Materials and Methods Cell Culture and Transfection. the Human
Total Page：16
File Type：pdf, Size：1020Kb
Materials and methods Cell culture and transfection. The human osteosarcoma cell line U2OS, human cervical cancer cell line HeLa, mouse embryo fibroblast cell line NIH3T3, and human embryonic kidney HEK293T cell line were obtained from ATCC. The cells were cultured in DMEM (ThermoFisher Scientific) supplemented with 10% FBS and NEAA according to the provided protocol. For serum starvation, cells were cultured with DMEM without serum for several time points. For amino acids starvation, cells were cultured with medium without amino acids for 48h. For high salt treatment, cells were cultured with 190mM NaCl for 48h. For 1,6-hexanediol treatment, cells were treated with 10% 1,6-hexanediol for 2min at room temperature. Plasmids were transfected into cells using polyethyleneimine (PEI) according to the operation instructions. Plasmid construction. ORFs were amplified by PCR from cDNA (derived from AML12 cells cells). The PCR products were digested with BamHI (AscI) and MluI and cloned into the retroviral vector Lv-EF1a-GFP-MCS-IRES-puro. For RNAi experiments, shRNA plasmids were constructed by cloning the target sequences to the pLKO.1-puro vector: GAAATTCCAGACAATGTT AGA (shKDM7A-1), GTATAACTTCCACATTACAGT (shKDM7A-2) and ACTCGACAC TATAGTATCTCA (shControl). FRAP. The FRAP assay was performed in a live-cell chamber with confocal laser scanning microscopy. The bleaching duration was about 4 s in an area of one nuclear body. Images were captured at 1.3-s interval for 40 time points. The data were processed with LAS AF Lite. Live-cell imaging. Live-cell imaging experiments were performed on a GE DeltaVision inverted microscope. Images of U2OS cells were captured every 10 min for a total of 10 h. The data were processed with the Volocity software. Western blotting. Cells lysates were separated by SDS-PAGE and then transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore). After washing and blocking, the membranes were incubated with primary antibodies as follows: anti-β-actin (66009-1-Ig, Proteintech), anti-GAPDH (9600, AGOMA), anti-H3 (AF0009, Beyotime), anti-MCM7 (sc-9966, Santa Cruz) and anti-KDM7A (raised against amino acids 417-735 in rabbit, ABclonal). The blots were detected with HRP-coupled secondary antibodies. Immunofluorescence. Immunofluorescence was performed as described elsewhere (Zhang et al., 2015). Besides those used for western blotting, other primary antibodies were: anti-SC35 (ab11826, Abcam), anti-PML (A1184, ABclonal; 05-718, Merck Millipore), anti-PSPC1 (SC-374387, Santa Cruz), anti-COIL (SC-55594, Santa Cruz), anti-Sam68 (sc-1238, Santa Cruz), anti-BMI1 (sc-390443, Santa Cruz) anti-C23 (10556-1-AP, Proteintech), anti-H3 (ab1791, Abcam) and MCM7 (sc-9966, Santa Cruz). The slides were assessed with a confocal laser scanning microscopy (Leica, SP5 and SP8). Cell cycle assay. The samples were prepared with the cell cycle and apoptosis analysis kit (Beyotime), and then analyzed using a FACSCalibur flow cytometer (BD). TEM with HRP-DAB. The NIH3T3 cells and mouse testis (Department of Laboratory Animal Science provided guidance on the study protocol) were fixed with 4% formaldehyde and incubated with the KDM7A antibody. The primary antibody was detected using an HRP secondary antibody. Then, DAB (P0203, Beyotime) was used for the HRP staining, which is EM-visible. After that, the samples were prepared for conventional TEM. The sections were stained and imaged at the EM facility of ION (Institute of Neuroscience, Shanghai, China). Immunoprecipitation and mass spectrometry. The U2OS cells were transfected with GFP-only or GFP-KDM7A plasmids for 24 h and then harvested. The nuclear extracts were prepared from 20 million cells and were incubated with 20 L GFP-TRAP_M (gtm-20, Chromotek) in 50 mM Tris HCl (pH 7.5), 125 mM NaCl, 0.2% NP-40, 5% glycerol, 1.5 mM MgCl2, and protease inhibitors. The LC-MS/MS experiments and data analysis were performed as described elsewhere (Zhang et al., 2015). The experiments were conducted using three biological replicates, and the proteins appeared three times in the GFP-KDM7A group but not more than once in the GFP-only group were considered as candidates. For IP/MS assay in HeLa cells under 0% FBS, cells were harvested after cultured in 0% FBS for 48h, with IgG as control. The proteins appeared more than two times in KDM7A group but not more than once in control group were considered as candidates. Protein purification. The KDM7A and C-terminal of KDM7A cDNA was cloned into the pCAG-6xHis-GFP -KDM7A plasmid and then transfected into HEK293T cells. The proteins were purified with Ni Aogarose 6 FF (AOGMA) with the AKTA system (GE Healthcare Life Sciences). The proteins were then concentrated in an Amicon Ultracel-50K spin concentrator and was exchanged to storage buffer [50 mM Tris-HCl( pH 7.5), 200 mM NaCl, 1 mM DTT, 10% glycerol]. The concentrated proteins were stored in -80°C freezer after flash freezing in liquid nitrogen. Liquid droplet assay. For the droplet assay, proteins were dropped on the living cell chamber at concentrations of 0.25, 0.5, 1, 2, 3 μM in the reaction buffer [50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM DTT], and then imaged with a confocal laser scanning microscopy (Leica, SP5). For DNA contained droplet assays, genomic DNA was extracted from NIH3T3 cells and was sheered by sonication to lengths within the range of 300-700 bp. DNA was added to the protein solution at different concentrations and then imaged with a confocal laser scanning microscope (Leica, SP5). Supplementary figure legends Fig. S1: KDM7A marks a type of nuclear bodies (K-bodies) in serum starved Hela cells. (A) The separated images of co-staining of KDM7A and SC35, PSPC1, PML, Coilin, BMI1 and Sam68 in Hela cells treated with 0% FBS for 48h, respectively, in Figure 1D. Scale bar, 10 µm. (B) Co-stain of KDM7A and Pol II in Hela cells treated with 0% FBS for 48h. Scale bar, 10 µm. Right, Relative fluorescence intensity of KDM7A and Pol II from a to b. (C) Representative images of KDM7A in Hela cells treated with amino acids starvation for 0h and 48h. Scale bar, 10 µm. (D) The sizes of KDM7A foci in Hela cells under normal and amino acids starvation condition. 16-18 cells were analyzed. ns p>0.05 by unpaired t-test. (E) Representative images of KDM7A in Hela cells treated with 190mM NaCl for 0h and 48h. Scale bar, 10 µm. (F) The sizes of KDM7A foci in Hela cells treated with 190mM NaCl for 0h and 48h. 16-20 cells were analyzed. ****p<0.0001 by unpaired t-test. Fig.S2: KDM7A condensates in U2OS cells transfected with nGFP-KDM7A. (A) Western blot of H3K9me2 and H3K27me2 in Control and nGFP-KDM7A transfected 293T cells. H3 as the loading control. (B) The localization of nGFP-KDM7A expressed in U2OS cells. Scale bar, 10 µm. (C) The validation of KDM7A antibody. Representative images of immunofluorescence with KDM7A antibody in U2OS cells transfected with nGFP-KDM7A. Right: Relative fluorescence intensity of nGFP-KDM7A and KDM7A antibody from a to b. Scale bar, 10 µm. (D) The separated images of U2OS cells transfected with nGFP-KDM7A and stained with SC35, PSPC1, PML, Coilin, BMI1 and Sam68 in Figure 1E. Scale bar, 10 µm. Fig. S3: K-bodies interact with proteins associated with important biological processes. (A) Silver staining of SDS-PAGE gel separating proteins immunoprecipitated with GFP-trap in U2OS cells. GFP-only as the negative control. (B) Clustering analysis of nGFP-KDM7A-associated proteins with normalized number of peptides detected by LC-MS. Three biological replicates were conducted for nGFP-KDM7A (K1-K3) and GFP-only (G1-G3), respectively. (C) Gene Ontology (GO) analysis of biological processes of KDM7A-associated proteins in U2OS cells. The enriched terms are ranked by -log10 (p values). (D) Venn diagram of overlap proteins of KDM7A-associated proteins in Hela cells under 0% FBS and U2OS cells transfected with nGFP-KDM7A. Fig. S4: KDM7A is partially required for the formation of MCM7 puncta. (A) The localization of KDM7A and HNRNPU in U2OS cells transfected with nGFP-KDM7A. Scale bar, 10 µm. Right, relative fluorescence intensity of KDM7A and HNRNPU from a to b. (B) Co-staining of KDM7A and MCM7 in shControl, shKDM7A-1 and shKDM7A-2 Hela cells treated with 0% FBS for 48h. Scale bar, 10 µm. (C) The relative size of MCM7 foci in shControl, shKDM7A-1 and shKDM7A-2 Hela cells treated with 0% FBS for 48h. 15-16 cells were analyzed. ****p<0.0001 by unpaired t-test. (D) Western blot of KDM7A and MCM7 in shControl Hela cells under 10% FBS and shControl, shKDM7A-1, shKDM7A-2 Hela cells under 0% FBS, respectively. GAPDH as the loading control. Fig. S5: KDM7A condensates are surrounded by chromatin. (A) Representative results of immunofluorescence analysis with H3 antibody in KDM7A transfected (up) and control (down) cell. Scale bar, 10 µm. Right, relative fluorescence intensity of H3 and KDM7A crossed by the arrow on the left. Fig. S6: K-bodies are formed by LLPS. (A) Schematic representation and representative images of the appearance process of K-bodies in the inducible U2OS cell line. Scale bar, 10 µm. (B) Representative images of U2OS cells transfected with FL or C-terminal nGFP-KDM7A, respectively. Scale bar, 10 µm. (C) Quantification of the number (left) and size (right) of granules formed by FL or C-terminal nGFP-KDM7A. A total of 11 cells about 200 nuclear bodies were counted for each group. *p<0.05, ****p<0.0001 by unpaired t-test. (D) The N-terminal of KDM7A aggregates into the nucleoli as detected by C23 immunofluorescence. Scale bar, 10 µm.