Evaluation for Integrity of Extracted RNA by Reference Material Of

al Diag ic no ed s ti M c f M Journal of Medical Diagnostic o

a t h

n Takahashi et al., J Med Diagn Meth 2013, 2:3 r o

d u

o DOI: 10.4172/2168-9784.1000128 J Methods ISSN: 2168-9784

Research Article Article OpenOpen Access Access Evaluation for Integrity of Extracted RNA by Reference Material of RNA Junko Takahashi1*, Akiko Takatsu2 and Hitoshi Iwahashi3 1Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology Tsukuba, Ibaraki, Japan 2National Metrology Institute of Japan, National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki, Japan 3Faculty of Applied Biological Sciences, Gifu University, Gifu, Japan

Abstract Physiological information that identified from RNA expression level in tissues or organs give us benefit in clinical diagnostics. After extracting RNA from blood, tissue, or organs, diagnostics were carried out by using technique for semi-quantitative estimation of specific mRNA, such as real-time PCR or DNA microarrays. Validation of RNA quality need to quantitative estimation of gene expression at the moment of sampling, because using degraded RNA will lead to incorrect results. In this study, we conducted a series of experiment to evaluate RNA integrity using the reference materials of RNA length of 1000 base pairs (refRNA1000), and compared with RIN. There are significant correlation between RIN and the amount of refRNA1000, in varying state of degradation. There are also significant correlations between the amount of refRNA1000 and endogenous gene such as Actb and Rps18 in varying state of degradation in our study. The amount of endogenous gene reflects the extent of degradation more directly than that of RIN. To monitor the extent of degradation from the experimental starting point, we may refer the reference materials of refRNA1000. Not only for clinical diagnosis, but scientists always require the validity of experimental procedure, one of the candidate methods is using reference materials of RNA such as refRNA1000.

Keywords: RNA quality; RNA quantity; RNA diagnosis; Reference Materials and Methods material RNA reference material Introduction The synthetic constructed RNA has the length of 1000 base pairs, Physiological information that identified from RNA expression developed as candidate material of certificated reference materials level in tissues or organs give us benefit in clinical diagnostics. Thus, (CRM) for spike-in microarray control RNA. The sequence of the the diagnostic methods for evaluation of specific gene transcripts have refRNA1000 can be referred as Accession No. AB610945 in Genbank been developed to indicate the presence or prognosis of disease, to (http://www.ncbi.nlm.nih.gov/nuccore/AB610945). The solution predict or monitor the response to drug therapy, and to track disease of the refRNA1000 is produced 88.0 ng/μL. This refRNA1000 were 5 kinetics [1-6]. Diagnostics were carried out by using technique for added cells (5.0×10 cells) to be 20 pg. RNA reference materials with semi-quantitative estimation of specific mRNA, such as real-time different sequences were supplied as ribonucleic acid solution for reverse transcription PCR (RT-PCR) or DNA microarrays to samples quantitative analysis as NMIJ CRM 6204 from NMIJ. The protocols for prepared from blood, tissues or organs. preparation and evaluation were described in Web pages (https://www. nmij.jp/service/C/crm/42/6204a_J.pdf). These CRM concentrations It should be noted that diagnostics are strongly due to the quality of were determined by isotope-dilution mass spectrometry (ID-MS and mRNA. Intracellular RNA may be rapidly degraded ex vivo by specific inductively coupled plasma mass spectrometry (ICP-MS). RefRNA1000 and nonspecific endogenous nucleases. Contingent gene expressions to be degraded by RNase was confirmed previously. also can be induced by sampling collections. Transportation procedures, storage conditions, purification methods and unknown Cell preparation factors significantly affect the quality of mRNA. For monitoring degrading RNA situations, total RNA of the B16- Validation of RNA quality need for experiments that try to BL6 mouse melanoma cell were used. The B16-BL6 melanoma is known quantitative estimation of gene expression at the moment of to be highly invasive and spontaneously metastasizes [8]. This cell line sampling, because using degraded RNA will lead to incorrect is easily grown in culture media. These views are suitable for systems results. Commonly, the 28S/18S rRNA ratio is used to assess RNA as diagnostic model using total RNA. The cell line was supplied by the quality, as the ratio close to 2 should be indicative of intact RNA in Riken Cell Bank (Tsukuba, Japan) and cultured in PRMI1640 (GIBCO theory. Recently, Agilent Technologies introduced the RIN (an RNA integrity number) for assigning integrity value in order to RNA measurements [7]. The amount of endogenous gene reflects the *Corresponding author: Junko Takahashi, Biomedical Research Institute, extent of degradation more directly than that of RIN. It is difficult to National Institute of Advanced Industrial Science and Technology Tsukuba, 1-1- determine the absolute amount of them in each experiment without 1 Higashi, Tsukuba, Ibaraki 305-8563 Japan, Tel: +81-29-862-6705; Fax: +81- 29-861-2706; E-mail: [email protected] standard of comparison. In order to guarantee measurement traceability, the reference materials of RNA were developed by Received July 15, 2013; Accepted August 05, 2013; Published August 08, 2013 National Institute of Advanced Industrial Science and Technology Citation: Takahashi J, Takatsu A, Iwahashi H (2013) Evaluation for Integrity (AIST) and National Metrology Institute of Japan (NMIJ). The of Extracted RNA by Reference Material of RNA. J Med Diagn Meth 2: 128. doi:10.4172/2168-9784.1000128 reference materials of RNA which has the length of 1000 base pairs (refRNA1000) were constructed synthetically. In this study, we Copyright: © 2013 Takahashi J, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits conducted a series of experiment to evaluate RNA integrity using unrestricted use, distribution, and reproduction in any medium, provided the the refRNA1000, and compared with RIN. original author and source are credited.

J Med Diagn Meth ISSN: 2168-9784 JMDM, an open access journal Volume 2 • Issue 3 • 1000128 Citation: Takahashi J, Takatsu A, Iwahashi H (2013) Evaluation for Integrity of Extracted RNA by Reference Material of RNA. J Med Diagn Meth 2: 128. doi:10.4172/2168-9784.1000128

Page 2 of 5

BRL, Life Technologies, Tokyo, Japan) containing 10% FBS (Moregate Statistics ° BioTech, QLD, Australia) in a 5% CO2 humidified incubator at 37 C. Cells near confluence were gently separated into a single-to several- Pearson correlation coefficients were calculated to identify cell suspension with trypsin-EDTA, washed by PBS, and dispensed in similarities among amount of refRNA1000, Actb, Rps18, and RIN value. 0.1 ml aliquots (5.0×105 cells/tube) into plastic tubes. RNA reference The statistical significance of correlation coefficients was calculated. ° material was added 20 pg/tube, and then stored at -80 C. Results RNA degradation and extraction RNA yield Before RNA extraction, prepared tubes were incubated at 25°C To characterize the degree of degradation, yield of RNA derived for various times. After that, total RNA was extracted using RNeasy from cells were measured and microfluidics-based electrophoresis Mini Kit (Quiagen, Germany) following the manufacturer’s guidelines. were performed after RNA extraction. RNA yield change is shown Total RNA were collected by 30 μL RNase-free water. The expected in figure 1. The yield of RNA decreases depending on degradation concentration of refRNA1000 is 0.67 pg/μL. time. The isolation kit for this study use spin-column based on silica membranes technology, allows capture longer than 200 bases. So the RNA evaluation – concentration and electrophoresis nucleotide shorter than 200 bases result from degradation was lost RNA concentrations were determined using a NanoDrop® ND-1000 during isolation. spectrophotometer (NanoDrop Technologies, Wilmington, DE). For RNA integrity microcapillary electrophoresis, the Agilent 2100 bioanalyzer was used in conjunction with the RNA 6000 Nano LabChip kits. The RIN values RNA extracted from cell line incubated at room temperature prior were obtained automatically by algorithm based on a Bayesian learning to extraction. After isolation of RNA, electrophoresis of the RNA was that takes into consideration 8 features from the electrophoretic trace, carried out using Agilent 2100 Bioanalyzer. Electropherogram profiles including total RNA ratio. at different time of heat-mediated degradations are shown in Figure 2. Incubation time is indicated for each graph. In each figure, 18S and 28S RNA evaluation–real-time RT-PCR methods rRNA peaks map to 42 sec and 50sec respectively. RefRNA1000 were assessed by real-time RT-PCR with the MJ Mini Effect of degradation time on RIN values is shown in figure 3. The Thermal Cycler (Bio-Rad) using primers as described in table 1. Actb RIN values range from 10(intact) to 1(totally degraded) were calculated and Rps18 from cells RNA were also measured. The primers of these automatically by algorithm using Bayesian learning network taken genes were designed to span intron to avoid detection of genomic DNA. into consideration 8 features from the electrophoretic trace. The RIN iScript One-Step RT-PCR Kit with SYBR Green (Bio-Rad) was used to number decreases depending on degradation time. reverse-transcribe and amplify the RNA template for 40 cycles, 25 μM 2xSYBR Green RT reaction mix, 0.2 μM each primer, 1μL iScript reverse Real -time RT-PCR transcriptase for one-step RT-PCR and 1 μL template. The endpoint To evaluate semi-quantity of RNA, real time RT-PCR were used in the real-time RT-PCR quantification, C , is defined as the PCR t performed. Figure 4 shows the result of real time RT-PCR with serial cycle number that crossed an arbitrarily placed signal threshold. To dilutions of refRNA1000. The standard curve of refRNA1000 was determine semi-quantity of RNA, the calibration curve method was generated from 10 x serial dilutions. The derived standard curve showed used to determine the relative amounts of RNA value. that the correlation coefficient, r, is 0.998. The extraction efficiency of

250

200 ) l μ / g

n 150 ( d l e i

y 100 A N

R 50

0 SS 0 2 4 6 8 10 1224 14 Degradation time (hours)

Figure 1: Effects of degradation time on RNA yield. RNA yield of each samples of different degradation times were measured. RNA extracted from cell line incubated at room temperature prior to extraction. Short fragments resulting from degradation were removed during extraction and RNA concentration decrease as degradation time.

Gene Forward primer Reverse primer RefRNA1000 5’ TGGACCTCTGCGGCTATTTG 3’ 5’ CGGTTGTATGGTGGC GGTTA 3’ Actb 5’ TCCACACCCGCCACCAGTTC 3’ 5’ CATTCCCACCATCACACCCTGG 3’ Rps18 5’ GATGGGCGGCGGAAAATAGCCT 3’ 5’ CGATGTCTGCTTTCCTCAACACCAC 3’ Table 1: Primers used in the PCR. The nucleotide sequences of the PCR primers used to assay gene expression by real-time RT-PCR are shown.

Page 3 of 5

0 hour, RIN 9.8 3 hours, RIN 5.3 Fluorescence

0.5 hour, RIN 9.7 4 hours, RIN 4.7 Fluorescence

1 hour, RIN 8.5 6 hours, RIN 3.2 Fluorescence

2 hours, RIN 6.8 24 hours, RIN 2.5 Fluorescence

time time

Figure 2: Electropherogram profiles at different time of heat-mediated degradations. RNA extracted from cell line incubated at room temperature prior to extraction. After extraction of RNA, electrophoresis of the RNA was carried out using Agilent 2100 Bioanalyzer. 18S and 28S rRNA peaks map to 42 sec and 50sec respectively. Incubation time is indicated for each graph.

r 8 e b m

u 6 n N I 4 R

2 0 SS 0 2 4 6 8 10 1224 14 Degradation time (hours)

Figure 3: Effects of degradation time on RIN values. RIN numbers of each sample of different degradation times were measured. The RIN numbers were calculated automatically by algorithm using Bayesian learning network by Agilent 2100 Bioanalyzer.

Page 4 of 5 refRNA1000 without cells results in the yield of extraction with 0.67 ± 0.15 (n=5). A 1.6

Figure 5 shows relative values of refRNA1000, Actb and Rps18 1.4 t n of degraded samples. The amounts of these RNA were calculated by u 1.2 o standard curve and normalized by that of no degraded sample. The m

a 1.0 A

relative amounts decrease with degradation time, caused by dividing N 0.8 R

into short fragments or by alternation regardless of sequences. e

v 0.6 i t a l

We examined correlation of pairwise correlation among refRNA100, e 0.4 R Actb, Rps18 and RIN. The correlation coefficients between refRNA1000 0.2 were 0.794, 0.546 and 0.635 for Actb, Rps18, RIN, and different were 0.0 SS statistically significant (p<0.001). The correlation coefficients between 0 2 4 6 8 10 12 1424 RIN were 0.640 and 0.857 for Actb, Rps18, and different were statistically Degradation time (hours) B significant (p<0.001). 1.8 1.6 t

Discussion n 1.4 u o

RNA is useful to clinical diagnostics, because RNA contains an m 1.2 a

A 1.0

enormous amount of information on expression of messenger RNA and N

R 0.8 non coding functional RNAs which remain without being translated e v i

t 0.6 a

into proteins. But for evaluation of RNA expression levels, degradation l

e 0.4 is susceptible during storage or artificial manipulations such as cell R separation and extraction. So it is important to evaluate RNA quality 0.2 from the starting step to evaluating step. 0.0 SS 0 2 4 6 8 10 12 1424 Classically, RNA quality is evaluated by agarose gel electrophoresis Degradation time (hours) C stained with ethidium bromide. RNA considered of high quality when 1.8 the ratio of 28S:18S bands is close to 2.0 or higher, but the ratio has

t 1.6 n been shown to be inconsistent. The performance of semi-quantitative u

o 1.4 estimation of mRNA using microarray or real-time RT-PCR studies m a 1.2 A were significantly influenced by RNA integrity [9,10]. Recently, two N 1.0 R computer methods, the degradometer software and the RIN algorithm e 0.8 v i t a were developed [7,11]. l 0.6 e RIN is the method for evaluation RNA integrity taking R 0.4 0.2 0.0 SS 0 2 4 6 8 10 1224 14 A Degradation time (hours) 0.30

0.25 Figure 5: Effects of degradation time on amount of refRNA1000, Actb, e

c and RPS18.

n 0.20 e Relative values of refRNA1000, Actb and Rps18 of degraded samples of c

s different degradation times were measured. The amounts of these RNA were e 0.15 r 2.00E-05 o calculated by standard curve and normalized by no degraded sample. (A)

u 2.00E-04 l 0.10

F 2.00E-03 refRNA1000, (B) Actb (C) Rps18. (n=5). 2.00E-02 0.05 2.00E-01 2.00E+00 0.00 characteristics of several regions of the recorded electropherogram into 0 10 20 30 40 account, these regions are the marker region, 5S region, fast region, B C ycle 30 18S fragment, inter region, 28S fragment and post region [7]. RIN was proposed instead of the 28S/18S ratio, as this ratio was shown to be 25 unrelated to the amounts of housekeeping genes semi-quantified by 20 real-time RT-PCR [12]. RIN is considered more reliable to evaluate

) e l 15 RNA integrity based on the relation to the amount of housekeeping c y

c 10 gene by real-time RT-PCR. The amount of endogenous gene reflects the ( t extent of degradation more directly than that of RIN and can be carried C 5 out without expensive equipment. 0 To estimate the RNA integrity we propose to use refRNA1000, as there are significant correlation between RIN and the amount of Amount (ng) refRNA1000, in varying state of degradation. There are also significant correlations between refRNA1000 and endogenous gene such as Actb Figure 4: Real-time RT-PCR with serial dilutions of refRNA1000. The and Rps18 in varying state of degradation in our study. The results standard curve of refRNA1000 was generated from 10 x serial dilutions (n=3). suggest for the benefit of refRNA1000 for evaluation of RNA integrity.

Page 5 of 5

A B C 1.8 1.6 10.0

9.0 1.6 1.4

1.4 8.0 1.2 7.0 1.2 1.0 6.0 1.0 0.8 5.0

0.8 RI N Actb 4.0 R ps 18 0.6 0.6 3.0 0.4 0.4 2.0 0.2 0.2 1.0

0.0 0.0 0.0 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 D E RefRNA1000 1.8 RefRNA1000 1.6 RefRNA1000

1.6 1.4

1.4 1.2 1.2 1.0 1.0 0.8 0.8 Actb

Rps18 0.6 0.6 0.4 0.4

0.2 0.2

0.0 0.0 0.0 2.0 4.0 6.0 8.0 10.0 0.0 2.0 4.0 6.0 8.0 10.0 RIN RIN

Figure 6: Scatter plot of degradated-related correlation coefficients. (A) RefRNA vs. Actb. (B) RefRNA vs. Rps18. (C) RefRNA vs. RIN. (D) RIN vs. Actb. (E) RIN vs. Rps18.

To monitor the extent of degradation, the extraction yield, the an RNA integrity number for assigning integrity values to RNA measurements. storage conditions and even the transportation procedures, we may refer BMC Mol Biol 7: 3. the reference materials of refRNA1000 by poured refRNA1000s before 8. Nicolson GL, Dulski K, Basson C, Welch DR (1985) Preferential organ extraction, before storage, before transportation, and just after sampling. attachment and invasion in vitro by B16 melanoma cells selected for differing metastatic colonization and invasive properties. Invasion Metastasis 5: 144- Using ribonucleic acid solutions for quantitative analysis of NMIJ CRM 158. 6204 may evaluate the each procedures by different refRNA1000s at 9. Fleige S, Pfaffl MW (2006) RNA integrity and the effect on the real-time qRT- once. Not only for clinical diagnosis, but scientists always require the PCR performance. Mol Aspects Med 27: 126-139. validity of experimental procedure, one of the candidate methods is using reference materials of RNA such as refRNA1000. 10. Weis S, Llenos IC, Dulay JR, Elashoff M, Martínez-Murillo F, et al. (2007) Quality control for microarray analysis of human brain samples: The impact Acknowledgment of postmortem factors, RNA characteristics, and histopathology. J Neurosci Methods 165: 198-209. The authors wish to thank Shin-ichiro Fujii for providing refRNA1000. This work was supported by JSPS KAKENHI Grant Number 25670282. 11. Auer H, Lyianarachchi S, Newsom D, Klisovic MI, Marcucci G, et al. (2003) Chipping away at the chip bias: RNA degradation in microarray analysis. Nat References Genet 35: 292-293.

1. Nagel S, Schmidt M, Thiede C, Huhn D, Neubauer A (1996) Quantification of 12. Miller CL, Diglisic S, Leister F, Webster M, Yolken RH (2004) Evaluating RNA Bcr-Abl transcripts in chronic myelogenous leukemia (CML) using standardized, status for RT-PCR in extracts of postmortem human brain tissue. Biotechniques internally controlled, competitive differential PCR (CD-PCR). Nucleic Acids Res 36: 628-633. 24: 4102-4103.

2. Wong IH, Chan AT, Johnson PJ (2000) Quantitative analysis of circulating tumor cells in peripheral blood of osteosarcoma patients using osteoblast- specific messenger RNA markers: a pilot study. Clin Cancer Res 6: 2183-2188.

3. Wang SW, Pawlowski J, Wathen ST, Kinney SD, Lichenstein HS, et al. (1999) Cytokine mRNA decay is accelerated by an inhibitor of p38-mitogen-activated protein kinase. Inflamm Res 48: 533-538.

4. Hochhaus A, Lin F, Reiter A, Skladny H, Mason PJ, et al. (1996) Quantification of residual disease in chronic myelogenous leukemia patients on interferon- alpha therapy by competitive polymerase chain reaction. Blood 87: 1549-1555.

5. Hochhaus A, Weisser A, La Rosée P, Emig M, Müller MC, et al. (2000) Detection and quantification of residual disease in chronic myelogenous leukemia. Leukemia 14: 998-1005.

6. Lin F, van Rhee F, Goldman JM, Cross NC (1996) Kinetics of increasing BCR- ABL transcript numbers in chronic myeloid leukemia patients who relapse after bone marrow transplantation. Blood 87: 4473-4478.

7. Schroeder A, Mueller O, Stocker S, Salowsky R, Leiber M, et al. (2006) The RIN:

J Med Diagn Meth ISSN: 2168-9784 JMDM, an open access journal Volume 2 • Issue 3 • 1000128