Plant Protect. Sci. Vol. 41, No. 4: 141–149 PCR Detection of Pseudoperonospora humuli and Podosphaera macularis in Humulus lupulus JOSEF PATZAK Hop Research Institute Co., Ltd., Žatec, Czech Republic Abstract PATZAK J. (2005): PCR detection of Pseudoperonospora humuli and Podosphaera macularis in Humulus lupulus. Plant Protect. Sci., 41: 141–149. Hop downy mildew (Pseudoperonospora humuli) and hop powdery mildew (Podosphaera macularis) are the most important pathogens of hop (Humulus lupulus). The early detection and identification of these pathogens are often made difficult by symptomless or combined infection with another pathogens. Molecular analysis of internal transcribed spacer (ITS) regions of rDNA is a novel and very effective method of species determina- tion. Therefore, specific PCR assays were developed to detect the pathogens Pseudoperonospora humuli and Podosphaera macularis in naturally infected hop plants. The specific PCR primer combinations P1 + P2 and S1 + S2 amplified specific fragments from Pseudoperonospora humuli and Podosphaera macularis, respectively, and did not cross-react with hop DNA nor with DNA from other fungi. PCR primer combinations R1 + R2 and R3 + R4 could be used in multiplex PCR detection of Pseudoperonospora humuli, Podosphaera macularis, Verticillium albo-atrum and Fusarium sambucinum. Phylogenetic relationships were inferred for 42 species of the Erysiphales from nuclear rDNA (ITS1, 5.8S, ITS2). The molecular characterisation and phylogenetic analy- ses confirmed the species identification of hop powdery mildew. The PCR assays used in this study proved to be accurate and sensitive for detection, identification, classification and disease-monitoring of the major hop pathogens. Keywords: hop powdery mildew; hop downy mildew; internal transcribed spacers (ITS); PCR detection; phylo- genetic analysis Hop (Humulus lupulus L.) is a dioecious, peren- disease occurring worldwide. The pathogen infects nial, climbing plant and only female individuals young shoots, leaves, flowers and cones, causing are cultivated. Female inflorescences, referred “basal spikes”, angular black leaf spots and brown to as cones, are commercially used in brewing, discolouration of cones (NEVE 1991). Oospores and the pharmaceutical and cosmetics industry. are formed in infected shoots and cones (CHEE Unfortunately, the plants are regularly subjected & KLEIN 1998). Although hop downy mildew has to infection by oomycetal and fungal pathogens. not been extensively studied, the fine structure The infection sometimes results in severe loss of of the sporangium was described by CONSTAN- production as the plants wither (NEVE 1991). TINESCU (2000). Pseudoperonospora humuli (Miabe and Takah.) Podosphaera macularis (Braun) syn. Sphaerothe- Wilson is the causal agent of hop downy mildew, a ca macularis (Wallr.:Fr) Lind. (synonym S. humuli Supported by the Ministry of Education, Youth and Sports of the Czech Republic, Project No. MSM 1486434701. 141 Vol. 41, No. 4: 141–149 Plant Protect. Sci. (DC.) Burrill) is the causal agent of hop powdery DNA was isolated from pure cultures of fungal mildew, which has become a serious problem in isolates, mycelia and infected plant materials with almost all hop growing regions (SEIGNER et al. DNeasy Plant Mini kit (Qiagen, FRG), and from 2002). This pathogen infects leaves and cones, infected plants in field conditions with REDExtract causing humps, blisters, pale spots, distortion of N-Amp Plant PCR Kit (Sigma-Aldrich, USA), both cones and white mildew colonies. Conidia grow according to manufacturer’s instructions. Samples up from a surface mycelium (NEVE 1991). The were collected between 2001 and 2004. pathogen has not been extensively studied. PCR and sequencing. The ITS regions of the nu- Early detection and identification of pathogens clear rDNA, from 18S, 5.8S and 26S, were amplified are crucial for the implementation of efficient using primers R1 (GTGAACCWGCGGARGGAT- control strategies. Disease symptoms are rarely CATT) derived from the conserved region of 16S discernible on growing crops before mass infec- rDNA, R2 (TTYGCTRCGTTCTTCATCGATG), tion occurs and they can sometimes be confused R3 (GCATCGATGAAGAACGYAGCRA) derived with those of another species. Therefore, rapid, from the conserved region of 5.8S rDNA and R4 specific and sensitive methods for the detection (TATCTTAARTTCAGCGGGT) derived from con- of all important pathogens are required. Classical served region of 26S r DNA. Taq PCR master mix identification methods, based on morphological kit (Qiagen, FRG) and REDExtract N-Amp Plant or physiological characters, are time-consuming, PCR Kit (Sigma-Aldrich, U.S.A.) were used for PCR labour intensive and require considerable knowl- reactions according to manufacturer’s instructions. edge of the genera involved (GROTE et al. 2002). PCR amplifications were carried out in a Genius Molecular DNA techniques represent a novel and thermocycler (Techne, UK). After denaturation highly effective means of species determination, step 95°C 3 min, 35 cycles of amplification (94°C based mainly on the comparison of internal tran- 30 s, 54°C 60 s, 72°C 90 s) and 10 min at 72°C were scribed spacers (ITS) regions of rDNA (COOKE et performed. A minimum of two amplifications was al. 2000). Molecular data as a whole have been used always performed in order to check consistency. extensively to reconstruct phylogenetic relation- Aliquots of 10 µl of PCR products were analysed ships among downy and powdery mildew fungi by electrophoresis on horizontal 2% agarose gel, (SAENZ & TAYLOR 1999; VOGLMAYR 2003). stained by ethidium bromide and visualised under In this paper, we report the development of UV light. PCR products were then excised from specific PCR primers for the detection of Pseu- the gel, isolated with QIAquick Gel Extraction kit doperonospora humuli and Podosphaera macularis (Qiagen, FRG) and prepared for DNA sequencing. in naturally infected hop plants using molecular Both DNA strands were sequenced in the Labo- sequencing of ribosomal ITS regions. ratory of Plant Molecular Physiology, Masaryk University, Brno, Czech Republic, using ABI Prism MATERIALS AND METHODS 310 DNA sequencer (Applera Corporation, Ap- plied Biosystems, U.S.A.) in 2001. Sample sources and DNA extraction. Hop downy The specific rDNA of Pseudoperonospora humuli mildew (Pseudoperonospora humuli) and hop pow- were amplified using the primers P1 (CTGAG- dery mildew (Podosphaera macularis) were obtained GGGACGAAAGGCTCTG) derived from ITS1 and as mycelia from infected hop (Humulus lupulus) P2 (CTGGTCACATGGACAGCCTTCA) derived plants in the experimental hopgarden of the Hop from ITS2. The specific rDNA of Podosphaera Research Institute Co. Ltd., Žatec, Czech Republic. macularis were amplified using the primers S1 Other species of fungi were collected on diseased (CCCGAACTCATGTAGTTAGTGC) derived from hop plants and isolated by successive plating on ITS1 and S2 (GAGCACATCGGTACCGCCACTA) potato dextrose agar (Sigma-Aldrich, U.S.A.). Indi- derived from ITS2. The PCR protocol was the vidual isolates were separated and determined and same as described above. The experiments were grown 5 d at 23°C. The determination of species completed during 3 years for determination of was confirmed by Prof. EWA SOLARSKA from the specificity, consistency and monitoring ability. Institute of Soil Science and Plant Cultivation, Lub- Data analysis. The sequence alignment of con- lin, Poland. A Verticillium albo-atrum isolate from served rDNA regions of Humulus lupulus, Perono- hop was obtained from Dr. S. RADIŠEK, Institute of spora sp., Podosphaera sp., Verticillium sp. and Hop Research and Brewing, Žalec, Slovenia. Fusarium sp. was initially produced by MegAlign 142 Plant Protect. Sci. Vol. 41, No. 4: 141–149 Table 1. List of GenBank accession numbers for taxa studied in phylogenetic analyses Taxon Source of sequence Accession number Cystotheca lanestris TAKAMATSU et al. (2000) AB000933 Cystotheca wrightii TAKAMATSU et al. (2000) AB000932 Erysiphe convolvuli CUNNINGTON et al. (2000) only in database AF154327 Erysiphe glycines TAKAMATSU et al. (2002) only in database AB078807 Erysiphe gracilis MORI et al. (2000) AB022358 Erysiphe graminis HIRATA and TAKAMATSU (1996) D84379 Erysiphe pisi CUNNINGTON et al. (1999) only in database AF073348 Erysiphe prunastri GRIGALIUNAITE and TAKAMATSU (2001) only in database AB046984 Erysiphe tritici MORI et al. (2000) AB022377 Microsphaera trifolii CUNNINGTON et al. (2001) only in database AF298542 Microsphaera alphitoides ROLLAND et al. (2002) only in database AJ309201 Microsphaera juglandis TAKAMATSU et al. (1999) AB015928 Microsphaera platani CUNNINGTON et al. (1999) only in database AF073349 Microsphaera sparsa CUNNINGTON et al. (2001) only in database AF298541 Oidium longipes KISS et al. (2001) AF250777 Oidium lycopersici KISS et al. (2001) AF229021 Podosphaera aphanis CUNNINGTON et al. (1999) only in database AF073355 Podosphaera balsaminae HIRATA et al. (2000) AB040344 Podosphaera cercidiphylli TAKAMATSU et al. (2000) AB026140 Podosphaera clandestina TAKAMATSU et al. (2000) AB026150 Podosphaera collomiae CUNNINGTON et al. (2001) only in database AF298546 Podosphaera cucurbitae HIRATA et al. (2000) AB040330 Podosphaera elsholtziae TAKAMATSU et al. (2000) AB026142 Podosphaera euphorbiae-hirtae HIRATA et al. (2000) AB040306 Podosphaera ferrugunea TAKAMATSU et al. (2000) AB027232 Podosphaera filipendulae TAKAMATSU et al. (2000) AB022385 Podosphaera fugax TAKAMATSU et al. (2000) AB026134 Podosphaera fuliginea HIRATA et