DOCSLIB.ORG

PCR Detection of Pseudoperonospora Humuli and Podosphaera Macularis in Humulus Lupulus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PCR Detection of Pseudoperonospora Humuli and Podosphaera Macularis in Humulus Lupulus Plant Protect. Sci. Vol. 41, No. 4: 141–149 PCR Detection of Pseudoperonospora humuli and Podosphaera macularis in Humulus lupulus JOSEF PATZAK Hop Research Institute Co., Ltd., Žatec, Czech Republic Abstract PATZAK J. (2005): PCR detection of Pseudoperonospora humuli and Podosphaera macularis in Humulus lupulus. Plant Protect. Sci., 41: 141–149. Hop downy mildew (Pseudoperonospora humuli) and hop powdery mildew (Podosphaera macularis) are the most important pathogens of hop (Humulus lupulus). The early detection and identification of these pathogens are often made difficult by symptomless or combined infection with another pathogens. Molecular analysis of internal transcribed spacer (ITS) regions of rDNA is a novel and very effective method of species determina- tion. Therefore, specific PCR assays were developed to detect the pathogens Pseudoperonospora humuli and Podosphaera macularis in naturally infected hop plants. The specific PCR primer combinations P1 + P2 and S1 + S2 amplified specific fragments from Pseudoperonospora humuli and Podosphaera macularis, respectively, and did not cross-react with hop DNA nor with DNA from other fungi. PCR primer combinations R1 + R2 and R3 + R4 could be used in multiplex PCR detection of Pseudoperonospora humuli, Podosphaera macularis, Verticillium albo-atrum and Fusarium sambucinum. Phylogenetic relationships were inferred for 42 species of the Erysiphales from nuclear rDNA (ITS1, 5.8S, ITS2). The molecular characterisation and phylogenetic analy- ses confirmed the species identification of hop powdery mildew. The PCR assays used in this study proved to be accurate and sensitive for detection, identification, classification and disease-monitoring of the major hop pathogens. Keywords: hop powdery mildew; hop downy mildew; internal transcribed spacers (ITS); PCR detection; phylo- genetic analysis Hop (Humulus lupulus L.) is a dioecious, peren- disease occurring worldwide. The pathogen infects nial, climbing plant and only female individuals young shoots, leaves, flowers and cones, causing are cultivated. Female inflorescences, referred “basal spikes”, angular black leaf spots and brown to as cones, are commercially used in brewing, discolouration of cones (NEVE 1991). Oospores and the pharmaceutical and cosmetics industry. are formed in infected shoots and cones (CHEE Unfortunately, the plants are regularly subjected & KLEIN 1998). Although hop downy mildew has to infection by oomycetal and fungal pathogens. not been extensively studied, the fine structure The infection sometimes results in severe loss of of the sporangium was described by CONSTAN- production as the plants wither (NEVE 1991). TINESCU (2000). Pseudoperonospora humuli (Miabe and Takah.) Podosphaera macularis (Braun) syn. Sphaerothe- Wilson is the causal agent of hop downy mildew, a ca macularis (Wallr.:Fr) Lind. (synonym S. humuli Supported by the Ministry of Education, Youth and Sports of the Czech Republic, Project No. MSM 1486434701. 141 Vol. 41, No. 4: 141–149 Plant Protect. Sci. (DC.) Burrill) is the causal agent of hop powdery DNA was isolated from pure cultures of fungal mildew, which has become a serious problem in isolates, mycelia and infected plant materials with almost all hop growing regions (SEIGNER et al. DNeasy Plant Mini kit (Qiagen, FRG), and from 2002). This pathogen infects leaves and cones, infected plants in field conditions with REDExtract causing humps, blisters, pale spots, distortion of N-Amp Plant PCR Kit (Sigma-Aldrich, USA), both cones and white mildew colonies. Conidia grow according to manufacturer’s instructions. Samples up from a surface mycelium (NEVE 1991). The were collected between 2001 and 2004. pathogen has not been extensively studied. PCR and sequencing. The ITS regions of the nu- Early detection and identification of pathogens clear rDNA, from 18S, 5.8S and 26S, were amplified are crucial for the implementation of efficient using primers R1 (GTGAACCWGCGGARGGAT- control strategies. Disease symptoms are rarely CATT) derived from the conserved region of 16S discernible on growing crops before mass infec- rDNA, R2 (TTYGCTRCGTTCTTCATCGATG), tion occurs and they can sometimes be confused R3 (GCATCGATGAAGAACGYAGCRA) derived with those of another species. Therefore, rapid, from the conserved region of 5.8S rDNA and R4 specific and sensitive methods for the detection (TATCTTAARTTCAGCGGGT) derived from con- of all important pathogens are required. Classical served region of 26S r DNA. Taq PCR master mix identification methods, based on morphological kit (Qiagen, FRG) and REDExtract N-Amp Plant or physiological characters, are time-consuming, PCR Kit (Sigma-Aldrich, U.S.A.) were used for PCR labour intensive and require considerable knowl- reactions according to manufacturer’s instructions. edge of the genera involved (GROTE et al. 2002). PCR amplifications were carried out in a Genius Molecular DNA techniques represent a novel and thermocycler (Techne, UK). After denaturation highly effective means of species determination, step 95°C 3 min, 35 cycles of amplification (94°C based mainly on the comparison of internal tran- 30 s, 54°C 60 s, 72°C 90 s) and 10 min at 72°C were scribed spacers (ITS) regions of rDNA (COOKE et performed. A minimum of two amplifications was al. 2000). Molecular data as a whole have been used always performed in order to check consistency. extensively to reconstruct phylogenetic relation- Aliquots of 10 µl of PCR products were analysed ships among downy and powdery mildew fungi by electrophoresis on horizontal 2% agarose gel, (SAENZ & TAYLOR 1999; VOGLMAYR 2003). stained by ethidium bromide and visualised under In this paper, we report the development of UV light. PCR products were then excised from specific PCR primers for the detection of Pseu- the gel, isolated with QIAquick Gel Extraction kit doperonospora humuli and Podosphaera macularis (Qiagen, FRG) and prepared for DNA sequencing. in naturally infected hop plants using molecular Both DNA strands were sequenced in the Labo- sequencing of ribosomal ITS regions. ratory of Plant Molecular Physiology, Masaryk University, Brno, Czech Republic, using ABI Prism MATERIALS AND METHODS 310 DNA sequencer (Applera Corporation, Ap- plied Biosystems, U.S.A.) in 2001. Sample sources and DNA extraction. Hop downy The specific rDNA of Pseudoperonospora humuli mildew (Pseudoperonospora humuli) and hop pow- were amplified using the primers P1 (CTGAG- dery mildew (Podosphaera macularis) were obtained GGGACGAAAGGCTCTG) derived from ITS1 and as mycelia from infected hop (Humulus lupulus) P2 (CTGGTCACATGGACAGCCTTCA) derived plants in the experimental hopgarden of the Hop from ITS2. The specific rDNA of Podosphaera Research Institute Co. Ltd., Žatec, Czech Republic. macularis were amplified using the primers S1 Other species of fungi were collected on diseased (CCCGAACTCATGTAGTTAGTGC) derived from hop plants and isolated by successive plating on ITS1 and S2 (GAGCACATCGGTACCGCCACTA) potato dextrose agar (Sigma-Aldrich, U.S.A.). Indi- derived from ITS2. The PCR protocol was the vidual isolates were separated and determined and same as described above. The experiments were grown 5 d at 23°C. The determination of species completed during 3 years for determination of was confirmed by Prof. EWA SOLARSKA from the specificity, consistency and monitoring ability. Institute of Soil Science and Plant Cultivation, Lub- Data analysis. The sequence alignment of con- lin, Poland. A Verticillium albo-atrum isolate from served rDNA regions of Humulus lupulus, Perono- hop was obtained from Dr. S. RADIŠEK, Institute of spora sp., Podosphaera sp., Verticillium sp. and Hop Research and Brewing, Žalec, Slovenia. Fusarium sp. was initially produced by MegAlign 142 Plant Protect. Sci. Vol. 41, No. 4: 141–149 Table 1. List of GenBank accession numbers for taxa studied in phylogenetic analyses Taxon Source of sequence Accession number Cystotheca lanestris TAKAMATSU et al. (2000) AB000933 Cystotheca wrightii TAKAMATSU et al. (2000) AB000932 Erysiphe convolvuli CUNNINGTON et al. (2000) only in database AF154327 Erysiphe glycines TAKAMATSU et al. (2002) only in database AB078807 Erysiphe gracilis MORI et al. (2000) AB022358 Erysiphe graminis HIRATA and TAKAMATSU (1996) D84379 Erysiphe pisi CUNNINGTON et al. (1999) only in database AF073348 Erysiphe prunastri GRIGALIUNAITE and TAKAMATSU (2001) only in database AB046984 Erysiphe tritici MORI et al. (2000) AB022377 Microsphaera trifolii CUNNINGTON et al. (2001) only in database AF298542 Microsphaera alphitoides ROLLAND et al. (2002) only in database AJ309201 Microsphaera juglandis TAKAMATSU et al. (1999) AB015928 Microsphaera platani CUNNINGTON et al. (1999) only in database AF073349 Microsphaera sparsa CUNNINGTON et al. (2001) only in database AF298541 Oidium longipes KISS et al. (2001) AF250777 Oidium lycopersici KISS et al. (2001) AF229021 Podosphaera aphanis CUNNINGTON et al. (1999) only in database AF073355 Podosphaera balsaminae HIRATA et al. (2000) AB040344 Podosphaera cercidiphylli TAKAMATSU et al. (2000) AB026140 Podosphaera clandestina TAKAMATSU et al. (2000) AB026150 Podosphaera collomiae CUNNINGTON et al. (2001) only in database AF298546 Podosphaera cucurbitae HIRATA et al. (2000) AB040330 Podosphaera elsholtziae TAKAMATSU et al. (2000) AB026142 Podosphaera euphorbiae-hirtae HIRATA et al. (2000) AB040306 Podosphaera ferrugunea TAKAMATSU et al. (2000) AB027232 Podosphaera filipendulae TAKAMATSU et al. (2000) AB022385 Podosphaera fugax TAKAMATSU et al. (2000) AB026134 Podosphaera fuliginea HIRATA et
Load more

Recommended publications
  • EVALUATION of SILICON and BIOFUNGICIDE PRODUCTS for MANAGING POWDERY MILDEW CAUSED by Podosphaera Fusca in GERBERA DAISY (Gerbera Jamesonii)
    EVALUATION OF SILICON AND BIOFUNGICIDE PRODUCTS FOR MANAGING POWDERY MILDEW CAUSED BY Podosphaera fusca IN GERBERA DAISY (Gerbera jamesonii) By CATALINA MOYER A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2007 1 © 2007 Catalina Moyer 2 To my husband Scott 3 ACKNOWLEDGMENTS Immense appreciation given to Dr. Natalia Peres for her trusts and support. Thanks go out to the staff and faculty at the Gulf Coast Research and Education Center for their assistance. Especially thanks offered to Dr. Steve Mackenzie for his statistical wisdom, for caring about my project and for inspire me as a scientist. Thanks left to my friends in Gainesville in particular Linley for sharing her home and Norma for sharing the good and stressful times as graduate students. Thanks go out to all other members of my committee for their contributions to this project. Bountiful gratitude presented to my husband, for supporting me during the last two years. Thanks sent to my family for inspiring my growth. 4 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES...........................................................................................................................7 LIST OF FIGURES .........................................................................................................................8 ABSTRACT.....................................................................................................................................9
    [Show full text]
  • First Records of a Powdery Mildew Fungus Sawadaea Bicornis (Wallr.)
    УДК 582.282.112(477) В.П. ГЕЛЮТА 1, В.В. ДЖАГАН 2, О.О. СЕНЧИЛО 2 1 Інститут ботаніки імені М.Г. Холодного НАН України Україна, 01601 м. Київ, вул. Терещенківська, 2 2 Навчально-науковий центр «Інститут біології», Київський національний університет імені Тараса Шевченка Україна, 01601 м. Київ, вул. Володимирська, 64 ПЕРШІ ЗНАХІДКИ БОРОШНИСТОРОСЯНОГО ГРИБА SAWADAEA BICORNIS (WALLR.) HOMMA НА ACER VELUTINUM BOISS. В УКРАЇНІ Наведено інформацію про перші знахідки в Україні борошнисторосяного гриба Sawadaea bicornis (Wallr.) Homma на інтродукованому декоративному клені (Acer velutinum Boiss.). Уперше гриб виявлено у 2014 р. на території Ботаніч- ного саду імені акад. О.В. Фоміна (Київ). Його розвиток спостерігали тут і наступного року. Ураження A. velutinum борошнистою росою не було значним, міцелій гриба у вигляді дифузних сіруватих плям був добре помітний з верхнього боку листків. Відзначено утворення плодових тіл. Знахідка S. bicornis на A. velutinum є новою не лише для території України, а й для Європи. Очевидно, ця знахідка є свідченням того, що інтродуковані рослини можуть уражатися місцевими расами борошнисторосяних грибів, які розвиваються на споріднених аборигенних видах рослин-жи ви те лів. Ключові слова: Ascomycota, Erysiphales, Sawadaea tulasnei, декоративна рослина, Sapindaceae, Ботанічний сад імені акад. О.В. Фоміна, Крим, Нікітський ботанічний сад. Борошнисторосяні гриби (Erysiphales, Ascomy- на кінському каштані та ще п’яти видах роду cota) є облігатними паразитами судинних рос- Aesculus L. [3], E. elevata (Burrill) U. Braun et лин, переважно дводольних. За останніми да- S. Takam. на катальпі [13], E. magnifica (U. Braun) ними [11], вони уражують понад 10 тис. видів U. Braun et S. Takam. на 11 видах магнолій [9], рослин, однак кожен рік у світі реєструють E.
    [Show full text]
  • Preliminary Classification of Leotiomycetes
    Mycosphere 10(1): 310–489 (2019) www.mycosphere.org ISSN 2077 7019 Article Doi 10.5943/mycosphere/10/1/7 Preliminary classification of Leotiomycetes Ekanayaka AH1,2, Hyde KD1,2, Gentekaki E2,3, McKenzie EHC4, Zhao Q1,*, Bulgakov TS5, Camporesi E6,7 1Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, Yunnan, China 2Center of Excellence in Fungal Research, Mae Fah Luang University, Chiang Rai, 57100, Thailand 3School of Science, Mae Fah Luang University, Chiang Rai, 57100, Thailand 4Landcare Research Manaaki Whenua, Private Bag 92170, Auckland, New Zealand 5Russian Research Institute of Floriculture and Subtropical Crops, 2/28 Yana Fabritsiusa Street, Sochi 354002, Krasnodar region, Russia 6A.M.B. Gruppo Micologico Forlivese “Antonio Cicognani”, Via Roma 18, Forlì, Italy. 7A.M.B. Circolo Micologico “Giovanni Carini”, C.P. 314 Brescia, Italy. Ekanayaka AH, Hyde KD, Gentekaki E, McKenzie EHC, Zhao Q, Bulgakov TS, Camporesi E 2019 – Preliminary classification of Leotiomycetes. Mycosphere 10(1), 310–489, Doi 10.5943/mycosphere/10/1/7 Abstract Leotiomycetes is regarded as the inoperculate class of discomycetes within the phylum Ascomycota. Taxa are mainly characterized by asci with a simple pore blueing in Melzer’s reagent, although some taxa have lost this character. The monophyly of this class has been verified in several recent molecular studies. However, circumscription of the orders, families and generic level delimitation are still unsettled. This paper provides a modified backbone tree for the class Leotiomycetes based on phylogenetic analysis of combined ITS, LSU, SSU, TEF, and RPB2 loci. In the phylogenetic analysis, Leotiomycetes separates into 19 clades, which can be recognized as orders and order-level clades.
    [Show full text]
  • Genetic and Pathogenic Relatedness of Pseudoperonospora Cubensis and P. Humuli
    Mycology Genetic and Pathogenic Relatedness of Pseudoperonospora cubensis and P. humuli Melanie N. Mitchell, Cynthia M. Ocamb, Niklaus J. Grünwald, Leah E. Mancino, and David H. Gent First, second, and fourth authors: Department of Botany and Plant Pathology, third author: United States Department of Agriculture– Agricultural Research Service (USDA-ARS), Horticultural Crops Research Unit; and fifth author: USDA-ARS, Forage Seed and Cereal Research Unit, and Department of Botany and Plant Pathology, Oregon State University, Corvallis. Accepted for publication 6 March 2011. ABSTRACT Mitchell, M. N., Ocamb, C. M., Grünwald, N. J., Mancino, L. E., and in nuclear, mitochondrial, and ITS phylogenetic analyses, with the Gent, D. H. 2011. Genetic and pathogenic relatedness of Pseudoperono- exception of isolates of P. humuli from Humulus japonicus from Korea. spora cubensis and P. h u m u l i . Phytopathology 101:805-818. The P. cubensis isolates appeared to contain the P. humuli cluster, which may indicate that P. h um u li descended from P. cubensis. Host-specificity The most economically important plant pathogens in the genus experiments were conducted with two reportedly universally susceptible Pseudoperonospora (family Peronosporaceae) are Pseudoperonospora hosts of P. cubensis and two hop cultivars highly susceptible to P. humuli. cubensis and P. hu m u li, causal agents of downy mildew on cucurbits and P. cubensis consistently infected the hop cultivars at very low rates, and hop, respectively. Recently, P. humuli was reduced to a taxonomic sporangiophores invariably emerged from necrotic or chlorotic hyper- synonym of P. cubensis based on internal transcribed spacer (ITS) sensitive-like lesions. Only a single sporangiophore of P.
    [Show full text]
  • On Canola (Brassica Napus L.) Leaves 28 Abstract
    Pathogen growth inhibition and disease suppression on cucumber and canola plants with ActiveFlower™ (AF), a foliar nutrient spray containing boron by Li Ni B.Sc., Dalhousie University, 2016 B.Sc., Fujian Agricultural and Forestry University, 2016 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science in the Department of Biological Sciences Faculty of Science © Li Ni 2019 SIMON FRASER UNIVERSITY Summer 2019 Copyright in this work rests with the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Approval Name: Li Ni Degree: Master of Science Title: Pathogen growth inhibition and disease suppression on cucumber and canola plants with ActiveFlowerTM (AF), a foliar nutrient spray containing boron Examining Committee: Chair: Gerhard Gries Professor Zamir Punja Senior Supervisor Professor Sherryl Bisgrove Supervisor Associate Professor Rishi Burlakoti External Examiner Research Scientist – Plant Pathology Agriculture and Agri-Food Canada Date Defended/Approved: July 30, 2019 ii Abstract The effectiveness of ActiveFlower (AF), a fertilizer containing 3% boron in reducing pathogen growth and diseases on cucumber and canola plants was evaluated. In vitro, growth of S. sclerotiorum with AF at 0.1, 0.3 and 0.5 mL/100 mL showed pronounced inhibition at 0.5 mL/100 mL. In greenhouse experiments, the number of powdery mildew colonies on cucumber was significantly reduced by AF at the higher concentrations applied as weekly foliar sprays. On detached canola leaves, AF at 0.5 mL/100 mL and boric acid (BA) at 10 mL/L significantly reduced lesion size of S.
    [Show full text]
  • The Phylogeny of Plant and Animal Pathogens in the Ascomycota
    Physiological and Molecular Plant Pathology (2001) 59, 165±187 doi:10.1006/pmpp.2001.0355, available online at http://www.idealibrary.com on MINI-REVIEW The phylogeny of plant and animal pathogens in the Ascomycota MARY L. BERBEE* Department of Botany, University of British Columbia, 6270 University Blvd, Vancouver, BC V6T 1Z4, Canada (Accepted for publication August 2001) What makes a fungus pathogenic? In this review, phylogenetic inference is used to speculate on the evolution of plant and animal pathogens in the fungal Phylum Ascomycota. A phylogeny is presented using 297 18S ribosomal DNA sequences from GenBank and it is shown that most known plant pathogens are concentrated in four classes in the Ascomycota. Animal pathogens are also concentrated, but in two ascomycete classes that contain few, if any, plant pathogens. Rather than appearing as a constant character of a class, the ability to cause disease in plants and animals was gained and lost repeatedly. The genes that code for some traits involved in pathogenicity or virulence have been cloned and characterized, and so the evolutionary relationships of a few of the genes for enzymes and toxins known to play roles in diseases were explored. In general, these genes are too narrowly distributed and too recent in origin to explain the broad patterns of origin of pathogens. Co-evolution could potentially be part of an explanation for phylogenetic patterns of pathogenesis. Robust phylogenies not only of the fungi, but also of host plants and animals are becoming available, allowing for critical analysis of the nature of co-evolutionary warfare. Host animals, particularly human hosts have had little obvious eect on fungal evolution and most cases of fungal disease in humans appear to represent an evolutionary dead end for the fungus.
    [Show full text]
  • Hyperparasites of Erysiphales Fungi in the Urban Environment
    POLISH JOURNAL OF NATURAL SCIENCES Abbrev.: Pol. J. Natur. Sc., Vol 27(3): 289–299, Y. 2012 HYPERPARASITES OF ERYSIPHALES FUNGI IN THE URBAN ENVIRONMENT Ewa Sucharzewska, Maria Dynowska, Elżbieta Ejdys, Anna Biedunkiewicz, Dariusz Kubiak Department of Mycology University of Warmia and Mazury in Olsztyn Key words: Ampelomyces, hyperparasites, fungicolous fungi, powdery mildew, transport pollu- tion effects, anthropopressure. Abstract This manuscript presents data on the occurrence of hyperparasitic fungi colonizing the mycelium of selected species of Erysiphales: Erysiphe alphitoides, E. hypophylla, E. palczewskii, Golovinomyces sordidus, Podosphaera fusca and Sawadaea tulasnei in the urban environment. In the paper the effect of hyperparasites on the development of fungal hosts at diversified level of transport pollution is emphasized. Over a three-years experiment, the presence of hyperparasites was confirmed on all analyzed Erysiphales species, with prevailing species from the genus Ampelomyces. The representa- tives of other genera: Alternaria, Aureobasidium, Cladosporium, Stemphylium and Tripospermum were also observed on mycelium of E. alphitoides and E. palczewskii. The hyperparasites occurred only on stations situated at the main roads were found not to affect the extent of plant infection by fungi of the order Erysiphales, but reduced the number of chasmothecia. NADPASOŻYTY GRZYBÓW Z RZĘDU ERYSIPHALES W ŚRODOWISKU MIEJSKIM Ewa Sucharzewska, Maria Dynowska, Elżbieta Ejdys, Anna Biedunkiewicz, Dariusz Kubiak Katedra Mykologii Uniwersytet Warmińsko-Mazurski w Olsztynie Słowa kluczowe: Ampelomyces, nadpasożyty, mączniaki prawdziwe, zanieczyszczenia komunikacyjne, antropopresja. Address: Ewa Sucharzewska, University of Warmia and Mazury, ul. Michała Oczapowskiego 1A, 10-719 Olsztyn, Poland, phone: +48 (89) 523 42 98, e-mail: [email protected] 290 Ewa Sucharzewska et al.
    [Show full text]
  • Phylogeny of Podosphaera Sect. Sphaerotheca Subsect
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Schlechtendalia Jahr/Year: 2001 Band/Volume: 7 Autor(en)/Author(s): Braun Uwe, Shishkoff Nina, Takamatsu Susumu Artikel/Article: Phylogeny of Podosphaera sect. Sphaerotheca subsect. Magnicellulatae (Sphaerotheca fuliginea auct. s.lat.) inferred from rDNA ITS sequences - a taxonomic interpretation 45-52 ©Institut für Biologie, Institutsbereich Geobotanik und Botanischer Garten der Martin-Luther-Universität Halle-Wittenberg 45 PhylogenyPodosphaera of sect. Sphaerotheca subsect. Magnicellulatae (Sphaerotheca fuliginea auct. s.lat.) inferred from rDNA ITS sequences - a taxonomic interpretation Uw e Br a u n, Nin a Sh ish k o f f & Su su mu Ta k a m a t su Abstract: B raun, U., Shishkoff , N. & Takamatsu , S. 2001: PhylogenyPodosphaera of sect. Sphaerotheca subsect. Magnicellulatae (Sphaerotheca fuliginea auct. s.lat.) inferred from rDNA ITS sequences - a taxonomic interpretation. Schlechtendalia 7: 45-52. Data of a phylogenetic analysis ofPodosphaera the (Sphaerotheca) fuliginea complex based on rDNA ITS sequences are taxonomically interpreted. Using a morphological species concept, mainly based on the size of the ascomata and the diameter of the thin-walled apical portion of the asci (oculus), combined with biological data, the present taxonomic statusP. ofbalsaminae, P. diclipterae, P. fuliginea, P. intermedia, P. pseudofusca and P. sibirica as separate species has been confirmed. P. fusca emend. as well as P. xanthii emend. are reassessed as complex, compound species.P. euphorbiae-hirtae and P. phaseoli are reduced to synonymyP. withxanthii. Zusammenfassung: B raun, U., Shishkoff , N. & Takamatsu , S. 2001: PhylogenyPodosphaera of sect. Sphaerotheca subsect. Magnicellulatae (Sphaerotheca fuliginea auct.
    [Show full text]
  • New Records and New Host Plants of Powdery Mildews (Erysiphales) from Idaho and Oregon (USA)
    Schlechtendalia 27 (2013) New records and new host plants of powdery mildews (Erysiphales) from Idaho and Oregon (USA) Uwe BRAUN & S. Krishna MOHAN Abstract: Braun, U. & Mohan, S. K. 2013: New records and new host plants of powdery mildews (Erysiphales) from Idaho and Oregon (USA). Schlechtendalia 27: 7–10. In the course of routine examinations of powdery mildews collected in Idaho and Oregon, USA, some of the identified species proved to be new to North America, in some cases on new host plants. Leveillula papilionacearum and L. picridis are first records from the USA. Astragalus filipes, Dalea ornata and D. searlsiae are new hosts for Leveillula papilionacearum. Enceliopsis, Heliomeris and Machaeranthera are new host genera for L. picridis. Additional records refer to powdery mildew species which have been rarely reported from North America or first records on certain hosts. Zusammenfassung: Braun, U. & Mohan, S. K. 2013: Neufunde und neue Wirtsarten von Mehltaupilzen (Erysiphales) aus Idaho und Oregon (USA). Schlechtendalia 27: 7–10. Im Verlauf von Routineuntersuchungen an in Idaho und Oregon, USA, gesammelten Mehltaupilzen erwiesen sich einige der identifizierten Arten als Neunachweise für Nordamerika, in einigen Fällen auf neuen Wirtsarten. Erstnachweise für die USA umfassen Leveillula papilionacearum und L. picridis; Astragalus filipes, Dalea ornata und D. searlsiae sind neue Wirtsarten für Leveillula papilionacearum, und Enceliopsis, Heliomeris und Machaeranthera sind neu nachgewiesene Wirtsgattungen für L. picridis. Weitere Funde beziehen sich auf Arten, die selten aus Nordamerika angegeben worden sind, bzw. auf Neuangaben auf bestimmten Wirten. Key words: Erysiphaceae, North America, novelties, new hosts. Published online 6 Dec. 2013 Powdery mildews (Erysiphales) are an important group of plant pathogenic fungi, worldwide in distribution, and occur on a wide range of hosts including numerous economically important cultivated plants.
    [Show full text]
  • The Infection Capabilities of Hop Downy Mildew^
    THE INFECTION CAPABILITIES OF HOP DOWNY MILDEW^ By G. R. HoERNER Agentj Division of Drug and Related Plants^ Bureau of Plant Industry, United States Department of Agriculture INTRODUCTION Downy mildew, Pseudoperonospora humuli (Miyabe and Tak.) Wils, was first observed in commercial hopyards in Oregon in 1930. Following a survey to determine the incidence of infection, an inves- tigation of the life history and infection capabilities of the causal organ- ism was inaugurated. The primary objectives of the investigation were to determine the host range of the fungus; to discover any evi- dence of resistance to the fungus among botanical species, horticul- tural varieties, or strains of hops developed by means of selection or hybridization; and by attempting to infect all available known hosts of other species of the genus Psevdoperonospora, to confirm or dis- prove the opinion ^ that physiological races of the fungus may exist. MATERIALS AND METHODS In a previous paper the writer ^ discussed in some detail materials and methods employed and results obtained early in the course of this investigation. In addition to hop seedlings, the leaves of hop plants grown from cuttings were employed. Both cotyledons and leaves of seedlings, as well as the leaves of more mature plants of other host genera, were used. In some instances excised cotyledons and leaves were incubated after inoculation in Petri dish moist chambers or floated in covered Petri dishes of nutrient or sugar solutions. The methods of applying the inoculum varied also. In addition to the use of cameFs-hair brushes for the transfer of inoculum, water suspensions of zoosporangia were atomized onto the plant parts or placed in localized areas by means of a medicine dropper.
    [Show full text]
  • An Annotated Catalogue of the Fungal Biota of the Roztocze Upland Monika KOZŁOWSKA, Wiesław MUŁENKO Marcin ANUSIEWICZ, Magda MAMCZARZ
    An Annotated Catalogue of the Fungal Biota of the Roztocze Upland Fungal Biota of the An Annotated Catalogue of the Monika KOZŁOWSKA, Wiesław MUŁENKO Marcin ANUSIEWICZ, Magda MAMCZARZ An Annotated Catalogue of the Fungal Biota of the Roztocze Upland Richness, Diversity and Distribution MARIA CURIE-SkłODOWSKA UNIVERSITY PRESS POLISH BOTANICAL SOCIETY Grzyby_okladka.indd 6 11.02.2019 14:52:24 An Annotated Catalogue of the Fungal Biota of the Roztocze Upland Richness, Diversity and Distribution Monika KOZŁOWSKA, Wiesław MUŁENKO Marcin ANUSIEWICZ, Magda MAMCZARZ An Annotated Catalogue of the Fungal Biota of the Roztocze Upland Richness, Diversity and Distribution MARIA CURIE-SkłODOWSKA UNIVERSITY PRESS POLISH BOTANICAL SOCIETY LUBLIN 2019 REVIEWER Dr hab. Małgorzata Ruszkiewicz-Michalska COVER DESIN, TYPESETTING Studio Format © Te Authors, 2019 © Maria Curie-Skłodowska University Press, Lublin 2019 ISBN 978-83-227-9164-6 ISBN 978-83-950171-8-6 ISBN 978-83-950171-9-3 (online) PUBLISHER Polish Botanical Society Al. Ujazdowskie 4, 00-478 Warsaw, Poland pbsociety.org.pl Maria Curie-Skłodowska University Press 20-031 Lublin, ul. Idziego Radziszewskiego 11 tel. (81) 537 53 04 wydawnictwo.umcs.eu [email protected] Sales Department tel. / fax (81) 537 53 02 Internet bookshop: wydawnictwo.umcs.eu [email protected] PRINTED IN POLAND, by „Elpil”, ul. Artyleryjska 11, 08-110 Siedlce AUTHOR’S AFFILIATION Department of Botany and Mycology, Maria Curie-Skłodowska University, Lublin Monika Kozłowska, [email protected]; Wiesław
    [Show full text]
  • Fantastic Downy Mildew Pathogens and How to Find Them: Advances in Detection and Diagnostics
    plants Review Fantastic Downy Mildew Pathogens and How to Find Them: Advances in Detection and Diagnostics Andres F. Salcedo 1 , Savithri Purayannur 1 , Jeffrey R. Standish 1 , Timothy Miles 2, Lindsey Thiessen 1 and Lina M. Quesada-Ocampo 1,* 1 Department of Entomology and Plant Pathology, North Carolina State University, Raleigh, NC 27695-7613, USA; [email protected] (A.F.S.); [email protected] (S.P.); [email protected] (J.R.S.); [email protected] (L.T.) 2 Department of Plant, Soil and Microbial Sciences, Michigan State University, East Lansing, MI 48824, USA; [email protected] * Correspondence: [email protected] Abstract: Downy mildews affect important crops and cause severe losses in production worldwide. Accurate identification and monitoring of these plant pathogens, especially at early stages of the disease, is fundamental in achieving effective disease control. The rapid development of molecular methods for diagnosis has provided more specific, fast, reliable, sensitive, and portable alternatives for plant pathogen detection and quantification than traditional approaches. In this review, we provide information on the use of molecular markers, serological techniques, and nucleic acid amplification technologies for downy mildew diagnosis, highlighting the benefits and disadvantages of the technologies and target selection. We emphasize the importance of incorporating information on pathogen variability in virulence and fungicide resistance for disease management and how the Citation: Salcedo, A.F.; Purayannur, development and application of diagnostic assays based on standard and promising technologies, S.; Standish, J.R.; Miles, T.; Thiessen, including high-throughput sequencing and genomics, are revolutionizing the development of species- L.; Quesada-Ocampo, L.M. Fantastic specific assays suitable for in-field diagnosis.
    [Show full text]