sign in sign up
<<
Home , Sunitinib

ANTICANCER RESEARCH 37 : 4899-4909 (2017) doi:10.21873/anticanres.11899

Sunitinib Inhibits Breast Cancer Cell Proliferation by Inducing , Cell-cycle Arrest and DNA Repair While Inhibiting NF-ĸB Signaling Pathways HESHAM M. KORASHY 1, ZAID H. MAAYAH 1, FAWAZ E. AL ANAZI 1, ABDULAZIZ M. ALSAAD 1, IBRAHIM O. ALANAZI 2, OSAMAH M. BELALI 1, FAHAD O. AL-ATAWI 1 and AWS ALSHAMSAN 3

1Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh, Kingdom of Saudi Arabia; 2The National Center for Genomic Technology (NCGT), Life Science and Environment Research Institute, King Abdulaziz City for Science and Technology (KACST), Riyadh, Kingdom of Saudi Arabia; 3Department of Pharmaceutics, College of Pharmacy, King Saud University, Riyadh, Kingdom of Saudi Arabia

Abstract. The inhibitor sunitinib was complementing protein 1. In addition, sunitinib exhibited recently approved for use against gastrointestinal stromal concentration-dependent induction of oxidative stress genes tumors and advanced . Yet, the (heme oxygenase 1 and glutathione transferase A1) through protective effect of sunitinib against breast cancer has been the nuclear factor erythroid 2–related factor 2 pathway. poorly investigated. In this study, we investigated the These findings lead us to propose that sunitinib suppressed antiproliferative and apoptogenic effects of sunitinib and the the proliferation of MCF7 cells via cell-cycle arrest and possible mechanism involved against the MCF7 human apoptotic- and oxidative stress-mediated pathways. breast cancer cell line. Treatment of MCF7 cells with sunitinib caused concentration-dependent cell growth Breast cancer is one of the most widespread and lethal forms suppression due to apoptosis. Apoptotic death induced by of cancer, with almost one million new cases of breast cancer sunitinib in MCF7 cells was mediated by activation of identified each year worldwide. The incidence of breast caspase-3 and p53 mRNA and protein expression and an cancer morbidity and mortality has increased more than 20% increase in the percentage of apoptotic cells (40%) as since 2008 (1). Although a definitive predictor for breast determined by flow cytometry. Apoptosis was associated with cancer development is not available, many factors have been a significant inhibition of nuclear factor-kappa B mRNA and identified that facilitate the classification of women with protein expression. Mechanistically, blocking of de novo predisposed risk to this disease (2-4). Although the etiology RNA synthesis by actinomycin D significantly inhibited of breast cancer is still unclear, several signaling pathways sunitinib-induced expression of p53 mRNA, but not that of that control cell proliferation are thought to be involved in caspase-3, indicating involvement of a transcriptional disease progression and hence maybe targets for therapy. At mechanism. This apoptosis-mediated inhibition of MCF7 cell an early stage of diagnosis, therapy can reduce the mortality growth was attributed to inhibition of cell cycle-related of breast cancer (5-7). genes (cyclin D1 and cyclin E2) and arrest of MCF7 cells in One of those promising therapies for breast cancer is the G 2/M phase in the cell cycle, allowing up-regulation of sunitinib (Figure 1), a multitargeted tyrosine kinase inhibitor. expression of DNA repair genes such as x-ray repair cross- Sunitinib possesses antitumor and anti-angiogenic activity against several types of cancer, mainly gastrointestinal stromal tumors and advanced renal cell carcinoma (8). Sunitinib exerts its effect through inhibition of several Correspondence to: Hesham M. Korashy, Ph.D., Department of tyrosine kinases that are implicated in breast cancer Pharmacology and Toxicology, College of Pharmacy, King Saud growth and metastasis, such as vascular endothelial growth University, P.O. Box 2457, Riyadh 11451, Kingdom of Saudi factor (VEGF) receptor, platelet-derived Arabia. Tel: +966 114677183, Fax: +966 114677200, e-mail: [email protected] receptor, and colony-stimulating factor-1 receptor (9, 10). A previous study has reported that sunitinib targeted the Key Words: Sunitinib, MCF7 cells, caspases, cylin D, XRCC1 , paracrine and autocrine effects of VEGF on breast cancer to NF-ĸB, oxidative stress. suppress tumor , proliferation and migration in

4899 ANTICANCER RESEARCH 37 : 4899-4909 (2017) a mouse estrogen receptor-positive breast cancer model (11). In addition, sunitinib combined with chemotherapeutic agents, such as docetaxel, fluorouracil or doxorubicin, enhanced the antitumor activity and increased the survival in patients with human epidermal 2/neu- negative advanced breast cancer (10). Several previous reviews and studies have reported an association between cell proliferation, cell-cycle control and apoptosis with carcinogenesis (12-14). Activation of apoptosis has been proposed as a potential mechanism for the effects of chemotherapeutic agents. Recent data have shown that sunitinib inhibited tumorgenesis and carcinogenesis in basal-like triple-negative breast cancer cells through inhibiting proliferation and migration, and Figure 1 . Chemical structure of sunitinib. increasing apoptosis (15). Although studies have shown that sunitinib exerts protective effects against experimentally-induced carcinogenesis, the effects of sunitinib on breast cancer cell lines, particularly The cells were seeded onto 96-, 12-, and 6-well cell culture MCF7 cells, and the molecular mechanism(s) involved are still plates in DMEM culture medium for enzyme activity, mRNA, and very limited. Hence, the present study was designed to test the protein assays, respectively. In all experiments, the cells were treated for different time intervals in serum-free medium with hypothesis that sunitinib induces MCF7 cell growth and different concentrations of sunitinib (2.5, 5, and 10 μM). Stock proliferation suppression through apoptotic, cell-cycle, and solutions of sunitinib was prepared in dimethylsulfoxide (DMSO) oxidative stress pathways. and stored at −20˚C. The DMSO concentration did not exceed 0.05% (v/v). Materials and Methods Cell proliferation assay. The effect of sunitinib on MCF7 cell Materials. Sunitinib malate [( Z)- N-(2-(diethylamino) ethyl)-5-((5- proliferation and growth was determined by measuring the capacity fluoro-2-oxoindolin-3-ylidene) methyl)-2,4-dimethyl-1 H--3- of reducing enzymes present only in viable cells to convert MTT to carboxamide)] was obtained from LC Laboratories (Woburn, MA, colored formazan crystals as described previously (16). The USA). Dulbecco’s modified Eagle’s medium (DMEM), IgG percentage of cell viability was calculated relative to control wells peroxidase secondary antibody, protease inhibitor cocktail, and 3- designated as 100% viable cells using the following formula: cell (4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) viability=(A treated )/(A control ) ×100%. were purchased from Sigma Chemical Co. (St. Louis, MO, USA). TRIzol reagent, annexinV–fluorescein isothiocyanate (FITC), and Total RNA extraction and cDNA synthesis. Total cellular RNA was propidium iodide (PI) were purchased from Invitrogen Co. (Grand isolated using TRIzol reagent (Invitrogen ®) according to the Island, NY, USA). High Capacity cDNA Reverse Transcription manufacturer’s instructions and quantified by measuring the and SYBR ® Green PCR Master Mix were purchased from Applied absorbance at 260 nm. RNA quality was determined by measuring Biosystems ® (Foster city, CA, USA). Actinomycin D (Act-D) was the 260/280 ratio (~2.0). First-strand cDNA was synthesized using purchased from Calbiochem ® (San Diego, CA, USA). Caspase-3 the High-Capacity cDNA reverse transcription kit (Applied colorimetric activity kit was purchased from Biovision ® (Mountain Biosystems ®), according to the manufacturer’s instructions and as View, CA, USA). Resveratrol was obtained from Toronto Research described previously (16). Briefly, 1.5 μg of total RNA from each Chemicals (Toronto, ON, CANADA). Nitrocellulose membrane was sample was added to a mixture of 2.0 μl of 10× reverse transcriptase obtained from Bio-Rad Laboratories (Hercules, CA, USA). Primary buffer, 0.8 μl of 25× dNTP mix (100 mM), 2.0 μl of 10× reverse antibodies against target proteins were purchased from Santa Cruz transcriptase random primers, 1.0 μl of MultiScribe reverse Biotechnology, Inc. (Santa Cruz, CA, USA). Chemiluminescence transcriptase, and 3.2 μl of nuclease-free water. The final reaction western blot detection kit (Luminate forte) was obtained from mixture was kept at 25˚C for 10 min, heated to 37˚C for 120 min, Merck Millipore (Billerica, MA, USA). All other chemicals were heated for 85˚C for 5 min, and finally cooled to 4˚C. purchased from Fisher Scientific Co. (Toronto, ON, Canada). Quantification of mRNA expression by real-time polymerase chain Cell culture and treatments. MCF7 Human breast cancer cells, reaction (RT-PCR). Quantitative analysis of specific mRNA obtained from the American Type Cutler Collection (Manassas, VA, expression was performed by RT-PCR by subjecting the resulting USA), were maintained in DMEM with phenol red supplemented cDNA to PCR amplification using 96-well optical reaction plates in with 10% fetal bovine serum, 1X antibiotic-antimycotic (100 the ABI 7500 Fast RT-PCR System (Applied Biosystems ®) using units/ml of penicillin, 100 μg/ml of streptomycin, and 250 ng/ml of SYBR Green Universal Mastermix as described previously (17). amphotericin B), Gibco ® (Grand Island, NY, USA). Cells were Human primers for target genes (Table I) were purchased from 2 grown in 75 cm tissue culture flasks at 37˚C under a 5% CO 2 Integrated DNA technologies (IDT, Coralville, IA, USA). The fold humidified environment. change in the level of gene expression between treated and

4900 Korashy et al : Sunitinib Induces Apoptosis and Cell-cycle Arrest in MCF7 Cells

Table I. Primer sequences used for real-time polymerase chain reactions. → → Gene name Gene symbol 5’ 3’ Forward primer 5’ 3’ Reverse primer

Caspase-3 CASP3 GAGTGCTCGCAGCTCATACCT CCTCACGGCCTGGGATTT B-Cell 2 BCL2 CATGTGTGTGGAGAGCGTCAA GCCGGTTCAGGTACTCAGTCA P53 P53 GCCCCCAGGGAGCACTA GGGAGAGGAGCTGGTGTTG Heme oxygenase 1 HO1 ATGGCCTCCCTGTACCACATC TGTTGCGCTCAATCTCCTCCT Glutathione transferease A1 GSTA1 ATCAAGGGAAAGCAGGAAGC CCTTGTCTACAGGTGCATCA Cyclin D1 CCND1 GAAGATCGTCGCCACCTG GACCTCCTCCTCGCACTTCT Cyclin E1 CCNE1 GGCCAAAATCGACAGGAC GGGTCTGCACAGACTGCAT Human apurinic endonuclease 1 APE1 GGTTAACCATGACCGGGAACT TGCCCAAACCAAAGAGAGTGA X-Ray repair cross-complementing protein 1 XRCC1 GGAGGACCTCACTGAGATCAGG GGGCTGGCACAGTGACTTCAC Nuclear factor erythroid 2–related factor 2 NRF2 TACTCCCAGGTTGCCCACA CATCTACAAACGGGAATGTCTGC Nuclear factor kappa B NFĸB AGTCCTGCTCCTTCCAAAAC CTTCGGTGTAGCCCATTTGT β- Actin ACTB CCAGATCATGTTTGAGACCTTCAA GTGGTACGACCAGAGGCATACA

untreated cells were corrected by the levels of β- actin expression HCl pH 6.7, 100 mM 2-mercaptoethanol, and 2% SDS for 30 min Assay controls were incorporated onto the same plate, namely, no- at 50˚C and thereafter re-probed with goat anti-human β- actin template controls to test for the contamination of any assay reagents. primary antibody, which was used as loading control, as described The RT-PCR data were analyzed using the relative gene expression above. (i.e. ΔΔ Ct) method, as described and explained previously (18). The average ΔCt from untreated MCF7 cells was used as a Flow cytometric analysis of apoptosis with annexin V staining. The calibrator for each gene tested. The fold change in the level of target percentage of cells undergoing apoptosis/necrosis was determined genes between treated and untreated cells, corrected by the level of by flow cytometry using annexin V staining as described previously β- actin, was determined using the following equation: fold (21). Briefly, MCF7 cells were treated for 24 h with 5 μM sunitinib −Δ(Δ Ct ) change=2 , where ΔCt=Ct (target) −Ct (β- actin) and Δ(Δ Ct ) thereafter, the medium was removed, and cells were washed with =Δ Ct (treated) −ΔCt (untreated) . cold phosphate-buffered saline (PBS) before trypsinization. The collected cells were centrifuged at 300 × g for 5 min and then re- Determination of caspase-3 activity. Caspase-3 activity was suspended with 0.5 ml PBS. Cells were then stained with measured colorimetrically using the CaspACE assay system annexinV–FITC/PI and immediately analyzed on a Beckman purchased from Biovision ® (Mountain View, CA, USA) according Coulter FC500 Cytomics Benchtop flow cytometer, Beckman to the manufacturer’s instructions as described previously (19). Coulter Life Sciences (Indianapolis, IN, USA) for determination of Approximately 30 μg protein was incubated with 200 μM enzyme- apoptotic and necrotic populations. specific colorimetric caspase-3 substrate I, acetyl-Asp-Glu-Val- Asp p-nitroanilide (Ac-DEVD- pNA) at 37˚C for 2 h. Caspase-3 Analysis of cell-cycle phase distribution and progression. MCF7 activity was assessed by measuring absorbance at a wavelength of cell-cycle distribution was analyzed using flow cytometery as 405 nm with a plate reader BioTek (Winooski, VT, USA). described previously (21). Briefly, MCF7 cells seeded in a 6-well culture plates were treated for 24 h with different concentrations of Western blot analysis. Western blot analysis was performed using a sunitinib (2.5, 5, and 10 μM). Thereafter, cells were trypsinized, previously described method (20). Briefly, 25-35 μg of protein from harvested, and fixed in 1 ml of 70% cold ethanol in test tubes and each treatment group, isolated from MCF7 cells as described incubated at −20˚C for 30 min. After incubation, cells were previously (20), was separated by 10% sodium dodecyl sulfate centrifuged at 450 × g for 5 min and the cell pellets were re- (SDS)-polyacrylamide gel electrophoresis, and then suspended in 500 μl PI (10 μg/ml) containing 300 μg/ml RNase. electrophoretically transferred to nitrocellulose membrane. Protein Cells were then incubated on ice for 30 min and filtered with a 53 blots were then blocked overnight at 4˚C in blocking solution then μm nylon mesh. Cell-cycle distribution was calculated from 10,000 washed several times with Tris-buffered saline (TBS)-Tween-20 cells with ModFit LT ® software using FACScaliber (Becton before being incubated with primary antibodies against p53, cyclin Dickinson, CA, USA). D1, and cyclin E1 proteins over night at room temperature in TBS solution followed by incubation with a peroxidase-conjugated IgG Statistical analysis. The comparative analysis of the results from secondary antibodies for 2 h at room temperature. The bands were various experimental groups with their corresponding controls was visualized and then quantified by C-DiGit ® Blot Scanner, LI-COR performed using SigmaStat ® for Windows, Systat Software, Inc, (San Biosciences (Lincoln, NE, USA) using the enhanced Jose, CA, USA). One-way analysis of variance (ANOVA) followed chemiluminescence method according to the manufacturer’s by Student–Newman–Keul’s test was carried out to assess which instructions, Merck Millipore (Billerica, MA, USA). Membranes treatment groups showed a significant difference from the control were subsequently stripped in a solution containing 62.5 mM Tris- group. The differences were considered significant when p< 0.05.

4901 ANTICANCER RESEARCH 37 : 4899-4909 (2017)

In order to further investigate whether the induction of caspase-3 mRNA by sunitinib is also translated into a functional activity, we tested the effect of sunitinib on caspase-3 activity. Figure 3B shows that sunitinib increased caspase-3 activity in a dose-dependent manner in a fashion similar to that observed at the mRNA level. Next, we questioned whether the induction of human caspase-3 mRNA by sunitinib (Figure 3A) is regulated at the transcriptional level. Therefore, we tested the hypothesis that sunitinib increases the de novo synthesis of caspase-3 mRNA. For this purpose, MCF7 cells were treated for 24 h with a single concentration of sunitinib (10 μM), which showed maximal induction, in the presence and absence of 5 μg/ml Act-D, an inhibitor of RNA synthesis. Thereafter, Figure 2. Effect of sunitinib (SUN) on MCF7 cell proliferation and caspase-3 mRNA expression was quantified by RT-PCR. If growth. MCF7 cells were treated for 24 h with different concentrations of sunitinib. Cell viability was determined using the MTT assay. Values sunitinib increased the amount of caspase-3 mRNA through are presented as a percentage of the control (mean±SEM, n=6). increasing its de novo RNA synthesis, we would expect to *Significantly different at p<0.05 compared to control (0 μM). observe a decrease in their mRNA content after inhibition of RNA synthesis. Figure 3C shows that pretreatment of the cells with RNA synthesis inhibitor Act-D did not alter expression of caspase-3 mRNA. On the other hand, co- Results treatment of MCF7 cells with 20 μM resveratrol, a well- known chempreventive compound and caspase-3 activator Sunitinib treatment induces inhibition of cell growth and (22), significantly potentiated sunitinib-induced caspase-3 proliferation. The concentration of sunitinib that inhibited mRNA expression (Figure 3D). MCF7 cell proliferation and growth was determined by the MTT assay after exposure of the MCF7 cells for 24 h to a wide range concentrations of sunitinib. Our results showed Sunitinib-induced caspase-3 gene expression is associated that concentrations up to 2.5 μM did not significantly affect with inhibition of NF-kB signaling pathway. Constitutive cell viability or proliferation (Figure 2). However, 5 and 10 activity of the NF-ĸB transcription factor in different cancer μM sunitinib significantly reduced cell viability by cells appears to be important for their growth or resistance approximately 25% and 30%, respectively, whereas, higher to induced apoptosis (23). To investigate whether the concentrations (20 μM and 40 μM) markedly inhibited cell induction of apoptosis by sunitinib was associated with proliferation by 70% and 80%, respectively. Based on these inhibition of NF-ĸB pathway, MCF7 cells were treated with findings, sunitinib concentrations of 2.5, 5, and 10 μM were sunitinib (2.5, 5, and 10 μM) and thereafter mRNA and utilized in all subsequent experiments on MCF7 cells protein expression levels of NF-ĸB were determined by RT- (Figure 2). PCR and western blot analyses. Our results show that sunitinib significantly inhibited NF-ĸB mRNA and protein Effects of sunitinib treatment on apoptosis in MCF7 cells. To expression in a concentration-dependent manner to examine whether the inhibitory effect of sunitinib on MCF7 approximately 15% that of control levels at the highest cell proliferation and growth is an apoptosis-mediated concentration (10 μM) (Figure 3E and F). mechanism, a series of independent experiments were conducted as follows. In order to determine the capacity of Sunitinib treatment increases the percentage of apoptotic sunitinib to modulate the expression of apoptotic and anti- MCF7 cells. To further explore whether the sunitinib-induced apoptotic genes, MCF7 cells were incubated for 24 h with reduction in cell viability is due to increased apoptotic or either vehicle (DMSO) or increasing concentrations of necrotic cell populations, the percentage of cells undergoing sunitinib (2.5, 5, and 10 μM), thereafter caspase-3 and B-cell apoptosis/necrosis in response to a single concentration of lymphoma 2 ( BCL2 ) mRNA expressions were determined by sunitinib (5 μM) was determined by staining with annexinV– RT-PCR. Figure 3A shows that sunitinib significantly FITC and PI using flow cytometry. Figure 4 shows that 5 induced caspase-3 but not BCL2 mRNA expression in a μM sunitinib significantly increased the percentage of cells concentration-dependent manner. The maximum induction undergoing early apoptosis from 8% to 12% and the was observed at the highest concentration tested (10 μM) by percentage of cells undergoing late apoptosis to approximately 3-fold. approximately 30% of the total cell population, as compared

4902 Korashy et al : Sunitinib Induces Apoptosis and Cell-cycle Arrest in MCF7 Cells

Figure 3. Effects of sunitinib (SUN) on the expression of apoptosis-related genes in MCF7 cells. A: MCF7 cells were treated for 24 h with different concentrations of sunitinib. Total RNA was isolated using TRIzol reagent and mRNA of caspase-3 and B-cell lymphoma 2 (BCL2) genes was quantified by real-time polymerase chain reaction (RT-PCR) and expression normalized to that of β- actin housekeeping gene. Duplicate reactions were performed for each experiment and the values represent mean of fold change±SEM, n=6. B: MCF7 cells were treated for 24 h with sunitinib, and thereafter caspase-3 activity was determined calorimetrically using the CaspACE assay system (Biovision ®). Values are presented as mean±SEM (n=6). C and D: MCF7 cells were treated for 24 h with sunitinib (10 μM) in the presence and absence of either actinomycin D (Act-D) or resveratrol (RES). Caspase-3 was quantified by RT-PCR and normalized to β- actin housekeeping gene. Duplicate reactions were performed for each experiment and the values represent mean fold change±SEM, n=6. E: MCF7 cells were treated for 24 h with different concentrations of sunitinib. Total RNA was isolated using TRIzol reagent and mRNA of nuclear factor kappa B (NF-ĸB) gene was quantified by RT-PCR and expression normalized to that of β- actin housekeeping gene. F: MCF7 cells were treated for 24 h with sunitinib. Total protein was isolated and NF-ĸB protein expression was determined by western blot analysis. The intensity of protein bands was quantified relative to the signals obtained for β- actin protein using C- DiGit ® blot scanner (LI-COR Biotechnology, Lincoln, NE, USA). One of three representative experiments is shown. Values are presented as the mean±SEM, n=3. *Significantly different at p<0.05 compared to control (0 μM). NS: Not significantly different.

4903 ANTICANCER RESEARCH 37 : 4899-4909 (2017)

Figure 4. Effect of sunitinib (SUN) on the percentage of apoptotic MCF7 cells. MCF7 cells were treated for 24 h with sunitinib, thereafter the percentage of cells undergoing apoptosis/necrosis pathway was determined. Cells were stained with annexin V – Fluorescein isothiocyanate (FITC)/propidium iodide (PI) and immediately analyzed on a Beckman Coulter FC500 Cytomics Benchtop Flow Cytometer. *Significantly different at p<0.05 compared to control (0 μM).

to the control. Therefore, approximately 42% of the total cell cell proliferation and growth is attributed to cell-cycle arrest, population became apoptotic with sunitinib treatment. we addressed this hypothesis by two approaches. Firstly, we measured the mRNA and protein expression levels of two Sunitinib treatment induces the expression of p53 tumor- cell-cycle markers, cyclin D1 and cyclin E1, in response to suppressor gene at the transcriptional level. Since the tumor- increasing concentrations of sunitinib (2.5, 5, and 10 μM). suppressor gene, p53, slows down cell proliferation and Figure 6A shows that sunitinib at 2.5 μM significant induced mediates apoptosis (24), we examined the effect of sunitinib cyclin D1 and cyclin E1 mRNA expression by approximately on p53 gene expression. Figure 5A shows that sunitinib 35% and 60%, respectively. In contrast, higher significantly induced p53 mRNA expression only at higher concentrations of 5 and 10 μM significantly reduced the concentrations, 5 and 10 μM by approximately 1.7-and 2.1- mRNA expression in a concentration-dependent manner by fold, respectively. Similarly at the protein level, sunitinib approximately 65% and 80%, respectively for cyclin D1 and caused significant induction of p53 protein expression at 2.5, by approximately 50% and 65%, respectively for cyclin E1. 5 and 10 μM by approximately 3.5-, 3-, and 2-fold, Similarly, sunitinib concentration-dependent inhibition of respectively (Figure 5B). cyclin D1 and cyclin E1 protein expression was observed Next, we questioned whether the induction of human p53 (Figure 6B). These results correlated with the inhibition of gene by sunitinib (Figure 5A) is regulated at the cell proliferation induced by sunitinib in MCF7 cells. transcriptional level. Therefore, we tested the hypothesis that The second approach was to examine the effect of sunitinib increases de novo p53 RNA synthesis. For this sunitinib on the cell-cycle profile by flow cytometry. After purpose, MCF7 cells were treated for 24 h with a single 24 h treatment with sunitinib cells in the G 2/M population concentration of sunitinib (10 μM), which showed maximal increased in a concentration-dependent manner (Figure 6C). induction, in the presence and absence of 5 μg/ml Act-D. The increase of MCF7 cell population at the G 2/M phase was Thereafter, p53 mRNA expression was quantified by RT-PCR. accompanied by a concentration-independent decrease of If sunitinib increased the amount of p53 mRNA through cells in the G 0/G 1 phase (Figure 6C). On the other hand; the increasing its de novo RNA synthesis, we would expect to population of cells at the S phase was not significantly observe a decrease in the content of mRNA after the inhibition changed by sunitinib treatment. of RNA synthesis. Figure 5C shows that pretreatment of the cells with Act-D, an RNA synthesis inhibitor, completely Effects of sunitinib treatment on the expression of DNA repair blocked sunitinib-induced p53 mRNA expression. genes. Induction of cell-cycle arrest allows more time for DNA Sunitinib treatment induces MCF7 cell-cycle arrest. To repair activation (25). To further examine whether induction of examine whether the inhibitory effect of sunitinib on MCF7 cell-cycle arrest and inhibition of cell proliferation was

4904 Korashy et al : Sunitinib Induces Apoptosis and Cell-cycle Arrest in MCF7 Cells

Figure 5. Effect of sunitinib (SUN) on the tumour-suppressor gene p53. A: Figure 6. Effect of sunitinib (SUN) on the mRNA expression of cell-cell MCF7 cells were treated for 24 h with different concentrations of sunitinib. cycle markers and arrest. A: MCF7 cells were treated for 24 h with Total RNA was isolated using TRIzol reagent and p53 mRNA was quantified different concentrations of sunitinib. Cylin D1 (CCND1) and cyclin E1 by RT-PCR and normalized to β- actin housekeeping gene. Duplicate (CCNE1) mRNA levels were quantified by real-time polymerase chain reactions were performed for each experiment and the values represent mean reaction as described in the Materials and Methods section. Values of fold change±SEM, n=6. B: MCF7 cells were treated for 24 h with represent mean fold change±SEM (n=6). B: MCF7 cells were treated sunitinib. p53 protein expression was determined by western blot analysis as for 24 h with sunitinib. Cyclin D1 and cyclin E1 protein expression described in the Materials and Methods section. One of three representative levels were determined by western blot analysis as described in the experiments is shown. Values are presented as the mean±SEM, n=3. C: Materials and Methods section. One of three representative experiments MCF7 cells were treated for 6 h with sunitinib (10 μM) in the presence and is shown. Values are presented as the mean±SEM, n=3. C: MCF7 cells absence of actinomycin D (Act-D). p53 mRNA level was quantified by RT- were treated with sunitinib for 24 h, thereafter changes in cell-cycle PCR as described before. Values represent mean of fold change±SEM. (n=6). distribution were determined by flow cytometry. *Significantly different Significantly different at *p<0.05 compared to control (0 μM). at p<0.05 compared to control (0 μM).

4905 ANTICANCER RESEARCH 37 : 4899-4909 (2017)

Figure 7. Effect of sunitinib (SUN) on DNA repair genes. MCF7 cells were treated for 24 h with different concentrations of sunitinib. Total RNA was isolated using TRIzol reagent and the x-ray repair cross- complementing protein 1 (XRCC1) and human apurinic endonuclease 1 (APE1) mRNA levels were quantified by real-time polymerase chain reaction and normalized to β- actin housekeeping gene. Duplicate reactions were performed for each experiment and the values represent mean fold change±SEM (n=6). *Significantly different at p<0.05 compared to control (0 μM).

associated with an increased expression of DNA repair genes, we quantified the mRNA expression of human apurinic endonuclease 1 ( APE1 ) and x-ray repair cross-complementing protein 1 ( XRCC1 ) genes in response to increasing Figure 8. Effect of sunitinib (SUN) on the mRNA expression of oxidative concentrations of sunitinib. Figure 7 shows that sunitinib stress genes. MCF7 cells were treated for 24 h with different significantly induced APE1 and XRCC1 mRNA expression at concentrations of sunitinib. Total RNA was isolated using the TRIzol the higher concentrations by approximately 50%. reagent and the heme oxygenase 1 (HO1), glutathione transferease A1 (GSTA1), and nuclear factor erythroid 2–related factor 2 (NRF2) mRNA levels were quantified by real-time polymerase chain reaction and Effects of sunitinib treatment on the expression of oxidative normalized to β- actin housekeeping gene. Duplicate reactions were stress genes. The role of oxidative stress in the sunitinib performed for each experiment and the values represent mean fold inhibition of MCF7 cell proliferation and growth was change±SEM (n=6). *Significantly different at p<0.05 compared to examined by measuring the capacity of sunitinib to modulate control (0 μM). the expression of oxidative and antioxidant genes. Thus, MCF7 cells were incubated for 24 h with increasing concentrations of sunitinib, thereafter heme oxygenase 1 (HO1 ), glutathione transferease A1 ( GSTA1 ), and of sunitinib, thereafter NRF2 mRNA level was quantified by NAD(P)H:quinone oxidoresuctase 1 ( NQO1 ) mRNA levels RT-PCR. Figure 8B shows that sunitinib significantly were measured by RT-PCR. Figure 8 shows that sunitinib induced NRF2 mRNA expression by approximately 1.7-fold induced HO1 and GSTA1 mRNA expression only at higher only at the highest concentration (10 μM). concentrations (5 and 10 μM). For example, 10 μM sunitinib induced HO1 and GSTA1 expression by approximately 2- Discussion and 3-fold, respectively (Figure 8A). In contrast, sunitinib did not significantly alter NQO1 mRNA levels at any tested The present study demonstrates strong evidence that the concentrations (data not shown). tyrosine kinase inhibitor sunitinib induces MCF7 human To examine the role of redox-sensitive transcription breast cancer cell growth inhibition through apoptosis, cell- factors, nuclear factor erythroid 2–related factor 2 (NRF2), cycle arrest, and oxidative stress mechanisms. This is in sunitinib-induced modulation of oxidative stress genes, supported by the following findings; a) induction of cells were incubated for 24 h with increasing concentrations apoptotic gene markers at the mRNA, protein, and activity

4906 Korashy et al : Sunitinib Induces Apoptosis and Cell-cycle Arrest in MCF7 Cells levels associated with increased percentage of apoptotic The cell cycle is a critical process that a cell undergoes cells; b) inhibition of cell proliferation-related genes and in order to copy itself exactly. Deregulation of the cell cycle arrest of MCF7 cells in the G 2/M phase in the cell-cycle, by abnormal expression of one or several cell-cycle allowing activation of DNA repair genes; and c) induction regulatory proteins is a common finding in malignant of oxidative stress markers and mediated transcription factors tumors and cancer development. Thus, it is well reported (Figure 8). that cell-cycle arrest and apoptosis are closely related events The in vitro MCF7 cell model was utilized in the current in which disruption of cell-cycle progression may ultimately study to evaluate the antiproliferative effects of sunitinib on lead to apoptotic death (12, 13). In the current study, ability human breast cancer cells and explore the mechanisms of sunitinib to induce cell-cycle arrest is evidenced by three involved since they are largely unknown in breast cancer. observations; firstly, sunitinib induced expression of tumor- The in vitro concentrations of sunitinib used in this study suppressor gene, p53 , at mRNA and protein levels in a were maintained within the therapeutic range of plasma concentration-dependent manner at the transcriptional level concentration reported in human. For example, humans given through increasing its de novo RNA synthesis. Secondly, 80 mg sunitinib for the treatment of advanced renal cell sunitinib-induced apoptosis was associated with a carcinoma had mean plasma concentrations ranging from 0.5 concentration-dependent inhibition of cell cycle-related to 1 μM (26). Although the current in vitro sunitinib genes cyclin D1 and cyclin E1 at the mRNA and protein concentrations were above the feasible therapeutic plasma expression levels, which are definitely the most widely level in human, higher in vitro concentrations could be studied cyclins in breast tumors (12, 32). Thirdly, sunitinib attributed to the excessive concentrations of , glucose, arrested MCF7 cell-cycle progression in the G 2/M phase FBS, and growth factor in culture media that stimulate cell through the suppression of cyclin D1 and E1, which may growth, and promote breast cancer aggression (27). In contribute to the apoptotic cell death process. Our results addition, the presence of oncogenic mutation in the cell- are in agreement with previous studies showed that over culture system may account for the reduced efficacy and expression of cyclin D1 gene and hormone receptors were higher concentration of sunitinib required to elicit cellular observed in breast tumors (33, 34) and were involved in cell responses in vitro in order to achieve the anticancer effects cycle and estrogen receptor activation, which induces of sunitinib in cell-culture systems (28). This provides a high mitogenic growth factors by consecutive activation of cell degree of in vivo relevance to the results arising from the cycle-dependent cyclin kinase complexes (13, 35). Thus, concentrations of sunitinib (1-5 μM) that might be attained down-regulation of cyclin genes by anticancer drugs may be during cancer treatment. Therefore, the present results are helpful in estrogen receptor-positive breast cancer cells, still clinically relevant. such as MCF7 cells. Similarly, previous studies showed that Activation of caspase-3 is well known to play a central , a tyrosine kinase inhibitor, induces G 2/M arrest in role in the initiation of apoptosis (29). The ability of breast cancer (36) and other cancer cell lines (37), whereas sunitinib to induce the expression of caspase-3 mRNA and resveratrol was able to induce S-phase cell-cycle arrest in activity, but not BCL2, suggests a death receptor-mediated different breast cancer cell lines (38). pathway (29). This is supported by the finding that Cells which are highly proliferating, such as cancer cells, treatment of MCF7 cells with various inducers of apoptosis have less time to repair their damaged DNA. Thus, inhibition significantly inhibited the cell growth without causing of cell proliferation-related genes and induction of cell-cycle morphological changes (30). Similarly to our observations, arrest will allow more time to repair damaged DNA lesions. it has been reported that resveratrol inhibited MCF7 cell In this context, we report here that sunitinib treatment proliferation through induction of apoptosis (22). In significantly induced the expression of the DNA repair genes addition, the increase in the percentage of apoptotic cell (XRCC1 and APE1 ), which are involved in the base excision population (annexinV/PI-positive cell) by 40% in response repair (BER) and single-strand break repair pathways (39). to sunitinib as compared to the control clearly confirms that Our results are in agreement with a recent study on breast sunitinib is a potent inducer of apoptosis and triggers cancer showing that loss of XRCC1 activity by non- events leading to apoptotic cell death. It is generally homologous end-joining pathway was an independent believed that apoptosis can be induced by the activation of predictor of poor clinical outcome (40). pro-apoptotic signaling or inhibition of survival signaling, The ability of sunitinib to induce oxidative stress in a such as transcription factor, NF-ĸB. In this context, we concentration-dependent manner as evidenced by the report here that sunitinib-induced apoptosis was associated increased mRNA expression of HO1 and GSTA1 could be with NF-ĸB inhibition at the mRNA and protein expression another mechanism mediating sunitinib-induced apoptosis levels. These results are in agreement with the fact that and inhibition of cell proliferation. Mechanistically, this caspase increases NF-ĸB cleavage and this inhibits its increase in the oxidative stress in the cells in response to survival activity (31). sunitinib is attributed to increase the expression of redox-

4907 ANTICANCER RESEARCH 37 : 4899-4909 (2017) sensitive transcription factor NRF2 which subsequently 5 Zhao X, Li L and Wang Z: Chemoprevention of breast cancer: induces antioxidants and promotes detoxifying enzymes current status and future prospects. Front Biosci 11 : 2249-2256, such as GSTA1 (41). These results are supported by 2006. 6 Puntoni M and Decensi A: The rationale and potential of cancer previous observations showing that induction of oxidative chemoprevention with special emphasis on breast cancer. Eur J stress genes in breast carcinoma cells inhibits their Cancer 45(Suppl 1) : 346-354, 2009. proliferation and induces apoptosis and cell-cycle arrest (1, 7 Blaha P, Dubsky P, Fitzal F, Bachleitner-Hofmann T, Jakesz R, 42) through activation of ubiquitin-dependent proteasome Gnant M and Steger G: Breast cancer chemoprevention - a vision degradation of cyclin D1 (43). In a manner similar to our not yet realized. Eur J Cancer Care (Engl) 18 : 438-446, 2009. observations, we recently reported that sunitinib inhibits 8 Kassem MG, Motiur Rahman AF and Korashy HM: Sunitinib proliferation of triple-negative MDA-MB231 breast cancer malate. Profiles Drug Subst Excip Relat Methodol 37 : 363-388, 2012. cells with induction of apoptosis through activation of 9 Mendel DB, Laird AD, Xin X, Louie SG, Christensen JG, Li G, Forkhead box type O (FOXO3A) transcription factor (44). Schreck RE, Abrams TJ, Ngai TJ, Lee LB, Murray LJ, Carver J, Silencing of FOXO3A mRNA using siRNA significantly Chan E, Moss KG, Haznedar JO, Sukbuntherng J, Blake RA, Sun rescued MDA-MB231 cells from sunitinib-induced cell- L, Tang C, Miller T, Shirazian S, McMahon G and Cherrington proliferative arrest (44). JM: In vivo antitumor activity of SU11248, a novel tyrosine kinase inhibitor targeting vascular endothelial growth factor and Conclusion platelet-derived growth factor receptors: determination of a pharmacokinetic/pharmacodynamic relationship. Clin Cancer Res 9: 327-337, 2003. In the of our findings, the current report provides first 10 Abrams TJ, Murray LJ, Pesenti E, Holway VW, Colombo T, Lee evidence that sunitinib causes breast cancer cell growth LB, Cherrington JM and Pryer NK: Preclinical evaluation of the suppression through induction of apoptosis, oxidative stress, tyrosine kinase inhibitor SU11248 as a single agent and in and cell-cycle arrest. Our findings increase our combination with "standard of care" therapeutic agents for the understanding of the possible therapeutic effect of sunitinib treatment of breast cancer. Mol Cancer Ther 2: 1011-1021, 2003. in breast cancer and open doors for further study. 11 Young E, Miele L, Tucker KB, Huang M, Wells J and Gu JW: SU11248, a selective tyrosine kinases inhibitor suppresses breast Conflicts of Interest tumor angiogenesis and growth via targeting both tumor vasculature and breast cancer cells. Cancer Biol Ther 10 : 703-711, 2010. 12 Landberg G and Roos G: The cell cycle in breast cancer. APMIS There are no financial or other interests with regard to this 105 : 575-589, 1997. manuscript that might be construed as a conflict of interest. All of 13 Evan GI and Vousden KH: Proliferation, cell cycle and apoptosis the Authors are aware of and agree to the content of the manuscript in cancer. Nature 411 : 342-348, 2001. and their being listed as an author on the manuscript. 14 Pucci B, Kasten M and Giordano A: Cell cycle and apoptosis. Neoplasia 2: 291-299, 2000. Acknowledgements 15 Chinchar E, Makey KL, Gibson J, Chen F, Cole SA, Megason GC, Vijayakumar S, Miele L and Gu JW: Sunitinib significantly This work was funded by the National Plan Science, Technology suppresses the proliferation, migration, apoptosis resistance, and Innovation (MAARIFAH), King Abdulaziz City for Science and tumor angiogenesis and growth of triple-negative breast cancers Technology, Kingdom of Saudi Arabia, Award Number (12- but increases breast cancer stem cells. Vasc Cell 6: 12, 2014. MED3131-02). 16 Korashy HM, Anwar-Mohamed A, Soshilov AA, Denison MS and El-Kadi AO: The p38 MAPK inhibitor SB203580 induces References cytochrome P450 1A1 gene expression in murine and human hepatoma cell lines through ligand-dependent aryl hydrocarbon 1 WHO: Latest world cancer statistics (http:// www.iarc.fr/ receptor activation. Chem Res Toxicol 24 : 1540-1548, 2011. en/media-centre/pr/2013/pdfs/pr223_E.pdf). The International 17 Maayah ZH, Ghebeh H, Alhaider AA, El-Kadi AO, Soshilov AA, Agency for Research on Cancer, 2013. Denison MS, Ansari MA and Korashy HM: Metformin inhibits 2 Jordan VC: A century of deciphering the control mechanisms of 7,12-dimethylbenz[a]anthracene-induced breast carcinogenesis sex steroid action in breast and prostate cancer: the origins of and adduct formation in human breast cells by inhibiting the and chemoprevention. Cancer Res 69 : 1243- cytochrome P4501A1/aryl hydrocarbon receptor signaling 1254, 2009. pathway. Toxicol Appl Pharmacol 284 : 217-226, 2015. 3 Jordan S, Lim L, Vilainerun D, Banks E, Sripaiboonkij N, 18 Livak KJ and Schmittgen TD: Analysis of relative gene Seubsman SA, Sleigh A and Bain C: Breast cancer in the Thai expression data using real-time quantitative PCR and the 2(-Delta Cohort Study: an exploratory case–control analysis. Breast 18 : Delta C(T)) Method. Methods 25 : 402-408, 2001. 299-303, 2009. 19 Korashy HM, Maayah ZH, Abd-Allah AR, El-Kadi AO and 4 Phipps AI, Buist DS, Malone KE, Barlow WE, Porter PL, Alhaider AA: Camel milk triggers apoptotic signaling pathways Kerlikowske K and Li CI: Family history of breast cancer in in human hepatoma HepG2 and breast cancer MCF7 cell lines first-degree relatives and triple-negative breast cancer risk. through transcriptional mechanism. J Biomed Biotechnol 2012 : Breast Cancer Res Treat 126 : 671-678, 2011. 593195, 2012.

4908 Korashy et al : Sunitinib Induces Apoptosis and Cell-cycle Arrest in MCF7 Cells

20 Korashy HM and El-Kadi AO: Differential effects of mercury, 34 Gillett CE, Lee AH, Millis RR and Barnes DM: Cyclin D1 and lead and copper on the constitutive and inducible expression of associated proteins in mammary ductal carcinoma in situ and aryl hydrocarbon receptor (AHR)-regulated genes in cultured atypical ductal hyperplasia. J Pathol 184 : 396-400, 1998. hepatoma Hepa 1c1c7 cells. Toxicology 201 : 153-172, 2004. 35 Trimarchi JM and Lees JA: Sibling rivalry in the E2F family. 21 Shashi B, Jaswant S, Madhusudana RJ, Kumar SA and Nabi Nat Rev Mol Cell Biol 3: 11-20, 2002. QG: A novel lignan composition from Cedrus deodara induces 36 Krol J, Francis RE, Albergaria A, Sunters A, Polychronis A, apoptosis and early nitric oxide generation in human Coombes RC and Lam EW: The transcription factor FOXO3A Molt-4 and HL-60 cells. Nitric Oxide 14 : 72-88, 2006. is a crucial cellular target of gefitinib (Iressa) in breast cancer 22 Kim YA, Choi BT, Lee YT, Park DI, Rhee SH, Park KY and cells. Mol Cancer Ther 6: 3169-3179, 2007. Choi YH: Resveratrol inhibits cell proliferation and induces 37 Zhou X, Zheng M, Chen F, Zhu Y, Yong W, Lin H, Sun Y and apoptosis of human breast carcinoma MCF-7 cells. Oncol Rep Han X: Gefitinib inhibits the proliferation of 11 : 441-446, 2004. cells via cell cycle arrest. Anat Rec (Hoboken) 292 : 1122-1127, 23 Morotti A, Cilloni D, Pautasso M, Messa F, Arruga F, Defilippi 2009. I, Carturan S, Catalano R, Rosso V, Chiarenza A, Taulli R, 38 Joe AK, Liu H, Suzui M, Vural ME, Xiao D and Weinstein IB: Bracco E, Rege-Cambrin G, Gottardi E and Saglio G: NF-kB Resveratrol induces growth inhibition, S-phase arrest, apoptosis inhibition as a strategy to enhance etoposide-induced apoptosis and changes in biomarker expression in several human cancer in K562 cell line. Am J Hematol 81 : 938-945, 2006. cell lines. Clin Cancer Res 8: 893-903, 2002. 24 Rao VA and Plunkett W: Activation of a p53-mediated apoptotic 39 Ladiges WC: Mouse models of XRCC1 DNA repair pathway in quiescent lymphocytes after the inhibition of DNA polymorphisms and cancer. Oncogene 25 : 1612-1619, 2006. repair by fludarabine. Clin Cancer Res 9: 3204-3212, 2003. 40 Sultana R, Abdel-Fatah T, Abbotts R, Hawkes C, Albarakati N, 25 Branzei D and Foiani M: Regulation of DNA repair throughout Seedhouse C, Ball G, Chan S, Rakha EA, Ellis IO and the cell cycle. Nat Rev Mol Cell Biol 9: 297-308, 2008. Madhusudan S: Targeting XRCC1 deficiency in breast cancer 26 Hasinoff BB, Patel D and O’Hara KA: Mechanisms of myocyte for personalized therapy. Cancer Res 73 : 1621-1634, 2013. cytotoxicity induced by the multiple 41 Chanas SA, Jiang Q, McMahon M, McWalter GK, McLellan LI, inhibitor sunitinib. Mol Pharmacol 74 : 1722-1728, 2008. Elcombe CR, Henderson CJ, Wolf CR, Moffat GJ, Itoh K, 27 Wahdan-Alaswad R, Fan Z, Edgerton SM, Liu B, Deng XS, Yamamoto M and Hayes JD: Loss of the Nrf2 transcription Arnadottir SS, Richer JK anderson SM and Thor AD: Glucose factor causes a marked reduction in constitutive and inducible promotes breast cancer aggression and reduces metformin expression of the glutathione S-transferase Gsta1, Gsta2, Gstm1, efficacy. Cell Cycle 12 : 3759-3769, 2013. Gstm2, Gstm3 and Gstm4 genes in the of male and female 28 Will Y, Dykens JA, Nadanaciva S, Hirakawa B, Jamieson J, mice. Biochem J 365 : 405-416, 2002. Marroquin LD, Hynes J, Patyna S and Jessen BA: Effect of the 42 Hill M, Pereira V, Chauveau C, Zagani R, Remy S, Tesson L, multitargeted tyrosine kinase inhibitors , , sunitinib Mazal D, Ubillos L, Brion R, Asghar K, Mashreghi MF, Kotsch and on mitochondrial function in isolated rat heart K, Moffett J, Doebis C, Seifert M, Boczkowski J, Osinaga E and mitochondria and H9c2 cells. Toxicol Sci 106 : 153-161, 2008. Anegon I: Heme oxygenase-1 inhibits rat and human breast 29 Lowe SW and Lin AW: Apoptosis in cancer. Carcinogenesis 21 : cancer cell proliferation: mutual cross inhibition with 485-495, 2000. indoleamine 2,3-dioxygenase. Faseb J 19 : 1957-1968, 2005. 30 Oberhammer F, Wilson JW, Dive C, Morris ID, Hickman JA, 43 Pyo CW, Choi JH, Oh SM and Choi SY: Oxidative stress- Wakeling AE, Walker PR and Sikorska M: Apoptotic death in induced cyclin D1 depletion and its role in cell cycle processing. epithelial cells: cleavage of DNA to 300 and/or 50 kb fragments Biochim Biophys Acta 1830 : 5316-5325, 2013. prior to or in the absence of internucleosomal fragmentation. 44 Korashy HM, Belali OM, Ansar MA and Alharbi NO: FOXO3A Embo J 12 : 3679-3684, 1993. is essential for the antiproliferative and apoptogenic effects of 31 Kang KH, Lee KH, Kim MY and Choi KH: Caspase-3-mediated sunitinib in MDA-MB231 cell line. Anticancer Res 36 : 6097- cleavage of the NF-kappa B subunit p65 at the NH 2 terminus 6108, 2016. potentiates naphthoquinone analog-induced apoptosis. J Biol Chem 276 : 24638-24644, 2001. 32 Landberg G, Nielsen NH, Nilsson P, Emdin SO, Cajander J and Roos G: Telomerase activity is associated with cell cycle deregulation in human breast cancer. Cancer Res 57 : 549-554, 1997. 33 Jares P, Rey MJ, Fernandez PL, Campo E, Nadal A, Munoz M, Mallofre C, Muntane J, Nayach I, Estape J and Cardesa A: Cyclin D1 and retinoblastoma gene expression in human breast Received June 8, 2017 carcinoma: correlation with tumour proliferation and oestrogen Revised July 5, 2017 receptor status. J Pathol 182 : 160-166, 1997. Accepted July 6, 2017

4909