Identification of Notch Target Genes in Uncommitted T-Cell Progenitors: No Direct Induction of a T-Cell Specific Gene Program
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplementary Materials for the Oncogenic Runx3–Myc
Supplementary Materials for The oncogenic Runx3–Myc axis defines p53-deficient osteosarcomagenesis Shohei Otani†, Yuki Date†, Tomoya Ueno, Tomoko Ito, Shuhei Kajikawa, Keisuke Omori, Ichiro Taniuchi, Masahiro Umeda, Toshihisa Komori, Junya Toguchida, Kosei Ito* †These authors contributed equally. *Correspondence to: [email protected] Department of Molecular Bone Biology, Graduate School of Biomedical Sciences, Nagasaki University, 1-7-1 Sakamoto, Nagasaki, 852-8588, Japan. This file includes: Figs. S1 to S13 Tables S1 and S2 1 Fig. S1 Up- and down-regulated transcription factors in p53-deficient osteosarcomagenesis in human and mouse. (A) OS development in the tibia of a representative osteoprogenitor-specific p53 knockout mouse (Osterix/Sp7-Cre; p53fl/fl). Arrows indicate the tumor. Osterix-Cre is expressed in BM-MSCs of adult mice as well (56). Right panel: radiograph. A scale bar = 1 cm. (B) Principal component analysis (PCA) of RNA-seq data comparing OS tissues (OS) and normal osteoblasts (OB) in human and mouse. (C) MA plot presentation of RNA-seq data comparing OS and OB. The seven TFs (Fig. 1, A and B) are indicated by red dots. (D) Prognostic efficacy of the seven transcription factors (Fig. 1, A and B) as determined by Kaplan–Meier analysis of survival in the OS patients in the TARGET cohort. **p < 0.01; *p < 0.05. 2 Fig. S2 Runx3 is required for tumorigenicity of p53-deficient OS. (A) Levels of the indicated proteins in OS (mOS) in 14 individual OS mice and newborn calvaria, as determined by western blotting. (B) Tumorigenicity of clonal mOS cells isolated from mOS (arrow) in individual OS mice (left) was evaluated by allograft in nude mice (BALB/c nu/nu mice; right). -
Hes5 Regulates the Transition Timing of Neurogenesis and Gliogenesis In
© 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 3156-3167 doi:10.1242/dev.147256 RESEARCH ARTICLE Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development Shama Bansod1,2, Ryoichiro Kageyama1,2,3,4 and Toshiyuki Ohtsuka1,2,3,* ABSTRACT has been reported that the high mobility group AT-hook (Hgma) During mammalian neocortical development, neural stem/progenitor genes regulate gene expression by modulating chromatin structure cells (NSCs) sequentially give rise to deep layer neurons and (Ozturk et al., 2014), maintain neurogenic NSCs, and inhibit superficial layer neurons through mid- to late-embryonic stages, gliogenesis during early- to mid-embryonic stages through global shifting to gliogenic phase at perinatal stages. Previously, we found opening of the chromatin state (Kishi et al., 2012). However, the that the Hes genes inhibit neuronal differentiation and maintain mechanism by which the expression of these epigenetic factors is NSCs. Here, we generated transgenic mice that overexpress Hes5 in controlled remains to be analyzed. NSCs of the central nervous system, and found that the transition Here, we found that Hes5, a transcriptional repressor acting timing from deep to superficial layer neurogenesis was shifted earlier, as an effector of Notch signaling, regulates the timing of while gliogenesis precociously occurred in the developing neocortex neurogenesis and gliogenesis via alteration in the expression of Hes5-overexpressing mice. By contrast, the transition from deep to levels of epigenetic factors. Notch signaling contributes to the superficial layer neurogenesis and the onset of gliogenesis were elaboration of cellular diversity during the development of various delayed in Hes5 knockout (KO) mice. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Increased HOXA5 Expression Provides a Selective Advantage for Gain of Whole Chromosome 7 in IDH Wild-Type Glioblastoma
Downloaded from genesdev.cshlp.org on May 11, 2018 - Published by Cold Spring Harbor Laboratory Press Increased HOXA5 expression provides a selective advantage for gain of whole chromosome 7 in IDH wild-type glioblastoma Patrick J. Cimino,1,2,17 Youngmi Kim,1,17 Hua-Jun Wu,3,4,5 Jes Alexander,1 Hans-Georg Wirsching,1,6 Frank Szulzewsky,1 Ken Pitter,7 Tatsuya Ozawa,1,8 Jiguang Wang,9,10,16 Julio Vazquez,11 Sonali Arora,1 Raul Rabadan,9,10 Ross Levine,12 Franziska Michor,3,4,5,13,14,15 and Eric C. Holland1 1Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 2Department of Pathology, Division of Neuropathology, University of Washington, Seattle, Washington 98104, USA; 3Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02215, USA; 4Department of Biostatistics, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02115, USA; 5Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, Massachusetts 02138, USA; 6Department of Neurology, University Hospital Zurich, Zurich 8091, Switzerland; 7Department of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, New York 10065, USA; 8Division of Brain Tumor Translational Research, National Cancer Center Research Institute, Tokyo 104-0045, Japan; 9Department of Biomedical Informatics, Columbia University, New York, New York 10027, USA; 10Department of Systems Biology, Columbia University, New York, -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. -
Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung
Published OnlineFirst December 12, 2014; DOI: 10.1158/1535-7163.MCT-14-0492 Cancer Biology and Signal Transduction Molecular Cancer Therapeutics Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung Cancer Cell Proliferation and Inhibits Apoptosis by Silencing KLF2 and P21 Expression Feng-qi Nie1, Ming Sun2, Jin-song Yang3, Min Xie2, Tong-peng Xu1, Rui Xia2, Yan-wen Liu2, Xiang-hua Liu2, Er-bao Zhang2, Kai-hua Lu1, and Yong-qian Shu1 Abstract Recent evidence highlights long noncoding RNAs (lncRNA) was increased in NSCLC tissues, and its expression level was as crucial regulators of cancer biology that contribute to essen- significantly correlated with tumor–node–metastasis stages and tial cancer cell functions such as cell proliferation, apoptosis, tumor size. Moreover, patients with high levels of ANRIL and metastasis. In non–small cell lung cancer (NSCLC), several expression had a relatively poor prognosis. In addition, taking lncRNAs' expressions are misregulated and have been nomi- advantage of loss-of-function experiments in NSCLC cells, we nated as critical actors in NSCLC tumorigenesis. LncRNA ANRIL found that knockdown of ANRIL expression could impair cell was first found to be required for the PRC2 recruitment to and proliferation and induce cell apoptosis both in vitro and vivo. silencing of p15INK4B, the expression of which is induced by the Furthermore, we uncover that ANRIL could not repress p15 ATM–E2F1 signaling pathway. Our previous study showed that expression in PC9 cells, but through silencing of KLF2 and P21 ANRIL was significantly upregulated in gastric cancer, and it transcription. Thus, we conclusively demonstrate that lncRNA could promote cell proliferation and inhibit cell apoptosis by ANRIL plays a key role in NSCLC development by associating silencing of miR99a and miR449a transcription. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
MBT1 to Promote Repression of Notch Signaling Via Histone Demethylase
1 RBPJ/CBF1 interacts with L3MBTL3/MBT1 to promote repression 2 of Notch signaling via histone demethylase KDM1A/LSD1 3 Tao Xu1,†, Sung-Soo Park1,†, Benedetto Daniele Giaimo2,†, Daniel Hall3, Francesca Ferrante2, 4 Diana M. Ho4, Kazuya Hori4, Lucas Anhezini5,6, Iris Ertl7,8, Marek Bartkuhn9, Honglai Zhang1, 5 Eléna Milon1, Kimberly Ha1, Kevin P. Conlon1, Rork Kuick10, Brandon Govindarajoo11, Yang 6 Zhang11, Yuqing Sun1, Yali Dou1, Venkatesha Basrur1, Kojo S. J. Elenitoba-Johnson1, Alexey I. 7 Nesvizhskii1,11, Julian Ceron7, Cheng-Yu Lee5, Tilman Borggrefe2, Rhett A. Kovall3 & Jean- 8 François Rual1,* 9 1Department of Pathology, University of Michigan Medical School, Ann Arbor, MI 48109, USA; 10 2Institute of Biochemistry, University of Giessen, Friedrichstrasse 24, 35392, Giessen, Germany; 11 3Department of Molecular Genetics, Biochemistry and Microbiology, University of Cincinnati 12 College of Medicine, Cincinnati, OH 45267, USA; 13 4Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA; 14 5Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109, USA; 15 6Current address: Instituto de Ciências Biológicas e Naturais, Universidade Federal do 16 Triângulo Mineiro, Uberaba, MG 38025-180, Brasil; 17 7Cancer and Human Molecular Genetics, Bellvitge Biomedical Research Institute, L’Hospitalet 18 de Llobregat, Barcelona, Spain; 19 8Current address: Department of Urology, Medical University of Vienna, Währiger Gürtel 18-20, 20 Vienna, Austria; 21 9Institute for Genetics, University of Giessen, Heinrich-Buff-Ring 58, 35390, Giessen, Germany; 22 10Center for Cancer Biostatistics, School of Public Health, University of Michigan, Ann Arbor, MI 23 48109, USA; 24 11Department of Computational Medicine & Bioinformatics, University of Michigan, Ann Arbor, 25 MI 48108, USA; 26 †These authors contributed equally to this work; 27 *Correspondence and requests for materials should be addressed to J.F.R. -
UC Riverside UC Riverside Electronic Theses and Dissertations
UC Riverside UC Riverside Electronic Theses and Dissertations Title The Role of AMPK and miR-92a in the Shear Stress Regulation of KLF2 Permalink https://escholarship.org/uc/item/25z876bc Author Wu, Wei Publication Date 2010 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA RIVERSIDE The Role of AMPK and miR-92a in the Shear Stress Regulation of KLF2 A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cellular, Molecular and Developmental Biology by Wei Wu December 2010 Dissertation Committee: Dr. John Shyy, Chairperson Dr. Ameae Walker Dr. Kathryn Defea Copyright by Wei Wu 2010 ii The Dissertation of Wei Wu is approved: ------------------------------------------ ------------------------------------------ ------------------------------------------ Committee Chairperson University of California, Riverside iii Acknowledgements It is a pleasure to thank those who made this dissertation possible. First of all, I would like to thank CMDB program for giving me the opportunity to pursue my Ph.D degree in UCR. A hearty thanks to Dr. Anthony W. Norman, Dr. Helen Henry and the professors who taught and encouraged me in these past years. I owe my deepest gratitude to my major professor, Dr. John Y-J. Shyy, for his guidance and support. I am also grateful to Dr. Ameae M. Walker and Dr. Kathryn Defea for their valuable discussions and constructive suggestions. I am thankful to all of my colleagues and friends for their generous help and precious discussion on my work. My parents and parents-in-law, thanks for your support and unconditional love. Even though we are thousand of miles away, you were always there whenever I needed you. -
The Role of Hes1 in Pancreas Development Expression, Interdependancy and Notch Signalling
FACULTY OF SCIENCE UNIVERSITY OF COPENHAGEN PhD thesis Cand.scient. Rasmus Klinck Department of Beta Cell Regeneration, Hagedorn Research Institute, and The PhD School of Science, Faculty of Science, University of Copenhagen, Denmark. The role of Hes1 in pancreas development Expression, Interdependancy and Notch signalling. Academic Advisors Dr. Olaf Nielsen, Department of Biology, Faculty of Science, University of Copenhagen – Denmark Dr. Mette C. Jørgensen, Department of Beta Cell Regeneration, Hagedorn Research Institute Denmark Submitted: 31/05/11 Cover picture: e10.5 mouse embryo expressing EGFP under the control of the Hes1 promoter manually stitched together from 15 complete image stacks. 2 Preface This Ph.D. thesis is based on experimental work performed in the Department of β Cell Regeneration at the Hagedorn Research Institute, Gentofte, Denmark from January 2008 to December 2010. The faculty supervisor on the project was Professor Olaf Nielsen, Department of Genetics, Faculty of Science, University of Copenhagen, and the project supervisor was Mette Christine Jørgensen, Ph.D., Chemist, Department of Beta Cell Regeneration at the Hagedorn Research Institute. This thesis is submitted in order to meet the requirements for obtaining a Ph.D. degree at the Faculty of Science, University of Copenhagen. The thesis is built around three scientific Manuscripts: Manuscript I: “A BAC transgenic Hes1-EGFP reporter reveals novel expression domains in mouse embryos” Submitted to Gene Expression Patterns Rasmus Klinck1, Ernst-Martin Füchtbauer2, Jonas Ahnfelt-Rønne1, Palle Serup1,Jan Nygaard Jensen1, Ole Dragsbæk Madsen1, Mette Christine Jørgensen1 1Department of Beta Cell Regeneration, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark .2Department of Molecular Biology, Aarhus University, C. -
Notch Signaling in Breast Cancer: a Role in Drug Resistance
cells Review Notch Signaling in Breast Cancer: A Role in Drug Resistance McKenna BeLow 1 and Clodia Osipo 1,2,3,* 1 Integrated Cell Biology Program, Loyola University Chicago, Maywood, IL 60513, USA; [email protected] 2 Department of Cancer Biology, Loyola University Chicago, Maywood, IL 60513, USA 3 Department of Microbiology and Immunology, Loyola University Chicago, Maywood, IL 60513, USA * Correspondence: [email protected]; Tel.: +1-708-327-2372 Received: 12 September 2020; Accepted: 28 September 2020; Published: 29 September 2020 Abstract: Breast cancer is a heterogeneous disease that can be subdivided into unique molecular subtypes based on protein expression of the Estrogen Receptor, Progesterone Receptor, and/or the Human Epidermal Growth Factor Receptor 2. Therapeutic approaches are designed to inhibit these overexpressed receptors either by endocrine therapy, targeted therapies, or combinations with cytotoxic chemotherapy. However, a significant percentage of breast cancers are inherently resistant or acquire resistance to therapies, and mechanisms that promote resistance remain poorly understood. Notch signaling is an evolutionarily conserved signaling pathway that regulates cell fate, including survival and self-renewal of stem cells, proliferation, or differentiation. Deregulation of Notch signaling promotes resistance to targeted or cytotoxic therapies by enriching of a small population of resistant cells, referred to as breast cancer stem cells, within the bulk tumor; enhancing stem-like features during the process of de-differentiation of tumor cells; or promoting epithelial to mesenchymal transition. Preclinical studies have shown that targeting the Notch pathway can prevent or reverse resistance through reduction or elimination of breast cancer stem cells. However, Notch inhibitors have yet to be clinically approved for the treatment of breast cancer, mainly due to dose-limiting gastrointestinal toxicity.