chapter 3 and a reasonable extension of this project would be to identify the transcriptional regulator involved in the senescence specific expression. Deletion mapping of the NtabCYP82E4 promoter could be performed to identify the minimal promoter region that can drive a reporter expression in a senescence specific manner. Once confirmed, that promoter fragment can be used in a yeast one hybrid experiment to identify the putative transcriptional regulator. Validation would require further experiments, like mutating the putative cis element and silencing the putative transcriptional regulator to see if loss of these elements abolishes the senescence specific induction of NtabCYP82E4. Additionally the senescence specific NtabCYP82E4 promoter can be used to produce plant natural product or plant made pharmaceuticals in a more restricted way that could limit any negative impact on the plant. A further extension of the tobacco EIN2 characterization project can be the comparison of transcriptomic, proteomic and metabolic profiling between wild type and EIN2RNAi tobacco. A comparison between wild type and EIN2RNAi tobacco flowers at before pollination (0 DAP), 1 DAP (days after pollination) and 3 DAP can generate valuable information regarding the role of ethylene in pollination induced gene expression and in petal senescence. Comparison of wild type flowers at 0 DAP and 1 DAP can give a representation of the genes regulated differentially by pollination and by comparing those with the EIN2RNAi flowers at 0 DAP and 1 DAP can provide

86 an idea about the ethylene dependent and independent genes which are differentially regulated during pollination induced signaling. Since, the data presented here showed that the wild type flowers senesced by 3 DAP, while EIN2RNAi flowers do not senesce by 3 DAP. Thus, a comparison between wild type and EIN2RNAi flowers at 3 DAP can give a picture of genes differentially regulated, when EIN2 is silenced and can facilitate the identification of ethylene dependent and independent genes regulating petal senescence. Silencing of NtabEIN2 also increased susceptibility to insect attack. EIN2RNAi lines again can be a valuable tool to elucidate the mechanism for increased susceptibility in EIN2 silenced plants by comparing EIN2 silenced lines before and after insect feeding, with wild type tobacco at the transcriptomic, proteomic and metabolite levels. A possible link between tobacco EIN2, tasiRNA3 and ARF2 was proposed in chapter 4. To prove further if tasiRNA3 is indeed playing a role in the regulation of ARF2, silencing or overexpression of tasiRNA3 may be informative. Another interesting experiment can be to check if the ethylene signaling between EIN2 and EIN3 is linear or branched. This can be tested easily by large scale transcriptional studies between EIN2RNAi and EIN3 silenced lines. This can generate novel information on whether there are some genes which require EIN2, but not EIN3, thus can provide evidence for EIN2’s direct involvement in regulating other targets without the involvement of EIN3, which can support the role of EIN2 in cross-talk with hormonal or other signaling pathways. Similarly, identification of genes requiring EIN3 for their expression, but not EIN2, can provide evidences for regulating EIN3 by factors other than the EIN2 mediated ethylene signaling. It would be also interesting to check if silencing of EIN2 changes the alkaloid profile in tobacco. There is not much of information regarding the regulation of pyridine alkaloid biosynthesis in tobacco. If silencing of EIN2 alters the alkaloid profile, then transcriptomic and metabolic profiling of EIN2RNAi tobacco lines can be employed to gain novel insights into the regulation of ethylene in the pyridine alkaloid biosynthesis in tobacco.

Appendices Supplemental Table S1. DNA sequence, polarity and use of oligonucleotide primers employed in the PCR experiments for the chapter 2. Name Nucleotide sequence (5’-3’) Polarity Application E2cDNA_F ATGGTTTTTCCCATAGAAGCCATTG + Isolation of E2cDNA_R TTAATAAAGCTCAGGTGCCAGGC - NsylCYP82E2 cDNA E2Prom_R1 CGGGGATTTTCGGTGGTAAGGGTTTTGGAA - Gene-specific primer for the first round of amplification of the 206 bp of the promoter region of NsylCYP82E2 E2Prom_R2 GGAAGTATAAGAGAAATGTGAAGGT- - Nested primers TACTAGTCCTACAAA for the same as above E2Gen_F TTCTCTATTTCCCATATTATGCAC + Isolation of the E2Gen_R AGCACAATCATTCTTTACTTATTG - genomic NsylCYP82E2 clone

E2Ex2_F TGGAAATGCAGAAATTCTTT + Isolation of the E2Ex2_R AGCACAATCATTCTTTACTTATTG - second exon of the CYP82E2 orthologs from N. sylvestris and the tobacco tester lines E2As_F1 TGGAAATGCAGAAATTCTTT + First round of nondiscriminative E2As_R1 AGCACAATCATTCTTTACTTATTG - amplification of the CYP82E2 orthologs for allele-specific PCR E2As_F2 AGTATAGATGAGATGTGCATACTTAG + Nested primer for the same as above NsE2As_R2 TCGAACTTATCAGGATTTGACC - NsylCYP82E2- specific nested primer for allele- specific PCR NtE2As_R2 TCGAACTTATCAGGATTTGACA - NtabCYP82E2- specific nested primer for allele- specific PCR E2Rt_F GATATTGACTTCCGTGGTCAC + Amplification of E2Rt_R AGGCGTTATTATCAATTCCACT - a 229 bp cDNA fragment of the CYP82E2

orthologs for qRT-PCR GAPD_F GGTGTCCACAGACTTCGTGG + Amplification of GAPD_R GACTCCTCACAGCAGCACCA - a 220 bp fragment of the GAPDH cDNA used as an internal control for qRT-PCR

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, quantitative real time-polymerase chain reaction.

Supplemental Table S2. List of primers used in cloning NtabEIN2, NsylEIN2 and in quantitative real time PCR for chapter 4.

Name Sequence (5' to 3') EIN/For-1 TCTTATTATTTCTTTTGGAGTTTGGTGYATHCA EIN/Rev-1 CAACTGGCTTATTAGAAAGTCTTCTCTTRTANCKYTT EIN/For2 TCTAGACCAGAACTTTGGGGAAARTAYACNTA EIN/Rev-2 ACAGAAGCAAGATTTTCCTTTCCYTTNGGRAA EIN2_F2 ATATCTGGAGCGTAATCAATTC EIN2_R2 GCAGTTTTACATAACCTCGTTAC EIN2-5' _deg3 TGCTATTGGATATGTTGATCCAGGNAARTGGGC EIN2-5' _rev1 GAAATGCAGCTTCTTGCTTT EIN2-GW-1 TTGTGAGGTCCAAAGCAATCATCGAAA EIN2-GW-2 ACTGGCACAGAATTGCAGCAAAATTGA EIN2Full F5 GGTAAAACAAATTATGGAATCTGAA EINFull-R3 CAGTTGCTATGAACCGAGAAA EIN2:RNAi/P1 AAGCTTCGTTCTCAACCGTCTTCAGGG EIN2:RNAi/P2 CTCGAGAAGCAACATCCCCTGCAGCAG EIN2:RNAi/P3 GAGCTCAAGCAACATCCCCTGCAGCAG EIN2:RNAi/P4 TCTAGACGTTCTCAACCGTCTTCAGGG EIN2-RT_FOR CTCATTGTTAGCTTCGGTGT EIN2-RT_REV ACAATGACTCGTTGGAGAAC NtabARF2-FP AAGGTCTTGCAAGGTCAAGAAAAAGCTGTA NtabARF2-RP TCTAACTTGTCCTCGCCTCCATCTAAGTTT NtabPer-FP AGAACTGCAAGTCAAAGTGCTGCC NtabPer-RP TTGCTTGTCCAATTGTGTGAGCCC GAPDPH-FP GGTGTCCACAGACTTCGTGG GAPDPH-RP GACTCCTCACAGCAGCACCA Tobacco-tas3-D7-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATAC GACGGGGTC Tobacco-tas3-D7/D8-FP GCGGCGGTTCTTGACCTTGTAA RT-common-RP GTGCAGGGTCCGAGGT

ITS 1 TCCGTAGGTGAACCTGCGG ITS 4 TCCTCCGCTTATTGATATGC

Supplemental Figure S3. Sequence comparison of predicted EIN2 proteins from tobacco, N. sylvestris, Petunia (AY353249), tomato (AY566238), poplar (XM_002326149), Medicago (EU709495), Arabidopsis (NM_120406), rice (AY396568) and maize (AY359584). Identical and similar amino acids are colored with dark and light red, respectively.

Tobacco ------M E S E T L T I D H R ------Q P S M L Q R I L S A S A P M L L I A I G Y V D P G K-38 Nsylvestris ------M E S E T L T I D H R ------Q P S M L Q R I L S A S A P M L L I A I G Y V D P G K-38 Petunia ------M E S E T Q T I A Y R ------Q P S M L Q R I L S A S M P M L L I A I G Y V D P G K-38 Tomato ------M E S E T L T R E Y R ------R P S M L Q R V L S A S V P M L L I A V G Y V D P G K-38 Poplar ------M E T E F V N A N H ------L P H F L R R A L P A L G P G L L I A I G Y V D P G K-37 Medicago - M E T E A L S S E Q T K S K M E A E T L S T N P ------P P G F L I R A L P A V I P A L L I S I G Y V D P G K-51 Arabidopsis ------M E A E I V N V R P ------Q L G F I Q R M V P A L L P V L L V S V G Y I D P G K-37 Rice ------M D G Q Q L R S S E S P A S G G G G V T G G G A P H L F H A L G P A L L I S I G Y I D L G K-46 Maize ------M D A P D V Q Q S - - - - - M G Y K E S R G G M P K F F H A L G P A L L I S M G Y I D L G K-41 I Tobacco - W A A M V D G G A R F G F D L I M L V F M F N F A A I L C Q Y L S A C I A L A T D R N L A Q I C S E E Y D K V T C I F L-98 Nsylvestris - W A A M V D G G A R F G F D L I M L V F M F N F A A I L C Q Y L S A C I A L V T D R N L A Q I C S E E Y D K V T C I F L-98 Petunia - W A A M V D G G A R F G F D L I M L A L L F N F A A I L C Q Y L S A C I A L V T D Q D L A Q I C S E E Y G K V T C I F L-98 Tomato - W A A M V D G G A R F G F D L V M L V L L F N F A A I L C Q Y L S A C I A L V T D R D L A Q I C S E E Y D K V T C I F L-98 Poplar - W A A T V E G G A R F G F D L V L P M L I F N F V A I L C Q Y L S A R I G V V T G K D L A Q I C S D E Y D K W T C M F L-97 Medicago - W V A S I E G G A R F G F D L V A F A L I F N F A A I F C Q Y L S A R V G V I T G R D L A Q I C S D E Y D T W T C L L L-111 Arabidopsis - W V A N I E G G A R F G Y D L V A I T L L F N F A A I L C Q Y V A A R I S V V T G K H L A Q I C N E E Y D K W T C M F L-97 Rice - W V A A V E A G S R F G L D L V L L A L L F N F M A I L C Q Y L A A C I G T V T G R S L A E I C H Q E Y S R P T C I F L-106 Maize - W V A A V E A G S C F G F D L V L L A L L F N F T A I V C Q Y L A A C I G T V T G K N L A E I C H Q E Y N Q P T C I F L-101 I Tobacco - G I Q A E V S M I A L D L T M V L G T A H G L N V V F G - V D L F S C V F L T A T G A I L F P L L A S L L D N G S A K F -157 Nsylvestris - G I Q A E V S M I A L D L T M V L G T A H G L N V V F G - V D L F S C V F L T A T G A I L F P L L A S L L D N G S A K F -157 Petunia - G I Q A E V S M I A L D L T M V L G T A H G L N V V F G - V D L F S C V F L A A T G A I L F P L L A S L L D N G S A K F -157 Tomato - G I Q A E V S M I A L D L T M V L G T A H G L N V V F G - V D L F S C V F L T A T G A I L F P L L A S L L D N G S A K F -157 Poplar - G V Q A A L S V I A L D L T M I L G I A H G L N L L F G - M D L S T C V F L A A V D A V L F P V F A T L L E R C K A S F -156 Medicago - G I Q A E L S V I M L D L N M I L G M A Q G L N L I F G - W D L F T C V F L T A T G A V F H I L L A I L L D I E K T K F -170 Arabidopsis - G I Q A E F S A I L L D L T M V V G V A H A L N L L F G - V E L S T G V F L A A M D A F L F P V F A S F L E N G M A N T -156 Rice - G V Q A G L S L L T S E L T M I F G I A L G F N L L F E Y D D L I T G I C F A T V V P N L L P Y A I S H L G K K M V G T -166 Maize - G V Q A G L S L L T S E L S M I F G I A L G F N L L F E Y D D L I T G I C F A T V M E ------G T -146 I Tobacco - L C I G W G S S I L L S Y V F G V V I S Q P E S P F S I G G M L N K F S G E S A F A L M S L L G A S I M P H N F Y L H S-217 Nsylvestris - L C I G W G S S I L L S Y V F G V V I S Q P E S P F S I G G M L N K F S G E S A F A L M S L L G A S I M P H N F Y L H S-217 Petunia - I C I G W A S S I L L S Y V F G V V I S Q P E S P F S I G G M L N K F S G E S A F A L M S L L G A S I M P H N F Y L H S-217 Tomato - L C I G W A S S V L L S Y V F G V V I T L P E T P F S I G G V L N K F S G E S A F A L M S P L G A S I M P H N F Y L H S-217 Poplar - L S T C I A G F L L L L Y F F G V L I S Q P E I P L P M N G M P I K L S E D S A F A L M S L L G A S I M P H N F F L H S-216 Medicago - L G Q F V A G F V L L S F I L G V F I Q S - E V P V S M N G I L I N L S G E S T F M L M S L L G A T L V P H N F Y L H S-229 Arabidopsis - V S I Y S A G L V L L L Y V S G V L L S Q S E I P L S M N G V L T R L N G E S A F A L M G L L G A S I V P H N F Y I H S-216 Rice - L N A C I A G F A L L C Y V L G L L V S Q P Q I P L T T N V I F P K L S G E S A Y S L M A L L G A N V M A H N F Y I H S-226 Maize - I N A C I A G F A L L S Y V L G L L V S Q P Q I P L T M N V I F P K I S G E S A Y S L M A L L G A N I M A H N F Y I H S-206 I Tobacco - S I V Q Q G K D S T E L S R G A L C Q D H F F A I V F I F S G V F L V N Y A V M N S A A N V S Y S T G L L L L T F Q D A -277 Nsylvestris - S I V Q Q G K D S T E L S R G A L C Q D H F F A I V F I F S G V F L V N Y A V M N S A A N V S Y S T G L L L L T F Q D A -277 Petunia - S I V Q Q G K E S T N L S R G A L C Q D H F F A I V F V F S G I F L V N Y A I M N S A A N V S F S T G L L L L T F Q D S -277 Tomato - S I V Q Q G K E S T E L S R G A L C Q D H F F A I V F I F S G I F L V N Y A A M N S A A N V S Y S T G L L L L T F Q D T -277 Poplar - S M V L Q H Q G P P N I S K G A L C L N H F F A I L C I F S G I Y L V N Y V L M N S A A N V F Y S T G L V L L T F P D A -276 Medicago - S I V Q W H Q G P A N I S K D A L C H N H F L A L L C V F S G L Y L V N Y I L M T T L A N E F Y S T G P V L L ------284 Arabidopsis - Y F A G E S T S S S D V D K S S L C Q D H L F A I F G V F S G L S L V N Y V L M N A A A N V F H S T G L V V L T F H D A -276 Rice - S V V Q G Q K R S - A F A V G A L F H D H L F S V L F I F T G I F L V N H V L M N S A A - - A D S T N T L L L T F Q D V -283 Maize - S Y L Q G Q K K S S A V G L G A L F H D H L F S I L F I F T G I F M V N Y V L M N S A A - - A E S T N T L L I T F Q D V -264 I Tobacco - L S L L D Q V F R S S V A P F T I M L V T F I S N Q I T A L N W D L G R Q P V V H D L F G M D I P G W L H H V T I R V I -337 Nsylvestris - L S L L D Q V F R S S V A P F T I M L V T F I S N Q I T A L N W D L G R Q P V V H D L F G M D I P G W L H H V T I R V I -337 Petunia - L S L L D Q V F R S S V A P F S I M L V T F I S N Q I T P L T W D L G R Q A V V H D L F G M D I P G W L H H V T I R V I -337 Tomato - L S L L D Q V F R S S V A P F T I M L V T F I S N Q V T P L T W D L G R Q A V V H D L F G M D I P G W L H H V T I R V I -337 Poplar - M S L M E P V F R S P V A L C V F S L I L F F A N H I T A L T W N L G G Q V V L Q G F L R L D I P N W L Q R A T I R I I -336 Medicago - - - - M E Q V L H S P I A L I G F V L I L F L A N Q T A A L T W S L G G E V V V N G F L K L D I P G W L H Y A T I R V I -341 Arabidopsis - L S L M E Q V F M S P L I P V V F L M L L F F S S Q I T A L A W A F G G E V V L H D F L K I E I P A W L H R A T I R I L -336

Rice - V E L M N Q I F V N P M A P T I F L V V L L F S S H I I S L T S A I G S Q V I S Q H L F G I N L P L S G H H L I L K A F -343 Maize - V E L M N Q I F V N P L A P T I F L V V L L F S S H I I S L T S A I G S Q V I S H H L F G I N L P L S G H R L L L K V F -324 I Tobacco - S I V P A L Y C V W N S G A E G L Y Q L L I F T Q V V V A L V L P S S V I P L F R V A S S R S I M G I H K I S Q L M E F -397 Nsylvestris - S I V P A L Y C V W N S G A E G L Y Q L L I F T Q V V V A L V L P S S V I P L F R V A S S R S I M G I H K I S Q L M E F -397 Petunia - S V V P A L Y C V W N S G A E G L Y Q L L I V T Q V V V A L V L P S S V I P L F R V A S S R S I M G I H K I S Q L M E F -397 Tomato - S I V P A L Y C V W S S G A E G L Y Q L L I L T Q V V V A L V L P S S V I P L F R V A S S R S I M G I H K I S Q L M E F -397 Poplar - A V V P A L Y C V W T S G V E G I Y Q L L I F T Q V M V A L L L P S S V I P L F R I A S S R Q V M A A Y K I S A F L E F -396 Medicago - A V L P A L Y C V W S S G A E G I Y Q L L I F T Q V L V A L Q L P S S V I P L F R V A L S R S I M G A H K V S Q S M E L -401 Arabidopsis - A V A P A L Y C V W T S G A D G I Y Q L L I F T Q V L V A M M L P C S V I P L F R I A S S R Q I M G V H K I P Q V G E F -396 Rice - A I V P A L Y C A K V A G A E G I Y Q L L I I C Q I I Q A M L L P S S V V P L F R V A S S R L I M G A H R V S L H L E I -403 Maize - A I V P T L Y W A K V A G A E G I Y Q L L I I C Q I I Q A M L L P S S V V P L F R V A S S R S I M G A H R V S L H L E I -384 I Tobacco - L S L G T F I G L L G L K L I F V I E M I F G N S D W V N N L K W N I G S S V S I P Y V F L L I A A S L S L C L M L W L -457 Nsylvestris - L S L G T F I G L L G L K L I F V I E M I F G N S D W V N N L K W N I G S S V S I P Y V F L L I A A S L S L C L M L W L -457 Petunia - L S L G T F I G L L G L K I I F V I E M I F G N S D W V N N L K W S I G S G V S T P Y V F L L I A A S L S L C L M L W L -457 Tomato - L S L G T F I G L L G L K I I F V I E M I F G N S D W V N N L K W N I G S S V S T P Y F F L L I A A S L C L C L M L W L -457 Poplar - L A L I S F M G M L G I K I I F V V E M V F G D S D W A G N L R W S T S G G S S T S Y T V L L I T A C S S F C L M L W L -456 Medicago - L A L T I F L G V L G M N I M F L G E M I F G S S D W A C D L R W N L G N G V S V L F S V L L I A G F L S I C L M L R L -461 Arabidopsis - L A L T T F L G F L G L N V V F V V E M V F G S S D W A G G L R W N T V M G T S I Q Y T T L L V S S C A S L C L I L W L -456 Rice - L T F L A F L L M L F S N I I F M A E M L F G D S G W L N T L K G N T G S P V V F P S T V L I T V A C V S V A F S L Y M -463 Maize - L V F L A F L L M L F S N I I F V A E M L F G D S G W M N N L K G Y T G S P V V L P Y T V L V L V A L I S V A F S L Y L -444 I Tobacco - A V T P L K S A S S R F D A - Q A F - - - L H S P M P E P Y L E R N Q F D G S D S T F S L E R - S T Q K Q E A A F H A E -512 Nsylvestris - A V T P L K S A S S R F D A - Q A F - - - L H S P M P E P Y L E R N Q F D A S D S T F S L E R - S T Q K Q E A A F H A E -512 Petunia - A V T P L K S A S S R F D A - Q A F - - - L Q T P M P E S Y R E H N Q V D V S D T T F G L E R - S T Q K Q E P A F H V E -512 Tomato - A V T P L K S A S S R F D A - Q A F - - - L Q T H V P E P Y S E C N Q L G A S N A M F G L V E G S S Q K Q E G A F H V E -513 Poplar - A A T P L K S A - T H L D A - Q V W N W D V Q N T V S E P S M Q I E E E I F S E T R Y T E E E - S I G G Q E Q L S G P G -513 Medicago - A T T P L R S A S I Q L N A - Q V L N W D M P E A V L N P P V D G E E S H V T E T V G H E D A - S F Q A D E P K P A L A -519 Arabidopsis - A A T P L K S A S N R A E A - Q I W N M D A Q N A L S Y P S V Q E E E I E R T E T R R N E D E - S I V R L E S ------509 Rice - A V T P L K S G S H E A E L Q Q E W S V P S Q K E L L N T T Q D R E E T C A G N V T Y E E D Q - - - - R S D V V P S P R -519 Maize - A V T P L R S G S H E A E S - H E W S V H S Q R E L L N T S Q E R E D V K V D N V T Y E E D Q - - - - R S D V V P S P R -499 I Tobacco - K S L V G L P D L S T P D P D Q I L H E S L L D Y E N V P H L A T I D E S K S E T T F S A P P L S H P E V S A P A G E T -572 Nsylvestris - K S L V G L P D L S T P D P D Q I L H E S L L D Y E N V P H L A T I D E S K S E T T F S A P P L S H P E V S A P A G E T -572 Petunia - K S L G S H P D L S T S D P D E I L P E S L L D F E K V H H L T T I D E S K S E T T F S T P S F S C P E V S A S A G E T -572 Tomato - K S L V S H P D L S T K D P D Q L L P E S L L D F E K V H Q L A T I D E S K S E T T F S A P A V V H P E V P V S A G A S -573 Poplar - K S A E S Y S D V T V A N A D P D L P V T I M E S D Q E H H L T T I K E N H S E I T F S S P G T F Y E E E T S P I I E - -572 Medicago - R S L E - Y P E V S L A S F R P D L H L P E T V M E P D P Q V N A L K E N H S V A P S V S ------T S D S G - -568 Arabidopsis - R V K D Q L D T T S V T S S V Y D L P E N I L M T D Q E I R S S P P E E R E L D V K Y S T S Q V S S L K E D S D V K E Q -569 Rice - I Q P V D C L K S A L D Y I D - - S S D T A I E S D H D S Q H S T A H T S T A P E S C H S P S F I P E E S K S V V A V D -577 Maize - D V P D S H P E L A L D Y I D - - T S D T A V E S D H D S Q Q S T A Y A S T A P E T C S S P S F T R E E S K S V V A V N -557 I Tobacco - A A A K S V C N E V S G V E S V D T S V F S T T D E S V D V V E K T L R I E G D M A N D - K D D E G D S W - E P D - - - -627 Nsylvestris - A A A K S V C N E V S G V E S V D T S V F S T T D E S V D V V E K T L R I E G D M A N D - K D D E G D S W - E P D - - - -627 Petunia - - - A K S V L N E V S G G E S V D T R D F N - - A A S V D V V E K T L R I E G D T P T D - K D D D G D S W - E P D D V P -626 Tomato - P S V K S V C N E V S G V V S V D T S V F N - - T E T V D V A E K T L R I E G D M A N D - R D D - G D S W E E P E E A I -629 Poplar - - S V S L S A A M N V V P G S E L L G A K K I D I E S M D S V E K T V D I D G D F H A E K E D D E G D S W - E P E E S S -630 Medicago - - T V S K T V A N D T S S S D S K L K D T K T I I E A N A P I E K T V E I E D D S N V E R D D D D V D S W - E T E E S S -626 Arabidopsis - S V L Q S T V V N E V S D K D L I V E T K M A K I E P M S P V E K I V S M E N N S K F I E K D V E G V S W - E T E E A T -628 Rice - - - - W P E P L E P I S N A I V A E E S T V E S V D S K S T G E R D I E V E P A L L M D - N D K E A P N I L E S D N - - -631 Maize - - - - W P E P L E K V P T S T V M E E S T V E N V V S R I T T E R D V L V E T D V V S G - K D K E D I R T L E S E - - - -610 I Tobacco - K G V S E N S T Q S V I S D G P G S F K S L S G K - E D T G S G T G S L S R L A G L G R A A R R Q L T I V L D E F W G Q -686 Nsylvestris - K G V S E N S T Q S V I S D G P G S F K S L S G K - E D T G S G T G S L S R L A G L G R A A R R Q L T I V L D E F W G Q -686 Petunia - K D V S E N - T Q S Y T S D G P E S F K S L S V R S E D T G S G T G S L S R L A G L G R A A R R Q L T V V L D E F W G Q -685 Tomato - K G V S E N - A Q S F I S D G P G S Y K S L S G K L E D T G S G T G S L S R L A G L G R A A R R Q L T E A L N E F W G Q -688 Poplar - K G V P G S - T S S L T S D G P G S F R S L S G K S D E G G N G A G S L S R L A G L G R A A R R Q L A S V L D E F W G Q -689 Medicago - R A V L A N - A P S S T S E G P P S F R S I S G K S D D G G C S F G S L S R I E G L G R A A R R Q L A A T L D E F W G Q -685 Arabidopsis - K A A P T S - N F T V G S D G P P S F R S L S G - - - E G G S G T G S L S R L Q G L G R A A R R H L S A I L D E F W G H -684 Rice - K S L G G N N P S C A S D D G P P S L T F S R G K G S D A G N G S G S L S R L S G L G R A A R R Q L A A I L D E F W G H -691 Maize - K S I V D S T P - Y V S D D G P P S L T F S R G K G S D A G N G S G S L S R L S G L G R A A R R Q L A A T L D E F W G H -669 I Tobacco - L F D Y H G A A T P Q A K S K K L D I I L G L D S K V D P K P A P A S F K M E S S R S D F N N A Y I P S G S A R V P E S -746 Nsylvestris - L F D Y H G A A T P Q A K S K K L D I I L G L D S K V D P K P A P A S F K M E S S R S D F N N A Y I P S G S A R V P E S -746 Petunia - L F D Y H G M P T S Q A K F K K L D V I L G L D T K V D P K P A P V S L K L E N S R G D S N - A Y I P S G S A R V P E S -744 Tomato - L F D Y H G V A T A E A K S K K L D I I L G L D S K M N P K P A P A S L K V E S S ------A Y I P S G S A R I P E P -742 Poplar - L Y D F H G Q T T Q E A K T K K L D A L G - - - - - V D L K P - - S L L K V D T A G K E F S - G Y F S S V G G R A S D S -741

Medicago - L Y D F H G Q A T Q A A K A K K I D V L L G M G - - V D S K P T A S L Q K M D A C G K D Y S - E Y L V S V G G R A S D N -742 Arabidopsis - L Y D F H G Q L V A E A R A K K L D Q L F G - - - - T D Q K S - A S S M K A D S F G K D I S S G Y C M S P T A K G M D S -739 Rice - L F D Y H G K L T Q E A S S K R F D I L L G - - - - L D V R T P S S T V R A D S Q A N E I P K S P M V R D N L Q G - - S -745 Maize - L F D Y H G K L T Q E A S T K K F G I L L G - - - - I D L R T P S T S V R T D K Q A A E I L K S P L V R D S M R G - - A -723 I Tobacco - L I N S N I Y S - P K Q Q F A S G T V D S T Y R V P K E P S S - - - - W S S H M K L L D A Y V Q S S N S N - I L D S G E -800 Nsylvestris - L I N S N I Y S - P K Q Q F A S G T V D S T Y R V P K E P S S - - - - W S S H M K L L D A Y V Q S S N S N - I L D S G E -800 Petunia - W I N S N I Y S - P K Q Q C A S G A L D S G Y R V P K E P A S - - - - W S S H M K L L D A Y V Q S S S G N - T L D S G E -798 Tomato - L I N S H V Y S - P K Q Q F A S N I V D S A Y R V P K E P S S T S S M W S N H M K L V G A Y V Q S S N S N - M L D S G E -800 Poplar - Q I H S S L G D S P N H L R V P S N I D S S Y G G Q R G P S - - - S L W S N H M Q L M D A Y A Q G P S R S - I A D S S E -797 Medicago - L I N A G P Y D Y S N Q P R M Q S N S E S A Y G L Q R S S S - - - S V R A S P I Q L L D A Y V Q S S N R N - L N D S G E -798 Arabidopsis - Q M T S S L Y D S L K Q Q R T P G S I D S L Y G L Q R G S S P - - S P L V N R M Q M L G A Y G N T T N N N N A Y E L S E -797 Rice - A F L G S S R D L M S T K N E M S N L D L T Y G L Q M G N N I G S S A W S Q G M Q L P S T Q L Q S S S N S - L L D Q G A -804 Maize - A F L S S S V D M M S P K N E T S N L E L A Y G L Q R G P G M G L S S W S Q G M Q L P N T Q L Q S S S N S - L L E Q S A -782 I Tobacco - R R Y S S M R I P A S S A G Y D Q Q - P A T V H G Y Q I T A Y L N Q I A K E R G S D Y L N G Q L E S P S P R S V S S S M -859 Nsylvestris - R R Y S S M R I P A S S A G Y D Q Q - P A T V H G Y Q I T A Y L N Q I A K E R G S D Y L N G Q L E S P S P R S V S S S M -859 Petunia - R R Y S S M R I P A S S A G Y D Q Q - P A T V H G Y Q I S A Y L S Q I A K G R G S D Y L N G Q L E S A S P R S V S S - L -856 Tomato - R R Y S S M R I P A T S A G Y D Q Q - P A T V H G Y Q I T A Y L N Q L A K E R G S D Y L N G Q L E S P S P R S V S S - L -858 Poplar - R R Y S S V H T L P S S D G R C I Q - P A T V H G Y Q I A S I I N Q I A K E R G S S S L N G Q M D S P A P I S P S L - G -855 Medicago - R R Y S S V R N L H S S E A W D Y Q - P A T I H G Y Q T A S Y L S R G V K D R S S E N I N G S M P L T S L K S P S T - G -856 Arabidopsis - R R Y S S L R A P S S S E G W E H Q Q P A T V H G Y Q M K S Y V D N L A K E R - L E A L Q S R G E I P T S R S M A L - G -855 Rice - R L N S N F S T P S Y A D N N Q F Y Q P A T I H G Y Q L A S Y L K Q M N A N R N P Y S S M P L D P Q R L P K S S A S - A -863 Maize - R L N S N F S S - S Y S D N N Q F Y Q P A T I H G Y Q L T S Y L K Q M N A S P S L Y S S M P L D P Q R L P K S S V S - A -840 I Tobacco - S S N Y A E P F A R A L G Q K P Q S G V S S R A P P G F G N V P V A R N N S M Q P V N - T I T D L S S T E N A E S V A G -918 Nsylvestris - S S N Y A E P F A R A L G Q K P Q S G V S S R A P P G F G N V P V A R N N S M Q P V N - T I T D L S S T E N A E S V A G -918 Petunia - T S N H A E P L A R A L G Q K P Q S G V S S R A P P G F G S V P - A R N N S M Q P V N - T S T D L S S T E N A E S V A G -914 Tomato - T S N Y A E P L A R V S G Q K P Q S G V S S R A P P G F G N V P V G R N N S M Q P T N T T S V D H S S T E T A E S V A G -918 Poplar - P R N Y R D P L T V A M G Q K L Q N G P S S S Q P P G F Q N L A V S R N S T L Q S E R H Y H D V Y S S G S A D D A - G K -914 Medicago - N P N Y R D S L A F V L G K K L H N G S G V G H P P G F E N V A V S R N R Q L Q T E R S N Y D S S S P G A A A N T - V S -915 Arabidopsis - T L S Y T Q Q L A L A L K Q K S Q N G L T P G P A P G F E N F A G S R S I S R Q S E R S Y Y G V P S S G N T D T V G A A -915 Rice - V P T Y V D S V M H A R N Q N L L A S L G A T P S - - - Q I A A T S R I G T M M A E R S Y Y V P - S T L D G N E N A G S -919 Maize - V P N Y A D S M M H A R N H N L L A S L G G T T T - - - Q L P A T S R V G S M M P E R S Y Y D P - S S V D G N E N A G S -896 I Tobacco - A A N S K K Y Y S L P D I S G R Y V P R Q D S A L S D - G R A Q W Y N S M G - - - Y G P S V G R S T Y E Q A Y V T G - S -973 Nsylvestris - A A N S K K Y Y S L P D I S G R Y V P R Q D S A L S D - G R A Q W Y N S M G - - - Y G P S V G R S T Y E Q A Y V T G - S -973 Petunia - S A N S K K Y Y S L P D I S G R Y V P R Q D S S L P D - G R A Q W Y N S M G - - - Y G Q S I G R S A Y E Q P Y M T G - P -969 Tomato - S A N S K K Y Y S L P D I S G R Y V P R Q D S I V S D - A R A Q W Y N S M G - - - F G Q S G G R S T Y E Q A Y M S G - S -973 Poplar - S A N T K K Y H S L P D I A G L A G P Y R D L Y M S E - K N A Q W D K S V G - - - F G S S V S R T G Y E Q S Y Y S N T R -970 Medicago - S V N T K K Y H S L P D I S G Y S I P H R A G Y V S D - K N A P W D G S V G - - - Y G S F A G R M G Y E P S M Y S N S G -971 Arabidopsis - V A N E K K Y S S M P D I S G L S M S A R N M H L P N N K S G Y W D P S S G G G G Y G A S Y G R L S N E S S L Y S N L G -975 Rice - S A Y S K K Y H S S P D I S A L I A A S R S A L L N E - - S K L G G G T I G S - - - Q S Y L S R L A S E R S Q Y T N S V -974 Maize - P A Y S K K Y H S S P D M S G I I A A S R A A L L N E - - A K L G - A A I G P - - - Q S Y L S R L A A E R S Q Y A S S T -950 I Tobacco - L R A G G P Q R F E H S P S - - K V C R D A F S L Q Y S S S N S G T G S G S G S L W S R Q P F E Q - F G V A G K T D V T -1030 Nsylvestris - L R A G G P Q R F E H S P S - - K V C R D A F S L Q Y S S - N S G T G S G S G S L W S R Q P F E Q - F G V A G K T D V T -1029 Petunia - M R A G G P P R F E H S P S - - K V C R D A F T L Q Y S S - - - - - N S G T G S L W S R Q P F E Q - F G V A G K A D V S -1021 Tomato - L R A G G P Q R Y E H S P - - - K V C R D A F S L Q Y S S - - - - - N S G T G S L W S R Q P F E Q - F G V A G K P D V G -1024 Poplar - S G A G ------A G H G D A F S F H M T P ------D P G S L W S R Q P F E Q - F G V A D K S R - V -1009 Medicago - S R A G G A H L A F D E V - - - S P Y R E A L S S Q F S S G - - - - - F D T G S L W S R Q P F E Q - F G V A G K I H N V -1022 Arabidopsis - S R V G V P S T Y D D I S Q S R G G Y R D A Y S L P Q S A T - - - - - T G T G S L W S R Q P F E Q - F G V A E R N G - A -1028 Rice - A R P A A P L A F D E L S P P - K L P G D I F S M Q Q S P N - - - - - P S A R S L W A K Q P F E Q L F G V S S A E L T K -1028 Maize - A R P A A P L A F D E L S P P - K L Q S D I F S A Q S S M R - - - - - P S A R S L W A K Q P F E Q L F G M S S A E L S K -1004 I Tobacco - A S S D H G T V Q S - - S S T Q E S T S T V D L E A K L L Q S F R S C I V K L L K L E G S E W L F R Q D D G A D E D L I-1088 Nsylvestris - A S S D H G T V Q S - - S S T Q E S T S T V D L E A K L L Q S F R S C I V K L L K L E G S E W L F R Q D D G A D E D L I-1087 Petunia - S - - D H G T V Q S - - S S T Q E S T S L V D L E A K L L Q S F R S C I V K L L K L E G S E W L F R Q D D G A D E D L I-1077 Tomato - S G - D H G T V L S - - S S A Q E S T S T V D L E A K L L Q S F R S C I V K L L K L E G S E W L F R Q D D G A D E D L I-1081 Poplar - V G S G L G N R S N - - S I N R E V I S P V D P E A Q L L Q S F R R C I V K L L K L E G S D W L F R Q N D G A D E D L I-1067 Medicago - A M E G A G S R P N - - A I V Q E I T - F E D I E G K L L Q S V R L T I M K L L K L E G S D W L F K Q N D G I D E D L I-1079 Arabidopsis - V G E E L R N R S N P I N I D N N A S S N V D A E A K L L Q S F R H C I L K L I K L E G S E W L F G Q S D G V D E E L I-1088 Rice - S E F N P A G R S G - - G M T K D D F S Y K E S E A K L L Q S L R F C I S K L L K L E G S G W L F K Q N G G S D E D L I-1086 Maize - G D F N L P G R S G - - G V A K D D F S Y K E S E T K L L Q S L R L C I M K L L K L E G S G W L F K Q N G G C D E D L I-1062 I Tobacco - D R I A A R E K F L Y E A E T R E I S R L T N I G E S - H F S S N R K P G S G S A P K P E E M D Y T K F L V M S V P H C-1147 Nsylvestris - D R I A A R E K F L Y E A E T R E I S R L T N I G E S - H F S S N R K P G S G S A P K P E E M D Y T K F L V M S V P H C-1146 Petunia - D R I A A R E K F L Y E A E T R E I S R L T N I G E S - Q F S S N R K P G S - - A Q K P E E M D Y T K F L V M S V P H C-1134

Tomato - G R I A A R E K F L Y E A E T R E I S R L T N I G E S - H F S S N R K P G S - - A P K P E E M D Y T K F L V M S V P H C-1138 Poplar - D R V A A R E R Y L Y E A E T R E M N C V A N M G E S P Y L Y S D R K S G S - - V L R N D D A A I T N I M V S S V P N C-1125 Medicago - D R V A A R D K F V Y E I E A R E T N Q G I H M G D T R Y F P S D R K S V S - - S M K V N E A N A S S L S V S S V P N C-1137 Arabidopsis - D R V A A R E K F I Y E A E A R E I N Q V G H M G E P ------L I S S V P N C-1123 Rice - D Q V A A V E K L L Q Q G T S - D N Q L L L G - - D T Q Q P P C D K A D I Q ------Y M R V L P N C-1129 Maize - D R V A A A E K L L M Q G T A - E N Q L L L H G G D L Q Q H S S D Q A G I Q ------Y M R T L P N C-1107 I Tobacco - G E G C V W K V D L I V S F G V W C I H R I L E L S L M E S R P E L W G K Y T Y V L N R L Q G I I D L A F S K S R S P T -1207 Nsylvestris - G E G C V W K V D L I V S F G V W C I H R I L E L S L M E S R P E L W G K Y T Y V L N R L Q G I I D L A F S K S R S P T -1206 Petunia - G E G C V W K V D L V V S F G V W C I H R I L E L S L M E S R P E L W G K Y T Y C L N R L Q G I V D L A F S K P R S P T -1194 Tomato - G E G C V W K V D L I I S F G V W C I H R I L E L S L M E S R P E L W G K Y T Y V L N R L Q G I V D L A F S K P H S P T -1198 Poplar - G E G C V W R V D L I I S F G V W C I H R I L D L S L M E S R P E L W G K Y T Y V L N R L Q G I I E L A F S K P R S P M -1185 Medicago - G E G C V W R A D L I I S F G V W C I H R I L D L S L L E S R P E L W G K Y T Y V L N R L Q G I I E P A F S K P R T P S -1197 Arabidopsis - G D G C V W R A D L I V S F G V W C I H R V L D L S L M E S R P E L W G K Y T Y V L N R L Q G V I D P A F S K L R T P M -1183 Rice - G D D C I W R A S L V V S F G V W C I R R V L D L S L V E S R P E L W G K Y T Y V L N R L Q G I L D P A F S K P R S A L -1189 Maize - G E D C V W R A S L V V S F G V W C V R R V L D M S L V E S R P E L W G K Y T Y V L N R L Q G I L D P A F S K P R G A L -1167 I Tobacco - S H C F C L Q I P I G R Q Q K S S P P P I S N G S L P P Q A K Q G R G K C T T A P M L L D M I K D V E M A I S C R K G R-1267 Nsylvestris - S H C F C L Q I P I G R Q Q K S S P P P I S N G S L P P Q A K Q G R G K C T T A P M L L D M I K D V E M A I S C R K G R-1266 Petunia - S H C F C L Q I P I G R Q Q K S S P T P I S N G S L P P Q A K Q G R G K C T T A P M L L D M I K D V E M A I S C R K G R-1254 Tomato - S H C F C L Q I P A G R Q Q K A S P P P I S N G N L P P Q A K Q G R G K C T T A A M L L E M I K D V E T A I S C R K G R-1258 Poplar - S P C F C L Q I P A S H Q H R S S P P - V S N G M L P P A S K P G R G K C T T A A T L L D L I K D V E I A I S C R K G R-1244 Medicago - A P C F C I Q V P T T H Q Q K S S P P - L S N G M L P P T V K P G R G K Y T T A S S L L E L I K D V E I A I S S R K G R-1256 Arabidopsis - T P C F C L Q I P A S H Q R - A S P T - S A N G M L P P A A K P A K G K C T T A V T L L D L I K D V E M A I S C R K G R-1241 Rice - S A C A C L H R - - D I R V L N S L R H S S L V A T N S I P R Q I R G S F T T A S V V L E M I K D V E T A V S G R K G R-1247 Maize - T I C T C L Q K - - D T R V R N S P P H S G L T A M G P V P T P I R G A F T T A G V V L E M I K D V E A A V S G R K G R-1225 I Tobacco - T G T A A G D V A F P K G K E N L A S V L K R Y K R R L S N K P V G N Q E - A G G A G P R K V M S - P S A A P F S L - - -1323 Nsylvestris - T G T A A G D V A F P K G K E N L A S V L K R Y K R R L S N K P V G N Q E - A G G A G P R K V M S - P S A A P F S L - - -1322 Petunia - T G T A A G D V A F P K G K E N L A S V L K R Y K R R L S N K P V G N Q E - A G G G P Q R K V T S - P S S T S F G L - - -1310 Tomato - T G T A A G D V A F P K G K E N L A S V L K R Y K R R L S N K P V G N Q E V A G V A G P R K V T L S A S S P P F V L - - -1316 Poplar - S G T A A G D V A F P K G K E N L A S V L K R Y K R R L S S - K G I A T L - - K G G E R R K - V V E P S S L S V G I L A -1300 Medicago - T G T A A G E V A F P K G K E N L A S V L K R Y K R R L S S N K L V G N Q - - E G T S S R K - I P S S G P Y N Q - - - - -1309 Arabidopsis - T G T A A G D V A F P K G K E N L A S V L K R Y K R R L S N K P V G M N Q - - D G P G S R K N V T A Y G S L G ------1294 Rice - S G T A A G D V A F P K G K E N L A S V L K R Y K R R L S S K G Q Q ------1281 Maize - S G T A A G D V A F P K G K E N L A S V L K R Y K R R L A S K G Q ------1258 I Tobacco ------1323 Nsylvestris ------1322 Petunia ------1310 Tomato ------1316 Poplar - V G C Q S P C V L F -1310 Medicago ------1309 Arabidopsis ------1294 Rice ------1281 Maize ------1258 I

Supplemental Figure S4. (a) Sequence of tobacco tasiRNA3D7 (Ntabtas3D7). (b) Putative target site of Ntabtas3D7 in NtabARF2 (NCBI accession DQ340258).

References Abeles, F. B., Morgan, P.W., Saltveit, M.E. Jr. (1992). Ethylene in Plant Biology. San Diego, CA, USA: Academic Press, Inc. AbuQamar, S., M. F. Chai, et al. (2008). "Tomato protein kinase 1b mediates signaling of plant responses to necrotrophic fungi and insect herbivory." Plant Cell 20(7): 1964-1983. Achard, P., M. Baghour, et al. (2007). "The plant stress hormone ethylene controls floral transition via DELLA-dependent regulation ot floral meristem-identity genes." Proceedings of the National Academy of Sciences of the United States of America 104(15): 6484-6489. Adams, K. L. and J. F. Wendel (2005). "Novel patterns of gene expression in polyploid plants." Trends in Genetics 21(10): 539-543. Adams, K. L. and J. F. Wendel (2005). "Polyploidy and genome evolution in plants." Current Opinion in Plant Biology 8(2): 135-141. Adie, B., J. M. Chico, et al. (2007). "Modulation of plant defenses by ethylene." Journal of Plant Growth Regulation 26(2): 160-177. Alexander, L. and D. Grierson (2002). "Ethylene biosynthesis and action in tomato: a model for climacteric fruit ripening." Journal of Experimental Botany 53(377): 2039-2055. Alonso, J. M., T. Hirayama, et al. (1999). "EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis." Science 284(5423): 2148-52. Amagai, A., S. S. Soramoto, et al. (2007). "Ethylene induces zygote formation through an enhanced expression of zyg1 in Dictyostelium mucoroides." Experimental Cell Research 313(11): 2493-2503. Argueso, C. T., M. Hansen, et al. (2007). "Regulation of ethylene biosynthesis." Journal of Plant Growth Regulation 26(2): 92-105. Baldwin, I. T. (1988). "Short-Term Damage-Induced Increases in Tobacco Alkaloids Protect Plants." Oecologia 75(3): 367-370. Baldwin, I. T. (1998). "Jasmonate-induced responses are costly but benefit plants under attack in native populations." Proceedings of the National Academy of Sciences of the United States of America 95(14): 8113-8118. Baldwin, I. T. and T. E. Ohnmeiss (1993). "Alkaloidal Responses to Damage in Nicotiana Native to North-America." Journal of Chemical Ecology 19(6): 1143- 1153. Baldwin, I. T., E. A. Schmelz, et al. (1994). "Wound-Induced Changes in Root and Shoot Jasmonic Acid Pools Correlate with Induced Nicotine Synthesis in Nicotiana- Sylvestris Spegazzini and Comes." Journal of Chemical Ecology 20(8): 2139- 2157.

Baldwin, I. T., E. A. Schmelz, et al. (1996). "Effects of octadecanoid metabolites and inhibitors on induced nicotine accumulation in Nicotiana sylvestris." Journal of Chemical Ecology 22(1): 61-74. Baldwin, I. T., M. J. Karb, et al. (1994). "Allocation of N-15 from Nitrate to Nicotine - Production and Turnover of a Damage-Induced Mobile Defense." Ecology 75(6): 1703-1713. Barry, C. S., M. I. Llop-Tous, et al. (2000). "The regulation of 1-aminocyclopropane-1- carboxylic acid synthase gene expression during the transition from system-1 to system-2 ethylene synthesis in tomato." Plant Physiology 123(3): 979-986. Bartley, G. E. and B. K. Ishida (2007). "Ethylene-sensitive and insensitive regulation of transcription factor expression during in vitro tomato sepal ripening." Journal of Experimental Botany 58(8): 2043-2051. Bauer, W. and M. H. Zenk (1989). "Formation of Both Methylenedioxy Groups in the Alkaloid (S)-Stylopine Is Catalyzed by Cytochrome-P-450 Enzymes." Tetrahedron Letters 30(39): 5257-5260. Bauer, W. and M. H. Zenk (1991). "2 Methylenedioxy Bridge Forming Cytochrome-P- 450 Dependent Enzymes Are Involved in (S)-Stylopine Biosynthesis." Phytochemistry 30(9): 2953-2961. Becker, W. and K. Apel (1993). "Differences in Gene-Expression between Natural and Artificially Induced Leaf Senescence." Planta 189(1): 74-79. Benowitz, N. L. (1996). "Pharmacology of nicotine: addiction and therapeutics." Annu Rev Pharmacol Toxicol 36: 597-613. Berrocal-Lobo, M. and A. Molina (2004). "Ethylene response factor 1 mediates Arabidopsis resistance to the soilborne fungus Fusarium oxysporum." Molecular Plant-Microbe Interactions 17(7): 763-770. Berrocal-Lobo, M., A. Molina, et al. (2002). "Constitutive expression of ETHYLENE- RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi." Plant Journal 29(1): 23-32. Beyene, G., C. H. Foyer, et al. (2006). "Two new cysteine proteinases with specific expression patterns in mature and senescent tobacco (Nicotiana tabacum L.) leaves." Journal of Experimental Botany 57(6): 1431-1443. Binder, B. M., J. M. Walker, et al. (2007). "The Arabidopsis EIN3 binding F-box proteins EBF1 and EBF2 have distinct but overlapping roles in ethylene signaling." Plant Cell 19(2): 509-523. Bisson, M. M. A., A. Bleckmann, et al. (2009). "EIN2, the central regulator of ethylene signalling, is localized at the ER membrane where it interacts with the ethylene receptor ETR1." Biochemical Journal 424: 1-6. Bleecker, A. B. and H. Kende (2000). "Ethylene: a gaseous signal molecule in plants." Annu Rev Cell Dev Biol 16: 1-18.

Bleecker, A. B. and S. E. Patterson (1997). "Last exit: Senescence, abscission, and meristem arrest in Arabidopsis." Plant Cell 9(7): 1169-1179. Bleecker, A. B., M. A. Estelle, et al. (1988). "Insensitivity to Ethylene Conferred by a Dominant Mutation in Arabidopsis-Thaliana." Science 241(4869): 1086-1089. Bodenhausen, N. and P. Reymond (2007). "Signaling pathways controlling induced resistance to insect herbivores in Arabidopsis." Molecular Plant-Microbe Interactions 20(11): 1406-1420. Bogani, P., P. Lio, et al. (1997). "A physiological and molecular analysis of the genus Nicotiana." Molecular Phylogenetics and Evolution 7(1): 62-70. Boller, T., R. C. Herner, et al. (1979). "Assay for and Enzymatic Formation of an Ethylene Precursor, 1-Aminocyclopropane-1-Carboxylic Acid." Planta 145(3): 293-303. Bolwell, G. P., K. Bozak, et al. (1994). "Plant cytochrome P450." Phytochemistry 37(6): 1491-506. Bose, B. C., H.N. De et al. (1956). "Biogenesis of alkaloids in tobacco plants. II. Transmethylation of nicotine and nornicotine in Nicotiana tabacum and Nicotiana glauca." Indian Journal of Medical Research 44: 91-97. Bovy, A. G., G. C. Angenent, et al. (1999). "Heterologous expression of the Arabidopsis etr1-1 allele inhibits the senescence of carnation flowers." Molecular Breeding 5(4): 301-308. Brailsford, R. W., L. A. C. J. Voesenek, et al. (1993). "Enhanced Ethylene Production by Primary Roots of Zea-Mays L in Response to Sub-Ambient Partial Pressures of Oxygen." Plant Cell and Environment 16(9): 1071-1080. Brogan, A. P., T. J. Dickerson, et al. (2005). "Altered retinoid homeostasis catalyzed by a nicotine metabolite: Implications in macular degenerationand and normal development." Proceedings of the National Academy of Sciences of the United States of America 102(30): 10433-10438. Broglie, K. E., P. Biddle, et al. (1989). "Functional-Analysis of DNA-Sequences Responsible for Ethylene Regulation of a Bean Chitinase Gene in Transgenic Tobacco." Plant Cell 1(6): 599-607. Buchananwollaston, V. (1994). "Isolation of Cdna Clones for Genes That Are Expressed during Leaf Senescence in Brassica-Napus - Identification of a Gene Encoding a Senescence-Specific Metallothionein-Like Protein." Plant Physiology 105(3): 839-846. BuchananWollaston, V. (1997). "The molecular biology of leaf senescence." Journal of Experimental Botany 48(307): 181-199. Buchanan-Wollaston, V., T. Page, et al. (2005). "Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis." Plant Journal 42(4): 567-585.

Buer, C. S., P. Sukumar, et al. (2006). "Ethylene modulates flavonoid accumulation and gravitropic responses in roots of Arabidopsis." Plant Physiol 140(4): 1384-1396. Burk, L. G. and R. N. Jeffrey. (1958). "A study of the inheritance of alkaloid quality in tobacco." Tobacco Science 2: 139-141. Bush, L. P., M. Cui., H.Shi., H.R. Burton., F.F.Fannin., L. Lei., N. Dye (2001). "Formation of tobacco specific nitrosamines in air-cured tobacco." Recent Advances in Tobacco Sciences 27: 23-46. Butt, A., C. Mousley, et al. (1998). "Differential expression of a senescence-enhanced metallothionein gene in Arabidopsis in response to isolates of Peronospora parasitica and Pseudomonas syringae." Plant Journal 16(2): 209-221. Cancel, J. D. and P. B. Larsen (2002). "Loss-of-function mutations in the ethylene receptor ETR1 cause enhanced sensitivity and exaggerated response to ethylene in Arabidopsis." Plant Physiology 129(4): 1557-1567. Chae, H. S., F. Faure, et al. (2003). "The eto1, eto2, and eto3 mutations and cytokinin treatment increase ethylene biosynthesis in Arabidopsis by increasing the stability of ACS protein." Plant Cell 15(2): 545-559. Chakrabarti, M., K. M. Meekins, et al. (2007). "Inactivation of the cytochrome P450 gene CYP82E2 by degenerative mutations was a key event in the evolution of the alkaloid profile of modern tobacco." New Phytologist 175(3): 565-574. Chakrabarti, M., S. W. Bowen, et al. (2008). "CYP82E4-mediated nicotine to nornicotine conversion in tobacco is regulated by a senescence-specific signaling pathway." Plant Molecular Biology 66(4): 415-427. Chang, C., S. F. Kwok, et al. (1993). "Arabidopsis Ethylene-Response Gene Etr1 - Similarity of Product to 2-Component Regulators." Science 262(5133): 539-544. Chao, Q. M., M. Rothenberg, et al. (1997). "Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins." Cell 89(7): 1133-1144. Chapin, L. J. and M. L. Jones (2009). "Ethylene regulates phosphorus remobilization and expression of a phosphate transporter (PhPT1) during petunia corolla senescence." Journal of Experimental Botany 60(7): 2179-2190. Chapple, C. (1998). "Molecular-Genetic Analysis of Plant Cytochrome P450-Dependent Monooxygenases." Annu Rev Plant Physiol Plant Mol Biol 49: 311-343. Chelvarajan, R. L., F. F. Fannin, et al. (1993). "Study of Nicotine Demethylation in Nicotiana-Otophora." Journal of Agricultural and Food Chemistry 41(6): 858- 862. Chen, N., P. H. Goodwin, et al. (2003). "The role of ethylene during the infection of Nicotiana tabacum by Colletotrichum destructivum." Journal of Experimental Botany 54(392): 2449-2456.

Chen, Q. G. and A. B. Bleecker (1995). "Analysis of ethylene signal-transduction kinetics associated with seedling-growth response and chitinase induction in wild- type and mutant arabidopsis." Plant Physiol 108(2): 597-607. Chen, Q. G. and A. B. Bleecker (1995). "Analysis of ethylene signal-transduction kinetics associated with seedling-growth response and chitinase induction in wild- type and mutant arabidopsis." Plant Physiol 108(2): 597-607. Chen, S. and D. J. Zhou (1992). "Functional Domains of Aromatase Cytochrome-P450 Inferred from Comparative Analyses of Amino-Acid-Sequences and Substantiated by Site-Directed Mutagenesis Experiments." Journal of Biological Chemistry 267(31): 22587-22594. Chernikova, T., J. M. Robinson, et al. (2000). "Ozone tolerance and antioxidant enzyme activity in soybean cultivars." Photosynthesis Research 64(1): 15-26. Clark, D. G., E. K. Gubrium, et al. (1999). "Root formation in ethylene-insensitive plants." Plant Physiology 121(1): 53-59. Collu, G., N. Unver, et al. (2001). "Geraniol 10-hydroxylase, a cytochrome P450 enzyme involved in terpenoid indole alkaloid biosynthesis." Febs Letters 508(2): 215-220. Contin, A., R. van der Heijden, et al. (1999). "Effects of alkaloid precursor feeding and elicitation on the accumulation of secologanin in a Catharanthus roseus cell suspension culture." Plant Cell Tissue and Organ Culture 56(2): 111-119. Dawson, R. F. (1942). "Accumulation of nicotine in reciprocal grafts of tomato and tobacco." American Journal of Botany 29(1): 66-71. Dawson, R. F. (1945). "An Experimental Analysis of Alkaloid Production in Nicotiana - the Origin of Nornicotine." American Journal of Botany 32(7): 416-423. Dawson, R. F. (1945). "On the Biogenesis of Nornicotine and Anabasine." Journal of the American Chemical Society 67(3): 503-504. Dawson, R. F. (1951). "Alkaloid Biogenesis .3. Specificity of the Nicotine Nornicotine Conversion." Journal of the American Chemical Society 73(9): 4218-4221. De Martinis, D., G. Cotti, et al. (2002). "Ethylene response to pollen tube growth in Nicotiana tabacum flowers." Planta 214(5): 806-812. De Paepe, A., M. Vuylsteke, et al. (2004). "Transcriptional profiling by cDNA-AFLP and microarray analysis reveals novel insights into the early response to ethylene in Arabidopsis." Plant J 39(4): 537-59. Dickerson, T. J. and K. D. Janda (2002). "A previously undescribed chemical link between smoking and metabolic disease." Proceedings of the National Academy of Sciences of the United States of America 99(23): 15084-15088. Donaldson, R. P. and D. G. Luster (1991). "Multiple Forms of Plant Cytochromes-P- 450." Plant Physiology 96(3): 669-674. Egri, L. (1957). "Untersuchung uiber die Alkaloide einiger Tabaksorten mit besonderer Beriucksichtigung der Erforschung der Biosynthese von Nornikotin." Fachl. Mitt. osterr. Tabakreg: 19-24.

Ellis, C. M., P. Nagpal, et al. (2005). "AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana." Development 132(20): 4563-4574. Esquerretugaye, M. T., C. Lafitte, et al. (1979). "Cell-Surfaces in Plant-Microorganism Interactions .2. Evidence for the Accumulation of Hydroxyproline-Rich Glycoproteins in the Cell-Wall of Diseased Plants as a Defense-Mechanism." Plant Physiology 64(2): 320-326. Eulgem, T., P. J. Rushton, et al. (2000). "The WRKY superfamily of plant transcription factors." Trends in Plant Science 5(5): 199-206. Fannin, F. F. and L. P. Bush. (1992). "Nicotine demethylation in Nicotiana " Medical Science Research 20: 867-868. Fitting, H. (1911). "Untersuchungen Qber die vorzeitige Entbiatterung von Bltlten." Jahrbiicher fur wissenschaftliche Botanik4 49: 187-263. Flores, H. E., C.M. Protacio et al. (1991). "Primary and secondary metabolism of polyamines in plants." Receent Advances in Phytochemistry 23: 329-393. Fonne-Pfister, R., A. Simon et al. (1988). "Multiple forms of plant cytochrome-P450." Plant Science 55: 9-20. Friesen, J. B. and E. Leete (1990). "Biosynthesis of the Tobacco Alkaloids and Related- Compounds .52. Nicotine Synthase - an Enzyme from Nicotiana Species Which Catalyzes the Formation of (S)-Nicotine from Nicotinic-Acid and 1-Methyl- Delta'-Pyrrolinium Chloride." Tetrahedron Letters 31(44): 6295-6298. Fujita, H. and K. Syono (1996). "Genetic analysis of the effects of polar auxin transport inhibitors on root growth in Arabidopsis thaliana." Plant and Cell Physiology 37(8): 1094-1101. Fukuda, H. (2000). "Programmed cell death of tracheary elements as a paradigm in plants." Plant Molecular Biology 44(3): 245-253. Furutani, S. C., Johnston, E., Nagao, M (1989). "Anthesis and abscission of blue jade vine flowers treated with ethephon and AOA." HortScience 24: 1042. Gagne, J. M., J. Smalle, et al. (2004). "Arabidopsis EIN3-binding F-box 1 and 2 form ubiquitin-protein ligases that repress ethylene action and promote growth by directing EIN3 degradation." Proceedings of the National Academy of Sciences of the United States of America 101(17): 6803-6808. Gan, S. and R. M. Amasino (1995). "Inhibition of leaf senescence by autoregulated production of cytokinin." Science 270(5244): 1986-8. Gan, S. and R. M. Amasino (1997). "Making Sense of Senescence (Molecular Genetic Regulation and Manipulation of Leaf Senescence)." Plant Physiol 113(2): 313- 319. Gao, Z. Y., Y. F. Chen, et al. (2003). "Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of Arabidopsis through participation in ethylene receptor signaling complexes." Journal of Biological Chemistry 278(36): 34725-34732.

100

Gavilano, L. B. and B. Siminszky (2007). "Isolation and characterization of the cytochrome P450 gene CYP82E5v2 that mediates nicotine to nornicotine conversion in the green leaves of tobacco." Plant and Cell Physiology 48(11): 1567-1574. Gavilano, L. B., N. P. Coleman, et al. (2006). "Genetic engineering of Nicotiana tabacum for reduced nornicotine content." Journal of Agricultural and Food Chemistry 54(24): 9071-9078. Gavilano, L. B., N. P. Coleman, et al. (2007). "Functional analysis of nicotine demethylase genes reveals insights into the evolution of modern tobacco." Journal of Biological Chemistry 282(1): 249-256. Gerardy, R. and M. H. Zenk (1993). "Formation of Salutaridine from (R)-Reticuline by a Membrane-Bound Cytochrome-P-450 Enzyme from Papaver-Somniferum." Phytochemistry 32(1): 79-86. Gerstel, D. U. (1961). " Essay on the origin of tobacco " Tobacco Science 5: 15-17. Ghosh, B. (2000). " Polyamines and plant alkaloids." Indian Journal of Experimental Biology 38: 1086-1091. Gietz, D., A. Stjean, et al. (1992). "Improved Method for High-Efficiency Transformation of Intact Yeast-Cells." Nucleic Acids Research 20(6): 1425-1425. Giovannoni, J. (2001). "Molecular biology of fruit maturation and ripening." Annual Review of Plant Physiology and Plant Molecular Biology 52: 725-749. Goodspeed, T. H. (1954). “The genus Nicotiana.” Waltham, Ma, USA: Chronica Botanica Company. Goossens, A., S. T. Hakkinen, et al. (2003). "A functional genomics approach toward the understanding of secondary metabolism in plant cells." Proc Natl Acad Sci U S A 100(14): 8595-600. Grbic, V. and A. B. Bleecker (1995). "Ethylene Regulates the Timing of Leaf Senescence in Arabidopsis." Plant Journal 8(4): 595-602. Grbic, V. and A. B. Bleecker (1995). "Ethylene Regulates the Timing of Leaf Senescence in Arabidopsis." Plant Journal 8(4): 595-602. Griffith, G. D., T. Griffith, et al. (1960). "Nicotinic acid as a metabolite of nicotine in Nicotiana rustica." J Biol Chem 235: 3536-8. Griffith, R. B., W. D. Valleau, et al. (1955). "Determination and Inheritance of Nicotine to Nornicotine Conversion in Tobacco." Science 121(3140): 343-344. Grosskopf, D. G., G. Felix, et al. (1990). "K-252a Inhibits the Response of Tomato Cells to Fungal Elicitors Invivo and Their Microsomal Protein-Kinase Invitro." Febs Letters 275(1-2): 177-180. Guo, H. and J. R. Ecker (2003). "Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EIN3 transcription factor." Cell 115(6): 667-77.

101

Guo, H. W. and J. R. Ecker (2004). "The ethylene signaling pathway: new insights." Current Opinion in Plant Biology 7(1): 40-49. Guzman, P. and J. R. Ecker (1990). "Exploiting the triple response of Arabidopsis to identify ethylene-related mutants." Plant Cell 2(6): 513-23. Hakkinen, S. T. and K. M. Oksman-Caldentey (2004). " Regulation of secondary metabolism in tobacco". Biotechnology in Agriculture and Forestry. T. Nagata, S. Hasezawa., D. Inze. Berlin, Heidelberg., Springer-Verlag. 53: 231-249. Halitschke, R. and I. T. Baldwin (2003). "Antisense LOX expression increases herbivore performance by decreasing defense responses and inhibiting growth-related transcriptional reorganization in Nicotiana attenuata." Plant Journal 36(6): 794- 807. Hannemann, F., A. Bichet, et al. (2007). "Cytochrome P450 systems - biological variations of electron transport chains." Biochimica Et Biophysica Acta-General Subjects 1770(3): 330-344. Harfouche, A. L., R. Shivaji, et al. (2006). "Ethylene signaling mediates a maize defense response to insect herbivory." Molecular Plant-Microbe Interactions 19(2): 189- 199. Hasemann, C. A., R. G. Kurumbail, et al. (1995). "Structure and Function of Cytochromes-P450 - a Comparative-Analysis of 3 Crystal-Structures." Structure 3(1): 41-62. Hashimoto, T. and Y. Yamada (1994). "Alkaloid biogenesis-molecular aspects." Annual Review of Plant Physiology 45: 257-285. Hatae, T., S. Hara, et al. (1996). "Site-directed mutagenesis of human prostacyclin synthase: Alteration of Cys(441) of the Cys-pocket, and Glu(347)and Arg(350) of the EXXR motif." Febs Letters 389(3): 268-272. He, X. J., R. L. Mu, et al. (2005). "AtNAC2, a transcription factor downstream of ethylene and auxin signaling pathways, is involved in salt stress response and lateral root development." Plant J 44(6): 903-916. Hecht, S. S. (1998). "Biochemistry, biology, and carcinogenicity of tobacco-specific N- nitrosamines." Chem Res Toxicol 11(6): 559-603. Hecht, S. S. (2006). "Cigarette smoking: cancer risks, carcinogens, and mechanisms." Langenbecks Archives of Surgery 391(6): 603-613. Hecht, S. S. and D. Hoffmann (1988). "Tobacco-specific nitrosamines, an important group of carcinogens in tobacco and tobacco smoke." Carcinogenesis 9(6): 875- 84. Hegg, E. L. and L. Que, Jr. (1997). "The 2-His-1-carboxylate facial triad--an emerging structural motif in mononuclear non-heme iron(II) enzymes." Eur J Biochem 250(3): 625-629. Heim, W. G., K. A. Sykes, et al. (2007). "Cloning and characterization of a Nicotiana tabacum methylputrescine oxidase transcript." Phytochemistry 68(4): 454-63.

102

Higo, K., Y. Ugawa, et al. (1999). "Plant cis-acting regulatory DNA elements (PLACE) database: 1999." Nucleic Acids Research 27(1): 297-300. Hirayama, T., J. J. Kieber, et al. (1999). "Responsive-to-antagonist1, a Menkes/Wilson disease-related copper transporter, is required for ethylene signaling in Arabidopsis." Cell 97(3): 383-393. Hoeberichts, F. A., W. G. van Doorn, et al. (2007). "Sucrose prevents up-regulation of senescence-associated genes in carnation petals." Journal of Experimental Botany 58(11): 2873-2885. Hoffmann, D., K. D. Brunnemann, et al. (1994). "Tobacco-specific N-nitrosamines and Areca-derived N-nitrosamines: chemistry, biochemistry, carcinogenicity, and relevance to humans." J Toxicol Environ Health 41(1): 1-52. Horsch, R. B., J. E. Fry, et al. (1985). "A Simple and General-Method for Transferring Genes into Plants." Science 227(4691): 1229-1231. Hoyer, L. (1985). "Bud and flower drop in Begonia elatior 'Sirene' caused by ethylene and darkness." Ada Horticulturae 167: 387-391. Hua, J. and E. M. Meyerowitz (1998). "Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana." Cell 94(2): 261-271. Hua, J., C. Chang, et al. (1995). "Ethylene Insensitivity Conferred by Arabidopsis Ers Gene." Science 269(5231): 1712-1714. Hua, J., H. Sakai, et al. (1998). "EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis." Plant Cell 10(8): 1321-1332. Hunter, D. A., B. C. Steele, et al. (2002). "Identification of genes associated with perianth senescence in Daffodil (Narcissus pseudonarcissus L. 'Dutch Master')." Plant Science 163(1): 13-21. Hunter, D. A., M. F. Yi, et al. (2004). "Role of ethylene in perianth senescence of daffodil (Narcissus pseudonarcissus L. 'Dutch Master')." Postharvest Biology and Technology 32(3): 269-280. IARC (2004a). "Tobacco smoke and involuntary smoking". IARC monographs on the evaluation of carcinogenic risks to humans, IARC, Lyon, FR. 83: 53–119. IARC (2004b). "Tobacco smoke and involuntary smoking". IARC monographs on the evaluation of carcinogenic risks to humans, IARC, Lyon, FR. 83: 1179–1187. Il’in, G. S., K.B .Serebrovskaya. (1958). "Demethylation of nicotine & absorption of oxygen by tobacco plants." Doklady Akad. Nauk S.S.S.R 118: 139-141. Imanishi, S., K. Hashizume, et al. (1998). "Differential induction by methyl jasmonate of genes encoding ornithine decarboxylase and other enzymes involved in nicotine biosynthesis in tobacco cell cultures." Plant Mol Biol 38(6): 1101-11. Iordachescu, M. and S. Verlinden (2005). "Transcriptional regulation of three EIN3-like genes of carnation (Dianthus caryophyllus L. cv. Improved White Sim) during flower development and upon wounding, pollination, and ethylene exposure." Journal of Experimental Botany 56(418): 2011-2018.

103

Irmler, S., G. Schroder, et al. (2000). "Indole alkaloid biosynthesis in Catharanthus roseus: new enzyme activities and identification of cytochrome P450 CYP72A1 as secologanin synthase." Plant Journal 24(6): 797-804. Iwahori, S., J. M. Lyons, et al. (1970). "Sex Expression in Cucumber Plants as Affected by 2-Chloroethylphosphonic Acid, Ethylene, and Growth Regulators." Plant Physiology 46(3): 412-415. Jiao, X. Z., S. Philosophhadas, et al. (1986). "The Conversion of 1- (Malonylamino)Cyclopropane-1-Carboxylic Acid to 1-Aminocyclopropane-1- Carboxylic Acid in Plant-Tissues." Plant Physiology 81(2): 637-641. Jiao, X. Z., W. K. Yip, et al. (1987). "The Effect of Light and Phytochrome on 1- Aminocyclopropane-1-Carboxylic Acid Metabolism in Etiolated Wheat Seedling Leaves." Plant Physiology 85(3): 643-647. Jing, H. C., J. H. M. Schippers, et al. (2005). "Ethylene-induced leaf senescence depends on age-related changes and OLD genes in Arabidopsis." Journal of Experimental Botany 56(421): 2915-2923. Jing, H. C., M. J. G. Sturre, et al. (2002). "Arabidopsis onset of leaf death mutants identify a regulatory pathway controlling leaf senescence." Plant Journal 32(1): 51-63. Jones, M. L. and W. R. Woodson (1999). "Differential expression of three members of the 1-aminocyclopropane-1-carboxylate synthase gene family in carnation." Plant Physiology 119(2): 755-764. Jun, S. H., M. J. Han, et al. (2004). "OsEIN2 is a positive component in ethylene signaling in rice." Plant Cell Physiol 45(3): 281-9. Justin, S. H. F. W. and W. Armstrong (1987). "The Anatomical Characteristics of Roots and Plant-Response to Soil Flooding." New Phytologist 106(3): 465-495. Katano, N., H. Yamamoto, et al. (2001). "7-deoxyloganin 7-hydroxylase in Lonicera japonica cell cultures." Phytochemistry 58(1): 53-58. Kende, H. (1993). "Ethylene Biosynthesis." Annual Review of Plant Physiology and Plant Molecular Biology 44: 283-307. Kieber, J. J. (1997). "The ethylene response pathway in arabidopsis." Annual Review of Plant Physiology and Plant Molecular Biology 48: 277-296. Kieber, J. J., M. Rothenberg, et al. (1993). "Ctr1, a Negative Regulator of the Ethylene Response Pathway in Arabidopsis, Encodes a Member of the Raf Family of Protein-Kinases." Cell 72(3): 427-441. Kim, G. T. and H. Tsukaya (2002). "Regulation of the biosynthesis of plant hormones by cytochrome P450s." Journal of Plant Research 115(1119): 169-177. Kim, J. H., H. R. Woo, et al. (2009). "Trifurcate Feed-Forward Regulation of Age- Dependent Cell Death Involving miR164 in Arabidopsis." Science 323(5917): 1053-1057. Kimura, Y., Y. Tosa, et al. (2001). "OARE-1, a Ty1-copia retrotransposon in oat activated by abiotic and biotic stresses." Plant Cell Physiol 42(12): 1345-54. 104

Knoester, M., L. C. van Loon, et al. (1998). "Ethylene-insensitive tobacco lacks nonhost resistance against soil-borne fungi." Proceedings of the National Academy of Sciences of the United States of America 95(4): 1933-1937. Koltunow, A. M., J. Truettner, et al. (1990). "Different Temporal and Spatial Gene- Expression Patterns Occur during Anther Development." Plant Cell 2(12): 1201- 1224. Kosugi, Y., K. Waki, et al. (2002). "Senescence and gene expression of transgenic non- ethylene-producing carnation flowers." Journal of the Japanese Society for Horticultural Science 71(5): 638-642. Kutchan, T. M. and H. Dittrich (1995). "Characterization and mechanism of the berberine bridge enzyme, a covalently flavinylated oxidase of benzophenanthridine alkaloid biosynthesis in plants." J Biol Chem 270(41): 24475-81. Langston, B. J., S. Bai, et al. (2005). "Increases in DNA fragmentation and induction of a senescence-specific nuclease are delayed during corolla senescence in ethylene- insensitive (etr1-1) transgenic petunias." Journal of Experimental Botany 56(409): 15-23. Latchman, D. S. (1998). Eukaryotic transcription factors. San Diego, Academic Press. Leete, E. (1980). “Alkaloids derived from ornithine, lysine and nicotinic acidZ". Encyclopedia of plant physiology, new series, secondary plant products. E. A. Bell, B.V. Charlwood., Springer, Berlin heidelberg, New York. 8: 65-91. Leete, E. and M. R. Chedekel (1974). "Metabolism of Nicotine in Nicotiana-Glauca." Phytochemistry 13(9): 1853-1859. Leete, E. and S. A. Slattery (1976). "Incorporation of [2-C-14]Nicotine Acid and [6-C- 14]Nicotinic Acid into Tobacco Alkaloids - Biosynthesis of Anatabine and Alpha,Beta-Dipyridyl." Journal of the American Chemical Society 98(20): 6326- 6330. Lewis, R. S., A. M. Jack, et al. (2008). "RNA interference (RNAi)-induced suppression of nicotine demethylase activity reduces levels of a key carcinogen in cured tobacco leaves." Plant Biotechnol J 6(4): 346-54. Liang, X., S. Abel, et al. (1992). "The 1-aminocyclopropane-1-carboxylate synthase gene family of Arabidopsis thaliana." Proc Natl Acad Sci U S A 89(22): 11046-11050. Liang, X., Y. Oono, et al. (1995). "Characterization of two members (ACS1 and ACS3) of the 1-aminocyclopropane-1-carboxylate synthase gene family of Arabidopsis thaliana." Gene 167(1-2): 17-24. Lieberman, M. (1979). "Biosynthesis and Action of Ethylene." Annual Review of Plant Physiology and Plant Molecular Biology 30: 533-591. Lim, K. Y., R. Matyasek, et al. (2004). "Genome evolution in allotetraploid Nicotiana." Biological Journal of the Linnean Society 82(4): 599-606. Lim, P. O., H. J. Kim, et al. (2007). "Leaf senescence." Annual Review of Plant Biology 58: 115-136.

105

Lim, P. O., H. J. Kim, et al. (2007). "Leaf senescence." Annual Review of Plant Biology 58: 115-136. Lin, Z. F., Y. G. Hong, et al. (2008). "A tomato HD-Zip homeobox protein, LeHB-1, plays an important role in floral organogenesis and ripening." Plant Journal 55(2): 301-310. Lin, Z., S. Zhong, et al. (2009). "Recent advances in ethylene research." J Exp Bot 60(12): 3311-3336. Liu, B. and J. F. Wendel (2003). "Epigenetic phenomena and the evolution of plant allopolyploids." Molecular Phylogenetics and Evolution 29(3): 365-379. Lohman, K. N., S. S. Gan, et al. (1994). "Molecular Analysis of Natural Leaf Senescence in Arabidopsis-Thaliana." Physiologia Plantarum 92(2): 322-328. Mann, T. J. and J. A. Weybrew. (1958). "Inheritance of alkaloids in hybrids between flue-cured tobacco and related amphidiploids." Tobacco Science 2: 29-34. Mann, T. J., J. A. Weybrew., et al. (1964). "Inheritance of the conversion of nicotine to nornicotine in varieties of Nicotiana tabacum and related amphidiploids." Crop Science 4: 349-353. Mattoo, A. K. a. S., J.C. (1991). “The Plant Hormone Ethylene.” Boca Raton, FL, USA: CRC Press. Matyasek, R., K. Y. Lim, et al. (2003). "Ribosomal DNA evolution and gene conversion in Nicotiana rustica." Heredity 91(3): 268-275. Mclauchlan, W. R., R. A. Mckee, et al. (1993). "The Purification and Immunocharacterisation of N-Methylputrescine Oxidase from Transformed Root Cultures of Nicotiana-Tabacum-L Cv-Sc58." Planta 191(4): 440-445. Mewis, I., H. M. Appel, et al. (2005). "Major signaling pathways modulate Arabidopsis glucosinolate accumulation and response to both phloem-feeding and chewing insects." Plant Physiology 138(2): 1149-1162. Miao, Y., T. Laun, et al. (2004). "Targets of the WRKY 53 transcription factor and its role during leaf senescence in Arabidopsis." Plant Molecular Biology 55: 853- 867. Mizusaki, S., Y. Tanabe, et al. (1972). "Phytochemical Studies on Tobacco Alkaloids .15. N-Methylputrescine Oxidase from Tobacco Roots." Phytochemistry 11(9): 2757- &. Morant, M., G. A. Schoch, et al. (2007). "Catalytic activity, duplication and evolution of the CYP98 cytochrome P450 family in wheat." Plant Mol Biol 63(1): 1-19. Morant, M., S. Bak, et al. (2003). "Plant cytochromes P450: tools for pharmacology, plant protection and phytoremediation (vol 14, pg 151, 2003)." Current Opinion in Biotechnology 14(3): 355-355. Moussatche, P. and H. J. Klee (2004). "Autophosphorylation activity of the Arabidopsis ethylene receptor multigene family." Journal of Biological Chemistry 279(47): 48734-48741.

106

Murad, L., K. Y. Lim, et al. (2002). "The origin of tobacco's T genome is traced to a particular lineage within Nicotiana tomentosiformis (Solanaceae)." American Journal of Botany 89(6): 921-928. Nakazato, Y., S. Tamogami, et al. (2000). "Methionine-induced phytoalexin production in rice leaves." Biosci Biotechnol Biochem 64(3): 577-583. Nelson, D. R., L. Koymans, et al. (1996). "P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature." Pharmacogenetics 6(1): 1- 42. Nelson, D. R., T. Kamataki, et al. (1993). "The P450 superfamily: update on new sequences, gene mapping, accession numbers, early trivial names of enzymes, and nomenclature." DNA Cell Biol 12(1): 1-51. Nukui, H., S. Kudo, et al. (2004). "Repressed ethylene production in the gynoecium of long-lasting flowers of the carnation 'White Candle': role of the gynoecium in carnation flower senescence." Journal of Experimental Botany 55(397): 641-650. Oeller, P. W., L. M. Wong, et al. (1991). "Reversible Inhibition of Tomato Fruit Senescence by Antisense Rna." Science 254(5030): 437-439. Oh, S. A., J. H. Park, et al. (1997). "Identification of three genetic loci controlling leaf senescence in Arabidopsis thaliana." Plant J 12(3): 527-35. Okushima, Y., I. Mitina, et al. (2005). "AUXIN RESPONSE FACTOR 2 (ARF2): a pleiotropic developmental regulator." Plant Journal 43(1): 29-46. ONeill, S. D. (1997). "Pollination regulation of flower development." Annual Review of Plant Physiology and Plant Molecular Biology 48: 547-574. Ouaked, F., W. Rozhon, et al. (2003). "A MAPK pathway mediates ethylene signaling in plants." EMBO J 22(6): 1282-1288. Pasquali, G., A. S. W. Erven, et al. (1999). "The promoter of the strictosidine synthase gene from periwinkle confers elicitor-inducible expression in transgenic tobacco and binds nuclear factors GT-1 and GBF." Plant Molecular Biology 39(6): 1299- 1310. Patterson, S. E. (2001). "Cutting loose. Abscission and dehiscence in Arabidopsis." Plant Physiology 126(2): 494-500. Peiser, G. D., T. T. Wang, et al. (1984). "Formation of Cyanide from Carbon-1 of 1- Aminocyclopropane-1-Carboxylic Acid during Its Conversion to Ethylene." Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences 81(10): 3059-3063. Penninckx, I. A., B. P. Thomma, et al. (1998). "Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis." Plant Cell 10(12): 2103-2113. Penninckx, I. A., K. Eggermont, et al. (1996). "Pathogen-induced systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent pathway." Plant Cell 8(12): 2309-2323.

107

Perriere, G. and M. Gouy (1996). "WWW-Query: An on-line retrieval system for biological sequence banks." Biochimie 78(5): 364-369. Picton, S., S. L. Barton, et al. (1993). "Altered Fruit Ripening and Leaf Senescence in Tomatoes Expressing an Antisense Ethylene-Forming Enzyme Transgene." Plant Journal 3(3): 469-481. Pitts, R. J., A. Cernac, et al. (1998). "Auxin and ethylene promote root hair elongation in Arabidopsis." Plant J 16(5): 553-560. Pnueli, L., A. D. Hareven, et al. (1994). "Isolation of the Tomato Agamous Gene Tag1 and Analysis of Its Homeotic Role in Transgenic Plants." Plant Cell 6(2): 163- 173. Pompon, D., B. Louerat, et al. (1996). "Yeast expression of animal and plant P450s in optimized redox environments." Cytochrome P450, Pt B 272: 51-64. Potuschak, T., E. Lechner, et al. (2003). "EIN3-dependent regulation of plant ethylene hormone signaling by two arabidopsis F box proteins: EBF1 and EBF2." Cell 115(6): 679-89. Preussmann, R. and B. W. Stewart. (1984). "N-Nitroso carcinogens." Chemical carcinogens, ACS monograph 182. C. E. Searle American Chemical Society, Washington, DC. 2: 643–828. Prokopczyk, B., D. Hoffmann, et al. (2002). "Identification of tobacco-derived compounds in human pancreatic juice." Chem Res Toxicol 15(5): 677-85. Qiao, H., K. N. Chang, et al. (2009). "Interplay between ethylene, ETP1/ETP2 F-box proteins, and degradation of EIN2 triggers ethylene responses in Arabidopsis." Genes & Development 23(4): 512-521. Rahman, A., S. Hosokawa, et al. (2002). "Auxin and ethylene response interactions during Arabidopsis root hair development dissected by auxin influx modulators." Plant Physiol 130(4): 1908-1917. Reid, M. S. and M. J. Wu (1992). "Ethylene and Flower Senescence." Plant Growth Regulation 11(1): 37-43. Riah, O., J. C. Dousset, et al. (1997). "Synthesis of cotinine and cotinine N-oxide: Evaluation of their interaction with nicotine in the insecticidal activity." Natural Product Letters 11(1): 37-45. Rieu, I., M. Wolters-Arts, et al. (2003). "Ethylene regulates the timing of anther dehiscence in tobacco." Planta 217(1): 131-137. Roberts, D. L. (1988). "Natural tobacco flavor." Recent Advances in Tobacco Sciences 14: 49-81. Robins, R. J., N.J. Walton et al. (1994). “Progress in the genetic engineering of the pyridine and tropane alkaloid biosynthetic pathway of solanaceous plants.". Genetic engineering of plant secondary metabolism. B. E. Ellis, G.W. Kuroki., H.A. Stafford., Plenum Pree, New York: 1-33.

108

Rodriguez, F. I., J. J. Esch, et al. (1999). "A copper cofactor for the ethylene receptor ETR1 from Arabidopsis." Science 283(5404): 996-998. Roman, G., B. Lubarsky, et al. (1995). "Genetic analysis of ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress response pathway." Genetics 139(3): 1393-409. Rose, T. M., E. R. Schultz, et al. (1998). "Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences." Nucleic Acids Research 26(7): 1628-1635. Saitoh, F., M. Noma, et al. (1985). "The Alkaloid Contents of 60 Nicotiana Species." Phytochemistry 24(3): 477-480. Sakai, H., J. Hua, et al. (1998). "ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis." Proceedings of the National Academy of Sciences of the United States of America 95(10): 5812-5817. Salminen, O., T. Seppa, et al. (1999). "The effects of acute nicotine on the metabolism of dopamine and the expression of Fos protein in striatal and limbic brain areas of rats during chronic nicotine infusion and its withdrawal." J Neurosci 19(18): 8145-51. Samac, D. A., C. M. Hironaka, et al. (1990). "Isolation and Characterization of the Genes Encoding Basic and Acidic Chitinase in Arabidopsis thaliana." Plant Physiol 93(3): 907-914. Samuel, G. (1931). "Some experiments on inoculating methods with plant viruses, and on local lesions." Annals of Applied Biology 18(4): 494-507. Sanchez, A. M. and C. Mariani (2002). "Expression of the ACC synthase and ACC oxidase coding genes after self-pollination and incongruous pollination of tobacco pistils." Plant Molecular Biology 48(4): 351-359. Sanger, F., S. Nicklen, et al. (1977). "DNA sequencing with chain-terminating inhibitors." Proc Natl Acad Sci U S A 74(12): 5463-7. Savin, K. W., S. C. Baudinette, et al. (1995). "Antisense Acc Oxidase Rna Delays Carnation Petal Senescence." Hortscience 30(5): 970-972. Schardl, C. L., A. D. Byrd, et al. (1987). "Design and construction of a versatile system for the expression of foreign genes in plants." Gene 61(1): 1-11. Schroder, G., E. Unterbusch, et al. (1999). "Light-induced cytochrome P450-dependent enzyme in indole alkaloid biosynthesis: tabersonine 16-hydroxylase." Febs Letters 458(2): 97-102. Sebastia, C. H., S. C. Hardin, et al. (2004). "Identification of a new motif for CDPK phosphorylation in vitro that suggests ACC synthase may be a CDPK substrate." Archives of Biochemistry and Biophysics 428(1): 81-91. Shaw, J. F., H. H. Chen, et al. (2002). "Extended flower longevity of Petunia hybrida plants transformed with boers, a mutated ERS gene of Brassica oleracea." Molecular Breeding 9(3): 211-216.

109

Shi, H. Z., N. E. Kalengamaliro, et al. (2003). "Stimulation of nicotine demethylation by NaHCO3 treatment using greenhouse-grown burley tobacco." Journal of Agricultural and Food Chemistry 51(26): 7679-7683. Shi, Q. M., C. J. Li, et al. (2006). "Nicotine synthesis in Nicotiana tabacum L. induced by mechanical wounding is regulated by auxin." Journal of Experimental Botany 57(11): 2899-2907. Shibuya, K., K. G. Barry, et al. (2004). "The central role of PhEIN2 in ethylene responses throughout plant development in petunia." Plant Physiol 136(2): 2900-12. Shibuya, K., T. Yamada, et al. (2009). "InPSR26, a Putative Membrane Protein, Regulates Programmed Cell Death during Petal Senescence in Japanese Morning Glory." Plant Physiology 149(2): 816-824. Shibuya, K., T. Yoshioka, et al. (2000). "Role of the gynoecium in natural senescence of carnation (Dianthus caryophyllus L.) flowers." J Exp Bot 51(353): 2067-2073. Shimizu, T., T. Tateishi, et al. (1991). "Probing the Role of Lysines and Arginines in the Catalytic Function of Cytochrome-P450d by Site-Directed Mutagenesis - Interaction with Nadph-Cytochrome-P450 Reductase." Journal of Biological Chemistry 266(6): 3372-3375. Shoji, T., K. Nakajima, et al. (2000). "Ethylene suppresses jasmonate-induced gene expression in nicotine biosynthesis." Plant and Cell Physiology 41(9): 1072-1076. Siegler, E. H. and C. V. Bowen (1946). "Toxicity of Nicotine, Nornicotine, and Anabasine to Codling Moth Larvae." Journal of Economic Entomology 39(5): 673-674. Siegmund, B., E. Leitner, et al. (1999). "Determination of the nicotine content of various edible nightshades (Solanaceae) and their products and estimation of the associated dietary nicotine intake." Journal of Agricultural and Food Chemistry 47(8): 3113-3120. Siminszky, B., L. Gavilano, et al. (2005). "Conversion of nicotine to nornicotine in Nicotiana tabacum is mediated by CYP82E4, a cytochrome P450 monooxygenase." Proceedings of the National Academy of Sciences of the United States of America 102(41): 14919-14924. Sisson, V. A. and R. F. Severson (1990). "Alkaloid Composition of the Nicotiana Species." Beitrage Zur Tabakforschung International 14(6): 327-339. Solano, R., A. Stepanova, et al. (1998). "Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1." Genes & Development 12(23): 3703- 3714. Soloway, S. B. (1976). "Naturally Occurring Insecticides." Environmental Health Perspectives 14(Apr): 109-117. Spanu, P., D. G. Grosskopf, et al. (1994). "The Apparent Turnover of 1- Aminocyclopropane-1-Carboxylate Synthase in Tomato Cells Is Regulated by

110

Protein-Phosphorylation and Dephosphorylation." Plant Physiology 106(2): 529- 535. Stadler, R. and M. H. Zenk (1993). "The Purification and Characterization of a Unique Cytochrome-P-450 Enzyme from Berberis-Stolonifera Plant-Cell Cultures." Journal of Biological Chemistry 268(2): 823-831. Staswick, P. E. and I. Tiryaki (2004). "The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis." Plant Cell 16(8): 2117- 2127. Stead, A. D. (1992). "Pollination-Induced Flower Senescence - a Review." Plant Growth Regulation 11(1): 13-20. Stepka, W. and L. J. Dewey (1961). "Conversion of Nicotine to Nornicotine in Harvested Tobacco - Fate of Methyl Group." Plant Physiology 36(5): 592-&. Steppuhn, A., K. Gase, et al. (2004). "Nicotine's defensive function in nature." Plos Biology 2(8): 1074-1080. Stolerman, I. P. and M. Shoaib (1991). "The neurobiology of tobacco addiction." Trends Pharmacol Sci 12(12): 467-73. Stotz, H. U., B. R. Pittendrigh, et al. (2000). "Induced plant defense responses against chewing insects. Ethylene signaling reduces resistance of Arabidopsis against Egyptian cotton worm but not diamondback moth." Plant Physiology 124(3): 1007-1017. St-Pierre, B. and V. De Luca (1995). "A Cytochrome P-450 Monooxygenase Catalyzes the First Step in the Conversion of Tabersonine to Vindoline in Catharanthus roseus." Plant Physiol 109(1): 131-139. Su, W. P. and S. H. Howell (1992). "A Single Genetic-Locus, Ckr1, Defines Arabidopsis Mutants in Which Root-Growth Is Resistant to Low Concentrations of Cytokinin." Plant Physiology 99(4): 1569-1574. Szabo, E., A. Thelen, et al. (1999). "Fungal elicitor preparations and methyl jasmonate enhance rosmarinic acid accumulation in suspension cultures of Coleus blumei." Plant Cell Reports 18(6): 485-489. Takeuchi, Y., M. Yoshikawa, et al. (1990). "Molecular Cloning and Ethylene Induction of mRNA Encoding a Phytoalexin Elicitor-Releasing Factor, beta-1,3- Endoglucanase, in Soybean." Plant Physiol 93(2): 673-682. Tang, D. Z., K. M. Christiansen, et al. (2005). "Regulation of plant disease resistance, stress responses, cell death, and ethylene signaling in Arabidopsis by the EDR1 protein kinase." Plant Physiology 138(2): 1018-1026. Tarun, A. S. and A. Theologis (1998). "Complementation analysis of mutants of 1- aminocyclopropane-1-carboxylate synthase reveals the enzyme is a dimer with shared active sites." Journal of Biological Chemistry 273(20): 12509-12514. Thomma, B. P., B. P. Cammue, et al. (2002). "Plant defensins." Planta 216(2): 193-202.

111

Thomma, B. P., K. Eggermont, et al. (1999). "Requirement of functional ethylene- insensitive 2 gene for efficient resistance of Arabidopsis to infection by Botrytis cinerea." Plant Physiol 121(4): 1093-1102. Thurston, R., W. T. Smith, et al. (1966). "Alkaloid Secretion by Trichomes of Nicotiana Species and Resistance to Aphids." Entomologia Experimentalis Et Applicata 9(4): 428-&. Tiburcio, A. F. and A. W. Galston (1986). "Arginine decarboxylase as the source of putrescine for tobacco alkaloids." Phytochemistry 25(1): 107-10. Trebitsh, T., J. E. Staub, et al. (1997). "Identification of a 1-aminocyclopropane-1- carboxylic acid synthase gene linked to the female (F) locus that enhances female sex expression in cucumber." Plant Physiology 113(3): 987-995. Tsuchisaka, A. and A. Theologis (2004). "Unique and overlapping expression patterns among the arabidopsis 1-amino-cyclopropane-1-carboxylate synthase gene family members." Plant Physiology 136(2): 2982-3000. Tusnady, G. E. and I. Simon (2001). "The HMMTOP transmembrane topology prediction server." Bioinformatics 17(9): 849-850. Valleau, W. D. (1949). "The genetics of mosaic resistance in Nicotiana glutinosa." J Agric Res 78(3-4): 77-9. Van der Graaff, E., R. Schwacke, et al. (2006). "Transcription analysis of arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence." Plant Physiology 141(2): 776-792. van Doorn, W. G. (2001). "Categories of petal senescence and abscission: A re- evaluation." Annals of Botany 87(4): 447-456. van Doorn, W. G. (2004). "Is petal senescence due to sugar starvation?" Plant Physiology 134(1): 35-42. van Doorn, W. G. and E. J. Woltering (2008). "Physiology and molecular biology of petal senescence." Journal of Experimental Botany 59(3): 453-480. van Loon, L. C., B. P. Geraats, et al. (2006). "Ethylene as a modulator of disease resistance in plants." Trends Plant Sci 11(4): 184-191. vanDoorn, W. G., Stead ,A.D. (1997). "Abscission of flowers and floral parts." JOURNAL OF EXPERIMENTAL BOTANY 48 (309 ): 821-837. Visser, E. J. W., C. J. Heijink, et al. (1995). "Regulatory Role of Auxin in Adventitious Root-Formation in 2 Species of Rumex, Differing in Their Sensitivity to Waterlogging." Physiologia Plantarum 93(1): 116-122. Visser, E. J. W., G. M. Bogemann, et al. (1996). "Ethylene accumulation in waterlogged Rumex plants promotes formation of adventitious roots." Journal of Experimental Botany 47(296): 403-410. Visser, E. J. W., J. D. Cohen, et al. (1996). "An ethylene-mediated increase in sensitivity to auxin induces adventitious root formation in flooded Rumex palustris Sm." Plant Physiology 112(4): 1687-1692.

112

Voesenek, L. A. C. J., F. J. M. Harren, et al. (1990). "Ethylene Production and Petiole Growth in Rumex Plants Induced by Soil Waterlogging - the Application of a Continuous-Flow System and a Laser Driven Intracavity Photoacoustic Detection System." Plant Physiology 94(3): 1071-1077. von Dahl, C. C. and I. T. Baldwin (2007). "Deciphering the role of ethylene in plant- herbivore interactions." Journal of Plant Growth Regulation 26(2): 201-209. Wada, E. (1956). "Conversion of nicotine to nornicotine in cherry red tobacco during flue-curing." Arch Biochem Biophys 62(2): 471-5. Wagner, R. and K. G. Wagner (1985). "The Pyridine-Nucleotide Cycle in Tobacco Enzyme-Activities for the Denovo Synthesis of Nad." Planta 165(4): 532-537. Walton, N. J., R.J. Robins et al. (1987). "Perturbation of alkaloid production by cadaverine in hairy root cultures of Nicotiana rustica " Plant Science 54: 125-131. Wang, K. L. C., H. Yoshida, et al. (2004). "Regulation of ethylene gas biosynthesis by the Arabidopsis ETO1 protein." Nature 428(6986): 945-950. Wang, W., A. E. Hall, et al. (2003). "Canonical histidine kinase activity of the transmitter domain of the ETR1 ethylene receptor from Arabidopsis is not required for signal transmission." Proc Natl Acad Sci U S A 100(1): 352-357. Wang, Y., C. Liu, et al. (2007). "Arabidopsis EIN2 modulates stress response through abscisic acid response pathway." Plant Mol Biol 64(6): 633-44. Watkins, C. B. (2006). "The use of 1-methylcyclopropene (1-MCP) on fruits and vegetables." Biotechnology Advances 24(4): 389-409. Weaver, L. M., S. S. Gan, et al. (1998). "A comparison of the expression patterns of several senescence-associated genes in response to stress and hormone treatment." Plant Molecular Biology 37(3): 455-469. Weinzierl, R. O. J. (1999). Mechanism of gene expression. London, Imperial College Press. Welinder, K. G., A. F. Justesen, et al. (2002). "Structural diversity and transcription of class III peroxidases from Arabidopsis thaliana." Eur J Biochem 269(24): 6063- 81. Wendel, J. F. (2000). "Genome evolution in polyploids." Plant Molecular Biology 42(1): 225-249. Wenkert, E. (1954). "The Role of Oxidation in the Biogenesis of Alkaloids." Experientia 10(8): 346-350. Wernsman, E. A. and D. F. Matzinger. (1968). "Time and site of nicotine conversion in tobacco." Tobacco Science 12: 226-228. Whitham, S., S. P. Dineshkumar, et al. (1994). "The Product of the Tobacco Mosaic- Virus Resistance Gene-N - Similarity to Toll and the Interleukin-1 Receptor." Cell 78(6): 1101-1115.

113

Wilkinson, J. Q., M. B. Lanahan, et al. (1997). "A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants." Nature Biotechnology 15(5): 444-447. Williams, D. L. H. (1999). "The chemistry of S-nitrosothiols." Accounts of Chemical Research 32(10): 869-876. Williams, L., C. C. Carles, et al. (2005). "A database analysis method identifies an endogenous trans-acting short-interfering RNA that targets the Arabidopsis ARF2, ARF3, and ARF4 genes." Proceedings of the National Academy of Sciences of the United States of America 102(27): 9703-9708. Wink, M. (2003). "Evolution of secondary metabolites from an ecological and molecular phylogenetic perspective." Phytochemistry 64(1): 3-19. Woeste, K. E., C. Ye, et al. (1999). "Two Arabidopsis mutants that overproduce ethylene are affected in the posttranscriptional regulation of 1-aminocyclopropane-1- carboxylic acid synthase." Plant Physiology 119(2): 521-529. Wonnacott, S. (1997). "Presynaptic nicotinic ACh receptors." Trends Neurosci 20(2): 92- 8. Woo, H. R., J. H. Kim, et al. (2004). "The delayed leaf senescence mutants of Arabidopsis, ore1, ore3, and ore9 are tolerant to oxidative stress." Plant Cell Physiol 45(7): 923-32. Wuriyanghan, H., B. Zhang, et al. (2009). "The Ethylene Receptor ETR2 Delays Floral Transition and Affects Starch Accumulation in Rice." Plant Cell 21(5): 1473- 1494. Xu, D. M., Y. X. Shen, et al. (2007). "Biochemical and molecular characterizations of nicotine demethylase in tobacco." Physiologia Plantarum 129(2): 307-319. Xu, Y. and M. R. Hanson (2000). "Programmed cell death during pollination-induced petal senescence in petunia." Plant Physiology 122(4): 1323-1333. Yamagami, T., A. Tsuchisaka, et al. (2003). "Biochemical diversity among the 1-aminocyclopropane-1-carboxylate synthase isozymes encoded by the Arabidopsis gene family." Journal of Biological Chemistry 278(49): 49102-49112. Yamamoto, H., N. Katano, et al. (2000). "Secologanin synthase which catalyzes the oxidative cleavage of loganin into secologanin is a cytochrome P450." Phytochemistry 53(1): 7-12. Yamamoto, I., Y. Soeda, et al. (1968). "Studies on Nicotinoids as an Insecticide .7. Cholinesterase Inhibition by Nicotinoids and Pyridylalkylamines - Its Significance to Mode of Action." Agricultural and Biological Chemistry 32(11): 1341-1348. Yamasaki, S., N. Fujii, et al. (2001). "The M locus and ethylene-controlled sex determination in andromonoecious cucumber plants." Plant and Cell Physiology 42(6): 608-619.

114

Yanagisawa, S., S. D. Yoo, et al. (2003). "Differential regulation of EIN3 stability by glucose and ethylene signalling in plants." Nature 425(6957): 521-525. Yang, P. Z., C. H. Chen, et al. (1999). "A pathogen- and salicylic acid-induced WRKY DNA-binding activity recognizes the elicitor response element of the tobacco class I chitinase gene promoter." Plant Journal 18(2): 141-149. Yang, T. F., Z. H. Gonzalez-Carranza, et al. (2008). "Ethylene and the regulation of senescence processes in transgenic Nicotiana sylvestris plants." Annals of Botany 101(2): 301-310. Ye, Z. H. and D. L. Droste (1996). "Isolation and characterization of cDNAs encoding xylogenesis-associated and wounding-induced ribonucleases in Zinnia elegans." Plant Molecular Biology 30(4): 697-709. Ye, Z. H. and J. E. Varner (1996). "Induction of cysteine and serine proteases during xylogenesis in Zinnia elegans." Plant Molecular Biology 30(6): 1233-1246. Yin, S. H., L. Mei, et al. (1997). "Regulation of sesquiterpene cyclase gene expression - Characterization of an elicitor- and pathogen-inducible promoter." Plant Physiology 115(2): 437-451. Yip, W. K. and S. F. Yang (1988). "Cyanide Metabolism in Relation to Ethylene Production in Plant-Tissues." Plant Physiology 88(2): 473-476. Yoo, S. D., Y. H. Cho, et al. (2008). "Dual control of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling." Nature 451(7180): 789-95. Yoo, S. D., Y. H. Cho, et al. (2009). "Emerging connections in the ethylene signaling network." Trends in Plant Science 14(5): 270-279. Yoshida, H., K. L. C. Wang, et al. (2006). "The ACC synthase TOE sequence is required for interaction with ETO1 family proteins and destabilization of target proteins." Plant Molecular Biology 62(3): 427-437. Yoshida, H., M. Nagata, et al. (2005). "Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases." Bmc Plant Biology 5: 14. Yoshida, S. (2003). "Molecular regulation of leaf senescence." Current Opinion in Plant Biology 6(1): 79-84. Yu, Y. B., D. O. Adams, et al. (1979). "1-Aminocyclopropanecarboxylate Synthase, a Key Enzyme in Ethylene Biosynthesis." Archives of Biochemistry and Biophysics 198(1): 280-286. Yukawa, M., T. Tsudzuki, et al. (2006). "The chloroplast genome of Nicotiana sylvestris and Nicotiana tomentosiformis: complete sequencing confirms that the Nicotiana sylvestris progenitor is the maternal genome donor of Nicotiana tabacum." Molecular Genetics and Genomics 275(4): 367-373. Zenk, M., Gerardy, R.,Stadler, R. (1989). J.Chem. Sot. Chem. Commun. 22: 1725. Zhao, J., S. H. Zheng, et al. (2004). "Jasmonate and ethylene signalling and their interaction are integral parts of the elicitor signalling pathway leading to beta-

115

thujaplicin biosynthesis in Cupressus lusitanica cell cultures." J Exp Bot 55(399): 1003-1012. Zhao, X. C., X. Qu, et al. (2002). "Effect of ethylene pathway mutations upon expression of the ethylene receptor ETR1 from Arabidopsis." Plant Physiology 130(4): 1983- 1991. Zimmermann, P., L. Hennig, et al. (2005). "Gene-expression analysis and network discovery using Genevestigator." Trends in Plant Science 10(9): 407-409.

116

VITA Manohar Chakrabarti was born on December 18th, 1977 at Sonamukhi, Bankura, West Bengal, India. He received his schooling from Asansol Ramakrishna Mission High School and Raniganj High School. He completed Bachelor of Science (Agriculture) with specialization in Genetics and Plant Breeding from Uttar Banga Krishi Viswavidyalaya in 2001, followed by Master of Science (Agriculture) in Genetics from Bidhan Chandra Krishi Viswavidyalaya in 2003. He joined PhD program in Plant Physiology at the University of Kentucky in Spring, 2006. He qualified ‘National Eligibility Test’ in the discipline of Genetics, conducted by Indian Council of Agricultural Research (ICAR, India) in 2005. He was the recipient of ‘Jeffrey Fellowship for Tobacco Research’ from University of Kentucky in 2007. His professional publications include: 1.Manohar Chakrabarti, Steven W. Bowen, Nicholas P. Coleman, Karen M. Meekins, Ralph E. Dewey and Balazs Siminszky. 2008. CYP82E4-mediated nicotine to nornicotine conversion in tobacco is regulated by a senescence-specific signaling pathway. Plant Molecular Biology. 66: 415-427.

2. Manohar Chakrabarti, Karen M. Meekins, Lily B. Gavilano and Balazs Siminszky. 2007. Inactivation of CYP82E2 by Degenerative Mutations was a Key Event in the Evolution of the Alkaloid Profile of Modern Tobacco. New Phytologist. 175:565-574.

3. Manohar, Chakrabarti, Bhattacharya N. M. 2005. Association of Green Forage Yield Attributes in Rice Bean, Vigna umbellate (Thumb.) Ohwi and Ohashi. Environment & Ecology. 23 (3): 538- 540.

4. Manohar Chakrabarti, Bhattacharya, N. M. 2005. Genetic Variability in Rice Bean. Environment & Ecology. 23 (3): 534-537.

117