DOCSLIB.ORG

Rodents Fact Sheet

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Rodents Fact Sheet Rodents Fact Sheet The Water Mouse, Xeromys myoides. Image: QM, Bruce Cowell. Rodents in Queensland Australia is commonly thought of as a land of marsupials. However, it also supports a rich diversity of indigenous rodents. Rodents are one of the most successful groups of mammals, with more than 2000 species on all major landmasses except Antarctica. These include mice and rats, squirrels, guinea pigs, beavers, picas, capybaras, voles and lemmings. All Australian rodents belong to the family Muridae (rats and mice). More than sixty species are currently recognised, and these are placed in five groups. Additionally, there are five introduced species. Although these rodents are ‘native’, they have not been in Australia for as long as the marsupials. Multiple waves The Bush Rat, Rattus fuscipes. Image: QM. of arrivals are recognised, probably starting some time in House Mice can be difficult to distinguish from similarly- the late Miocene or early Pliocene (more than five million sized native Pseudomys. House Mice have relatively years ago). More recent arrivals are the native True Rats smaller eyes, and a characteristic musty smell. The (probably less than one million years ago), and more most reliable feature is in the teeth. House Mice have a recently still are species introduced by Europeans, such as distinctive notch on the inner surface of the upper incisor, a the House Mouse. feature not seen among Pseudomys. True Rats Seven species of True Rats (Rattus) are native to Australia. It is important to distinguish these from the four species of introduced rats. The Pacific Rat (R. exulans) is present on some islands in the Torres Strait. It was probably introduced by islanders. Three species of introduced Rattus are present in mainland Australia: the European Black Rat; Brown Rat; and Asian Black Rat. Despite their name, most black rats are not black. The European and Asian Black Rats are very similar externally and probably cannot be distinguished without comparing genetics. The House Mouse, Mus musculus. Image: QM. Black and Brown Rats are distinguished by their ears. The ear of the Black Rat partially covers the eye when folded Old Endemics forward, while that of the Brown Rat does not reach the eye. ‘Old endemics’ refers to descendants of the first wave of Brown Rats will repeatedly attack when cornered, while murids to arrive in Australia. These have evolved into a Black Rats and native rats will cower. The Black Rat has a highly varied group. Members of the Pseudomys genus are tail that is longer than its head and body. Other Queensland mostly unspecialised animals, but some have unusual and Rattus, Melomys, and larger Pseudomys have tails that are even bizarre behaviours. For example, the four species the same length or shorter than their head and body. of pebble-mice build piles of marble-sized rocks atop their burrows. These pebble mounds may be thousands of times House Mouse the weight of the rodent that built them (and far outlast House Mice (Mus musculus) have become established them too). in both artificial and natural habitats across most of As their name suggests, the two species of short-tailed the Australian continent. They breed extremely quickly mice (Leggadina) can be distinguished by their noticeably (gestation periods are approximately 19 days) with short tails. For some time they were confused with populations sometimes exploding into plagues when food is members of the Pseudomys group. abundant. www.qm.qld.gov.au © The State of Queensland, (Queensland Museum) 2011 Hopping-mice (Notomys) superficially resemble the Water Rats kangaroo rats of North America and the jerboas of Africa Only two species of water-loving murids are found in and Asia. All of these have similar hopping gaits and all are Australia and, curiously, only one has webbed feet for found in arid regions. However, they are not closely related, swimming. The Water Rat (Hydromys chyogaster) is and have evolved their similarities because they live under reasonably common along waterways and coastlines similar conditions. Hopping-mice seem to be close relatives around Australia. It feeds on crustaceans and molluscs of members of the Pseudomys group, but they can be and leaves distinctive ‘feeding tables’ of meal scraps near distinguished by their long hind feet and longer ears. the water’s edge. Water Rats have also been known to Rock rats (Zyzomys), as their name implies, usually inhabit raid hen houses and kill fowls. The much smaller Water rocky areas. Most species are found in the tropics. Mouse (Xeromys myoides, also called the False Water Rat) Some native rodents share behavioural and morphological inhabits mangroves, coastal wetlands and saltmarshes. similarities with unrelated species from overseas. For It builds mud nests that resemble termite mounds, but is example, stick-nest rats (Leporillus) build nests of sticks also known to burrow and hide in hollow tree trunks. Like and other debris, similarly to the pack rats of North the Water Rat, the Water Mouse can be detected by the America. Tree rats and rabbit rats (Mesembriomys and presence of ‘feeding tables’ of discarded prey remains. Conilurus) live in trees but forage on the ground, rather like However, the introduced Black Rat (Rattus rattus) will also some squirrels. leave similar evidence when foraging in coastal habitats. The Water Rat, Hydromys chrysogaster. Image: QM. Bruce Cowell. The Common Rock Rat, Zyzomys argurus. Image: QM. Tree Mouse The ‘Tree Mouse’ (Pogonomys, also called the Prehensile- Mosaic-tailed Rats tailed Rat) is a small rodent found in north Queensland Mosaic-tailed rats are represented by four species in rainforests. It forages high in the canopy, using its gripping eastern Australia. Many more species are found in New tail to assist in climbing. During the day the Tree Mouse Guinea and Melanesia. One of Australia’s largest rodents is stays in a burrow on the ground. At night it climbs into the the Giant White-tailed Rat (Uromys caudimaculatus) which canopy to feed on leaves, fruit and insects. Fossils of Tree can weigh more than 800 grams. White-tailed rats can use Mice approximately 500 thousand years old have been their powerful incisors to chew open coconuts, and can found near Rockhampton, indicating that the group was inflict serious damage when biting slow human fingers. A more widespread before a drying climate destroyed much smaller relative, the Pygmy White-tailed Rat (U. hadrourus) of its rainforest habitat. Several species of tree mice are is also found in upland rainforests in north Queensland. In found in New Guinea. eastern Queensland the Grassland Melomys (M. burtoni) Authors: Jonathan Cramb & Steve Van Dyck has become a commercially important pest of sugarcane. The Bramble Cay Melomys (M. rubicola) is only found on Further Information a tiny coral island in the Torres Strait. In such a restricted Breed, S. & Ford, F., 2007. Native Mice and Rats. CSIRO range it is highly vulnerable to environmental disturbance, Publishing, Melbourne. inbreeding and climate change. Van Dyck, S. & Strahan, R., (Eds.), 2008. The Mammals of Australia, 3rd edition. Reed New Holland, Sydney. Queensland Museum PO Box 3300, SOUTH BRISBANE QLD 4101 Phone: (07) 3840 7555 http://www.qm.qld.gov.au/ The Giant White-tailed Rat, Uromys caudimaculatus. Image: QM. www.qm.qld.gov.au © The State of Queensland, (Queensland Museum) 2011.
Load more

Recommended publications
  • Central Rock-Rat)
    Consultation Document on Listing Eligibility and Conservation Actions Zyzomys pendunculatus (central rock-rat) You are invited to provide your views and supporting reasons related to: 1) the eligibility of Zyzomys pendunculatus (central rock-rat) for inclusion on the EPBC Act threatened species list in the Critically Endangered category; and 2) the necessary conservation actions for the above species. Evidence provided by experts, stakeholders and the general public are welcome. Responses can be provided by any interested person. Anyone may nominate a native species, ecological community or threatening process for listing under the Environment Protection and Biodiversity Conservation Act 1999 (EPBC Act) or for a transfer of an item already on the list to a new listing category. The Threatened Species Scientific Committee (the Committee) undertakes the assessment of species to determine eligibility for inclusion in the list of threatened species and provides its recommendation to the Australian Government Minister for the Environment. Responses are to be provided in writing either by email to: [email protected] or by mail to: The Director Marine and Freshwater Species Conservation Section Wildlife, Heritage and Marine Division Department of the Environment PO Box 787 Canberra ACT 2601 Responses are required to be submitted by 15 March 2017. Contents of this information package Page General background information about listing threatened species 2 Information about this consultation process 2 Draft information about the species and its eligibility for listing 3 Conservation actions for the species 10 References cited 13 Consultation questions 15 Zyzomys pendunculatus (Central rock-rat) consultation Page 1 of 15 General background information about listing threatened species The Australian Government helps protect species at risk of extinction by listing them as threatened under Part 13 of the EPBC Act.
    [Show full text]
  • Checklist of the Mammals of Indonesia
    CHECKLIST OF THE MAMMALS OF INDONESIA Scientific, English, Indonesia Name and Distribution Area Table in Indonesia Including CITES, IUCN and Indonesian Category for Conservation i ii CHECKLIST OF THE MAMMALS OF INDONESIA Scientific, English, Indonesia Name and Distribution Area Table in Indonesia Including CITES, IUCN and Indonesian Category for Conservation By Ibnu Maryanto Maharadatunkamsi Anang Setiawan Achmadi Sigit Wiantoro Eko Sulistyadi Masaaki Yoneda Agustinus Suyanto Jito Sugardjito RESEARCH CENTER FOR BIOLOGY INDONESIAN INSTITUTE OF SCIENCES (LIPI) iii © 2019 RESEARCH CENTER FOR BIOLOGY, INDONESIAN INSTITUTE OF SCIENCES (LIPI) Cataloging in Publication Data. CHECKLIST OF THE MAMMALS OF INDONESIA: Scientific, English, Indonesia Name and Distribution Area Table in Indonesia Including CITES, IUCN and Indonesian Category for Conservation/ Ibnu Maryanto, Maharadatunkamsi, Anang Setiawan Achmadi, Sigit Wiantoro, Eko Sulistyadi, Masaaki Yoneda, Agustinus Suyanto, & Jito Sugardjito. ix+ 66 pp; 21 x 29,7 cm ISBN: 978-979-579-108-9 1. Checklist of mammals 2. Indonesia Cover Desain : Eko Harsono Photo : I. Maryanto Third Edition : December 2019 Published by: RESEARCH CENTER FOR BIOLOGY, INDONESIAN INSTITUTE OF SCIENCES (LIPI). Jl Raya Jakarta-Bogor, Km 46, Cibinong, Bogor, Jawa Barat 16911 Telp: 021-87907604/87907636; Fax: 021-87907612 Email: [email protected] . iv PREFACE TO THIRD EDITION This book is a third edition of checklist of the Mammals of Indonesia. The new edition provides remarkable information in several ways compare to the first and second editions, the remarks column contain the abbreviation of the specific island distributions, synonym and specific location. Thus, in this edition we are also corrected the distribution of some species including some new additional species in accordance with the discovery of new species in Indonesia.
    [Show full text]
  • Calaby References
    Abbott, I.J. (1974). Natural history of Curtis Island, Bass Strait. 5. Birds, with some notes on mammal trapping. Papers and Proceedings of the Royal Society of Tasmania 107: 171–74. General; Rodents; Abbott, I. (1978). Seabird islands No. 56 Michaelmas Island, King George Sound, Western Australia. Corella 2: 26–27. (Records rabbit and Rattus fuscipes). General; Rodents; Lagomorphs; Abbott, I. (1981). Seabird Islands No. 106 Mondrain Island, Archipelago of the Recherche, Western Australia. Corella 5: 60–61. (Records bush-rat and rock-wallaby). General; Rodents; Abbott, I. and Watson, J.R. (1978). The soils, flora, vegetation and vertebrate fauna of Chatham Island, Western Australia. Journal of the Royal Society of Western Australia 60: 65–70. (Only mammal is Rattus fuscipes). General; Rodents; Adams, D.B. (1980). Motivational systems of agonistic behaviour in muroid rodents: a comparative review and neural model. Aggressive Behavior 6: 295–346. Rodents; Ahern, L.D., Brown, P.R., Robertson, P. and Seebeck, J.H. (1985). Application of a taxon priority system to some Victorian vertebrate fauna. Fisheries and Wildlife Service, Victoria, Arthur Rylah Institute of Environmental Research Technical Report No. 32: 1–48. General; Marsupials; Bats; Rodents; Whales; Land Carnivores; Aitken, P. (1968). Observations on Notomys fuscus (Wood Jones) (Muridae-Pseudomyinae) with notes on a new synonym. South Australian Naturalist 43: 37–45. Rodents; Aitken, P.F. (1969). The mammals of the Flinders Ranges. Pp. 255–356 in Corbett, D.W.P. (ed.) The natural history of the Flinders Ranges. Libraries Board of South Australia : Adelaide. (Gives descriptions and notes on the echidna, marsupials, murids, and bats recorded for the Flinders Ranges; also deals with the introduced mammals, including the dingo).
    [Show full text]
  • Pseudomys Auritus (Long-Eared Mouse)
    Consultation Document on Listing Eligibility Pseudomys auritus (Long-eared Mouse) You are invited to provide your views and supporting reasons related to the eligibility of Pseudomys auritus (Long-eared Mouse) for inclusion on the EPBC Act threatened species list in the Extinct category. Evidence provided by experts, stakeholders and the general public are welcome. Responses can be provided by any interested person. Anyone may nominate a native species, ecological community or threatening process for listing under the Environment Protection and Biodiversity Conservation Act 1999 (EPBC Act) or for a transfer of an item already on the list to a new listing category. The Threatened Species Scientific Committee (the Committee) undertakes the assessment of species to determine eligibility for inclusion in the list of threatened species and provides its recommendation to the Australian Government Minister for the Environment. Responses are to be provided in writing either by email to: [email protected] or by mail to: The Director Marine and Freshwater Species Conservation Section Biodiversity Conservation Division Department of Agriculture, Water and the Environment PO Box 787 Canberra ACT 2601 Responses are required to be submitted by 11 September 2020. Contents of this information package Page General background information about listing threatened species 2 Information about this consultation process 3 Draft information about the common name and its eligibility for listing 4 References cited 8 Collective list of questions – your views 8 Pseudomys auritus (Long-eared Mouse) consultation document Page 1 of 11 General background information about listing threatened species The Australian Government helps protect species at risk of extinction by listing them as threatened under Part 13 of the EPBC Act.
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Mouse Models of Human Disease an Evolutionary Perspective Robert L
    170 commentary Evolution, Medicine, and Public Health [2016] pp. 170–176 doi:10.1093/emph/eow014 Mouse models of human disease An evolutionary perspective Robert L. Perlman* Department of Pediatrics, The University of Chicago, 5841 S. Maryland Ave, MC 5058, Chicago, IL 60637, USA *E-mail: [email protected] Received 31 December 2015; revised version accepted 12 April 2016 ABSTRACT The use of mice as model organisms to study human biology is predicated on the genetic and physio- logical similarities between the species. Nonetheless, mice and humans have evolved in and become adapted to different environments and so, despite their phylogenetic relatedness, they have become very different organisms. Mice often respond to experimental interventions in ways that differ strikingly from humans. Mice are invaluable for studying biological processes that have been conserved during the evolution of the rodent and primate lineages and for investigating the developmental mechanisms by which the conserved mammalian genome gives rise to a variety of different species. Mice are less reliable as models of human disease, however, because the networks linking genes to disease are likely to differ between the two species. The use of mice in biomedical research needs to take account of the evolved differences as well as the similarities between mice and humans. KEYWORDS: allometry; cancer; gene networks; life history; model organisms transgenic, knockout, and knockin mice, have If you have cancer and you are a mouse, we can provided added impetus and powerful tools for take good care of you. Judah Folkman [1] mouse research, and have led to a dramatic increase in the use of mice as model organisms.
    [Show full text]
  • Quaternary Murid Rodents of Timor Part I: New Material of Coryphomys Buehleri Schaub, 1937, and Description of a Second Species of the Genus
    QUATERNARY MURID RODENTS OF TIMOR PART I: NEW MATERIAL OF CORYPHOMYS BUEHLERI SCHAUB, 1937, AND DESCRIPTION OF A SECOND SPECIES OF THE GENUS K. P. APLIN Australian National Wildlife Collection, CSIRO Division of Sustainable Ecosystems, Canberra and Division of Vertebrate Zoology (Mammalogy) American Museum of Natural History ([email protected]) K. M. HELGEN Department of Vertebrate Zoology National Museum of Natural History Smithsonian Institution, Washington and Division of Vertebrate Zoology (Mammalogy) American Museum of Natural History ([email protected]) BULLETIN OF THE AMERICAN MUSEUM OF NATURAL HISTORY Number 341, 80 pp., 21 figures, 4 tables Issued July 21, 2010 Copyright E American Museum of Natural History 2010 ISSN 0003-0090 CONTENTS Abstract.......................................................... 3 Introduction . ...................................................... 3 The environmental context ........................................... 5 Materialsandmethods.............................................. 7 Systematics....................................................... 11 Coryphomys Schaub, 1937 ........................................... 11 Coryphomys buehleri Schaub, 1937 . ................................... 12 Extended description of Coryphomys buehleri............................ 12 Coryphomys musseri, sp.nov.......................................... 25 Description.................................................... 26 Coryphomys, sp.indet.............................................. 34 Discussion . ....................................................
    [Show full text]
  • Natural History of the Eutheria
    FAUNA of AUSTRALIA 35. NATURAL HISTORY OF THE EUTHERIA P. J. JARMAN, A. K. LEE & L. S. HALL (with thanks for help to J.H. Calaby, G.M. McKay & M.M. Bryden) 1 35. NATURAL HISTORY OF THE EUTHERIA 2 35. NATURAL HISTORY OF THE EUTHERIA INTRODUCTION Unlike the Australian metatherian species which are all indigenous, terrestrial and non-flying, the eutherians now found in the continent are a mixture of indigenous and exotic species. Among the latter are some intentionally and some accidentally introduced species, and marine as well as terrestrial and flying as well as non-flying species are abundantly represented. All the habitats occupied by metatherians also are occupied by eutherians. Eutherians more than cover the metatherian weight range of 5 g–100 kg, but the largest terrestrial eutherians (which are introduced species) are an order of magnitude heavier than the largest extant metatherians. Before the arrival of dingoes 4000 years ago, however, none of the indigenous fully terrestrial eutherians weighed more than a kilogram, while most of the exotic species weigh more than that. The eutherians now represented in Australia are very diverse. They fall into major suites of species: Muridae; Chiroptera; marine mammals (whales, seals and dugong); introduced carnivores (Canidae and Felidae); introduced Leporidae (hares and rabbits); and introduced ungulates (Perissodactyla and Artiodactyla). In this chapter an attempt is made to compare and contrast the main features of the natural histories of these suites of species and, where appropriate, to comment on their resemblance to or difference from the metatherians. NATURAL HISTORY Ecology Diet. The native rodents are predominantly omnivorous.
    [Show full text]
  • LESSER STICK-NEST RAT Leporillus Apicalis
    Threatened Species of the Northern Territory LESSER STICK-NEST RAT Leporillus apicalis Conservation status Australia: Extinct Northern Territory: Extinct (J Gould © Museum Victoria) Description The lesser stick-nest rat was a moderately sized native rodent (body mass 60 g) that differed from its larger relative, the greater stick-nest rat, by the narrow brush of white hairs near the tip of its tail. Distribution The last specimen of the lesser stick- nest rat was captured near Mt Crombie, south west of Known locations of the lesser stick-nest rat the present Amata settlement, South Australia ο = pre 1970 in 1933. However in the nineteenth century it occupied a broad swath of desert and semi- Ecology desert land stretching from the Riverina in New South Wales through most of inland The biology of the lesser sticknest rat is South Australia and into the Gibson Desert, poorly known. Its most notable feature was reaching the West Australian coast in the its construction of nests of sticks, sometimes Gascoyne region. Examination of middens of in the open, but often in caves and rock this species is providing significant new overhangs. information on environmental and climatic Conservation assessment change in central Australia over a 2500-year time frame. The lesser stick-nest rat is presumed to have Conservation reserves where reported: become extinct in the NT by the 1940s, None (however it formerly occurred in areas following a broad-scale decline extending that are now included within Uluru Kata-Tjuta over at least the previous 30 years (Finlayson National Park, Arltunga Historical Reserve, 1961; Burbidge et al.
    [Show full text]
  • Factsheet: a Threatened Mammal Index for Australia
    Science for Saving Species Research findings factsheet Project 3.1 Factsheet: A Threatened Mammal Index for Australia Research in brief How can the index be used? This project is developing a For the first time in Australia, an for threatened plants are currently Threatened Species Index (TSX) for index has been developed that being assembled. Australia which can assist policy- can provide reliable and rigorous These indices will allow Australian makers, conservation managers measures of trends across Australia’s governments, non-government and the public to understand how threatened species, or at least organisations, stakeholders and the some of the population trends a subset of them. In addition to community to better understand across Australia’s threatened communicating overall trends, the and report on which groups of species are changing over time. It indices can be interrogated and the threatened species are in decline by will inform policy and investment data downloaded via a web-app to bringing together monitoring data. decisions, and enable coherent allow trends for different taxonomic It will potentially enable us to better and transparent reporting on groups or regions to be explored relative changes in threatened understand the performance of and compared. So far, the index has species numbers at national, state high-level strategies and the return been populated with data for some and regional levels. Australia’s on investment in threatened species TSX is based on the Living Planet threatened and near-threatened birds recovery, and inform our priorities Index (www.livingplanetindex.org), and mammals, and monitoring data for investment. a method developed by World Wildlife Fund and the Zoological A Threatened Species Index for mammals in Australia Society of London.
    [Show full text]
  • Ba3444 MAMMAL BOOKLET FINAL.Indd
    Intot Obliv i The disappearing native mammals of northern Australia Compiled by James Fitzsimons Sarah Legge Barry Traill John Woinarski Into Oblivion? The disappearing native mammals of northern Australia 1 SUMMARY Since European settlement, the deepest loss of Australian biodiversity has been the spate of extinctions of endemic mammals. Historically, these losses occurred mostly in inland and in temperate parts of the country, and largely between 1890 and 1950. A new wave of extinctions is now threatening Australian mammals, this time in northern Australia. Many mammal species are in sharp decline across the north, even in extensive natural areas managed primarily for conservation. The main evidence of this decline comes consistently from two contrasting sources: robust scientifi c monitoring programs and more broad-scale Indigenous knowledge. The main drivers of the mammal decline in northern Australia include inappropriate fi re regimes (too much fi re) and predation by feral cats. Cane Toads are also implicated, particularly to the recent catastrophic decline of the Northern Quoll. Furthermore, some impacts are due to vegetation changes associated with the pastoral industry. Disease could also be a factor, but to date there is little evidence for or against it. Based on current trends, many native mammals will become extinct in northern Australia in the next 10-20 years, and even the largest and most iconic national parks in northern Australia will lose native mammal species. This problem needs to be solved. The fi rst step towards a solution is to recognise the problem, and this publication seeks to alert the Australian community and decision makers to this urgent issue.
    [Show full text]
  • Micromys Minutus)
    Acta Theriol (2013) 58:101–104 DOI 10.1007/s13364-012-0102-0 SHORT COMMUNICATION The origin of Swedish and Norwegian populations of the Eurasian harvest mouse (Micromys minutus) Lars Råberg & Jon Loman & Olof Hellgren & Jeroen van der Kooij & Kjell Isaksen & Roar Solheim Received: 7 May 2012 /Accepted: 17 September 2012 /Published online: 29 September 2012 # Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland 2012 Abstract The harvest mouse (Micromys minutus) occurs the Mediterranean, from France to Russia and northwards throughout most of continental Europe. There are also two to central Finland (Mitchell-Jones et al. 1999). Recently, isolated and recently discovered populations on the it has also been found to occur in Sweden and Norway. Scandinavian peninsula, in Sweden and Norway. Here, we In 1985, an isolated population was discovered in the investigate the origin of these populations through analyses province of Dalsland in western Sweden (Loman 1986), of mitochondrial DNA. We found that the two populations and during the last decade, this population has been on the Scandinavian peninsula have different mtDNA found to extend into the surrounding provinces as well haplotypes. A comparison of our haplotypes to published as into Norway. The known distribution in Norway is sequences from most of Europe showed that all Swedish and limited to a relatively small area close to the Swedish Norwegian haplotypes are most closely related to the border, in Eidskog, Hedmark (van der Kooij et al. 2001; haplotypes in harvest mice from Denmark. Hence, the two van der Kooij et al., unpublished data). In 2007, another populations seem to represent independent colonisations but population was discovered in the province of Skåne in originate from the same geographical area.
    [Show full text]