Computational Discovery of Hidden Breaks in 28S Ribosomal Rnas Across Eukaryotes and Consequences for RNA Integrity Numbers
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Final Copy 2018 09 25 Gaunt
This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Gaunt, Jess Title: A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation Jessica Ruth Gaunt A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School. -
Validation of Two Ribosomal RNA Removal Methods for Microbial Metatranscriptomics
ANaLYSIS Validation of two ribosomal RNA removal methods for microbial metatranscriptomics Shaomei He1,2,5, Omri Wurtzel3,5, Kanwar Singh1, Jeff L Froula1, Suzan Yilmaz1, Susannah G Tringe1, Zhong Wang1, Feng Chen1, Erika A Lindquist1, Rotem Sorek3 & Philip Hugenholtz1,2,4 The predominance of rRNAs in the transcriptome is a major Among these methods, subtractive hybridization and exo- technical challenge in sequence-based analysis of cDNAs from nuclease digestion have become the most popular owing to the microbial isolates and communities. Several approaches have availability of commercial kits from Ambion (MICROBExpress been applied to deplete rRNAs from (meta)transcriptomes, but Bacterial mRNA Enrichment kit) and Epicentre (mRNA-ONLY no systematic investigation of potential biases introduced by Prokaryotic mRNA Isolation kit). The former kit uses a subtrac- any of these approaches has been reported. Here we validated tive hybridization with capture oligonucleotides specific to 16S the effectiveness and fidelity of the two most commonly and 23S rRNAs. It has been applied to both bacterial isolates used approaches, subtractive hybridization and exonuclease and environmental samples, in one or two rounds6,13–18. The digestion, as well as combinations of these treatments, on Epicentre kit uses exonuclease to preferentially degrade processed two synthetic five-microorganism metatranscriptomes using RNAs with 5′ monophosphate (the majority of which are believed massively parallel sequencing. We found that the effectiveness to be rRNAs)19,20. In some instances, these methods have been of rRNA removal was a function of community composition and used in combination to improve rRNA removal21–23. There is no RNA integrity for these treatments. -
Comparison of RIN and Rine Algorithms for the Agilent 2100 Bioanalyzer and the Agilent 2200 Tapestation Systems Technical Overview
Comparison of RIN and RINe algorithms for the Agilent 2100 Bioanalyzer and the Agilent 2200 TapeStation systems Technical Overview Introduction A typical application for the 96-well plate compatible Agilent 2200 TapeStation system is automated, effi cient, and reliable RNA analysis, including RNA charac- terization and quality assessment with Agilent R6K ScreenTape or Agilent High Sensitivity R6K ScreenTape. When separated by electrophoresis, eukaryotic total RNA samples typically display two major peaks representing the 18S and 28S ribosomal RNA (rRNA). Depending on the purifi cation method, additional smaller peaks can also been seen, which correspond to small rRNAs as well as tRNAs. As total RNA degrades, the 18S and 28S rRNA peaks slowly disappear and the degradation products emerge in the region between the 18S and small RNAs, termed as the fast zone. The RNA integrity number (RIN) functionality of the Agilent 2100 Expert software for the Agilent 2100 Bioanalyzer system uses a proprietary neural network trained algorithm to make an assessment of the entire electrophoretic trace for a given total RNA sample, including ribosomal peak ratios, separation, and the presence or absence of degradation products. RIN values from 1 to 10 can be obtained, where 10 indicates the highest possible RNA quality. Due to fundamental differences in the nature of the raw data, a dedicated soft- ware algorithm has been developed for the 2200 TapeStation system and R6K ScreenTape to determine the RNA integrity number equivalent (RINe). The RINe algorithm is based on a Experimental RNA preparation mathematical model that calculates an Total RNA from HEK 293, Hep G2, and objective quantitative measurement of Material Jurkat cells was purifi ed using the RNA degradation1. -
Supplementary Figure 1
Supplementary Table 1 siRNA Oligonucleotide Sequences not Used for IGFBP-3 Knockdown siRNA Sequence nucleotides Source GCUACAAAGUUGACUACGA 686-704 ON-TARGET Plus SMART pool sequences GAAAUGCUAGUGAGUCGGA 536-554 ON-TARGET Plus SMART pool sequences GCACAGAUACCCAGAACUU 713-731 ON-TARGET Plus SMART pool sequences GAAUAUGGUCCCUGCCGUA 757-775 ON-TARGET Plus SMART pool sequences UAUCGAGAAUAGGAAAACC 1427-1445 siDESIGN center GCAGCCUCUCCCAGGCUACA 940-958 siDESIGN center GCAUAAGCUCUUUAAAGGCA 1895-1913 siDESIGN center UGCCUGGAUUCCACAGCUU 44-62 siDESIGN center AAGCAGCGTGCCCCGGUUG 106-124 siDESIGN center AAAGGCAAAGCUUUAUUUU 1908-1926 siDESIGN center Oligonucleotide sequences used for siRNA oligonucleotides tested to induce IGFBP-3 knockdown. Sequences 1-4 were from ON-TARGET Plus SMART pool sequences (Cat. # L-004777-00-0005, Dharmacon, Lafayette, CO). Sequences 5-10 were generated in our laboratory using the siDESIGN center from the Dharmacon website (www.dharmacon.com) by inputting the Genbank accession number NM_000598 (IGFBP-3). Supplementary Table 2 Transcripts Activated by NKX3.1 in PC-3 Cells PC-3 cells were stably transfected with the pcDNA3.1 empty vector or NKX3.1 expression vector and mRNA from two clones of each cell type was isolated for microarray analysis on the Affymetrix U-133 expression array. Analyses of results from each pair of clones of the same genotype that did not match up were discarded to ensure clonal variation was not a factor. 984 genes were found to be up- or down-regulated more that 1.4 fold in the NKX3.1 expressing PC-3 cells, in comparison to the PC-3 control cells. The 6th and 9th most activated probe sets were for human growth hormone-dependent insulin-like growth factor-binding protein, now known as IGFBP-3. -
Low RIN Value for RNA-Seq Library Construction from Long-Term Stored Seeds: a Case Study of Barley Seeds
G C A T T A C G G C A T genes Technical Note Low RIN Value for RNA-Seq Library Construction from Long-Term Stored Seeds: A Case Study of Barley Seeds Marta Puchta , Maja Boczkowska * and Jolanta Groszyk National Centre for Plant Genetic Resources, Plant Breeding and Acclimatization National Research Institute, Radzików, 05-870 Błonie, Poland; [email protected] (M.P.); [email protected] (J.G.) * Correspondence: [email protected] Received: 20 August 2020; Accepted: 8 October 2020; Published: 13 October 2020 Abstract: Seed aging is a complex biological process and its fundamentals and mechanisms have not yet been fully recognized. This is a key issue faced by research teams involved in the collection and storage of plant genetic resources in gene banks every day. Transcriptomic changes associated with seed aging in the dry state have barely been studied. The aim of the study was to develop an efficient protocol for construction of RNA-Seq libraries from long-term stored seeds with very low viability and low RNA integrity number (RIN). Here, barley seeds that have almost completely lost their viability as a result of long-term storage were used. As a control, fully viable seeds obtained in the course of field regeneration were used. The effectiveness of protocols dedicated to RNA samples with high and low RIN values was compared. The experiment concluded that library construction from low viable or long-term stored seeds with degraded RNA (RIN < 3) should be carried out with extraordinary attention due to the possibility of uneven degradation of different RNA fractions. -
PD-WP-017 Issue2 (Interpreting Bioanaylzer).Indd
Interpreting bioanalyzer results for RNA collected using Oragene®•RNA The Agilent Bioanalyzer is an instrument for assessing however, for several reasons, it is more difficult to the “quality” of RNA used for microarray analysis. obtain a high RIN value. As with blood, saliva has a The sharpness of the ribosomal RNA peak and the lower RNA to DNA ratio than that of cultured cells or low baseline between peaks on the electropherogram tissue therefore similar care must be taken to remove generated by the instrument are used as measures of the contaminating DNA. Additionally, saliva is not a integrity of the ribosomal RNA and, by implication, the sterile source of nucleic acid; some of the RNA integrity of messenger RNA. The bioanalyzer uses an contained in saliva originates from oral bacteria. algorithm to generate an “RNA integrity number” (RIN) The ratio between the 16S and 23S bacterial ribosomal that helps researchers decide if the RNA is of sufficiently RNAs is less than the human 18S:28S ratio. The high integrity to proceed with microarray analysis. algorithm used by the bioanalyzer was not designed for use with samples containing both human and Most high quality RNA samples share the same bacterial RNA so the instrument generates a lower common features: RIN that is not indicative of the integrity of the RNA. • distinct 18S and 28S ribosomal peaks Instead of relying on the RIN, a visual assessment of (or 16S and 23S for prokaryotic samples) the electropherogram can provide valuable insight • the absence of smaller peaks between the into the quality of the RNA. -
Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery
Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Duygu Ucar Graduate Program in Computer Science and Engineering The Ohio State University 2009 Dissertation Committee: Srinivasan Parthasarathy, Advisor Yusu Wang Umit Catalyurek c Copyright by Duygu Ucar 2009 ABSTRACT Many biological datasets can be effectively modeled as interaction networks where nodes represent biological entities of interest such as proteins, genes, or complexes and edges mimic associations among them. The study of these biological network structures can provide insight into many biological questions including the functional characterization of genes and gene products, the characterization of DNA-protein bindings, and the under- standing of regulatory mechanisms. Therefore, the task of constructing biological interac- tion networks from raw data sets and exploiting information from these networks is critical, but is also fraught with challenges. First, the network structure is not always known in a priori; the structure should be inferred from raw and heterogeneous biological data sources. Second, biological networks are noisy (containing unreliable interactions) and incomplete (missing real interactions) which makes the task of extracting useful information difficult. Third, typically these networks have non-trivial topological properties (e.g., uneven degree distribution, small world) that limit the effectiveness of traditional knowledge discovery al- gorithms. Fourth, these networks are usually dynamic and investigation of their dynamics is essential to understand the underlying biological system. In this thesis, we address these issues by presenting a set of computational techniques that we developed to construct and analyze three specific types of biological interaction networks: protein-protein interaction networks, gene co-expression networks, and regulatory networks. -
Impact of RNA Degradation on Gene Expression Profiling
Opitz et al. BMC Medical Genomics 2010, 3:36 http://www.biomedcentral.com/1755-8794/3/36 RESEARCH ARTICLE Open Access Impact of RNA degradation on gene expression profiling Lennart Opitz1, Gabriela Salinas-Riester1, Marian Grade2, Klaus Jung3, Peter Jo2, Georg Emons2, B Michael Ghadimi2, Tim Beißbarth3*†, Jochen Gaedcke2† Abstract Background: Gene expression profiling is a highly sensitive technique which is used for profiling tumor samples for medical prognosis. RNA quality and degradation influence the analysis results of gene expression profiles. The impact of this influence on the profiles and its medical impact is not fully understood. As patient samples are very valuable for clinical studies, it is necessary to establish criteria for the RNA quality to be able to use these samples in later analysis. Methods: To investigate the effects of RNA integrity on gene expression profiling, whole genome expression arrays were used. We used tumor biopsies from patients diagnosed with locally advanced rectal cancer. To simulate degradation, the isolated total RNA of all patients was subjected to heat-induced degradation in a time- dependent manner. Expression profiling was then performed and data were analyzed bioinformatically to assess the differences. Results: The differences introduced by RNA degradation were largely outweighed by the biological differences between the patients. Only a relatively small number of probes (275 out of 41,000) show a significant effect due to degradation. The genes that show the strongest effect due to RNA degradation were, especially, those with short mRNAs and probe positions near the 5′ end. Conclusions: Degraded RNA from tumor samples (RIN > 5) can still be used to perform gene expression analysis. -
Assessing Integrity of Insect RNA
Assessing Integrity of Insect RNA Application Note Nucleic Acid Analysis Authors Abstract Jeffrey A. Fabrick and J. Joe Hull Assessing total RNA integrity is important for the success of downstream RNA Pest Management and Biocontrol applications. The Agilent 2100 Bioanalyzer system with the RNA Integrity Number Research Unit, (RIN) provides a quantitative measure of RNA degradation. Although RINs may not Agricultural Research Service, be ascertained for RNA from all organisms, namely those with unusual or complex United States Department of RNA profiles, this Application Note demonstrates the applicability of total RNA Agriculture, quality assessment of different insect species with the 2100 Bioanalyzer system Maricopa, AZ, USA and its relevance to downstream quantitative RT-PCR experiments. Introduction Experimental RNA extraction Total RNA was extracted from insect In general, the success of downstream Materials RNA applications depends on the tissues using a TissueLyser and TRI quality and integrity of the extracted TissueLyser was obtained from Qiagen Reagent. For RNA degradation, tissues total RNA. Therefore, evaluating levels (Valencia, CA, USA). TRI Reagent, were homogenized in 2-mL round-bottom of degradation in RNA samples is OPTIZYME DNase I and a NanoDrop microfuge tubes with two steel critical. Electrophoretic separation and 1000 spectrophotometer were from beads in PBS buffer (700 µL) or TRI visual inspection of the highly abundant Thermo Fisher Scientific (Waltham, Reagent (positive controls), and held ribosomal RNAs (rRNAs) – 16S and MA, USA). An Agilent 2100 Bioanalyzer at room temperature for 0, 5, 10, 30, or 23S in prokaryotes and 18S and 28S in system (G2940CA or G2943CA) and the 60 minutes. -
Massey Genome Service
MASSEY GENOME SERVICE RNA Quality Analysis using Agilent 2100 Bioanalyzer Operational since 2011 BIOANALYZER TECHNICAL INFORMATION BULLETIN January 2017 BULLETIN INCLUDES Checking the quality of RNA Assay Results Details of Bioanalyzer Report Summary Details of Bioanalyzer Service QC Report Enquiries regarding sequencing technical information contact: Xiaoxiao Lin – Acting Laboratory Manager Massey Genome Service Private Bag 11222, Palmerston North 4442, New Zealand Lab +64 6 350 5378 Office +64 6 951 9080 http://genome.massey.ac.nz MASSEY GENOME SERVICE (MGS) RNA Quality Analysis using Agilent 2100 Bioanalyzer and the RNA 6000 Nano Assay TECHNICAL BULLETIN Background This document provides you with information on how to check the quality of your RNA 6000 Nano assay data, and includes information on: Checking the quality of the RNA Ladder used for product sizing Checking the quality of the total RNA profiles and mRNA profiles Massey Genome Service (MGS) provides the following two reports to the customer: Bioanalyzer Report Summary: This report is generated by the Agilent Bioanlyzer 2100 Expert software used for running the instrument. The report is a summary of the quality of your RNA samples and includes the RNA ladder, which is run with each LabChip assay and is used for product sizing. Bioanalyzer Service QC Report: This report is generated by the MGS and is a summary of our services analysis of the data quality. Included with these two reports are the Data Files, which can be opened using the Agilent 2100 expert software. This is the same software used by the MGS for running and analyzing the results. This software can be downloaded from the MGS website at http://genome.massey.ac.nz , by going to the ‘Bioanalyzer Service’ link. -
Multifaceted Deregulation of Gene Expression and Protein Synthesis with Age
Multifaceted deregulation of gene expression and protein synthesis with age Aleksandra S. Anisimovaa,b,c,1, Mark B. Meersona,c, Maxim V. Gerashchenkob, Ivan V. Kulakovskiya,d,e,f,2, Sergey E. Dmitrieva,c,d,2, and Vadim N. Gladyshevb,2 aBelozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, Moscow 119234, Russia; bDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; cFaculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University, Moscow 119234, Russia; dEngelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow 119991, Russia; eVavilov Institute of General Genetics, Russian Academy of Sciences, Moscow 119991, Russia; and fInstitute of Protein Research, Russian Academy of Sciences, Pushchino 142290, Russia Edited by Joseph D. Puglisi, Stanford University School of Medicine, Stanford, CA, and approved May 27, 2020 (received for review January 30, 2020) Protein synthesis represents a major metabolic activity of the cell. RNA polymerase I, eIF2Be, and eEF2, decrease with age in rat However, how it is affected by aging and how this in turn impacts tissues (10). Increased promoter methylation in ribosomal RNA cell function remains largely unexplored. To address this question, genes and decreased ribosomal RNA concentration during aging herein we characterized age-related changes in both the transcrip- were also reported (11). In addition, down-regulation of trans- tome and translatome of mouse tissues over the entire life span. lation with age was confirmed in vivo in the sheep (12) as well as We showed that the transcriptome changes govern those in the in replicatively aged yeast (13). -
RNA-QC-Protocol-2013.Pdf
SAMPLE MANAGEMENT STANDARD OPERATING PROCEDURE RNA (tube based) QC SOP (For Collaborators) Version Number: 1 Version Date: 5.03.13 Author(s): Jennifer Chiniquy Reviewed/Revised by: Mansi Chovatia, Chia-lin Wei and Shweta Deshpande Summary Before shipping your RNA sample(s), please be sure to follow the JGI sample preparation and sample submission guidelines located at http://my.jgi.doe.gov/general/gettingstarted.html This protocol describes how to perform quality control of RNA samples to evaluate the quantity (Qubit RNA BR Assay) and quality (Agilent Bioanalyzer, RNA 6000 Nano Kit) of your RNA sample(s). We recommend all RNA samples to be evaluated with this protocol before they are shipped to JGI. Materials & Reagents Materials/Reagents/Equipment Supplier/Vendor Stock Number Disposables Qubit assay tubes Q32856 10 ml Serological pipettes 1367811E 0.2 ml PCR 8-tube flex-free strip (RNase-free) 1402-4700 0.2 ml PCR tubes (individual) Ambion/Life Technologies AM12225 Bioanalyzer Cleaning Chips Agilent 5065-9951 Petri Dishes, 100x15 mm, BD Falcon 25373-100 1.5 ml microcentrifuge tubes (RNase-free) Ambion AM12450 Air canister 23022523 Agilent RNA 6000 Nano Kit and Chips (includes syringe for Priming Station) Agilent 5067-1511 Reagents RNase Zap Ambion AM9780 DNA AWAY Surface Decontaminant Fisher Scientific 21-236-28 70% Isopropanol Fisher Scientific 19-130-3860 Nuclease Free Water (10 × 50 ml) Ambion AM9937 Qubit RNA BR Assay Kit Invitrogen Q10211 Equipment 96-well cold block E&K Scientific EK-76120 RNA QC.V1.DOC 1/11 SAMPLE MANAGEMENT STANDARD OPERATING PROCEDURE Bioanalyzer Chip Priming Station Agilent 5065-4401 Chip Vortexer IKA 3617036 2100 Electrophoresis Bioanalyzer Agilent G2939AA Qubit 2.0 Fluorometer Invitrogen Q32866 Thermocycler Applied Biosystems N8050001 Microcentrifuge Eppendorf 022620100 Serological pipettor Eppendorf 022230204 Speed Vac Thermo Fisher SPD1010 EH&S PPE Requirements: Safety glasses, lab coat, and nitrile gloves should be worn at all times while performing this protocol.