DOCSLIB.ORG

Embryonic Transcription Factor SOX9 Drives Breast Cancer Endocrine Resistance

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Embryonic Transcription Factor SOX9 Drives Breast Cancer Endocrine Resistance Embryonic transcription factor SOX9 drives breast cancer endocrine resistance Rinath Jeselsohna,b,c,1, MacIntosh Cornwella, Matthew Puna, Gilles Buchwaltera,b, Mai Nguyena, Clyde Bangoa, Ying Huanga, Yanan Kuangd, Cloud Paweletzd, Xiaoyong Fue,f,g, Agostina Nardonee,f,g, Carmine De Angelise,f,g, Simone Detreh, Andrew Dodsonh, Hisham Mohammedi, Jason S. Carrolli, Michaela Bowdena, Prakash Raoa, Henry W. Longa, Fugen Lia, Mitchell Dowsetth,j, Rachel Schiffe,f,g, and Myles Browna,b,c,1 aDepartment of Medical Oncology, Dana Farber Cancer Institute, Boston, MA 02215; bCenter for Functional Cancer Epigenetics, Dana Farber Cancer Institute, Boston, MA 02215; cBreast Oncology Center, Dana Farber Cancer Institute, Boston, MA 02215; dBelfer Center for Applied Cancer Science, Dana Farber Cancer Institute, Boston, MA 02215; eLester and Sue Smith Breast Center, Baylor College of Medicine, Houston, TX 77030; fDan L. Duncan Cancer Center, Baylor College of Medicine, Houston, TX 77030; gDepartment of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030; hRalph Lauren Centre for Breast Cancer Research, Royal Marsden Hospital, London, SW3 6JB, United Kingdom; iNuclear Transcription Factor Laboratory, Cancer Research UK, Cambridge Institute, Cambridge University, Li Ka Shing Centre, Cambridge, CB2 0RE, United Kingdom; and jThe Breast Cancer Now Toby Robin’s Research Centre, Institute of Cancer Research, London, SW7 3RP, United Kingdom Contributed by Myles Brown, March 28, 2017 (sent for review December 21, 2016; reviewed by John H. Bushweller, Baruch Frenkel, and Michael R. Stallcup) The estrogen receptor (ER) drives the growth of most luminal breast (9) and cross-talk between ERα and growth factor receptor cancers and is the primary target of endocrine therapy. Although ER pathways, such as the human epidermal growth factor receptor 2 blockade with drugs such as tamoxifen is very effective, a major (HER2) and insulin-like growth factor receptor 1 (IGF1R) (10, clinical limitation is the development of endocrine resistance especially 11). This cross-talk leads to the activation of the PI3K signaling in the setting of metastatic disease. Preclinical and clinical observations pathway, which facilitates ligand-independent activation of ERα. suggest that even following the development of endocrine resistance, In addition, we and other groups have detected ESR1ligand ER signaling continues to exert a pivotal role in tumor progression in binding domain (LBD) mutations in ∼20% of patients with met- the majority of cases. Through the analysis of the ER cistrome in astatic HR+ disease. These mutations confer constitutive ligand- tamoxifen-resistant breast cancer cells, we have uncovered a role for independent activity and resistance to estrogen deprivation (12). an RUNX2–ER complex that stimulates the transcription of a set of Also, recently reported is a YAP1–ESR1 translocation, whereby genes, including most notably the stem cell factor SOX9, that promote the ER LBD is lost, leading to ligand-independent growth and proliferation and a metastatic phenotype. We show that up-regulation endocrine resistance (13). More recently up-regulation of FOXA1, of SOX9 is sufficient to cause relative endocrine resistance. The gain of a pioneer transcription factor for ERα in breast cancer, has been SOX9 as an ER-regulated gene associated with tamoxifen resistance implicated as a mechanism of endocrine resistance (14). Taken was validated in a unique set of clinical samples supporting the need together, these preclinical studies suggest that the ERα tran- for the development of improved ER antagonists. scriptional activity remains an important factor in the majority of cases exhibiting endocrine resistance. estrogen receptor | breast cancer | cistrome | endocrine resistance | SOX9 Significance pproximately 70% of breast cancers are hormone receptor- Apositive (HR+) and express estrogen receptor (ERα), pro- Resistance to endocrine treatment remains a significant clinical gesterone receptor, or both. ERα is a nuclear receptor that is a obstacle. ESR1 mutations were found to be the mechanism of key driver of tumor development and progression and is the most endocrine resistance in a substantial number of patients with important therapeutic target in HR+ breast cancers. Therapies metastatic ER-positive breast. However, these mutations are targeting ERα signaling include aromatase inhibitors that inhibit primarily linked to aromatase inhibitor resistance and are not ERα by blocking the synthesis of estrogen in peripheral tissues strongly associated with tamoxifen resistance. Herein, we show and are effective in postmenopausal women or in combination that tamoxifen treatment promotes a RUNX2–ER complex, with ovarian suppression in premenopausal women. Another which mediates an altered ER cistrome that facilitates the up- type of endocrine therapy is the use of pure antiestrogens, also regulation of SOX9. We show that up-regulation of SOX9, an called selective estrogen receptor degraders (SERDs), which do embryonic transcription factor with key roles in metastases, is a not have agonistic activity and cause ERα degradation. A third driver of endocrine resistance in the setting of tamoxifen treat- class of endocrine therapy consists of the selective estrogen re- ment. Our data provide putative targets for the development of ceptor modulators (SERMs), such as tamoxifen (TAM), which new strategies to treat tamoxifen-resistant breast cancer. bind to ERα and competitively inhibit estrogen binding in the breast. The efficacy of TAM in the treatment of breast cancer Author contributions: R.J., M.C., M.P., G.B., Y.H., H.W.L., R.S., and M. Brown designed patients was first confirmed in clinical trials conducted over 30 y research; R.J., M.C., M.P., G.B., M.N., C.B., Y.H., Y.K., C.P., X.F., A.N., C.D.A., H.M., J.S.C., ago (1–4), and TAM remains an important drug in the adjuvant M. Bowden, and P.R. performed research; X.F., S.D., A.D., M.D., and R.S. contributed new + reagents/analytic tools; R.J., M.C., M.P., G.B., C.B., Y.H., Y.K., C.P., A.N., C.D.A., H.M., J.S.C., and metastatic setting of HR disease. M. Bowden, P.R., H.W.L., F.L., M.D., R.S., and M. Brown analyzed data; and R.J., R.S., and Despite the known efficacy of endocrine treatments, endocrine M. Brown wrote the paper. resistance remains an important clinical challenge. A significant Reviewers: J.H.B., University of Virginia; B.F., University of Southern California; M.R.S., number of patients with early stage disease will develop disease USC Norris Comprehensive Cancer Center, Keck School of Medicine, University of recurrence after adjuvant endocrine treatment, and in metastatic Southern California. disease, the majority of patients will eventually develop resistance The authors declare no conflict of interest. (5). Loss of ERα expression is seen in 10–15% of patients who Data deposition: The sequence reported in this paper has been deposited in the Gene Expression Omnibus (GEO) database, https://www.ncbi.nlm.nih.gov/geo (accession no. develop resistance to endocrine treatment. Thus, in the majority GSE86538). of these cases, ERα continues to be expressed (6–8). Moreover, 1To whom correspondence may be addressed. Email: [email protected] or ligand-independent ERα activity is a key feature underlying the [email protected]. mechanism of endocrine resistance in multiple preclinical studies. This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. These mechanisms include increased ERα coactivator interactions 1073/pnas.1620993114/-/DCSupplemental. E4482–E4491 | PNAS | Published online May 15, 2017 www.pnas.org/cgi/doi/10.1073/pnas.1620993114 Downloaded by guest on September 26, 2021 A number of clinical trials also support the notion that ERα is in a dose-dependent reduction in ERα levels and growth in- PNAS PLUS a pivotal driver of endocrine-resistant breast cancer and con- hibition (Fig. 1B). Thus, cell proliferation in TAMR remains tinues to be an important therapeutic target. In the metastatic dependent on ERα. setting, ∼30% of patients who progress on an aromatase in- We further characterized the TAMR cells and observed that hibitor respond to fulvestrant (15, 16). Additionally, increasing these cells acquired morphological changes consisting of cellular the dose of fulvestrant resulted in improved disease-free survival elongation with a mesenchymal-like appearance and a more dis- and overall survival (17). Furthermore, there is evidence that the persed growth pattern compared with the parental cells (Fig. 1C). combination of fulvestrant with an aromatase inhibitor is supe- The TAMR cells also develop filopodia, which are plasma mem- rior to an aromatase inhibitor alone in first-line treatment for brane protrusions known to be important for cell migration (32, metastatic disease (18). In early-stage disease, it has been dem- 33). In line with the morphological changes, the TAMR cells ex- onstrated that prolonging endocrine treatment or enhancing hibit a significantly increased migratory capacity compared with endocrine blockade with the combination of ovarian suppression the parental cells, as demonstrated by the radius assay and a with an aromatase inhibitor or TAM in premenopausal women Boyden chamber (Fig. 1C). Furthermore, differential gene ex- can improve clinical outcomes in certain patients (19, 20), sug- pression by RNA-sequencing (RNA-seq) analysis revealed 1,092 gesting that more effective inhibition of ERα signaling may also
Load more

Recommended publications
  • Loss of Mafb and Maf Distorts Myeloid Cell Ratios and Disrupts Fetal Mouse Testis Vascularization and Organogenesisǂ
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Loss of Mafb and Maf distorts myeloid cell ratios and disrupts fetal mouse testis vascularization and organogenesisǂ 5 Shu-Yun Li1,5, Xiaowei Gu1,5, Anna Heinrich1, Emily G. Hurley1,2,3, Blanche Capel4, and Tony DeFalco1,2* 1Division of Reproductive Sciences, Cincinnati Children’s Hospital Medical Center, Cincinnati, 10 OH 45229, USA 2Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 3Department of Obstetrics and Gynecology, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 15 4Department of Cell Biology, Duke University Medical Center, Durham, NC 27710 USA 5These authors contributed equally to this work. ǂThis work was supported by the National Institutes of Health (R37HD039963 to BC, R35GM119458 to TD, R01HD094698 to TD, F32HD058433 to TD); March of Dimes (1-FY10- 355 to BC, Basil O’Connor Starter Scholar Award 5-FY14-32 to TD); Lalor Foundation 20 (postdoctoral fellowship to SL); and Cincinnati Children’s Hospital Medical Center (Research Innovation and Pilot funding, Trustee Award, and developmental funds to TD). *Corresponding Author: Tony DeFalco E-mail: [email protected] 25 Address: Division of Reproductive Sciences Cincinnati Children’s Hospital Medical Center 3333 Burnet Avenue, MLC 7045 Cincinnati, OH 45229 USA Phone: +1-513-803-3988 30 Fax: +1-513-803-1160 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021.
    [Show full text]
  • RUNX1 Control of Mammary Epithelial and Breast Cancer Cell Phenotypes
    University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2017-12-12 RUNX1 Control of Mammary Epithelial and Breast Cancer Cell Phenotypes Deli Hong University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Cancer Biology Commons, and the Cell Biology Commons Repository Citation Hong D. (2017). RUNX1 Control of Mammary Epithelial and Breast Cancer Cell Phenotypes. GSBS Dissertations and Theses. https://doi.org/10.13028/M21Q2F. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/949 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. RUNX1 CONTROL OF MAMMARY EPITHELIAL AND BREAST CANCER CELL PHENOTYPES A Dissertation Presented By Deli Hong Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY December 12, 2017 Program of Cell Biology RUNX1 CONTROL OF MAMMARY EPITHELIAL AND BREAST CANCER CELL PHENOTYPES A Dissertation Presented By Deli Hong This work was undertaken in the Graduate School of Biomedical Sciences Program of Cell Biology The signature of the Thesis Advisor signifies validation of Dissertation content Gary S. Stein, Ph. D., Thesis Advisor The signatures of the Dissertation Defense Committee signify completion and approval as to style and content of the Dissertation Leslie Shaw, Ph.
    [Show full text]
  • Functions of the Mineralocorticoid Receptor in the Hippocampus By
    Functions of the Mineralocorticoid Receptor in the Hippocampus by Aaron M. Rozeboom A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cellular and Molecular Biology) in The University of Michigan 2008 Doctoral Committee: Professor Audrey F. Seasholtz, Chair Professor Elizabeth A. Young Professor Ronald Jay Koenig Associate Professor Gary D. Hammer Assistant Professor Jorge A. Iniguez-Lluhi Acknowledgements There are more people than I can possibly name here that I need to thank who have helped me throughout the process of writing this thesis. The first and foremost person on this list is my mentor, Audrey Seasholtz. Between working in her laboratory as a research assistant and continuing my training as a graduate student, I spent 9 years in Audrey’s laboratory and it would be no exaggeration to say that almost everything I have learned regarding scientific research has come from her. Audrey’s boundless enthusiasm, great patience, and eager desire to teach students has made my time in her laboratory a richly rewarding experience. I cannot speak of Audrey’s laboratory without also including all the past and present members, many of whom were/are not just lab-mates but also good friends. I also need to thank all the members of my committee, an amazing group of people whose scientific prowess combined with their open-mindedness allowed me to explore a wide variety of interests while maintaining intense scientific rigor. Outside of Audrey’s laboratory, there have been many people in Ann Arbor without whom I would most assuredly have gone crazy.
    [Show full text]
  • GATA3 As an Adjunct Prognostic Factor in Breast Cancer Patients with Less Aggressive Disease: a Study with a Review of the Literature
    diagnostics Article GATA3 as an Adjunct Prognostic Factor in Breast Cancer Patients with Less Aggressive Disease: A Study with a Review of the Literature Patrizia Querzoli 1, Massimo Pedriali 1 , Rosa Rinaldi 2 , Paola Secchiero 3, Paolo Giorgi Rossi 4 and Elisabetta Kuhn 5,6,* 1 Section of Anatomic Pathology, Department of Morphology, Surgery and Experimental Medicine, University of Ferrara, 44124 Ferrara, Italy; [email protected] (P.Q.); [email protected] (M.P.) 2 Section of Anatomic Pathology, ASST Mantova, Ospedale Carlo Poma, 46100 Mantova, Italy; [email protected] 3 Surgery and Experimental Medicine and Interdepartmental Center of Technology of Advanced Therapies (LTTA), Department of Morphology, University of Ferrara, 44121 Ferrara, Italy; [email protected] 4 Epidemiology Unit, Azienda Unità Sanitaria Locale-IRCCS di Reggio Emilia, 42122 Reggio Emilia, Italy; [email protected] 5 Division of Pathology, Fondazione IRCCS Ca’ Granda, Ospedale Maggiore Policlinico, 20122 Milano, Italy 6 Department of Biomedical, Surgical, and Dental Sciences, University of Milan, 20122 Milano, Italy * Correspondence: [email protected]; Tel.: +39-02-5032-0564; Fax: +39-02-5503-2860 Abstract: Background: GATA binding protein 3 (GATA3) expression is positively correlated with Citation: Querzoli, P.; Pedriali, M.; estrogen receptor (ER) expression, but its prognostic value as an independent factor remains unclear. Rinaldi, R.; Secchiero, P.; Rossi, P.G.; Thus, we undertook the current study to evaluate the expression of GATA3 and its prognostic value Kuhn, E. GATA3 as an Adjunct in a large series of breast carcinomas (BCs) with long-term follow-up. Methods: A total of 702 Prognostic Factor in Breast Cancer consecutive primary invasive BCs resected between 1989 and 1993 in our institution were arranged Patients with Less Aggressive in tissue microarrays, immunostained for ER, progesterone receptor (PR), ki-67, HER2, p53, and Disease: A Study with a Review of GATA3, and scored.
    [Show full text]
  • Reconstruction of the Global Neural Crest Gene Regulatory Network in Vivo
    Reconstruction of the global neural crest gene regulatory network in vivo Ruth M Williams1, Ivan Candido-Ferreira1, Emmanouela Repapi2, Daria Gavriouchkina1,4, Upeka Senanayake1, Jelena Telenius2,3, Stephen Taylor2, Jim Hughes2,3, and Tatjana Sauka-Spengler1,∗ Supplemental Material ∗Lead and corresponding author: Tatjana Sauka-Spengler ([email protected]) 1University of Oxford, MRC Weatherall Institute of Molecular Medicine, Radcliffe Department of Medicine, Oxford, OX3 9DS, UK 2University of Oxford, MRC Centre for Computational Biology, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 3University of Oxford, MRC Molecular Haematology Unit, MRC Weatherall Institute of Molecular Medicine, Oxford, OX3 9DS, UK 4Present Address: Okinawa Institute of Science and Technology, Molecular Genetics Unit, Onna, 904-0495, Japan A 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R1_5-6ss) log2(R1_8-10ss) log2(R1_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.92 0 r=0.99 0 r=0.96 0 r=0.99 0 r=0.96 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R2_non-NC) log2(R2_5-6ss) log2(R3_5-6ss) log2(R2_8-10ss) log2(R3_8-10ss) 25 25 25 25 25 20 20 20 20 20 15 15 15 15 15 10 10 10 10 10 log2(R1_5-6ss) log2(R2_5-6ss) log2(R1_8-10ss) log2(R2_8-10ss) log2(R1_non-NC) 5 5 5 5 5 0 r=0.94 0 r=0.96 0 r=0.95 0 r=0.96 0 r=0.95 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 0 5 10 15 20 25 log2(R3_non-NC) log2(R4_5-6ss) log2(R3_5-6ss) log2(R4_8-10ss) log2(R3_8-10ss)
    [Show full text]
  • Tomo-Seq Identifies SOX9 As a Key Regulator of Cardiac Fibrosis During Ischemic Injury
    myocardial myocardial Eva van ◼ osis fibr SOX9 transcription ◼ PhD* PhD PhD PhD MSc, PhD naarden, MSc, PhD naarden, PhD* ventricular remodeling Correspondence to: Correspondence Rooij, MSc, PhD, Hubrecht Department of Institute, KNAW University Medical Cardiology, Uppsalalaan 8, Center Utrecht, The Netherlands. 3584CT Utrecht, E-mail [email protected] of Funding, see page 1408 Sources Key Words: ischemia ◼ © 2017 American Heart Association, Inc. *Drs. Lacraz and Junker contributed equally. Grégory P.A. Lacraz, MSc, P.A. Grégory MSc, Jan Philipp Junker, Monika M. Gladka, MSc, MSc Bas Molenaar, Scholman, MSc Koen T. MSc Marta Vigil-Garcia, BS Danielle Versteeg, BS Hesther de Ruiter, MSc, Vermunt, Marit W. MSc, Creyghton, Menno P. Manon M.H. Huibers, Nicolaas de Jonge, MD Alexander van Oude- Eva van Rooij, MSc, PhD 2017;136:1396–1409. DOI: 10.1161/CIRCULATIONAHA.117.027832 DOI: 2017;136:1396–1409. Circulation. blunted the cardiac fibrotic fibrotic blunted the cardiac Sox9 ). Subsequent correlation analysis allowed). Subsequent correlation Serca2 Editorial, see p 1410 , and Nppa Based on the exact local expression cues, tomo-seq can Based on the exact local expression Cardiac ischemic injury induces a pathological remodeling ischemic injury induces a pathological remodeling Cardiac , Although genome-wide transcriptome analysis on diseased tissues Tracing transcriptional differences with a high spatial resolution with a high spatial resolution transcriptional differences Tracing Col1a2 October 10, 2017 October 10, 1396 CONCLUSIONS: novel genes and key transcription factors involved in specific serve to reveal able to unveil the Using tomo-seq, we were remodeling. aspects of cardiac pointing fibrosis, of cardiac of SOX9 as a key regulator unknown relevance fibrosis.
    [Show full text]
  • The Versatile Functions of Sox9 in Development, Stem Cells, And
    Genes & Diseases (2014) 1, 149e161 HOSTED BY Available online at www.sciencedirect.com ScienceDirect journal homepage: http://ees.elsevier.com/gendis/default.asp REVIEW ARTICLE The versatile functions of Sox9 in development, stem cells, and human diseases Alice Jo a, Sahitya Denduluri a, Bosi Zhang a, Zhongliang Wang a,b, Liangjun Yin a,b, Zhengjian Yan a,b, Richard Kang a, Lewis L. Shi a, James Mok a, Michael J. Lee a, Rex C. Haydon a,* a Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, IL 60637, USA b Departments of Orthopaedic Surgery, The Affiliated Hospitals of Chongqing Medical University, Chongqing 400046, China Received 3 September 2014; accepted 6 September 2014 Available online 16 October 2014 KEYWORDS Abstract The transcription factor Sox9 was first discoveredinpatientswithcampomelic Development; dysplasia, a haploinsufficiency disorder with skeletal deformities caused by dysregulation of Sox9; Sox9 expression during chondrogenesis. Since then, its role as a cell fate determiner during Stem cells; embryonic development has been well characterized; Sox9 expression differentiates cells Transcription factor derived from all three germ layers into a large variety of specialized tissues and organs. How- ever, recent data has shown that ectoderm- and endoderm-derived tissues continue to express Sox9 in mature organs and stem cell pools, suggesting its role in cell maintenance and speci- fication during adult life. The versatility of Sox9 may be explained by a combination of post- transcriptional modifications, binding partners, and the tissue type in which it is expressed. Considering its importance during both development and adult life, it follows that dysregula- tion of Sox9 has been implicated in various congenital and acquired diseases, including fibrosis and cancer.
    [Show full text]
  • Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-Kb Signaling Axis
    International Journal of Molecular Sciences Article Curcumin Attenuates Environment-Derived Osteoarthritis by Sox9/NF-kB Signaling Axis Constanze Buhrmann 1,2, Aranka Brockmueller 1, Anna-Lena Mueller 1, Parviz Shayan 3 and Mehdi Shakibaei 1,* 1 Musculoskeletal Research Group and Tumor Biology, Chair of Vegetative Anatomy, Institute of Anatomy, Faculty of Medicine, Ludwig-Maximilian-University Munich, Pettenkoferstr. 11, D-80336 Munich, Germany; [email protected] (C.B.); [email protected] (A.B.); [email protected] (A.-L.M.) 2 Institute of Anatomy and Cell Biology, Faculty of Medicine, University of Augsburg, Universitaetsstr. 2, D-86159 Augsburg, Germany 3 Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran 141556453, Iran; [email protected] * Correspondence: [email protected]; Tel.: +49-89-2180-72624 Abstract: Inflammation has a fundamental impact on the pathophysiology of osteoarthritis (OA), a common form of degenerative arthritis. It has previously been established that curcumin, a component of turmeric (Curcuma longa), has anti-inflammatory properties. This research evaluates the potentials of curcumin on the pathophysiology of OA in vitro. To explore the anti-inflammatory efficacy of curcumin in an inflamed joint, an osteoarthritic environment (OA-EN) model consisting of fibroblasts, T-lymphocytes, 3D-chondrocytes is constructed and co-incubated with TNF-α, antisense oligonucleotides targeting NF-kB (ASO-NF-kB), or an IkB-kinase (IKK) inhibitor (BMS-345541). Our results show that OA-EN, similar to TNF-α, suppresses chondrocyte viability, which is accompanied Citation: Buhrmann, C.; by a significant decrease in cartilage-specific proteins (collagen II, CSPG, Sox9) and an increase in NF- Brockmueller, A.; Mueller, A.-L.; kB-driven gene proteins participating in inflammation, apoptosis, and breakdown (NF-kB, MMP-9, Shayan, P.; Shakibaei, M.
    [Show full text]
  • Progesterone Receptor Isoform B Regulates the Oxtr-Plcl2-Trpc3 Pathway to Suppress Uterine Contractility
    Progesterone receptor isoform B regulates the Oxtr-Plcl2-Trpc3 pathway to suppress uterine contractility Mary C. Peaveya,1, San-Pin Wub,1, Rong Lib, Jian Liub, Olivia M. Emeryb, Tianyuan Wangc, Lecong Zhouc, Margeaux Wetendorfd, Chandra Yallampallie, William E. Gibbonse, John P. Lydond, and Francesco J. DeMayob,2 aDepartment of Obstetrics and Gynecology, University of North Carolina, Chapel Hill, NC 27599; bReproductive and Developmental Biology Laboratory, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709; cIntegrative Bioinformatic Support Group, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709; dDepartment of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030; and eDepartment of Obstetrics and Gynecology, Baylor College of Medicine, Houston, TX 77030 Edited by R. Michael Roberts, University of Missouri, Columbia, MO, and approved January 19, 2021 (received for review June 6, 2020) Uterine contractile dysfunction leads to pregnancy complications The “progesterone receptor isoform switch” concept was posited such as preterm birth and labor dystocia. In humans, it is hypoth- to explain the transition from a quiescent to a contractile myometrial esized that progesterone receptor isoform PGR-B promotes a re- phenotype in the presence of high levels of progesterone (10, 11, laxed state of the myometrium, and PGR-A facilitates uterine 26–30). Progesterone acts via the nuclear receptor isoforms, PGR-A contraction. This hypothesis was tested in vivo using transgenic and PGR-B, which are coexpressed at different levels throughout mouse models that overexpress PGR-A or PGR-B in smooth muscle pregnancy (31–35). Progesterone can transactivate different tran- cells. Elevated PGR-B abundance results in a marked increase in scriptional programs determined by the relative levels of PGR-A and gestational length compared to control mice (21.1 versus 19.1 d PGR-B isoforms in the myometrium (36–41).
    [Show full text]
  • The Novel Progesterone Receptor
    0013-7227/99/$03.00/0 Vol. 140, No. 3 Endocrinology Printed in U.S.A. Copyright © 1999 by The Endocrine Society The Novel Progesterone Receptor Antagonists RTI 3021– 012 and RTI 3021–022 Exhibit Complex Glucocorticoid Receptor Antagonist Activities: Implications for the Development of Dissociated Antiprogestins* B. L. WAGNER†, G. POLLIO, P. GIANGRANDE‡, J. C. WEBSTER, M. BRESLIN, D. E. MAIS, C. E. COOK, W. V. VEDECKIS, J. A. CIDLOWSKI, AND D. P. MCDONNELL Department of Pharmacology and Cancer Biology (B.L.W., G.P., P.G., D.P.M.), Duke University Medical Center, Durham, North Carolina 27710; Molecular Endocrinology Group (J.C.W., J.A.C.), NIEHS, National Institutes of Health, Research Triangle Park, North Carolina 27709; Department of Biochemistry and Molecular Biology (M.B., W.V.V.), Louisiana State University Medical School, New Orleans, Louisiana 70112; Ligand Pharmaceuticals, Inc. (D.E.M.), San Diego, California 92121; Research Triangle Institute (C.E.C.), Chemistry and Life Sciences, Research Triangle Park, North Carolina 27709 ABSTRACT by agonists for DNA response elements within target gene promoters. We have identified two novel compounds (RTI 3021–012 and RTI Accordingly, we observed that RU486, RTI 3021–012, and RTI 3021– 3021–022) that demonstrate similar affinities for human progeste- 022, when assayed for PR antagonist activity, accomplished both of rone receptor (PR) and display equivalent antiprogestenic activity. As these steps. Thus, all three compounds are “active antagonists” of PR with most antiprogestins, such as RU486, RTI 3021–012, and RTI function. When assayed on GR, however, RU486 alone functioned as 3021–022 also bind to the glucocorticoid receptor (GR) with high an active antagonist.
    [Show full text]
  • And EZH2-Regulated Gene, Has Differential Roles in AR-Dependent and -Independent Prostate Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No.4 RUNX1, an androgen- and EZH2-regulated gene, has differential roles in AR-dependent and -independent prostate cancer Ken-ichi Takayama1,2, Takashi Suzuki3, Shuichi Tsutsumi4, Tetsuya Fujimura5, Tomohiko Urano1,2, Satoru Takahashi6, Yukio Homma5, Hiroyuki Aburatani4 and Satoshi Inoue1,2,7 1 Department of Anti-Aging Medicine, The University of Tokyo, Bunkyo-ku, Tokyo, Japan 2 Department of Geriatric Medicine, The University of Tokyo, Bunkyo-ku, Tokyo, Japan 3 Department of Pathology, Tohoku University Graduate School of Medicine, Sendai, Miyagi, Japan 4 Genome Science Division, Research Center for Advanced Science and Technology (RCAST), The University of Tokyo, Meguro-ku, Tokyo, Japan 5 Department of Urology, Graduate School of Medicine, The University of Tokyo, Bunkyo-ku, Tokyo, Japan 6 Department of Urology, Nihon University School of Medicine, Itabashi-ku, Tokyo, Japan 7 Division of Gene Regulation and Signal Transduction, Research Center for Genomic Medicine, Saitama Medical University, Hidaka, Saitama, Japan Correspondence to: Satoshi Inoue, email: [email protected] Keywords: RUNX1, androgen receptor, EZH2, prostate cancer Received: October 02, 2014 Accepted: December 09, 2014 Published: December 10, 2014 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Androgen receptor (AR) signaling is essential for the development of prostate cancer. Here, we report that runt-related transcription factor (RUNX1) could be a key molecule for the androgen-dependence of prostate cancer. We found RUNX1 is a target of AR and regulated positively by androgen.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]