New Primers for the Class Actinobacteria: Application to Marine and Terrestrial Environments
Total Page：16
File Type：pdf, Size：1020Kb
Blackwell Science, LtdOxford, UKEMIEnvironmental Microbiology1462-2920Blackwell Publishing Ltd, 2003510828841Original ArticlePCR primers for the class ActinobacteriaJ. E. M. Stach et al . Environmental Microbiology (2003) 5(10), 828–841 doi:10.1046/j.1462-2920.2003.00483.x New primers for the class Actinobacteria: application to marine and terrestrial environments James E. M. Stach,1* Luis A. Maldonado,2 cytosine and form a distinct phyletic line in the 16S rDNA Alan C. Ward,2 Michael Goodfellow2 and Alan T. Bull1 tree (Embley and Stackebrandt, 1994; Stackebrandt et al., 1Research School of Biosciences, University of Kent, 1997). Members of the taxon are of interest primarily Canterbury, Kent CT2 7NJ, UK. because of their importance in agriculture, ecology, indus- 2School of Biology, University of Newcastle, Newcastle try and medicine (McNeill and Brown, 1994; Strohl, 2003). upon Tyne NE1 7RU, UK. Actinobacteria are widely distributed in terrestrial (McVeigh et al., 1996; Heuer et al., 1997; Hayakawa et al., 2000), freshwater (Goodfellow et al., 1990; Wohl and Summary McArthur, 1998) and marine (Goodfellow and Haynes, In this study, we redesigned and evaluated primers for 1984; Takizawa et al., 1993; Colquhoun et al., 1998) hab- the class Actinobacteria. In silico testing showed that itats where they are involved in the turnover of organic the primers had a perfect match with 82% of genera matter (McCarthy, 1987; Schrempf, 2001) and xenobiotic in the class Actinobacteria, representing a 26–213% compounds (Kastner et al., 1994; Bunch, 1998; De Schr- improvement over previously reported primers. Only ijver and De Mot, 1999). Some actinobacteria are serious 4% of genera that displayed mismatches did so in the pathogens of animals, including humans, and plants terminal three bases of the 3¢¢¢ end, which is most (Locci, 1994; McNeill and Brown, 1994; Trujillo and critical for polymerase chain reaction success. The Goodfellow, 2003), whereas others form nitrogen-fixing primers, designated S-C-Act-0235-a-S-20 and S-C- associations with non-leguminous plants (Benson and Act-0878-a-A-19, amplified an ª640 bp stretch of the Silvester, 1993). 16S rRNA gene from all actinobacteria tested (except Currently, actinobacteria, especially spore-forming act- Rubrobacter radiotolerans) up to an annealing tem- inomycetes, represent the most economically and bio- perature of 72∞C. An Actinobacteria Amplification technologically valuable prokaryotes, producing over half Resource (http://microbe2.ncl.ac.uk/MMB/AAR.htm) the bioactive compounds present in the Antibiotic Litera- was generated to provide a visual guide to aid the ture Database (Lazzarini et al., 2000), notably antibiotics amplification of actinobacterial 16S rDNA. Application (Lazzarini et al., 2000; Strohl, 2003), antitumour agents of the primers to DNA extracted from marine and ter- (Zheng et al., 2000; Dieter et al., 2003), enzymes restrial samples revealed the presence of actinobac- (Peczynska-Czoch and Mordarski, 1988; Oldfield et al., teria that have not been described previously. The use 1998) and enzyme inhibitors and immunomodifiers of 16S rDNA similarity and DNA–DNA pairing correla- (Umezawa, 1988). However, the rediscovery rate of bio- tions showed that almost every actinomycete clone active compounds from microorganisms currently in cul- represented either a new species or a novel genus. ture has been estimated to be 95% (Fenical et al., 1999). The results of this study reinforce the proposition that In order to isolate novel actinobacteria for biotechnology, current culture-based techniques drastically underes- we need first to understand their ecology, which encom- timate the diversity of Actinobacteria in the environ- passes diversity, species richness and distribution. Molec- ment and highlight the need to evaluate taxon- ular techniques overcome culture bias and can be used specific primers regularly in line with improvements to investigate actinobacterial ecology; this approach has in databases holding 16S rDNA sequences. been used to detect actinobacteria in environmental sam- ples where corresponding culture-based procedures have been unsuccessful (Relman et al., 1992; Heuer et al., Introduction 1997; Rheims et al., 1999), and has highlighted novel The class Actinobacteria encompasses bacteria that are actinobacterial lineages (McVeigh et al., 1996; Rheims diverse with respect to their biochemistry, morphology and et al., 1996; 1999; Rheims and Stackebrandt, 1999; Lude- relationship to oxygen, but have DNA rich in guanine plus mann and Conrad, 2000). In contrast, there are instances where actinobacteria have been isolated from environ- mental samples but have not been detected in clone librar- Received 4 April, 2003; accepted 22 May, 2003. *For correspon- dence. E-mail [email protected]; Tel. (+44) 1227 823336; Fax ies generated from the same sample (Felske et al., 1997; (+44) 1227 763912. Li et al., 1999). Actinobacteria-specific/biased primers © 2003 Society for Applied Microbiology and Blackwell Publishing Ltd PCR primers for the class Actinobacteria 829 have been designed to increase the likelihood of detecting specific primers based on an alignment of an equal fre- actinobacterial 16S rDNA in community DNA extracted quency of 16S rRNA genes from all genera; (ii) evaluate from environmental samples (McVeigh et al., 1996; Heuer and compare the newly designed primers in silico; (iii) test et al., 1997; Ludemann and Conrad, 2000). To this end, primer specificity on a comprehensive library of actinobac- McVeigh et al. (1996) found that 46 out of 53 clones gen- teria and non-actinobacteria type strains; (iv) evaluate the erated from amplified DNA of community DNA extracted in situ specificity of the primers in terrestrial and marine from a temperate forest soil were actinobacterial in origin. environments; and (v) produce an Actinobacteria Amplifi- When the same primers were used to amplify 16S rDNA cation Resource that will allow investigators to adjust the from a rhizosphere soil, only 2% of the clones were of primer set in order to amplify members of specific actino- actinobacterial origin (Macrae et al., 2001). Amplification bacterial genera. of 16S rDNA from environmental samples has shown that The actinobacteria primers designed in this study gave primers specific for actinobacteria have had a success a 26–213% increase in the coverage of actinobacteria rate of between 2% and 87% (McVeigh et al., 1996; over corresponding primers and allowed the detection of Ludemann and Conrad, 2000; Peters et al., 2000; Macrae many novel actinobacterial lineages that have been unde- et al., 2001). tected previously (McVeigh et al., 1996; Heuer et al., The utility of actinobacteria-specific primers is defined 1997; Ludemann and Conrad, 2000). It is apparent from by both their specificity (i.e. minimal hybridization to non- these results that actinobacterial diversity based on target DNA) and their coverage (i.e. how many members detected or cultivated species is underestimated by at of the class Actinobacteria are amplified by the primers). least an order of magnitude. These properties are directly influenced by the quality and quantity of sequences used to design the primers, e.g. if three actinobacterial sequences are used, primers will Results have high specificity but low coverage. Secondly, primers Testing of primers in silico designed from alignments dominated by specific genera or species will be biased towards those species and have The theoretical specificities of primers S-C-Act-0235-a-S- reduced coverage. The rapid growth in the number of 16S 20 and S-C-Act-0878-a-A-19 were tested by submission rDNA sequences available in the Ribosomal Database to the CHECK_PROBE algorithm of the RDP, using default Project (RDP; Maidak et al., 2001) serves as a warning parameters and allowing zero mismatches. Previously to evaluate regularly and, if necessary, redesign primers; described actinobacteria-specific primers were also sub- when the first sets of actinobacteria-specific primers mitted for comparison. The sequence, target position and were designed (McVeigh et al., 1996; Heuer et al., 1997), CHECK_PROBE results for each of the primers are given in the RDP contained ª250 actinobacterial 16S rDNA Table 1. Primer S-C-Act-0235-a-S-20 displayed a 26% sequences (McVeigh et al., 1996; Maidak et al., 2001). increase in the number of perfect actinobacteria matches Presently, the RDP contains ª2300 actinobacterial over primer ACT283F, and displayed a 213% increase sequences (Maidak et al., 2001), while the forthcoming over primer F243. Primer S-C-Act-0878-a-A-19 gave an release will comprise 7500 sequences (Cole et al., 2003). 18% increase over primer ACT1360R and 13% over Clearly, primers designed from a small set of sequences primer AB1165r. Primers S-C-Act-0235-a-S-20 and S-C- will no longer reflect the diversity of those currently Act-0878-a-A-19 amplify the V3 to V5 regions of the 16S present in the databases and, therefore, an evaluation of rRNA gene (Brosius et al., 1981). Representatives of 168 actinobacteria-specific primers is warranted. genera were used in the alignment, and only 18% of these The aims of this study were to: (i) design actinobacteria- showed one or more mismatches with primer S-C-Act- Table 1. Comparison of actinomycete-specific primers. Identical Identical Percentage actinomycete Primera Sequence (5¢Æ3¢) matchesb actinomtycetesb matches Reference AB1165r ACCTTCCTCCGAGTTRAC 2013 99.5 2003 Ludemann and Conrad (2000) ACT1360R CTGATCTGCGATTACTAGCGACTCC 1731 99.7 1725 McVeigh et al.