DOCSLIB.ORG

Primepcr™Assay Validation Report

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Primepcr™Assay Validation Report PrimePCR™Assay Validation Report Gene Information Gene Name TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene Symbol TAF12 Organism Human Gene Summary Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene. Gene Aliases TAF2J, TAFII20 RefSeq Accession No. NC_000001.10, NT_004610.19 UniGene ID Hs.530251 Ensembl Gene ID ENSG00000120656 Entrez Gene ID 6883 Assay Information Unique Assay ID qHsaCIP0032940 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000373824, ENST00000263974 Amplicon Context Sequence AAAATCCAAGGATGAGATGGCTGAGTTCTCAGCTCAAGTATCTCCAAATACATTG CTGTCCATTCCCTGACCTTTCCGTGTGTTATTTCTTGGTTGTTTTCCGGATCAATG CCATTCTCTGTTTGTGAGCTTCTGTGGTGCAAGCTTTT Amplicon Length (bp) 119 Chromosome Location 1:28929969-28931914 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 97 Page 1/5 PrimePCR™Assay Validation Report R2 0.9995 cDNA Cq 19.39 cDNA Tm (Celsius) 81.5 gDNA Cq 36.19 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report TAF12, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 3/5 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. Amplicon Context Sequence This is the amplicon sequence with additional base pairs added to the beginning and/or end of the sequence. This is in accordance with the minimum information for the publication of real-time quantitative PCR experiments (MIQE) guidelines. For details, please refer to the following publication, "Primer Sequence Disclosure: A Clarification of the MIQE Guidelines" (Bustin et al 2011). Chromosome Location This is the chromosomal location of the amplicon context sequence within the genome. Assay Design Exonic: Primers sit within the same exon in the mRNA transcript and can potentially co-amplify genomic DNA. If performing gene expression analysis, it is suggested that the samples be treated with a DNase to eliminate potential unwanted signal from contaminating genomic DNA. Exon-exon junction: One primer sits on an exon-exon junction in mRNA. When performing gene expression analysis, this design approach will prevent unwanted signal from contaminating genomic DNA. Intron-spanning: Primers sit within different exons while spanning a large intron in the mRNA (intron is greater than 750bp). When performing gene expression analysis, this design approach should limit potential unwanted signal from contaminating genomic DNA. Small intron-spanning: Primers sit within different exons with a short intron in between (intron is smaller than 750bp). Small introns may not prevent unwanted signal from contaminating genomic DNA. Efficiency Assay efficiency was determined using a seven-point standard curve from 20 copies to 20 million copies. While an efficiency of 100% represents a perfect doubling of template at every cycle and is ideal, typical ranges of good assay efficiency are between 90-110%. For difficult targets, assay efficiency outside of this range are accepted and reported accordingly. R2 The R2 represents the linearity of the standard curve and how well the standard curve data points fit the linear regression line. Acceptable values are >0.98. Page 4/5 PrimePCR™Assay Validation Report cDNA Cq Cq value obtained from 25ng of cDNA transcribed from universal RNA when performing wet-lab validation of the assay. Note: Not all genes will be expressed at a detectable level in the universal RNA sample. cDNA Tm Melting temperature of the amplicon when running a melt curve analysis. gDNA Cq Cq value obtained when running the assay with 2.5ng of genomic DNA. This is more than a moderate level of genomic DNA contamination. Intron-spanning and exon-exon junction assay designs can minimize or eliminate genomic DNA detection. Note: Genomic DNA contamination is often present at variable levels. If concerned about genomic DNA contamination, the genomic DNA contamination control assay is recommended to run with your sample to determine if genomic DNA levels are sufficient to negatively impact results. Specificity This value is the percent of specific amplicon reads as measured by next generation sequencing (NGS). While 100% specificity is desirable, small decreases in specificity (<1%) can be due to NGS read errors. More significant reductions are likely due to co-amplification of homologous regions. Note: Since gene expression can be cell type and condition specific, the exact level and impact of co-amplification in a given sample is impossible to predict. If co-amplification is detected, it should be taken into consideration and reported when analyzing gene expression results. Page 5/5.
Load more

Recommended publications
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Molecular Mechanisms of Ribosomal Protein Gene Coregulation
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Molecular mechanisms of ribosomal protein gene coregulation Rohit Reja, Vinesh Vinayachandran, Sujana Ghosh, and B. Franklin Pugh Center for Eukaryotic Gene Regulation, Pennsylvania State University, University Park, Pennsylvania 16802, USA The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair res- olution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20–50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1–TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences.
    [Show full text]
  • Novel Candidate Genes of Thyroid Tumourigenesis Identified in Trk-T1 Transgenic Mice
    Endocrine-Related Cancer (2012) 19 409–421 Novel candidate genes of thyroid tumourigenesis identified in Trk-T1 transgenic mice Katrin-Janine Heiliger*, Julia Hess*, Donata Vitagliano1, Paolo Salerno1, Herbert Braselmann, Giuliana Salvatore 2, Clara Ugolini 3, Isolde Summerer 4, Tatjana Bogdanova5, Kristian Unger 6, Gerry Thomas6, Massimo Santoro1 and Horst Zitzelsberger Research Unit of Radiation Cytogenetics, Helmholtz Zentrum Mu¨nchen, Ingolsta¨dter Landstr. 1, 85764 Neuherberg, Germany 1Istituto di Endocrinologia ed Oncologia Sperimentale del CNR, c/o Dipartimento di Biologia e Patologia Cellulare e Molecolare, Universita` Federico II, Naples 80131, Italy 2Dipartimento di Studi delle Istituzioni e dei Sistemi Territoriali, Universita` ‘Parthenope’, Naples 80133, Italy 3Division of Pathology, Department of Surgery, University of Pisa, 56100 Pisa, Italy 4Institute of Radiation Biology, Helmholtz Zentrum Mu¨nchen, 85764 Neuherberg, Germany 5Institute of Endocrinology and Metabolism, Academy of Medical Sciences of the Ukraine, 254114 Kiev, Ukraine 6Department of Surgery and Cancer, Imperial College London, Hammersmith Hospital, London W12 0HS, UK (Correspondence should be addressed to H Zitzelsberger; Email: [email protected]) *(K-J Heiliger and J Hess contributed equally to this work) Abstract For an identification of novel candidate genes in thyroid tumourigenesis, we have investigated gene copy number changes in a Trk-T1 transgenic mouse model of thyroid neoplasia. For this aim, 30 thyroid tumours from Trk-T1 transgenics were investigated by comparative genomic hybridisation. Recurrent gene copy number alterations were identified and genes located in the altered chromosomal regions were analysed by Gene Ontology term enrichment analysis in order to reveal gene functions potentially associated with thyroid tumourigenesis. In thyroid neoplasms from Trk-T1 mice, a recurrent gain on chromosomal bands 1C4–E2.3 (10.0% of cases), and losses on 3H1–H3 (13.3%), 4D2.3–E2 (43.3%) and 14E4–E5 (6.7%) were identified.
    [Show full text]
  • Whole Genome Sequencing of Familial Non-Medullary Thyroid Cancer Identifies Germline Alterations in MAPK/ERK and PI3K/AKT Signaling Pathways
    biomolecules Article Whole Genome Sequencing of Familial Non-Medullary Thyroid Cancer Identifies Germline Alterations in MAPK/ERK and PI3K/AKT Signaling Pathways Aayushi Srivastava 1,2,3,4 , Abhishek Kumar 1,5,6 , Sara Giangiobbe 1, Elena Bonora 7, Kari Hemminki 1, Asta Försti 1,2,3 and Obul Reddy Bandapalli 1,2,3,* 1 Division of Molecular Genetic Epidemiology, German Cancer Research Center (DKFZ), D-69120 Heidelberg, Germany; [email protected] (A.S.); [email protected] (A.K.); [email protected] (S.G.); [email protected] (K.H.); [email protected] (A.F.) 2 Hopp Children’s Cancer Center (KiTZ), D-69120 Heidelberg, Germany 3 Division of Pediatric Neurooncology, German Cancer Research Center (DKFZ), German Cancer Consortium (DKTK), D-69120 Heidelberg, Germany 4 Medical Faculty, Heidelberg University, D-69120 Heidelberg, Germany 5 Institute of Bioinformatics, International Technology Park, Bangalore 560066, India 6 Manipal Academy of Higher Education (MAHE), Manipal, Karnataka 576104, India 7 S.Orsola-Malphigi Hospital, Unit of Medical Genetics, 40138 Bologna, Italy; [email protected] * Correspondence: [email protected]; Tel.: +49-6221-42-1709 Received: 29 August 2019; Accepted: 10 October 2019; Published: 13 October 2019 Abstract: Evidence of familial inheritance in non-medullary thyroid cancer (NMTC) has accumulated over the last few decades. However, known variants account for a very small percentage of the genetic burden. Here, we focused on the identification of common pathways and networks enriched in NMTC families to better understand its pathogenesis with the final aim of identifying one novel high/moderate-penetrance germline predisposition variant segregating with the disease in each studied family.
    [Show full text]
  • TAF10 Complex Provides Evidence for Nuclear Holo&Ndash;TFIID Assembly from Preform
    ARTICLE Received 13 Aug 2014 | Accepted 2 Dec 2014 | Published 14 Jan 2015 DOI: 10.1038/ncomms7011 OPEN Cytoplasmic TAF2–TAF8–TAF10 complex provides evidence for nuclear holo–TFIID assembly from preformed submodules Simon Trowitzsch1,2, Cristina Viola1,2, Elisabeth Scheer3, Sascha Conic3, Virginie Chavant4, Marjorie Fournier3, Gabor Papai5, Ima-Obong Ebong6, Christiane Schaffitzel1,2, Juan Zou7, Matthias Haffke1,2, Juri Rappsilber7,8, Carol V. Robinson6, Patrick Schultz5, Laszlo Tora3 & Imre Berger1,2,9 General transcription factor TFIID is a cornerstone of RNA polymerase II transcription initiation in eukaryotic cells. How human TFIID—a megadalton-sized multiprotein complex composed of the TATA-binding protein (TBP) and 13 TBP-associated factors (TAFs)— assembles into a functional transcription factor is poorly understood. Here we describe a heterotrimeric TFIID subcomplex consisting of the TAF2, TAF8 and TAF10 proteins, which assembles in the cytoplasm. Using native mass spectrometry, we define the interactions between the TAFs and uncover a central role for TAF8 in nucleating the complex. X-ray crystallography reveals a non-canonical arrangement of the TAF8–TAF10 histone fold domains. TAF2 binds to multiple motifs within the TAF8 C-terminal region, and these interactions dictate TAF2 incorporation into a core–TFIID complex that exists in the nucleus. Our results provide evidence for a stepwise assembly pathway of nuclear holo–TFIID, regulated by nuclear import of preformed cytoplasmic submodules. 1 European Molecular Biology Laboratory, Grenoble Outstation, 6 rue Jules Horowitz, 38042 Grenoble, France. 2 Unit for Virus Host-Cell Interactions, University Grenoble Alpes-EMBL-CNRS, 6 rue Jules Horowitz, 38042 Grenoble, France. 3 Cellular Signaling and Nuclear Dynamics Program, Institut de Ge´ne´tique et de Biologie Mole´culaire et Cellulaire, UMR 7104, INSERM U964, 1 rue Laurent Fries, 67404 Illkirch, France.
    [Show full text]
  • Structure and Mechanism of the RNA Polymerase II Transcription Machinery
    Downloaded from genesdev.cshlp.org on October 9, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Structure and mechanism of the RNA polymerase II transcription machinery Allison C. Schier and Dylan J. Taatjes Department of Biochemistry, University of Colorado, Boulder, Colorado 80303, USA RNA polymerase II (Pol II) transcribes all protein-coding ingly high resolution, which has rapidly advanced under- genes and many noncoding RNAs in eukaryotic genomes. standing of the molecular basis of Pol II transcription. Although Pol II is a complex, 12-subunit enzyme, it lacks Structural biology continues to transform our under- the ability to initiate transcription and cannot consistent- standing of complex biological processes because it allows ly transcribe through long DNA sequences. To execute visualization of proteins and protein complexes at or near these essential functions, an array of proteins and protein atomic-level resolution. Combined with mutagenesis and complexes interact with Pol II to regulate its activity. In functional assays, structural data can at once establish this review, we detail the structure and mechanism of how enzymes function, justify genetic links to human dis- over a dozen factors that govern Pol II initiation (e.g., ease, and drive drug discovery. In the past few decades, TFIID, TFIIH, and Mediator), pausing, and elongation workhorse techniques such as NMR and X-ray crystallog- (e.g., DSIF, NELF, PAF, and P-TEFb). The structural basis raphy have been complemented by cryoEM, cross-linking for Pol II transcription regulation has advanced rapidly mass spectrometry (CXMS), and other methods. Recent in the past decade, largely due to technological innova- improvements in data collection and imaging technolo- tions in cryoelectron microscopy.
    [Show full text]
  • A High-Resolution Comparative Map of Porcine Chromosome 4 (SSC4).Pdf
    SHORT COMMUNICATION doi:10.1111/j.1365-2052.2010.02140.x A high-resolution comparative map of porcine chromosome 4 (SSC4) J.-G. Ma*†, T.-C. Chang†, H. Yasue‡, A. D. Farmer§, J. A. Crow§, K. Eyer¶, H. Hiraiwa‡, T. Shimogiri**, S. N. Meyers††, J. E. Beever††, L. B. Schook††, E. F. Retzel§, C. W. Beattie‡‡ and W.-S. Liu† *Department of Biological Science and Engineering, Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology, XiÕan Jiaotong University, XiÕan 710049, China. †Department of Dairy and Animal Science, College of Agricultural Sciences, Pennsylvania State University, 305 Henning Building, University Park, PA 16802, USA. ‡Genome Research Department, National Institute of Agrobiological Sciences, Ikenodai, Tsukuba, Ibaraki 305-0901, Japan. §National Center for Genome Resources, Santa Fe, NM 87505 USA. ¶Department of Biology, College of Sciences, University of Nevada, Reno, NV 89557, USA. **Faculty of Agriculture, Kagoshima University, Korimoto, Kagoshima 890-0065, Japan. ††Department of Animal Science, University of Illinois at Urbana-Champaign, Urbana, IL, USA. ‡‡Department of Surgical Oncology, Room 618 820 CSB, University of Illinois COM, 840 South Wood St., Chicago, IL, USA Summary We used the IMNpRH212 000-rad RH and IMpRH7 000-rad panels to integrate 2019 tran- scriptome (RNA-seq)-generated contigs with markers from the porcine genetic and radia- tion hybrid (RH) maps and bacterial artificial chromosome finger-printed contigs, into 1) parallel framework maps (LOD ‡10) on both panels for swine chromosome (SSC) 4, and 2) a high-resolution comparative map of SSC4, thus and human chromosomes (HSA) 1 and 8.
    [Show full text]
  • Ing1 Functions in DNA Demethylation by Directing Gadd45a to H3k4me3
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Ing1 functions in DNA demethylation by directing Gadd45a to H3K4me3 Andrea Scha¨fer,1,3 Emil Karaulanov,1 Ulrike Stapf,1 Gabi Do¨ derlein,2 and Christof Niehrs1,2,3 1Institute of Molecular Biology, 55128 Mainz, Germany; 2Division of Molecular Embryology, DKFZ-ZMBH Alliance, German Cancer Research Center, 69120 Heidelberg, Germany Active DNA demethylation regulates epigenetic gene activation in numerous processes, but how the target site specificity of DNA demethylation is determined and what factors are involved are still poorly understood. Here we show that the tumor suppressor inhibitor of growth protein 1 (Ing1) is required for targeting active DNA demethylation. Ing1 functions by recruiting the regulator of DNA demethylation growth arrest and DNA damage protein 45a (Gadd45a) to histone H3 trimethylated at Lys 4 (H3K4me3). We show that reduced H3K4 methylation impairs recruitment of Gadd45a/Ing1 and gene-specific DNA demethylation. Our results indicate that histone methylation directs DNA demethylation. [Keywords: p33Ing1b; Gadd45a; Ing1; DNA demethylation; H3K4me3; chromatin] Supplemental material is available for this article. Received January 9, 2012; revised version accepted December 26, 2012. DNA methylation at 5-methylcytosine (5mC) of CpGs 1994). Gadd45 proteins are multifunctional and regulate is a common epigenetic mark in metazoa, which plays a range of cellular processes, including DNA repair, pro- important roles in regulating gene expression, genomic liferation, apoptosis, and differentiation (Fornace et al. imprinting, X-chromosome inactivation, genomic insta- 1988; Kastan et al. 1992; Smith et al. 1996; Carrier et al. bility, embryonic development, and cancer (Costello and 1999; Harkin et al.
    [Show full text]
  • Rabbit Anti-TAF9 Antibody-SL12968R
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-TAF9 antibody SL12968R Product Name: TAF9 Chinese Name: 转录起始因子TFIID亚基9抗体 TAF9 RNA polymerase II, TATA box-binding protein-associated factor, 32kDa; MGC:1603; MGC:3647; MGC:5067; RNA polymerase II TBP-associated factor subunit G; STAF31/32; TAF17; TAF2G; TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa; TAF9 RNA polymerase II, TATA box-binding protein-associated factor, 32kDa; TAFII31; TAFII32; TAFIID32; TATA Alias: box-binding protein-associated factor 2G; TBP associated factor 17 kDa; TBP associated factor 9; TBP associated factor, RNA polymerase II, 32-KD; transcription initiation factor TFIID 31 kD subunit; transcription initiation factor TFIID 31 kDa subunit; transcription initiation factor TFIID 32 kDa subunit; Transcription initiation factor TFIID subunit 9. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Cow, WB=1:500-2000ELISA=1:500-1000IHC-P=1:400-800IHC-F=1:400-800ICC=1:100- 500IF=1:100-500（Paraffin sections need antigen repair） Applications: notwww.sunlongbiotech.com yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 29kDa Cellular localization: The nucleus Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human TAF9: Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized Storage: antibody is stable at room temperature for at least one month and for greater than a year when kept at -20°C.
    [Show full text]
  • Integrative Framework for Identification of Key Cell Identity Genes Uncovers
    Integrative framework for identification of key cell PNAS PLUS identity genes uncovers determinants of ES cell identity and homeostasis Senthilkumar Cinghua,1, Sailu Yellaboinaa,b,c,1, Johannes M. Freudenberga,b, Swati Ghosha, Xiaofeng Zhengd, Andrew J. Oldfielda, Brad L. Lackfordd, Dmitri V. Zaykinb, Guang Hud,2, and Raja Jothia,b,2 aSystems Biology Section and dStem Cell Biology Section, Laboratory of Molecular Carcinogenesis, and bBiostatistics Branch, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC 27709; and cCR Rao Advanced Institute of Mathematics, Statistics, and Computer Science, Hyderabad, Andhra Pradesh 500 046, India Edited by Norbert Perrimon, Harvard Medical School and Howard Hughes Medical Institute, Boston, MA, and approved March 17, 2014 (received for review October 2, 2013) Identification of genes associated with specific biological pheno- (mESCs) for genes essential for the maintenance of ESC identity types is a fundamental step toward understanding the molecular resulted in only ∼8% overlap (8, 9), although many of the unique basis underlying development and pathogenesis. Although RNAi- hits in each screen were known or later validated to be real. The based high-throughput screens are routinely used for this task, lack of concordance suggest that these screens have not reached false discovery and sensitivity remain a challenge. Here we describe saturation (14) and that additional genes of importance remain a computational framework for systematic integration of published to be discovered. gene expression data to identify genes defining a phenotype of Motivated by the need for an alternative approach for iden- interest. We applied our approach to rank-order all genes based on tification of key cell identity genes, we developed a computa- their likelihood of determining ES cell (ESC) identity.
    [Show full text]
  • A Unified Nomenclature for TATA Box Binding Protein (TBP)-Associated Factors (Tafs) Involved in RNA Polymerase II Transcription
    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press CORRESPONDENCE A unified nomenclature for TATA box binding protein (TBP)-associated factors (TAFs) involved in RNA polymerase II transcription La`szlo`Tora1 Institut de Ge´ne´tique et de Biologie Mole´culaire et Cellulaire, CNRS/INSERM/ULP, F-67404 ILLKIRCH Cedex, CU de Strasbourg, France Initiation of transcription by RNA polymerase II (Pol II) The unified nomenclature is based on the following requires general transcription factors to assemble the Pol considerations: II pre-initiation complex (PIC) (Hampsey 1998). PIC as- 1. It now appears evident from a comparison of Dro- sembly on both TATA-containing and TATA-less pro- sophila, human, and yeast TFIID that there is an es- moters can be nucleated by the general transcription fac- sential or “core” set of TAFs that are conserved across tors TFIID or B-TFIID, which are comprised of the many species. These 13 evolutionarily conserved TATA-binding protein (TBP) and TBP-associated factors TAFs (Sanders and Weil 2000) have been aligned with (TAF s) (Bell and Tora 1999; Albright and Tjian 2000). II their orthologs from different species and designated More than 10 years ago, the first TAF s were discovered II TAF1 to TAF13 (see Table 1). After extensive discus- in Drosophila and in human cells (Dynlacht et al. 1991; sions this nomenclature was chosen because of its Tanese et al. 1991). These proteins were identified in simplicity and because it complies with guidelines biochemically stable complexes with TBP and named endorsed by both the Saccharomyces Genome Data- after their electrophoretic mobility in polyacrylamide base (SGD) and the human HUGO Gene Nomencla- gels.
    [Show full text]
  • Title: a Yeast Phenomic Model for the Influence of Warburg Metabolism on Genetic
    bioRxiv preprint doi: https://doi.org/10.1101/517490; this version posted January 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Title Page: 2 3 Title: A yeast phenomic model for the influence of Warburg metabolism on genetic 4 buffering of doxorubicin 5 6 Authors: Sean M. Santos1 and John L. Hartman IV1 7 1. University of Alabama at Birmingham, Department of Genetics, Birmingham, AL 8 Email: [email protected], [email protected] 9 Corresponding author: [email protected] 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 1 bioRxiv preprint doi: https://doi.org/10.1101/517490; this version posted January 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 26 Abstract: 27 Background: 28 Saccharomyces cerevisiae represses respiration in the presence of adequate glucose, 29 mimicking the Warburg effect, termed aerobic glycolysis. We conducted yeast phenomic 30 experiments to characterize differential doxorubicin-gene interaction, in the context of 31 respiration vs. glycolysis. The resulting systems level biology about doxorubicin 32 cytotoxicity, including the influence of the Warburg effect, was integrated with cancer 33 pharmacogenomics data to identify potentially causal correlations between differential 34 gene expression and anti-cancer efficacy.
    [Show full text]