US00941 O155B2

(12) United States Patent (10) Patent No.: US 9.410,155 B2 Collard et al. (45) Date of Patent: Aug. 9, 2016

(54) TREATMENT OF VASCULAR ENDOTHELIAL 5,491,084 A 2f1996 Chalfie et al. GROWTH FACTOR (VEGF) RELATED 35, A : 3: Sutter s al. DISEASES BY INHIBITION OF NATURAL 5.535.735 A 6/1996 di t ANTISENSE TRANSCRIPT TO VEGF 5.539,083 A 7/1996 Cookeral. 5,549,974 A 8, 1996 Holmes (71) Applicant: CuRNA, Inc., Miami, FL (US) 5,569,588 A 10/1996 Ashby et al. 5,576,302 A 11/1996 Cook et al. (72) Inventors: Joseph Collard, Delray Beach, FL (US); 5,593,853 A 1/1997 Chen et al. Olga Khorkova Sherman. Tequesta, FL 5,605,662 A 2f1997 Heller et al. g , led s 5,661,134 A 8, 1997 Cook et al. (US) 5,708, 161 A 1/1998 Reese 5,736,294 A * 4/1998 Ecker et al...... 435/375 (73) Assignee: CuRNA, Inc., Miami, FL (US) 5,739,119 A 4/1998 Galli et al. 5,739,311 A 4/1998 Lackey et al. (*)c Notice:- r Subject to any disclaimer, the term of this 5,849,9025,756,710 A 12/19985/1998 ArrowStein et et al. al. patent is extended or adjusted under 35 5,891.725 A 4/1999 Soreqet al. U.S.C. 154(b) by 0 days. 5,902,880 A 5/1999 Thompson 5,908,779 A 6/1999 Carmichael et al. (21) Appl. No.: 14/534,349 5,965,721 A 10/1999 Cook et al. 5,985,663 A 11/1999 Bennett et al. 1-1. 6,005.095 A 12/1999 Capaccioli et al. (22) Filed: Nov. 6, 2014 6,013,639 A 1/2000 Peyman et al. O O 6,013,786 A 1/2000 Chen et al. (65) Prior Publication Data 6,034,233 A 3/2000 Ecker et al. 6,100,090 A 8, 2000 Monia et al. US 2015/0141494A1 May 21, 2015 6,140,492. A 10/2000 Morelli et al. 6,147,200 A 11/2000 Manoharan et al. O O 6,165,712 A 12/2000 Foulkes et al. Related U.S. Application Data 6,165,990 A 12, 2000 Singh et al. (62) Division- - - of application No. 13/132,997, filed as 6,221,5876,175,409 B1 4/20011/2001 NielsenEcker et etal. al. application No. PCT/US2009/066455 on Dec. 2. 6,239,265 B1 5, 2001 Cook 2009, now Pat. No. 8,927,511. 6.242,589 B1 6/2001 Cook et al. (60) Provisional application No. 61/119,957, filed on Dec. 6,303,3746,268,490 B1 10/2001T/2001 WEI ishi et al.a 4, 2008. 6,307,040 B1 10/2001 Cook et al. (51) Int. Cl. (Continued) C7H 2L/04 (2006.01) CI2N IS/II3 (2010.01) FOREIGN PATENT DOCUMENTS A6 IK3I/72 (2006.01) CA 26869.33 4/2008 CI2O I/68 (2006.01) EP 335451 A3 3, 1988 (52) U.S. Cl. (Continued) CPC ...... CI2N 15/1136 (2013.01); A61 K3I/712 (2013.01); C12O 1/6816 (2013.01); C12O OTHER PUBLICATIONS I/6883 (2013.01); C12O I/6886 (2013.01); CI2N 2310/11 (2013.01); C12N 2310/113 Nikiforov et al. (PCRMethods and Applications 1994: 285-291).* (2013.01); C12O 2600/156 (2013.01) (Continued) (58) Field of Classification Search None See application file for complete search history. Pririmary ExamiExaminer — KimberlyK1mberly Chunong (56) References Cited (74) Attorney, Agent, or Firm — CuRNA, Inc.; Monte R. Browder U.S. PATENT DOCUMENTS

4,683,195 A 7, 1987 Mullis et al. 4,683.202 A 7/1987 Mullis (57) ABSTRACT 4,754,065. A 6, 1988 Levenson et al. 4,800,159 A 1, 1989 Mullis et al. Oligonucleotide compounds modulate expression and/or 5,034,506 A 7, 1991 Summerton et al. function of Vascular Endothelial Growth Factor (VEGF) 5,138,045 A 8, 1992 Cook et al. 5,218, 105 A 6, 1993 Cook et al. polynucleotides and encoded products thereof. Methods for 5,288,512 A 2f1994 Seiden treating diseases associated with Vascular Endothelial 5,288,514 A 2f1994 Ellman Growth Factor (VEGF) comprise administering one or more A g A. Oligonucleotide compounds designed to inhibit the VEGF 5.432.272 A 7, 1995 Bennerea et al. natural antisense transcript to patients. 5,457,189 A 10, 1995 Crooke et al. 5,459,255 A 10, 1995 Cook et al. 5,474,796 A 12/1995 Brennan 12 Claims, 9 Drawing Sheets US 9.410,155 B2 Page 2

(56) References Cited 7,569,575 B2 8, 2009 Sorensen et al. 7,569,686 B1 8/2009 Bhat et al. U.S. PATENT DOCUMENTS 7,572,582 B2 8/2009 Wengel et al. 7,582,745 B2 9/2009 Sah et al. 6,316,198 B1 1 1/2001 Skouv et al. 7.585,893 B2 9/2009 Baguley et al. 6,335.434 B1 1/2002 Guzaev et al. 7,589, 190 B2 9/2009 Westergaard et al. 6.376,541 B1 4/2002 Nixon et al. 7,598.227 B2 10/2009 Crooke et al. 6,403,566 Bi 6/2002 Wang 7,605,251 B2 10/2009 Tan et al. 6,444,464 B1 9/2002 Wyatt 7.622,453 B2 11/2009 Frieden et al. 6.451.991 B1 9, 2002 Martin et al. 7,662,948 B2 2/2010 Kurreck et al. 6,525,191 B1 2/2003 Ramassamy 7,666,854 B2 2/2010 Seth et al. 6,528,262 B1 3/2003 Giladet al. 7,674,895 B2 3/2010 Reich et al. 6,528,631 B1 3/2003 Cook et al. 7,687,617 B2 3/2010 Thrue et al. 6,617,122 B1 9/2003 Hayden et al. 7,691.995 B2 4/2010 Zamore et al. 6,617.442 B 1 9/2003 Crooke et al. 7,695,902 B2 4/2010 Crooke 6,630,315 B1 10/2003 Miwa et al. 7,696,345 B2 4/2010 Allerson et al. 6,639,059 B1 10/2003 Kochkine et al. 7,709,456 B2 5/2010 Corey et al. 6,656,730 B1 12/2003 Manoharan 7,709,630 B2 5, 2010 Gaarde et al. 6,667,337 B2 12/2003 Wilson 7,713,738 B2 5, 2010 Hansen et al. 6,670.461 B1 12/2003 Wengel et al. 7,718,629 B2 5, 2010 Bamcrot et al. 6,710, 174 B2 3, 2004 Bennett et al. 7,723,508 B2 5, 2010 Crooke et al. 6,734,291 B2 5/2004 Kochkine et al. 7,732,422 B2 6/2010 Gleave et al. 6,762,169 B1 7/2004 Manoharan 7,732,590 B2 6, 2010 Bhanot et al. 6,794,499 B2 9/2004 Wengel et al. 7,737,264 B2 6/2010 Thrue et al. 6,833,361 B2 12/2004 Hong et al. 7,737,265 B2 6/2010 Akinc et al. 6,861,514 B2 3/2005 Cook et al. 7,741.305 B2 6, 2010 Crooke et al. 6,867,294 B1 3/2005 Sanghviet al. 7,741.309 B2 6/2010 Hansen et al. 6,936.467 B2 8/2005 Kmiec et al. 7,741,457 B2 6/2010 Seth et al. 6,936,593 B1 8/2005 Agrawal et al. 7,745,609 B2 6, 2010 Bennett et al. 6,977.295 B2 12/2005 Belotserkovskii et al. 7,749,978 B2 7.2010 Sah et al. 6.986,988 B2 1/2006 Giladet al. 2003/O139359 A1 7, 2003 Dobie 7,034.133 B2 4/2006 Wengeet al. 2003. O186920 A1 10, 2003 Sirois 7,034,145 B2 4/2006 Shen et al. 2003. O191075 A1 10, 2003 Cook et al. T.053.195 B1 5, 2006 Goff 2003/02286.18 A1 12/2003 Levanon et al. 7053.199 B2 5 2006 Imanishi et al. 2003/0233670 Al 12/2003 Edgerton et al. 7053.207 B2 5/2006 Wenge 2004/0006031 A1 1/2004 Dean et al. 7,060.809 B2 6/2006 Wengel et al. 2004/0033480 A1 2/2004 Wong 7,084,125 B2 8/2006 Wengel 2004/0101858 A1 5, 2004 Ward et al. T.O87.589 B2 8/2006 Jacobson et al. 2004/O137423 A1 7/2004 Hayden et al. 7,125,982 Bf 10/2006 Frayne 2004/O1381.55 A1 7, 2004 Baird et al. 7.144.995 B2 12, 2006 Wise et al. 2004/0175803 A1 9, 2004 Meritet et al. 7.144.999 B2 12/2006 Wardet al. 2004/0180336 A1 9, 2004 Giladet al. 7.148.204 B2 22006 Bennett et al. 2004/0254137 A1 12/2004 Ackermann et al. 7,153,954 B2 12, 2006 Koch et al. 2005/OOO9771 A1 1/2005 Levanon et al. 7169,916 B2 1/2007 Krotzetal. 2005/0026160 A1 2/2005 Allerson et al. 799,107 B2 4/2007 Dobie et al. 2005, 01.13326 A1 5/2005 Siwkowski et al. 7.302.357 B2 4/2007 Crooke et al. 2005.01433.57 A1 6/2005 Pousette et al. 7217,572 B2 5/2007 Ward'etal 2005. O153286 A1 7, 2005 Clements 7220,549 B2 5/2007 Buzby 2005/0215504 A1 9, 2005 Bennett et al. T226.785 B2 6, 2007 Kmiec et al. 2005/0222029 A1 10, 2005 Bartel et al. 7229.974 B2 6/2007 Peyman et al. 2006/000941.0 A1 1/2006 Crooke et al. 7,229.976 B2 6, 2007 Dobie et al. 2006/0142.196 A1 6/2006 Klein et al. 7,235,534 B2 6/2007 Tauguay et al. 2006/017.8333 A1 8/2006 Soreq et al. 7,235,653 B2 6, 2007 Bennett et al. 2007/0082848 A1 4/2007 Alitalo et al. 7,238,858 B2 7/2007 Marraccini et al. 2007. O197459 A1 8, 2007 Milner 7,250,289 B2 * 7/2007 Zhou ...... 435/287.2 2007/0213274 A1 9, 2007 Salonen 7.276,599 B2 10, 2007 Moore et al. 2007/0213292 A1 9, 2007 Stoffel et al. 7.285.2ss B1 10/2007 Tomoetal. 2007/0231816 A1 10, 2007 Chaussabel et al. 7297,786 B2 1/2007 McCrayetal. 2007/0248590 A1 10, 2007 Milne et al. 7.314.923 B2 1/2008 Kaneko et al. 2008. O146788 A1 6/2008 Bhat et al. 7320.965 B2 /2008 Saheta 2008, 0221051 A1 9, 2008 Becker et al. 732.82s B2 1/2008 Cowsertet al. 2008/0293142 A1 11/2008 Liu et al. 7.335,764 B2 2/2008 Crookeet al. 2009,019 1263 A1 7, 2009 Reich et al. 7.335,765 B2 22008 Kanekoet al. 2009,0192106 A1 7, 2009 Dobie et al. 7.339,051 B2 3/2008 Crooke et al. 2009/0208479 A1 8/2009 Jaye et al. 7,371,833 B1 5, 2008 Weiss 2009,0258925 A1 10, 2009 Wahlestedt 7,399,845 B2 7/2008 Seth et al. 20090318536 A1 12/2009 Freier et al. 7,402434 B2 7/2008 Newman et al. 2009/0326041 A1 12/2009 Bhanot et al. 7,402,574 B2 7/2008 Iversen et al. 2010/0105760 A1 4, 2010 Collard et al. 7,420,050 B2 9/2008 Parket al. 7,423, 142 B2 9, 2008 Vornlocher FOREIGN PATENT DOCUMENTS 7,425,545 B2 9, 2008 Crooke et al. 7.427,675 B2 9/2008 Capaldi et al. EP 335451 A2 10, 1989 7,456,154 B2 11/2008 Soreq et al. WO WO-84/03.504 9, 1984 7.462,642 B2 12/2008 Wang et al. WO WO-91, 19735 12/1991 7.468,431 B2 12/2008 Bhanot et al. WO WO-92.00091 1, 1992 7,510,830 B2 3/2009 Baguley et al. WO WO-92,087.96 5, 1992 7,541,344 B2 6/2009 Bhat et al. WO WO-93/20242 10, 1993 7,547,684 B2 6/2009 Seth et al. WO WO-94-26887 A1 11F1994 US 9.410,155 B2 Page 3

(56) References Cited Caplen, N.J., et al., “Specific inhibition of gene expression by Small double-stranded RNAs in invertebrate and vertebrate systems.” FOREIGN PATENT DOCUMENTS PNAS Sci. USA'98: 9742-9747 (2001). Carninci, et al., “The transcriptional landscape of the mammalian WO WO-94,28143 12/1994 genome.” Science 309:1559-1563 (2005). WO WO-95-15373 A2 6, 1995 Carulli, et al., “High Throughput Analysis of Differential Gene WO WO-95/22618 8, 1995 WO WO-95/251.16 10, 1995 Expression.” J. Cell Biochem. Suppl. 3:286-296 (1998). WO WO-95/35505 12/1995 Celis, et al., “Gene expression profiling: monitoring transcription and WO WO-96-27663 A2 9, 1996 translation products using DNA microarrays and proteomics.” FEBS WO WO-97-39 120 A1 10, 1997 Lett., 480:2-16 (2000). WO WO-99-14226 A1 3, 1999 Chabala, J.C., “Solid-phase combinatorial chemistry and novel tag WO WO-99-39352 A1 8, 1999 ging methods for identifying leads.” Curr Opin Biotechnol. 6:632 WO WO-00-57837 A1 10/2000 639 (1995). WO WO-00-61770 A2 10, 2000 Cech. J., “Ribozymes and Their Medical Implications.” American. WO WO-01-00669 A2 1, 2001 Med Assoc. 260:3030-3035 (1988). WO WO-01-21631 A2 3, 2001 Chen, et al., “Expression of ssDNA in Mammalian Cells.” WO WO-01-25488 A2 4/2001 BioTechniques 34:167-171 (2003). WO WO-01-51630 A1 T 2001 Chen, et al., “Analogous Organic Synthesis of Small-Compound WO WO-02-06284.0 A1 8, 2002 WO WO-02-068688 A1 9, 2002 Libraries: Validation of Combinatorial Chemistry in Small-Molecule WO WO-2004-016255 A1 2, 2004 Synthesis,” J. Amer. Chem. Soc. 116:2661-2662 (1994). WO WO-2004-024079 A2 3, 2004 Cheng, J. et al., “Transcriptional maps of 10 human chromosomes at WO WO-2004-030750 A1 4/2004 5-nucleotide resolution.” Science 308:5725:1149-1154 (2005). WO WO-2004-041838 A1 5, 2004 Cho, et al., “An Unnatural Biopolymer.” Science 261: 1303-1305 WO WO-2004-104161 A2 12/2004 (1993). WO WO-2005-045034 A2 5, 2005 Christiensen, N.K. et al., “A Novel Class of Oligonucleotide Ana WO WO-2005-070136 A2 8, 2005 logues Containing 2'-O,3'-C-Linked 3.2. WO WO-2005-079862 A1 9, 2005 OBicycloarabinonucleoside Monomers: Synthesis, Thermal Affinity WO WO-2007-028065 A2 3, 2007 Studies, and Molecular Modeling.” J. Am. Chem. Soc., 120:5458 WO WO-2007-071-182 A1 6, 2007 WO WO-2007-087113 A2 8, 2007 5463 (1998). WO WO 2007-138O23 A1 12/2007 Cubitt, et al., “Understanding, improving and using green fluorescent WO WO-2008-057556 A2 5, 2008 proteins.” Trends in Biochemical Science 20:448-455 (1995). WO WO-2008-066672 A2 6, 2008 Curiel, D. T. et al., “Adenoviris enhancement of transferrin WO WO-2008-087561 A2 T 2008 polylysine-mediated gene delivery.” PNAS 88:8850-8854 (1991). WO WO 2010-002984 A1 1, 2010 Daiet al., “SIRT1 Interacts With p73 and Suppresses p73-Dependent WO WO-2010-040571 A2 4/2010 Transcriptional Activity:” J Cell Physiol 210(1):161-165 (2007). WO WO-2010-054364 A1 5, 2010 Davidson, et al., “A model system for in vivo gene transfer into the WO WO-2010-0582.27 A2 5, 2010 central nervous system using an adenoviral vector.” Nat. Genet 3:219-223 (1993). OTHER PUBLICATIONS Davis, et al., “Direct Gene Transfer into Skeletal Muscle In Vivo: Factors Affecting Efficiency of Transfer and Stability of Expression.” Ausubel, Cnrreat Protocols in Molecular Biology vol. 1, 1994. 6.0. Hum Gene Ther 4: 151-159 (1993). 1-6.4.10. De Mesmaeker, et al., “Antisense Oligonucleotides.” Acc. Chem. Barak, et al., “A B-Arrestin/Green Fluorescent Protein Biosensor for Res. 28:366-374 (1995). Detecting G Protein-Coupled Receptor Activation.” J. Biol. Chem. Deng et al., “Small Interfering RNA Targeting the PINK1 Induces 272:27497-27500 (1997). Apoptosis in Dopaminergic Cells SH-SY5Y”. Biochemical and Bio Barber, et al., “Delivery of membrane-imperimeant fluorescent physical Research Communications, vol. 337, No. 4, pp. 1133-1138 probes into living neural cell populations by lipotransfer.” (2005). Neuroscience Letters 207:17-20 (1996). Dixon, et al., “Anthrax.” New England J. Med. 341:815-826 (1999). Baum, “Solid-phase synthesis or benzodiazepines.” C&EN News, Dolle, “Discovery of Enzyme inhibitors through combinatorial Jan. 18, p. 33-34 (1993). chemistry.” Mol Divers. 2:223-236 (1997). Bernstein, E., et al., “Role for a Bidentate Ribonuclease in the Initia Dykxhoorn, D., et al., “Determinants of Specific RNA Interference tion Step of RNA Interference.” Nature 409:363-366 (2001). Mediated Silencing of Human B-Globin Alleles Differing by a Single Boutla, A., et al., “Short 5'-phosphorylated double-stranded RNAs Nucleotide Polymorphism.” PNAS, vol. 103, No. 15, pp. 5953-5958, (2006). induce RNA interference in Drosophila,” Curr. Biol. 11:1776-1780 Eguchi, et al., “Antisense RNA.” Annu. Rev. Biochem 60:631-652 (2001). (1991). Boyd-Kimball, et al., “Proteomic Identification of Proteins Specifi Eichler, et al., “Generation and utilization of synthetic combinatorial cally Oxidized by Intracerebral Injection of Amyloid f-Peptide libraries.” Mol Med Today 1:174-180 (1995). (1-42) into Rat Brain: Implications for Alzheimer's Disease.” Eichler, et al., “Peptide Peptidomimetic and organic synthetic Neuroscience 132, 313-324 (2005). combinatorial libraries.” Med Res Rev 15:481-496 (1995). Brazma & Vilo, "Gene expression data analysis.” FEBS Lett. Espeseth, et al. A genome wide analysis of ubiquitin ligases in APP 480:17-24 (2000). processing identifies a novel regulator of BACE1 mRNA levels, Mol. Bright, et. al... “Chapter 6. Fluorescence Ratio Imaging Microscopy.” Cell Neurosci. 33: 227-235 (2006). Methods in Cell Biology vol. 30, Taylor and Wang (eds) p. 157-192 Faghihi, M. & Wahlestedt, C., “RNA interference is not involved in (1989). natural antisense mediated regulation of gene expression in mam Bright, et al., “Delivery of Macromolecules Into Adherent Cells via mals.” Genome Biol (2005). Electroporation for Use in Fluorescence Spectroscopic Imaging and Fauchere, et al., “Peptide and nonpeptide lead discovery using roboti Metabolic Studies.” Cytometry 24:226-233 (1996). cally synthesized soluble libraries.” Can J. Physiol Pharmacol Bright, et al., “Fluorescence Ratio Imaging Microscopy: Temporal 75:683-689 (1997). and Spatial Measurements of Cytoplasmic pH. J. Cell Biology Felgner and Holm, "Cationic Liposome-Mediated Transfection.” 104: 1019-1033 (1987). Bethesda Res. Lab Focus, 11:2:21 (1989). Campbell, et al., “Phosphonmate Ester Synthesis. Using a Modified Fields, et al., “How many genes in the human genome?' Nature Mitsunobu Condensation.” J. Org. Chem. 59:658-660 (1994). Genetics 7:345-346 (1994). US 9.410,155 B2 Page 4

(56) References Cited Kaplitt, M.G., et al., “Long-term gene expression and phenotypic correction using adeno-associated virus vectors in the mammalian OTHER PUBLICATIONS brain.” Nat. Genet, 8: 148-154 (1994). Kapranov, P. et al., “Examples of the complex architecture of the Freier & Altman, “The ups and downs of nucleic acid duplex stabil human transcriptome revealed by RACE and high-density tiling ity: structure-stability studies on chemically-modified DNA:RNA arrays.” Genome Res 15:7:987-997 (2005). duplexes.” Nucl. Acid Res., 25:22:4429-4443 (1997). Katayama, S. et al., “AntiSense Transcription in the Mammalian Fuchs, et al., “Identification of Differentially Expressed Genes by Transcriptome.” Science 309: 1564-1566 (2005). Mutually Subtracted RNA Fingerprinting.” Anal. Biochem., 286:91 Kawahara & Nishikura, “Extensive adenosine-to-inosine editing 98 (2000). detected in Alu repeats of antisense RNAS reveals scarcity of sense Gebeyehu, G., et al., “Novel biotinylated nucleotide-analogs for antisense duplex formation.” FEBS Lett580:2301-2305 (2006). labeling and colorimetric detection of DNA. Nucl. Acids Res. Kay, et al., “Identification of enzyme inhibitors from phage-dis 15:4513 (1987). played combinatorial peptide libraries.” Comb Chem High Through Geller, A.I. et al., “An HSV-1 Vector Expressing Tyrosine put Screen 4:535-543 (2001). Hydroxylase Causes Production and Release of L-DOPA from Cul Kenan, et al., “Exploriug molecular diversity with combinatorial tured Rat Striatal Cells,” J. Neurochem 64:487-496 (1995). shape libraries.” Trends Biochem Sci 19:57-64 (1994). Geller, A.I. et al., “Long-term increases in neurotransmitter release Kornberg, A., DNA Replication, W.H. Freeman & Co., San Fran from neuronal cells expressing a constitutively active adenylate cisco, 1980 pp. 75-77. cyclase from a herpes simplex virus type 1 vector.” PNAS U.S.A. Larson, et al., “Rapid DNA Fingerprinting of Pathogens by Flow :90:7603-7607 (1993). Cytometry,” Cytometry, 2000, 41:203-208 (2000). Geller, A.I., et al., “Infection of cultured central nervous system Larsson, et al., “High-throughput protein expression of cDNA prod neurons with a defective herpes simplex virus 1 vector results in ucts as a tool in functional genomics,” J. Biotechnology. 80: 143-157 stable expression of Escherichia coli B-galactosidase.” PNAS USA (2000). 87:1149-1153 (1990). Lebl, et al., “One-bead-one-structure combinatorial libraries.” GenBank Accession No. NM 000559, Homo sapiens Hemoglobin, Biopolymers 37: 177-198 (1995). Gamma A (HBG1), mRNA, (2008). LeGAL Lasalle et al., “An Adenovirus Vector for Gene Transfer into Giuliano, et al., “FLuorescent Protein Biosensors: Measurement of Neurons and Glia in teh Brain.” Science 259:988-990 (1993). Molecular Dynamics in Living Cells.” Ann. Rev. of Biophysics and Letsinger, et al., “Cholesteryl-conjugated oligonucleotides: Synthe Biomolecular Structure. 24:405-434(1999). sis, properties, and activity as inhibitors of replication of human Giuliano, et al., “Light-Optical-Based Reagents for the Measurement immunodeficiency virus in cell culture.” PNAS 86:6553-6556 and Manipulation of Ions, Metabolites, and Macromolecules in Liv (1989). ing Cells.” Methods in Neuroscience 27:1-16 (1995). Li et al., “Control of APP processing and AB generation level by Giuliano, et al., “Determination of Intracellular pH of BALB/c-3T3 BACE1 enzymatic activity and transcription.” Faseb J. 20; 285-292 Cells Using the Fluorescence of Pyranine.” Anal. Biochem 167:362 (2006). 371 (1987). Li, et al., J. Neurochem 89 1308-1312 (2004). Going & Gusterson, “Molecular Pathology and Future Develop Liang, et al., “Parallel Synthesis and Screening of a Solid Phase ments.” Eur, J. Cancer, 35:1895-1904 (1999). Carbohydrate Library.” Science 274: 1520-1522 (1996). Hagihara, et al., “Vinylogous Polypeptides: An Alternate Peptide Luther, “Role of endogenous antisense RNA in cardiac gene regula Backbone.” J. Amer. Chem. Soc. 114:6568-6571 (1992). tion.” J. Mol. Med. 83:26-32 (2005). Haussecker, D, et al., “Dicer-Dependent Turnover of Intergenic from Madden, et al., “Serial analysis of gene expression: from gene dis the Human B-Globin Gene Cluster.” Molecular and Cellular Biology, covery to target identification.” Drug Discov. Today 5:415-425 vol. 25, No. 21, pp: 9724-9793, (2005). (2000). Heller, et al., “Discovery and analysis of inflammatory disease-re Makalowska I, Lin CF, Makalowski W. “Overlapping genes in ver lated genes using cDNA microarrays.” PNAS U.S.A. 94:2150-2155 tebrate genomes.” Comput Biol. Chem 29:1:1-12 (2005). (1997). Mannino and Gould-Fogerite, "Liposome Mediated Gene Transfer.” Herdewijn P. “Heterocyclic Modifications of Oligonucleotides and BioTechniques 6:682-690 (1988). Antisense Technology.” AntiSense & Nucleic Acid Drug Dev. Manoharan et al., “Lipidic Nucleic Acids.” Tetrahedron Lett 10:297-310 (2000). 36:3651-3654 (1995). Hirschmann, et al., J. Amer. Chem. Soc., 114:9217-9218 (1992). Manoharan, et al., “Chemical Modifications to Improve Uptake and Hobbs-DeWitt, et al., “Diversomers: An approach to nonpeptide, Bioavailability of Antisense Oligonucleotides.” Ann. N.Y. Acad. Scie nonoligomeric chemical diversity.” Proc. Nat. Acad. Sci. USA 660:306-309 (1992). 90:6909-6913 (1993). Manoharan, et al., “Introduction of a Lipophilic Thioether in teh Houghton AN, Gold J.S. Blachere NE, Immunity against cancer. Minor Groove of Nucleic Acids for Antisense Applications.” Bioorg. lessons learned from melanoma. Curr Opin Immunol 13:134-140 Med. Chem. Let 3:2765-2770 (1993). (2001). Manoharan, et al., “Cholic Acid-Oligonucleotide Conjugates for International Human Genome Sequencing Consortium "Finishing Antisense Applications.” Bioorg. Med. Chem. Let 4:1053 (1994). the euchromatic sequence of the human genome.” Nature Manoharan, et al., “Oligonucleotide Conjugates: Alteration of the 431:701 1:931-945 (2004). Pharmacokinetic Properties of AntiSense Agents.” Nucleosides & Janda, K.D. "Tagged versus untagged libraries: Methods for the Nucleotides 14:969-973 (1995). generation and screening of combinatorial chemical libraries.” PNAS Manoharan, M., "2"-Carbohydrate modifications in antisense of 91: 10779-10785 (1994). oligonucleotide therapy: importance of conformation, configuration Janowski, et al., “Inhibiting gene expression at transcription start and conjugation.” Biochemica et Biophysica Acta 1489:117-139 sites in chromosomal DNA with antigene RNAs.” Nature Chemical (1999). Biology, 1(4):216-222 (2005). Mattick, J. S. "RNA reegulation: a new genetics?” Nat. Rev. Genet Jungblut, et al., “Proteomics in human disimse: Cancer, heart and 5:4:316-323 (2004). infectious diseases.” Electrophoresis 20:2100-2110 (1999). Maurer, R.A., “Cationic Liposome-Mediated Transfection of Pri Jurecic & Belmont, “Long-distance DD-PCR and cDNA microar mary Cultures of Rat Pituitary Cells.” Bethesda Res. Lab. Focus rays.” Curr. Opin, Microbiol. 3:316-321 (2000). 11:2:25 (1989). Kabanov, et al., “A new class of antivirals: antisense oligonueleotides McNeil in Methods in Cell Biology vol. 29, Taylor and Wang (eds.) combined with a hydrophobic substituent effectively inhibit influ p. 153-173 (1989). enza virus reproduction and synthesis of virus-specific proteins in Morelli et al., “The antisensebcl-2-IgE transcript is an optimal target MDCK cells.” FEBS Lett. 259:327-330 (1990). for synthetic oligonucleotides.” PNAS USA 94.8150-8155 (1997). US 9.410,155 B2 Page 5

(56) References Cited Tamagno, et al., “The various aggregation states off-amyloid 1-42 mediate different effects on Oxidative stress, neurodegeneration, and OTHER PUBLICATIONS BACE-1 expression.” Free Radic Biol Med 41:202-212 (2006). Thakker, D.R., et al., “siRNA-mediated knockdown of the serotonin Nielsen, et al., “Sequence-Selective Recognition of DNA by Strand transporter in the adult mouse brain.” Mol Psychiatry 10:782-789 Displacement with a Thymine-Substituted Polyamide.” Science (2005). 254: 1497-1500 (1991). Thakker, et al., “Neurochemical and behavioral consequences of Oberhauser, et al., “Effective incorporation of 2'-A-methyl widespread gene knockdown in the adult mouse brain by using oligoribonucleotides into liposomes and enhanced cell association through modification with thiocholesterol.” Nucl. Acids Res. 20:333 nonviral RNA interference.” PNAS 101: 17270-17275 (2004). 538 (1992). Thomas et al., “Intracellular pH Measurements in Ehrlich Ascites Petit et al., “Wild-type PINK1 Prevents Basal and Induced Neuronal Tumor Cells Utilizing Spectroscopic Probes Generated in Situ.” Bio Apoptosis, a Protective Effect Abrogated by Parkinson Disease-Re chemistry 18:2210-2218 (1979). lated Mutations”, Journ. Biol. Chem... vol. 280, No. 40, pp. 34.025 Thompson, et al., “Synthesis and Applications of Small Molecule 334032 (2005). Libraries” Chem Rev 96:555-600 (1996). Prasanth, et al., “Regulating Gene Expression through RNANuclear To, KY, “Identification of Differential Gene Expressionm by High Retention.” Cell 123, 249-263 (2005). Throughput Analysis.” Comb. Chem. High Throughput Screen Prashar & Weissman, "READS: A Method for Display of 3'-End 3:235-241 (2000). Fragments of Restriction Enzyme-Digested cDNAs for Analysis of Tong, et al., “Oxidative stress potentiates BACE1 gene expression.” Differential Gene Expression.” Methods Enzymol. 303:238-272 Neural Transm 112,455-469 (2005). (1999). Toulme, J.J., “New candidates for true antisense.” Nature Biotechnol Quantin, et al., “Adenovirus as an expression vector in muscle cells in ogy 19:17-18 (2001). vivo..” PNAS 89:2581-2584 (1992). Tsien in Methods in Cell Biology vol. 30 Taylor and Wang (eds.) p. Rosenfeld, et al., “In Vivo Transfer of the Human Cystic Fibrosis 127-156 (1989). Transmembrane Conductance Regulator Gene to the Airway Epithe Ulhman, E., “Recent advances in the medical chemistry of antisense lium” Cell, 68:143-153 (1992). oligonucleotide.” Current Opinions in Drug Discovery & Develop Rosok and Sioud, "Systematic identification of sense-antisense tran ment 3:203-213 (2000). scripts in mammalian cells.” Nature Biotech. 22(1):104-108 (2004). Van Den Eynde BJ, "T cell defined tumor antigens.” Curr Opin Saison-Behmoaras, et al., “Short modified antisense Immunol 9:684-693 (1997). oligonucleotides directed against Ha-ras point mutation induce selec Van Der Bruggen, et al., “Tumor-specific shared antigenic peptides tive cleavage of the mRNA and inhibit T24 cells proliferation.” recognized by human T cells.” Immunol Rev 188:51-64 (2002). EMBO J. 10: 1111-1118 (1991). Vanhee-Brossolet and Vacquero, “Do natural antisense transcripts Sanghvi, Y.S. in Crooke, S.T. and Lebleu, B., eds. Antisense make sense in eukaryotes?” Gene 211: 1-9 (1998). Research and Applications, CRC Press, Boca Raton, 1993, p. 276 Vaughn, et al., "Human Antibodies with Sub-nanomolar Affinities 278. Isolated from a Large Non-immunized Phage Display Library.” Scheele et al., “The Human PINK1 Locus is Regulated and Vivo by Nature Biotechnology, 14:3:309-314 (1996). a Non-Coding Natural Antisense RNA During Modulation of Velculescu, et al., “Serial Analysis of Gene Expression.” Science Mitochondrial Function'. BMC Genomics, vol. 8, No. 1, p. 74 270:484-487 (1995). (2007). Wahlestedt, “Natural antisense and noncoding RNA transcripts as Schena, et al., “Parallel human genome analysis: Microarray-based potential drug targets.” Drug Discovery Today 11 (11/12):503-508 expression monitoring of 1000 genes.” PNAS 93:10614 (2006). 10619(1996). Wahlestedt, C., “Antisense oligonucleotide strategies in Shea, et al., “Synthesis, hybridization properties and antiviral activity neuropharmacology.” Trends Pharmacol Sci 15:2:42-46(1994). of lipid-oligodeoxynucleotide conjugates. Nucl. Acids Res Walsh, et al., The role of cell-derived oligomers of AB in Alzheimer's 18:3777-3783 (1990). disease and avenues for therapeutic intervention, Biochem Soc Trans Shen, T., et al., “Modification of Globin Gene Expression by RNA 33: 1087-1090 (2005). Targeting Strategies. Experimental Hematology, vol. 35. No. 8, pp. Wang, B.B. et al., “Identification of a nuclear-specific cyclophilin 1209-1218, (2007). which interacts with the proteinase inhibitor eglin c.” Biochem J.314 Shimomura, et al., “Semi-synthetic aequorin.” J. of Biochemistry (Pt. 1) 313-319 (1996). (Tokyo) 251:405-410 (1988). Wiesenhofer, et al., “Glial cell line-derived neurotrophic factor Singer, et al., “Targeting BACE1 with siRNAs ameliorates Alzheimer (GDNP) is a proliferation factor for rat C6 glioma cells: evidence disease neuropathology in a transgenic model.” Nat Neurosci 8: 1343 from ainisense experiments.” Antisense & Nucleic Acid Drug Devel 1349 (2005). opment 10(5):311-321 (2000). Southwick, et al., “Cyanine Dye Labeling Reagents Xue, et al., “Hypoxia and reoxygenation increased BACE1 mRNA Carboxymethylindocyanine Succinimidyl Esters,” Cytometry and protein levels in human neuroblastoma SH-SY5Y cells.” 11:418-430 (1990). Neurosci Lett 405,231-235 (2006). Stratford-Perricadet, et al., “Widespread Long-term Gene Transfer to Yamada, et al., “Endothelial Nitric-Oxide Synthase Antiserise Mouse Skeletal Muscles and Heart.” J. Clin. Invest., 90:626-630 (NOS3AS) Gene Encodes an Autophagy-Related Protein (APG9 (1992). like2) Highly Expressed in Trophoblast” (2005). Sullenger, et al., “Overexpression of TAR sequences Renders Cells Yang, et al., “Cellular and Humoral Immune Responses to Viral Resistant to Human Immunodeficiency Virus Replication.” Antigens Create Barriers to Lung-Directed Gene Therapy with Cello3:601-608 (1990). Recombinant Adenoviruses.” J. Virol 69:2004-2015 (1995). Sun, et al., “Downregulation of Sirt1 by antisense oligonucleotides Yoshigai, et al., “Characterization of Natural Antisense Transcripts induces apoptosis and enhances radiations sensitization in A549 lung Expressed from Interleukin 1B-inducible Genes in Rat Hepatocytes.” cancer cells.” Lung Cancer 58(1):21-29 (2007). HOAJ Biology: 1-10 (2012). Sutcliffe, et al., “TOGA: An automated parsing technology for ana EP Application No. 06850393.7 Examination Report dated Oct. 18. lyzing expression of nearly all genes.” PNAS, 97: 1976-1981 (2000. 2011. Sutton, et al., “TIGR Assembler: A New Tool for Assembling Large International Search Report and Written Opinion for PCT Applica Shotgun Sequencing Projects.” Genome Science & Tech. 1:9-19 tion No. PCT/US2010/033078 mailed Jun. 29, 2011. (1995). PCT/US2010/026119 Seareh Report and Written Opinion mailed Svinarchuk, et al., “Inhibition of HIV proliferation in MT-4 cells by Feb. 7, 2011. antisense oligonucleotide conjugated to lipophilic groups.” PCT/US2010/024079 Search Report and Written Opinion mailed Biochimie 75:49-54 (1993). Jan. 31, 2011. US 9.410,155 B2 Page 6

(56) References Cited PCT/US96/10287 (WO97/000271) The Regents of the University of California Jan. 3, 1997. OTHER PUBLICATIONS PCT/US2010/027394 Search Report and Written Opinion mailed Nov. 5, 2010. * cited by examiner U.S. Patent Aug. 9, 2016 Sheet 1 of 9 US 9.410,155 B2

foid difference in VEGFA expressior after treatment with SiRNAS to WEGA8s : 8 5 & 3 S. S. 2 8 S a weis3333 wefaas 3 weiaasis

: xxaaarvarurassrora warrar u-rererrerase.xxenase-earnear-r

F. is

Fcid difference in VEGFas2 expression after treatment with six is to WESFas2

{} m - www.wrwr. vefaasi.2 wefaasi 3 wefaas3.5 U.S. Patent Aug. 9, 2016 Sheet 2 of 9 US 9.410,155 B2

G. C.

numa h larvalryvkwww.maw Faic difference in WEGF expression after treatire int with sin. As to WEGRas2

as C3

wegR&Si2 we gR3S3 vegiasis

U.S. Patent Aug. 9, 2016 Sheet 9 of 9 US 9.410,155 B2

tea-Sequence its------Buruuauruvauvvuwww.wrwrvw.ver-re-rrrrrrrrrrrrrrrrr-v---Sequence wwn------w-r-r-r-ror---nava--- errrrrrrrrrrrrrrrra-a-a-aramarmammar $82 ES (3 : R S SCSSESS GAS C3RsR SRSSSSESSSSSSCE

SSE {{Stasis

tarn

is

eqi etce if: Sequence occassessssssciress

Ric Sig E83.

33 EC: 3.2 go.ggA&SCRiggags &

SS3 ;SAAccessess cigric $8.3 : ) & 3: 34 jpgrpeggiri:35&RAErgi eggar

US 9,410,155 B2 1. 2 TREATMENT OF VASCULARENDOTHELLAL for example, nucleotides set forth in SEQID NOS: 2 and 3. GROWTH FACTOR (VEGF) RELATED and any variants, alleles, homologs, mutants, derivatives, DISEASES BY INHIBITION OF NATURAL fragments and complementary sequences thereto. Examples ANTISENSE TRANSCRIPT TO VEGF of antisense oligonucleotides are set forth as SEQID NOS: 4 to 9 (FIG. 4). CROSS REFERENCE Another embodiment provides a method of modulating function and/or expression of an VEGF polynucleotide in This application is a divisional of U.S application Ser. No. patient cells or tissues in vivo or in vitro comprising contact 13/132,997 filed Jun. 15, 2011, now U.S. Pat. No. 8,927,511, ing said cells or tissues with an antisense oligonucleotide 5 to which is a National Phase application of PCT/US2009/ 10 30 nucleotides in length wherein said oligonucleotide has at 066455 filed on Dec. 2, 2009, which is based upon U.S. least 50% sequence identity to a reverse complement of the an Provisional No. 61/119,957 filed on Dec. 4, 2008, which are antisense of the VEGF polynucleotide; thereby modulating all hereby incorporated by reference. function and/or expression of the VEGF polynucleotide in 15 patient cells or tissues in vivo or in vitro. FIELD OF THE INVENTION Another embodiment provides a method of modulating Embodiments of the invention comprise oligonucleotides function and/or expression of an VEGF polynucleotide in modulating expression and/or function of VEGF and associ patient cells or tissues in vivo or in vitro comprising contact ated molecules. ing said cells or tissues with an antisense oligonucleotide 5 to 30 nucleotides in length wherein said oligonucleotide has at BACKGROUND least 50% sequence identity to an antisense oligonucleotide to anVEGF antisense polynucleotide; thereby modulating func DNA-RNA and RNA-RNA hybridization are important to tion and/or expression of the VEGF polynucleotide in patient many aspects of nucleic acid function including DNA repli cells or tissues in vivo or in vitro. cation, transcription, and translation. Hybridization is also 25 In a preferred embodiment, a composition comprises one central to a variety of technologies that either detect a par or more antisense oligonucleotides which bind to sense and/ ticular nucleic acid or alter its expression. Antisense nucle or antisense VEGF polynucleotides. otides, for example, disrupt gene expression by hybridizing to In another preferred embodiment, the oligonucleotides target RNA, thereby interfering with RNA splicing, transcrip comprise one or more modified or Substituted nucleotides. tion, translation, and replication. Antisense DNA has the 30 In another preferred embodiment, the oligonucleotides added feature that DNA-RNA hybrids serve as a substrate for comprise one or more modified bonds. digestion by ribonuclease H, an activity that is present in most In yet another embodiment, the modified nucleotides com cell types. Antisense molecules can be delivered into cells, as prise modified bases comprising phosphorothioate, meth is the case for oligodeoxynucleotides (ODNs), or they can be ylphosphonate, peptide nucleic acids, 2'-O-methyl, fluoro- or expressed from endogenous genes as RNA molecules. The 35 FDA recently approved an antisense drug, VITRAVENETM carbon, methylene or other locked nucleic acid (LNA) mol (for treatment of cytomegalovirus retinitis), reflecting that ecules. Preferably, the modified nucleotides are locked antisense has therapeutic utility. nucleic acid molecules, including C-L-LNA. In another preferred embodiment, the oligonucleotides are SUMMARY 40 administered to a patient Subcutaneously, intramuscularly, intravenously or intraperitoneally. This Summary is provided to present a Summary of the In another preferred embodiment, the oligonucleotides are invention to briefly indicate the nature and substance of the administered in a pharmaceutical composition. A treatment invention. It is submitted with the understanding that it will regimen comprises administering the antisense compounds at not be used to interpret or limit the scope or meaning of the 45 least once to patient; however, this treatment can be modified claims. to include multiple doses over a period of time. The treatment In one embodiment, the invention provides methods for can be combined with one or more other types of therapies. inhibiting the action of a natural antisense transcript by using In another preferred embodiment, the oligonucleotides are antisense oligonucleotide(s) targeted to any region of the encapsulated in a liposome or attached to a carrier molecule natural antisense transcript resulting in up-regulation of the 50 (e.g. cholesterol, TAT peptide). corresponding sense gene. It is also contemplated herein that Other aspects are described infra. inhibition of the natural antisense transcript can be achieved by siRNA, ribozymes and small molecules, which are con BRIEF DESCRIPTION OF THE DRAWINGS sidered to be within the scope of the present invention. One embodiment provides a method of modulating func 55 FIGS. 1A, 1B, and 1C: tion and/or expression of an VEGF polynucleotide in patient FIGS. 1A and 1B: is a graph of real time PCR results cells or tissues in vivo or in vitro comprising contacting said showing the fold change+standard deviation in VEGF mRNA cells or tissues with an antisense oligonucleotide 5 to 30 after treatment of HepG2 cells with siRNA oligonucleotides nucleotides in length wherein said oligonucleotide has at least introduced using Lipofectamine 2000, as compared to con 50% sequence identity to a reverse complement of a poly 60 trol. Real time PCR results show that the levels of the VEGFA nucleotide comprising 5 to 30 consecutive nucleotides within mRNA in HepG2 cells are significantly increased 48 h after nucleotides 1 to 643 of SEQID NO: 2 or nucleotides 1 to 513 treatment with one of the siRNAs designed to vegfaas (ve of SEQID NO:3 (FIG.3) thereby modulating function and/or faas 1 2, P=0.05), and possibly with the second, Vefaas 13 expression of the VEGF polynucleotide in patient cells or (P=0.1, FIG. 1A). In the same samples the levels of vegfaas tissues in vivo or in vitro. 65 RNA were significantly decreased after treatment with either In another preferred embodiment, an oligonucleotide tar Vefaas1 2 or Vefaas 13, but unchanged after treatment with gets a natural antisense sequence of VEGF polynucleotides, vefaas 15, which also had no effect on the VEGFA mRNA US 9,410,155 B2 3 4 levels (FIG. 1B). Bars denoted in as Vefaas 1 2. Vefaas 13, Definitions vefaas 15 correspond to samples treated with SEQID NOS The terminology used herein is for the purpose of describ 4, 5, and 6 respectively. ing particular embodiments only and is not intended to be FIG. 1C is a graph of real time PCR results showing the limiting of the invention. As used herein, the singular forms fold change--standard deviation in VEGF mRNA after treat “a”, “an and “the are intended to include the plural forms as ment of HepG2 cells with siRNA oligonucleotides intro well, unless the context clearly indicates otherwise. Further duced using Lipofectamine 2000, as compared to control. more, to the extent that the terms “including”, “includes”, Real time PCR results show that the levels of the VEGFA “having”, “has”, “with, or variants thereofare used in either mRNA in HepG2 cells are significantly increased 48 h after the detailed description and/or the claims, such terms are 10 intended to be inclusive in a manner similar to the term treatment with two of the siRNAs designed to vegRas (veg “comprising.” Ras1 2, P=0.02 and vegRas13, P=0.06.). The results for the The term “about' or “approximately’ means within an change in VegRas RNA levels are pending. Bars denoted as acceptable error range for the particular value as determined VegRas1 2, vegRas13, VegRasl 5 correspond to samples by one of ordinary skill in the art, which will dependin part on treated with SEQID NOS 7, 8, and 9 respectively. 15 how the value is measured or determined, i.e., the limitations FIG. 2 shows SEQ ID NO: 1: Homo sapiens Vascular of the measurement system. For example, "about can mean Endothelial Growth Factor (VEGF), transcript variant 1, within 1 or more than 1 standard deviation, per the practice in mRNA. (NCBI Accession No: NM_001025366.1) and SEQ the art. Alternatively, “about can mean a range of up to 20%, ID NO: 17 shows the genomic sequence of VEGF (exons are preferably up to 10%, more preferably up to 5%, and more shown in capital letters, introns in Small). preferably still up to 1% of a given value. Alternatively, par FIG. 3 shows ticularly with respect to biological systems or processes, the SEQ ID NO: 2: VEGF Natural antisense sequence (NCBI term can mean within an order of magnitude, preferably Accession No.: BIO45995) within 5-fold, and more preferably within 2-fold, of a value. SEQ ID NO:3: VEGR Natural antisense sequence (NCBI Where particular values are described in the application and Accession No.: BF829784) 25 claims, unless otherwise stated the term “about’ meaning FIG. 4 shows the antisense oligonucleotides, SEQID NOs: within an acceptable error range for the particular value 4 to 6 designed to VEGF Natural antisense sequence should be assumed. FIG. 5 shows the antisense oligonucleotides, SEQID NOs: As used herein, the term “mRNA means the presently 7 to 9 designed to VEGR Natural antisense sequence known mRNA transcript(s) of a targeted gene, and any further FIG. 6 shows the target sequence VEGFA exon 1 (SEQID 30 transcripts which may be elucidated. NO: 10); Forward primer sequences (SEQ ID NOS: 11 and By “antisense oligonucleotides' or “antisense compound 12), reverse primer sequences (SEQID NOS: 13 and 14) and is meantan RNA or DNA molecule that binds to another RNA the reporter sequences (SEQ ID NOS: 15 and 16) of the or DNA (target RNA, DNA). For example, if it is an RNA Custom assays designed by Applied Biosystems Taqman oligonucleotide it binds to another RNA target by means of 35 RNA-RNA interactions and alters the activity of the target Gene Expression Assay (HsO0173626 m1). RNA (Eguchi et al., (1991) Ann. Rev. Biochem. 60, 631-652). An antisense oligonucleotide can upregulate or downregulate DETAILED DESCRIPTION expression and/or function of a particular polynucleotide. The definition is meant to include any foreign RNA or DNA Several aspects of the invention are described below with 40 molecule which is useful from a therapeutic, diagnostic, or reference to example applications for illustration. It should be other viewpoint. Such molecules include, for example, anti understood that numerous specific details, relationships, and sense RNA or DNA molecules, interference RNA (RNAi), methods are set forth to provide a full understanding of the microRNA, decoy RNA molecules, siRNA, enzymatic RNA, invention. One having ordinary skill in the relevant art, how therapeutic editing RNA and agonist and antagonist RNA, ever, will readily recognize that the invention can be practiced 45 antisense oligomeric compounds, antisense oligonucleotides, without one or more of the specific details or with other external guide sequence (EGS) oligonucleotides, alternate methods. The present invention is not limited by the ordering splicers, primers, probes, and other oligomeric compounds of acts or events, as some acts may occur in different orders that hybridize to at least a portion of the target nucleic acid. As and/or concurrently with other acts or events. Furthermore, Such, these compounds may be introduced in the form of not all illustrated acts or events are required to implement a 50 single-stranded, double-stranded, partially single-stranded, methodology in accordance with the present invention. or circular oligomeric compounds. All genes, gene names, and gene products disclosed herein In the context of this invention, the term "oligonucleotide' are intended to correspond to homologs from any species for refers to an oligomer or polymer of ribonucleic acid (RNA) or which the compositions and methods disclosed herein are deoxyribonucleic acid (DNA) or mimetics thereof. The term applicable. Thus, the terms include, but are not limited to 55 "oligonucleotide', also includes linear or circular oligomers genes and gene products from humans and mice. It is under of natural and/or modified monomers or linkages, including stood that when a gene or gene product from a particular deoxyribonucleosides, ribonucleosides, substituted and species is disclosed, this disclosure is intended to be exem alpha-anomeric forms thereof, peptide nucleic acids (PNA), plary only, and is not to be interpreted as a limitation unless locked nucleic acids (LNA), phosphorothioate, methylphos the context in which it appears clearly indicates. Thus, for 60 phonate, and the like. Oligonucleotides are capable of spe example, for the genes disclosed herein, which in some cifically binding to a target polynucleotide by way of a regular embodiments relate to mammalian nucleic acid and amino pattern of monomer-to-monomer interactions, such as Wat acid sequences are intended to encompass homologous and/ son-Crick type of base pairing, Hoogsteen or reverse Hoðgs or orthologous genes and gene products from other animals teen types of base pairing, or the like. including, but not limited to other mammals, fish, amphib 65 The oligonucleotide may be “chimeric', that is, composed ians, reptiles, and birds. In preferred embodiments, the genes of different regions. In the context of this invention “chi or nucleic acid sequences are human. meric' compounds are oligonucleotides, which contain two US 9,410,155 B2 5 6 or more chemical regions, for example, DNA region(s), RNA certain embodiments of the present invention, the mediators region(s), PNA region(s) etc. Each chemical region is made are 5-25 nucleotide “small interfering RNA duplexes (siR up of at least one monomer unit, i.e., a nucleotide in the case NAs). The siRNAs are derived from the processing of dsRNA of an oligonucleotides compound. These oligonucleotides by an RNase enzyme known as Dicer (Bernstein, E., et al. typically comprise at least one region wherein the oligonucle (2001) Nature 409:363-366), siRNA duplex products are otide is modified in order to exhibit one or more desired recruited into a multi-protein siRNA complex termed RISC properties. The desired properties of the oligonucleotide (RNA Induced Silencing Complex). Without wishing to be include, but are not limited, for example, to increased resis bound by any particular theory, a RISC is then believed to be tance to nuclease degradation, increased cellular uptake, and/ guided to a target nucleic acid (suitably mRNA), where the or increased binding affinity for the target nucleic acid. Dif 10 siRNA duplex interacts in a sequence-specific way to mediate ferent regions of the oligonucleotide may therefore have cleavage in a catalytic fashion (Bernstein, E., et al. (2001) different properties. The chimeric oligonucleotides of the Nature 409:363-366; Boutla, A., et al. (2001) Curr. Biol. present invention can be formed as mixed structures of two or 11:1776-1780). Small interfering RNAs that can be used in more oligonucleotides, modified oligonucleotides, oligo accordance with the present invention can be synthesized and nucleosides and/or oligonucleotide analogs as described 15 used according to procedures that are well known in the art above. and that will be familiar to the ordinarily skilled artisan. Small The oligonucleotide can be composed of regions that can interfering RNAs for use in the methods of the present inven be linked in “register, that is, when the monomers are linked tion suitably comprise between about 1 to about 50 nucle consecutively, as in native DNA, or linked via spacers. The otides (nt). In examples of non limiting embodiments, siR spacers are intended to constitute a covalent “bridge' NAs can comprise about 5 to about 40 nt, about 5 to about 30 between the regions and have in preferred cases a length not nt, about 10 to about 30 nt, about 15 to about 25 nt, or about exceeding about 100 carbon atoms. The spacers may carry 20-25 nucleotides. different functionalities, for example, having positive or Selection of appropriate oligonucleotides is facilitated by negative charge, carry special nucleic acid binding properties using computer programs that automatically align nucleic (intercalators, groove binders, toxins, fluorophors etc.), being 25 acid sequences and indicate regions of identity or homology. lipophilic, inducing special secondary structures like, for Such programs are used to compare nucleic acid sequences example, alanine containing peptides that induce alpha-heli obtained, for example, by searching databases such as Gen CCS. Bank or by sequencing PCR products. Comparison of nucleic As used herein “VEGF and “Vascular Endothelial Growth acid sequences from a range of species allows the selection of Factor A are inclusive of all family members, mutants, alle 30 nucleic acid sequences that display an appropriate degree of les, fragments, species, coding and noncoding sequences, identity between species. In the case of genes that have not sense and antisense polynucleotide strands, etc. been sequenced, Southern blots are performed to allow a As used herein, the words Vascular Endothelial Growth determination of the degree of identity between genes in Factor A, VEGF, VEGFA are used interchangeably in the target species and other species. By performing Southern present application. 35 blots at varying degrees of stringency, as is well known in the As used herein, the term "oligonucleotide specific for” or art, it is possible to obtain an approximate measure of identity. "oligonucleotide which targets” refers to an oligonucleotide These procedures allow the selection of oligonucleotides that having a sequence (i) capable of forming a stable complex exhibit a high degree of complementarity to target nucleic with a portion of the targeted gene, or (ii) capable of forming acid sequences in a subject to be controlled and a lower degree a stable duplex with a portion of a mRNA transcript of the 40 of complementarity to corresponding nucleic acid sequences targeted gene. Stability of the complexes and duplexes can be in other species. One skilled in the art will realize that there is determined by theoretical calculations and/or in vitro assays. considerable latitude in selecting appropriate regions of Exemplary assays for determining stability of hybridization genes for use in the present invention. complexes and duplexes are described in the Examples By “enzymatic RNA is meant an RNA molecule with below. 45 enzymatic activity (Cech, (1988) J. American. Med. Assoc. As used herein, the term “target nucleic acid encompasses 260,3030-3035). Enzymatic nucleic acids (ribozymes) act by DNA, RNA (comprising premRNA and mRNA) transcribed first binding to a target RNA. Such binding occurs through the from such DNA, and also cDNA derived from such RNA, target binding portion of an enzymatic nucleic acid which is coding, noncoding sequences, sense or antisense polynucle held in close proximity to an enzymatic portion of the mol otides. The specific hybridization of an oligomeric compound 50 ecule that acts to cleave the target RNA. Thus, the enzymatic with its target nucleic acid interferes with the normal function nucleic acid first recognizes and then binds a target RNA of the nucleic acid. This modulation of function of a target through base pairing, and once bound to the correct site, acts nucleic acid by compounds, which specifically hybridize to it, enzymatically to cut the target RNA. is generally referred to as “antisense”. The functions of DNA By “decoy RNA is meant an RNA molecule that mimics to be interfered include, for example, replication and tran 55 the natural binding domain for a ligand. The decoy RNA scription. The functions of RNA to be interfered, include all therefore competes with natural binding target for the binding vital functions such as, for example, translocation of the RNA of a specific ligand. For example, it has been shown that to the site of protein translation, translation of protein from over-expression of HIV trans-activation response (TAR) the RNA, splicing of the RNA to yield one or more mRNA RNA can act as a “decoy’ and efficiently binds HIV tat species, and catalytic activity which may be engaged in or 60 protein, thereby preventing it from binding to TAR sequences facilitated by the RNA. The overall effect of such interference encoded in the HIV RNA (Sullenger et al. (1990) Cell, 63, with target nucleic acid function is modulation of the expres 601-608). This is meant to be a specific example. Those in the sion of an encoded product or oligonucleotides. art will recognize that this is but one example, and other RNA interference “RNAi is mediated by double stranded embodiments can be readily generated using techniques gen RNA (dsRNA) molecules that have sequence-specific homol 65 erally known in the art. ogy to their “target nucleic acid sequences (Caplen, N.J., et As used herein, the term “monomers’ typically indicates al. (2001) Proc. Natl. Acad. Sci. USA 98: 9742-9747). In monomers linked by phosphodiester bonds or analogs thereof US 9,410,155 B2 7 8 to form oligonucleotides ranging in size from a few mono desired, i.e., under physiological conditions in the case of in meric units, e.g., from about 3-4, to about several hundreds of Vivo assays or therapeutic treatment, and under conditions in monomeric units. Analogs of phosphodiester linkages which assays are performed in the case of in vitro assays. include: phosphorothioate, phosphorodithioate, methylphos As used herein, the phrase “stringent hybridization condi phornates, phosphoroselenoate, phosphoramidate, and the tions” or “stringent conditions” refers to conditions under like, as more fully described below. which a compound of the invention will hybridize to its target The term “nucleotide' covers naturally occurring nucle sequence, but to a minimal number of other sequences. Strin otides as well as nonnaturally occurring nucleotides. It should gent conditions are sequence-dependent and will be different be clear to the person skilled in the art that various nucleotides in different circumstances and in the context of this invention, which previously have been considered “non-naturally occur 10 'stringent conditions” under which oligomeric compounds ring have Subsequently been found in nature. Thus, “nucle hybridize to a target sequence are determined by the nature otides' includes not only the known purine and pyrimidine and composition of the oligomeric compounds and the assays heterocycles-containing molecules, but also heterocyclic in which they are being investigated. In general, stringent analogues and tautomers thereof. Illustrative examples of hybridization conditions comprise low concentrations other types of nucleotides are molecules containing adenine, 15 (<0.15M) of salts with inorganic cations such as Na++ or K++ guanine, thymine, cytosine, uracil, purine, Xanthine, diami (i.e., low ionic strength), temperature higher than 20°C.-25° nopurine, 8-oxo-N6-methyladenine, 7-deazaxanthine, 7-dea C. below the Tm of the oligomeric compound:target sequence Zaguanine, N4.N4-ethanocytosin, N6.N6-ethano-2,6-diami complex, and the presence of denaturants such as formamide, nopurine, 5-methylcytosine, 5-(C3-C6)-alkynylcytosine, dimethylformamide, dimethyl sulfoxide, or the detergent 5-fluorouracil, 5-bromouracil, pseudoisocytostine, 2-hy sodium dodecyl sulfate (SDS). For example, the hybridiza droxy-5-methyl-4-triazolopyridin, isocytosine, isoguanin, tion rate decreases 1.1% for each 1% formamide. An example inosine and the “non-naturally occurring nucleotides of a high Stringency hybridization condition is 0.1x sodium described in Benner et al., U.S. Pat. No. 5,432,272. The term chloride-sodium citrate buffer (SSC)/0.1% (w/v) SDS at 60° “nucleotide' is intended to cover every and all of these C. for 30 minutes. examples as well as analogues and tautomers thereof. Espe 25 “Complementary, as used herein, refers to the capacity for cially interesting nucleotides are those containing adenine, precise pairing between two nucleotides on one or two oligo guanine, thymine, cytosine, and uracil, which are considered meric strands. For example, if a nucleobase at a certain posi as the naturally occurring nucleotides in relation to therapeu tion of an antisense compound is capable of hydrogen bond tic and diagnostic application inhumans. Nucleotides include ing with a nucleobase at a certain position of a target nucleic the natural 2'-deoxy and 2'-hydroxyl Sugars, e.g., as described 30 acid, said target nucleic acid being a DNA, RNA, or oligo in Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, nucleotide molecule, then the position of hydrogen bonding San Francisco, 1992) as well as their analogs. between the oligonucleotide and the target nucleic acid is Analogs' in reference to nucleotides includes synthetic considered to be a complementary position. The oligomeric nucleotides having modified base moieties and/or modified compound and the further DNA, RNA, or oligonucleotide Sugar moieties (see e.g., described generally by Scheit, 35 molecule are complementary to each other when a sufficient Nucleotide Analogs, John Wiley, New York, 1980; Freier & number of complementary positions in each molecule are Altmann, (1997) Nucl. Acid. Res., 25(22), 4429-4443, occupied by nucleotides which can hydrogen bond with each Toulmé, J.J. (2001) Nature Biotechnology 19:17-18; Mano other. Thus, “specifically hybridizable' and “complemen haran M., (1999) Biochemica et Biophysica Acta 1489: 117 tary' are terms which are used to indicate a sufficient degree 139; Freier S. M., (1997) Nucleic Acid Research, 25:4429 40 of precise pairing or complementarity over a sufficient num 4443. Uhlman, E., (2000) Drug Discovery & Development, 3: ber of nucleotides such that stable and specific binding occurs 203-213, Herdewin P. (2000) Antisense & Nucleic Acid Drug between the oligomeric compound and a target nucleic acid. Dev., 10:297-310); 2'-O, 3'-C-linked 3.2.0 bicycloarabino It is understood in the art that the sequence of an oligomeric nucleosides (see e.g. N. K Christiensen... et al. (1998).J. Am. compound need not be 100% complementary to that of its Chem. Soc., 120: 5458-5463; Prakash T P Bhat B. (2007) 45 target nucleic acid to be specifically hybridizable. Moreover, Curr Top Med Chem. 7(7):641-9; Cho E. J, et al. (2009) an oligonucleotide may hybridize over one or more segments Annual Review of Analytical Chemistry, 2, 241-264). Such Such that intervening or adjacent segments are not involved in analogs include synthetic nucleotides designed to enhance the hybridization event (e.g., a loop structure, mismatch or binding properties, e.g., duplex or triplex stability, specificity, hairpin structure). The oligomeric compounds of the present or the like. 50 invention comprise at least about 70%, or at least about 75%, As used herein, “hybridization” means the pairing of sub or at least about 80%, or at least about 85%, or at least about stantially complementary Strands of oligomeric compounds. 90%, or at least about 95%, or at least about 99% sequence One mechanism of pairing involves hydrogenbonding, which complementarity to a target region within the target nucleic may be Watson-Crick, Hoogsteen or reversed Hoögsteen acid sequence to which they are targeted. For example, an hydrogen bonding, between complementary nucleoside or 55 antisense compound in which 18 of 20 nucleotides of the nucleotide bases (nucleotides) of the Strands of oligomeric antisense compound are complementary to a target region, compounds. For example, adenine and thymine are comple and would therefore specifically hybridize, would represent mentary nucleotides which pair through the formation of 90 percent complementarity. In this example, the remaining hydrogen bonds. Hybridization can occur under varying cir noncomplementary nucleotides may be clustered or inter Cum Stances. 60 spersed with complementary nucleotides and need not be An antisense compound is “specifically hybridizable' contiguous to each other or to complementary nucleotides. As when binding of the compound to the target nucleic acid Such, an antisense compound which is 18 nucleotides in interferes with the normal function of the target nucleic acid length having 4 (four) noncomplementary nucleotides which to cause a modulation of function and/or activity, and there is are flanked by two regions of complete complementarity with a sufficient degree of complementarity to avoid non-specific 65 the target nucleic acid would have 77.8% overall complemen binding of the antisense compound to non-target nucleic acid tarity with the target nucleic acid and would thus fall within sequences under conditions in which specific binding is the scope of the present invention. Percent complementarity US 9,410,155 B2 10 of an antisense compound with a region of a target nucleic nescent agents, chromogenic agents, Substrates, cofactors, acid can be determined routinely using BLAST programs inhibitors, magnetic particles, and the like. (basic local alignment search tools) and PowerBLAST pro A "derivative' polypeptide or peptide is one that is modi grams known in the art (Altschulet al., (1990).J. Mol. Biol., fied, for example, by glycosylation, pegylation, phosphory 215, 403-410; Zhang and Madden, (1997) Genome Res., 7. lation, Sulfation, reduction/alkylation, acylation, chemical 649-656). Percent homology, sequence identity or comple coupling, or mild formalin treatment. A derivative may also mentarity, can be determined by, for example, the Gap pro be modified to contain a detectable label, either directly or gram (Wisconsin Sequence Analysis Package, Version 8 for indirectly, including, but not limited to, a radioisotope, fluo Unix, Genetics Computer Group, University Research Park, rescent, and enzyme label. Madison Wis.), using default settings, which uses the algo 10 As used herein, the term “animal' or “patient' is meant to rithm of Smith and Waterman (Adv. Appl. Math., (1981) 2, include, for example, humans, sheep, elks, deer, mule deer, 482-489). minks, mammals, monkeys, horses, cattle, pigs, goats, dogs, As used herein, the term “Thermal Melting Point (Tm)” cats, rats, mice, birds, chicken, reptiles, fish, insects and refers to the temperature, under defined ionic strength, pH, arachnids. and nucleic acid concentration, at which 50% of the oligo 15 “Mammal’ covers warm blooded mammals that are typi nucleotides complementary to the target sequence hybridize cally under medical care (e.g., humans and domesticated to the target sequence at equilibrium. Typically, stringent animals). Examples include feline, canine, equine, bovine, conditions will be those in which the salt concentration is at and human, as well as just human. least about 0.01 to 1.0 MNaion concentration (or other salts) “Treating or “treatment covers the treatment of a dis at pH 7.0 to 8.3 and the temperature is at least about 30°C. for ease-state in a mammal, and includes: (a) preventing the short oligonucleotides (e.g., 10 to 50 nucleotide). Stringent disease-state from occurring in a mammal, in particular, when may also be achieved with the addition of destabilizing agents Such mammal is predisposed to the disease-state but has not Such as formamide. yet been diagnosed as having it; (b) inhibiting the disease As used herein, "modulation” means either an increase state, e.g., arresting it development; and/or (c) relieving the (stimulation) or a decrease (inhibition) in the expression of a 25 disease-state, e.g., causing regression of the disease state until gene. a desired endpoint is reached. Treating also includes the ame The term “variant, when used in the context of a poly lioration of a symptom of a disease (e.g., lessen the pain or nucleotide sequence, may encompass a polynucleotide discomfort), wherein Such amelioration may or may not be sequence related to a wild type gene. This definition may also directly affecting the disease (e.g., cause, transmission, include, for example, “allelic,” “splice.” “species,” or “poly 30 expression, etc.). morphic' variants. A splice variant may have significant iden As used herein, the term "cancer refers to any malignant tity to a reference molecule, but will generally have a greater tumor, particularly arising in the lung, kidney, orthyroid. The or lesser number of polynucleotides due to alternate splicing cancer manifests itself as a "tumor or tissue comprising of exons during mRNA processing. The corresponding malignant cells of the cancer. Examples of tumors include polypeptide may possess additional functional domains oran 35 sarcomas and carcinomas Such as, but not limited to: fibrosa absence of domains. Species variants are polynucleotide rcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteo sequences that vary from one species to another. Of particular genic sarcoma, chordoma, angiosarcoma, endotheliosar utility in the invention are variants of wildtype gene products. coma, lymphangiosarcoma, lymphangioendotheliosarcoma, Variants may result from at least one mutation in the nucleic synovioma, mesothelioma, Ewings tumor, leiomyosarcoma, acid sequence and may result in altered mRNAS or in 40 rhabdomyosarcoma, colon carcinoma, pancreatic cancer, polypeptides whose structure or function may or may not be breast cancer, ovarian cancer, prostate cancer, squamous cell altered. Any given natural or recombinant gene may have carcinoma, basal cell carcinoma, adenocarcinoma, Sweat none, one, or many allelic forms. Common mutational gland carcinoma, sebaceous gland carcinoma, papillary car changes that give rise to variants are generally ascribed to cinoma, papillary adenocarcinomas, cystadenocarcinoma, natural deletions, additions, or Substitutions of nucleotides. 45 medullary carcinoma, bronchogenic carcinoma, renal cell Each of these types of changes may occur alone, or in com carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, bination with the others, one or more times in a given seminoma, embryonal carcinoma, Wilms tumor, cervical Sequence. cancer, testicular tumor, lung carcinoma, Small cell lung car The resulting polypeptides generally will have significant cinoma, bladder carcinoma, epithelial carcinoma, glioma, amino acid identity relative to each other. A polymorphic 50 astrocytoma, medulloblastoma, craniopharyngioma, ependy variant is a variation in the polynucleotide sequence of a moma, pinealoma, hemangioblastoma, acoustic neuroma, particular gene between individuals of as given species. Poly oligodendroglioma, meningioma, melanoma, neuroblas morphic variants also may encompass 'single nucleotide toma, and retinoblastoma. As noted above, the invention spe polymorphisms” (SNPs.) or single base mutations in which cifically permits differential diagnosis of lung, kidney, and the polynucleotide sequence varies by one base. The presence 55 thyroid tumors. of SNPs may be indicative of, for example, a certain popula Polynucleotide and Oligonucleotide Compositions and Mol tion with a propensity for a disease state, that is Susceptibility ecules Versus resistance. Targets: In one embodiment, the targets comprise nucleic Derivative polynucleotides include nucleic acids subjected acid sequences of Vascular Endothelial Growth Factor to chemical modification, for example, replacement of hydro 60 (VEGF), including without limitation sense and/or antisense gen by an alkyl, acyl, or amino group. Derivatives, e.g., noncoding and/or coding sequences associated with VEGF. derivative oligonucleotides, may comprise non-naturally-oc Vascular Endothelial Growth Factor (VEGF) is a potent curring portions, such as altered Sugar moieties or inter-Sugar stimulating factor for angiogenesis and vascular permeabil linkages. Exemplary among these are phosphorothioate and ity. There are eight isoforms with different and sometimes other Sulfur containing species which are known in the art. 65 overlapping functions. The mechanisms of action are under Derivative nucleic acids may also contain labels, including investigation with emerging insights into overlapping path radionucleotides, enzymes, fluorescent agents, chemilumi ways and cross-talk between other receptors such as the neu US 9,410,155 B2 11 12 rophilins, which were not previously associated to angiogen midine, guanosine, cytidine or other natural or unnatural esis. VEGF has important physiological actions on the nucleotides at this position. This may be done at any of the embryonic development, healing and menstrual cycle. It has positions of the antisense compound. These compounds are also a great role in pathological conditions that are associated then tested using the methods described herein to determine to autoimmune diseases. their ability to inhibit expression of a target nucleic acid. Exemplary Vascular Endothelial Growth Factor mediated In some embodiments, homology, sequence identity or diseases and disorders which can be treated with cell/tissues complementarity, between the antisense compound and tar regenerated from stem cells obtained using the antisense get is from about 50% to about 60%. In some embodiments, compounds comprise diseases that are characterized by homology, sequence identity or complementarity, is from excessive vascular endothelial cell proliferation; cardiovas 10 about 60% to about 70%. In some embodiments, homology, cular diseases which results from a cardiovascular insuffi sequence identity or complementarity, is from about 70% to ciency, (e.g., coronary artery disease, congestive heart failure, about 80%. In some embodiments, homology, sequence iden and peripheral vascular disease); Conditions that are charac tity or complementarity, is from about 80% to about 90%. In terized or caused by abnormal or excessive angiogenesis, Some embodiments, homology, sequence identity or comple include, but are not limited to: cancer (e.g., activation of 15 mentarity, is about 90%, about 92%, about 94%, about 95%, oncogenes, loss of tumor Suppressors); infectious diseases about 96%, about 97%, about 98%, about 99% or about (e.g., pathogens express angiogenic genes, enhance angio 100%. genic programs); autoimmune disorders (e.g., activation of An antisense compound is specifically hybridizable when mast cells and otherleukocytes), including rheumatoid arthri binding of the compound to the target nucleic acid interferes tis; vascular malformations (e.g., Tie-2 mutation); DiGeorge with the normal function of the target nucleic acid to cause a syndrome (e.g., low VEGF and neuropilin-1 expression); loss of activity, and there is a Sufficient degree of complemen HHT (e.g., mutations of endoglin or LK-1), cavernous tarity to avoid non-specific binding of the antisense com hemangioma (e.g., loss of CX37 and CX40); atherosclerosis: pound to non-target nucleic acid sequences under conditions transplantateriopathy, obesity (e.g., angiogenesis induced by in which specific binding is desired. Such conditions include, fatty diet, weight loss by angiogenesis inhibitors); psoriasis; 25 i.e., physiological conditions in the case of in vivo assays or warts; allergic dermatitis; scar keloids; pyogenic granulomas; therapeutic treatment, and conditions in which assays are blistering disease; Kaposi sarcoma in AIDS patients; persis performed in the case of in vitro assays. tent hyperplastic vitreous syndrome (e.g., loss of Ang-2 or An antisense compound, whether DNA, RNA, chimeric, VEGF164); Autosomal dominant polycystic kidney disease substituted etc., is specifically hybridizable when binding of (ADPKD); diabetic retinopathy; retinopathy of prematurity; 30 the compound to the target DNA or RNA molecule interferes age related macular degeneration; choroidal neovasculariza with the normal function of the target DNA or RNA to cause tion (e.g., TIMP-3 mutation); primary pulmonary hyperten a loss of utility, and there is a sufficient degree of comple sion (e.g., germline BMPR-2 mutation, Somatic EC muta mentarily to avoid non-specific binding of the antisense com tion); asthma, nasal polyps; inflammatory bowel disease; pound to non-target sequences under conditions in which nerve injury, brain injury and Neurodegenerative disorders 35 specific binding is desired, i.e., under physiological condi (e.g. Alzheimer's disease, Parkinson's disease, amyotrophic tions in the case of in vivo assays ortherapeutic treatment, and lateral Sclerosis etc.); periodontal disease; ascites; peritoneal in the case of in vitro assays, under conditions in which the adhesions; endometriosis; uterine bleeding; ovarian cysts; assays are performed. ovarian hyperstimulation; arthritis; synovitis; osteomyelitis; In another preferred embodiment, targeting of VEGF and/or osteophyte formation; ulceration; Verruca Vulgaris; 40 including without limitation, antisense sequences which are angiofibroma of tuberous Sclerosis; pot-wine stains; Sturge identified and expanded, using for example, PCR, hybridiza Weber syndrome; Kippel-Trenaunay-Weber syndrome: tion etc., one or more of the sequences set forth as SEQ ID Osler-Weber-Rendu syndrome and any other diseases or con NO. 2, and the like, modulate the expression or function of ditions that are related to the levels of VEGF-R in a cell or VEGF. In one embodiment, expression or function is up tissue. 45 regulated as compared to a control. In another preferred In a preferred embodiment, the oligonucleotides are spe embodiment, expression or function is down-regulated as cific for polynucleotides of VEGF, which includes, without compared to a control. limitation noncoding regions. The VEGF targets comprise In another preferred embodiment, oligonucleotides com variants of VEGF; mutants of VEGF, including SNPs; non prise nucleic acid sequences set forth as SEQID NOS: 4 to 9 coding sequences of VEGF; alleles, fragments and the like. 50 including antisense sequences which are identified, and Preferably the oligonucleotide is an antisense RNA molecule. expanded, using for example, PCR, hybridization etc. These In accordance with embodiments of the invention, the tar oligonucleotides can comprise one or more modified nucle get nucleic acid molecule is not limited to VEGF polynucle otides, shorter or longer fragments, modified bonds and the otides alone but extends to any of the isoforms, receptors, like. Examples of modified bonds or internucleotide linkages homologs, non-coding regions and the like of VEGF. 55 comprise phosphorothioate, phosphorodithioate or the like. In another preferred embodiment, an oligonucleotide tar In another preferred embodiment, the nucleotides comprise a gets a natural antisense sequence (natural antisense to the phosphorus derivative. The phosphorus derivative (or modi coding and non-coding regions) of VEGF targets, including, fied phosphate group) which may be attached to the Sugar or without limitation, variants, alleles, homologs, mutants, Sugar analog moiety in the modified oligonucleotides of the derivatives, fragments and complementary sequences 60 present invention may be a monophosphate, diphosphate, thereto. Preferably the oligonucleotide is an antisense RNA triphosphate, alkylphosphate, alkanephosphate, phospho or DNA molecule. rothioate and the like. The preparation of the above-noted In another preferred embodiment, the oligomeric com phosphate analogs, and their incorporation into nucleotides, pounds of the present invention also include variants in which modified nucleotides and oligonucleotides, per se, is also a different base is present at one or more of the nucleotide 65 known and need not be described here. positions in the compound. For example, if the first nucleotide The specificity and sensitivity of antisense is also har is an adenine, variants may be produced which contain thy nessed by those of skill in the art for therapeutic uses. Anti US 9,410,155 B2 13 14 sense oligonucleotides have been employed as therapeutic of Vascular Endothelial Growth Factor (VEGF) modulate moieties in the treatment of disease states in animals and man. expression and/or function of Vascular Endothelial Growth Antisense oligonucleotides have been safely and effectively Factor (VEGF). administered to humans and numerous clinical trials are pres In another preferred embodiment, oligonucleotide com ently underway. It is thus established that oligonucleotides 5 pounds comprise sequences set forth as SEQID NOS: 4 to 9, can be useful therapeutic modalities that can be configured to antisense sequences which are identified and expanded, using be useful in treatment regimes for treatment of cells, tissues for example, PCR, hybridization etc. These oligonucleotides and animals, especially humans. can comprise one or more modified nucleotides, shorter or In embodiments of the present invention oligomeric anti longer fragments, modified bonds and the like. Examples of sense compounds, particularly oligonucleotides, bind to tar 10 get nucleic acid molecules and modulate the expression and/ modified bonds or internucleotide linkages comprise phos or function of molecules encoded by a target gene. The phorothioate, phosphorodithioate or the like. In another pre functions of DNA to be interfered comprise, for example, ferred embodiment, the nucleotides comprise a phosphorus replication and transcription. The functions of RNA to be derivative. The phosphorus derivative (or modified phosphate interfered comprise all vital functions such as, for example, 15 group) which may be attached to the Sugar or Sugar analog translocation of the RNA to the site of protein translation, moiety in the modified oligonucleotides of the present inven translation of protein from the RNA, splicing of the RNA to tion may be a monophosphate, diphosphate, triphosphate, yield one or more mRNA species, and catalytic activity which alkylphosphate, alkanephosphate, phosphorothioate and the may be engaged in or facilitated by the RNA. The functions like. The preparation of the above-noted phosphate analogs, may be up-regulated or inhibited depending on the functions and their incorporation into nucleotides, modified nucle desired. otides and oligonucleotides, per se, is also known and need The antisense compounds include antisense oligomeric not be described here. compounds, antisense oligonucleotides, external guide Since, as is known in the art, the translation initiation codon sequence (EGS) oligonucleotides, alternate splicers, primers, is typically 5'-AUG (in transcribed mRNA molecules: probes, and other oligomeric compounds that hybridize to at 25 5'-ATG in the corresponding DNA molecule), the translation least a portion of the target nucleic acid. As such, these com initiation codon is also referred to as the AUG codon, the pounds may be introduced in the form of single-stranded, “start codon’ or the AUG start codon’. A minority of genes double-stranded, partially single-stranded, or circular oligo has a translation initiation codon having the RNA sequence meric compounds. 5'-GUG, 5'-UUG or 5'-CUG; and 5'-AUA, 5'-ACG and Targeting an antisense compound to a particular nucleic 30 5'-CUG have been shown to function in vivo. Thus, the terms acid molecule, in the context of this invention, can be a “translation initiation codon’ and “start codon’ can encom multistep process. The process usually begins with the iden pass many codon sequences, even though the initiator amino tification of a target nucleic acid whose function is to be acid in each instance is typically methionine (in eukaryotes) modulated. This target nucleic acid may be, for example, a or formylmethionine (in prokaryotes). Eukaryotic and cellular gene (or mRNA transcribed from the gene) whose 35 prokaryotic genes may have two or more alternative start expression is associated with a particular disorder or disease codons, any one of which may be preferentially utilized for state, or a nucleic acid molecule from an infectious agent. In translation initiation in a particular cell type or tissue, or the present invention, the target nucleic acid encodes Vascular under a particular set of conditions. In the context of the Endothelial Growth Factor (VEGF). invention, “start codon’ and “translation initiation codon’ The targeting process usually also includes determination 40 refer to the codon or codons that are used in vivo to initiate of at least one target region, segment, or site within the target translation of an mRNA transcribed from a gene encoding nucleic acid for the antisense interaction to occur Such that the Vascular Endothelial Growth Factor (VEGF), regardless of desired effect, e.g., modulation of expression, will result. the sequence(s) of Such codons. A translation termination Within the context of the present invention, the term “region' codon (or 'stop codon) of a gene may have one of three is defined as a portion of the target nucleic acid having at least 45 sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corre one identifiable structure, function, or characteristic. Within sponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA, regions of target nucleic acids are segments. "Segments' are respectively). defined as Smaller or sub-portions of regions within a target The terms “start codon region' and “translation initiation nucleic acid. “Sites, as used in the present invention, are codon region” refer to a portion of such an mRNA or gene that defined as positions within a target nucleic acid. 50 encompasses from about 25 to about 50 contiguous nucle In a preferred embodiment, the antisense oligonucleotides otides in either direction (i.e., 5' or 3') from a translation bind to the natural antisense sequences of Vascular Endothe initiation codon. Similarly, the terms "stop codon region' and lial Growth Factor (VEGF) and modulate the expression and/ “translation termination codon region” refer to a portion of or function of Vascular Endothelial Growth Factor (VEGF) Such an mRNA or gene that encompasses from about 25 to (SEQ ID NO: 1). Examples of antisense sequences include 55 about 50 contiguous nucleotides in either direction (i.e., 5' or SEQID NOS: 2 to 9. 3') from a translation termination codon. Consequently, the In another preferred embodiment, the antisense oligo “start codon region’ (or “translation initiation codon region') nucleotides bind to one or more segments of Vascular Endot and the 'stop codon region’ (or “translation termination helial Growth Factor (VEGF) polynucleotides and modulate codon region') are all regions that may be targeted effectively the expression and/or function of Vascular Endothelial 60 with the antisense compounds of the present invention. Growth Factor (VEGF). The segments comprise at least five The open reading frame (ORF) or “coding region.” which consecutive nucleotides of the Vascular Endothelial Growth is known in the art to refer to the region between the transla Factor (VEGF) sense or antisense polynucleotides. tion initiation codon and the translation termination codon, is In another preferred embodiment, the antisense oligo also a region which may be targeted effectively. Within the nucleotides are specific for natural antisense sequences of 65 context of the present invention, a targeted region is the Vascular Endothelial Growth Factor (VEGF) wherein bind intragenic region encompassing the translation initiation or ing of the oligonucleotides to the natural antisense sequences termination codon of the open reading frame (ORF) of a gene. US 9,410,155 B2 15 16 Another target region includes the 5' untranslated region that pre-mRNA or mRNA. One specific type of alternative (5' UTR), known in the art to refer to the portion of an mRNA stop variant is the “polyA variant' in which the multiple in the 5' direction from the translation initiation codon, and transcripts produced result from the alternative selection of thus including nucleotides between the 5' cap site and the one of the “polyA stop signals' by the transcription machin translation initiation codon of an mRNA (or corresponding ery, thereby producing transcripts that terminate at unique nucleotides on the gene). Still another target region includes polyA sites. Within the context of the invention, the types of the 3' untranslated region (3'UTR), known in the art to refer to variants described herein are also embodiments of target the portion of an mRNA in the 3' direction from the transla nucleic acids. tion termination codon, and thus including nucleotides The locations on the target nucleic acid to which the anti between the translation termination codon and 3' end of an 10 sense compounds hybridize are defined as at least a 5-nucle mRNA (or corresponding nucleotides on the gene). The 5' cap otide long portion of a target region to which an active anti site of an mRNA comprises an N7-methylated guanosine sense compound is targeted. residue joined to the 5'-most residue of the mRNA via a 5'-5' While the specific sequences of certain exemplary target triphosphate linkage. The 5' cap region of an mRNA is con segments are set forth herein, one of skill in the art will sidered to include the 5' cap structure itself as well as the first 15 recognize that these serve to illustrate and describe particular 50 nucleotides adjacent to the cap site. Another target region embodiments within the scope of the present invention. Addi for this invention is the 5' cap region. tional target segments are readily identifiable by one having Although some eukaryotic mRNA transcripts are directly ordinary skill in the art in view of this disclosure. translated, many contain one or more regions, known as Target segments 5-100 nucleotides in length comprising a “introns, which are excised from a transcript before it is stretch of at least five (5) consecutive nucleotides selected translated. The remaining (and therefore translated) regions from within the illustrative preferred target segments are con are known as “exons' and are spliced together to form a sidered to be suitable for targeting as well. continuous mRNA sequence. In one embodiment, targeting Target segments can include DNA or RNA sequences that splice sites, i.e., intron-exon junctions or exon-intron junc comprise at least the 5 consecutive nucleotides from the tions, is particularly useful in situations where aberrant splic 25 5'-terminus of one of the illustrative preferred target segments ing is implicated in disease, or where an overproduction of a (the remaining nucleotides being a consecutive stretch of the particular splice product is implicated in disease. Anaberrant same DNA or RNA beginning immediately upstream of the fusion junction due to rearrangement or deletion is another 5'-terminus of the target segment and continuing until the embodiment of a target site. mRNA transcripts produced via DNA or RNA contains about 5 to about 100 nucleotides). the process of splicing of two (or more) mRNAs from differ 30 Similarly preferred target segments are represented by DNA ent gene Sources are known as “fusion transcripts”. Introns or RNA sequences that comprise at least the 5 consecutive can be effectively targeted using antisense compounds tar nucleotides from the 3'-terminus of one of the illustrative geted to, for example, DNA or pre-mRNA. preferred target segments (the remaining nucleotides being a In another preferred embodiment, the antisense oligo consecutive stretch of the same DNA or RNA beginning nucleotides bind to coding and/or non-coding regions of a 35 immediately downstream of the 3'-terminus of the target seg target polynucleotide and modulate the expression and/or ment and continuing until the DNA or RNA contains about 5 function of the target molecule. to about 100 nucleotides). One having skill in the art armed In another preferred embodiment, the antisense oligo with the target segments illustrated herein will be able, with nucleotides bind to natural antisense polynucleotides and out undue experimentation, to identify further preferred tar modulate the expression and/or function of the target mol 40 get Segments. ecule. Once one or more target regions, segments or sites have In another preferred embodiment, the antisense oligo been identified, antisense compounds are chosen which are nucleotides bind to sense polynucleotides and modulate the Sufficiently complementary to the target, i.e., hybridize Suf expression and/or function of the target molecule. ficiently well and with sufficient specificity, to give the Alternative RNA transcripts can be produced from the 45 desired effect. same genomic region of DNA. These alternative transcripts In embodiments of the invention the oligonucleotides bind are generally known as “variants. More specifically, “pre to an antisense Strand of a particular target. The oligonucle mRNA variants’ are transcripts produced from the same otides are at least 5 nucleotides in length and can be synthe genomic DNA that differ from other transcripts produced sized so each oligonucleotide targets overlapping sequences from the same genomic DNA in either their start or stop 50 Such that oligonucleotides are synthesized to cover the entire position and contain both intronic and exonic sequence. length of the target polynucleotide. The targets also include Upon excision alone or more exon or intron regions, or coding as well as non coding regions. portions thereofduring splicing, pre-mRNA variants produce In one embodiment, it is preferred to target specific nucleic smaller “mRNA variants”. Consequently, mRNA variants are acids by antisense oligonucleotides. Targeting an antisense processed pre-mRNA variants and each unique pre-mRNA 55 compound to a particular nucleic acid, is a multistep process. variant must always produce a unique mRNA variant as a The process usually begins with the identification of a nucleic result of splicing. These mRNA variants are also known as acid sequence whose function is to be modulated. This may “alternative splice variants”. If no splicing of the pre-mRNA be, for example, a cellular gene (or mRNA transcribed from variant occurs then the pre-mRNA variant is identical to the the gene) whose expression is associated with a particular mRNA variant. 60 disorder or disease state, or a non coding polynucleotide Such Variants can be produced through the use of alternative as for example, non coding RNA (ncRNA). signals to start or stop transcription. Pre-mRNAs and mRNAs RNAs can be classified into (1) messenger RNAs (mR can possess more than one start codon or stop codon. Variants NAS), which are translated into proteins, and (2) non-protein that originate from a pre-mRNA or mRNA that use alternative coding RNAs (ncRNAs). ncRNAs comprise microRNAs, start codons are known as “alternative start variants' of that 65 antisense transcripts and other Transcriptional Units (TU) pre-mRNA or mRNA. Those transcripts that use an alterna containing a high density of stop codons and lacking any tive stop codon are known as “alternative stop variants' of extensive “Open Reading Frame'. Many ncRNAs appear to US 9,410,155 B2 17 18 start from initiation sites in 3' untranslated regions (3'UTRs) Antisense compounds are routinely prepared linearly but can of protein-coding loci.ncRNAs are often rare and at least half be joined or otherwise prepared to be circular and/or of the nckNAs that have been sequenced by the FANTOM branched. Antisense compounds can include constructs Such consortium seem not to be polyadenylated. Most researchers as, for example, two strands hybridized to form a wholly or have for obvious reasons focused on polyadenylated mRNAs partially double-stranded compound or a single strand with that are processed and exported to the cytoplasm. Recently, it sufficient self-complementarity to allow for hybridization was shown that the set of non-polyadenylated nuclear RNAs and formation of a fully or partially double-stranded com may be very large, and that many Such transcripts arise from pound. The two strands can be linked internally leaving free 3' so-called intergenic regions (Cheng, J. et al. (2005) Science or 5' termini or can be linked to form a continuous hairpin 308 (5725), 1149-1154; Kapranov, P. et al. (2005), Genome 10 structure or loop. The hairpin structure may contain an over Res 15 (7),987-997). The mechanism by which incRNAs may hang on either the 5' or 3' terminus producing an extension of regulate gene expression is by base pairing with target tran single Stranded character. The double stranded compounds scripts. The RNAs that function by base pairing can be optionally can include overhangs on the ends. Further modi grouped into (1) cis encoded RNAs that are encoded at the fications can include conjugate groups attached to one of the same genetic location, but on the opposite strand to the RNAS 15 termini, selected nucleotide positions, Sugar positions or to the act upon and therefore display perfect complementarity to one of the internucleoside linkages. Alternatively, the two their target, and (2) trans-encoded RNAs that are encoded at Strands can be linked via a non-nucleic acid moiety or linker a chromosomal location distinct from the RNAs they act upon group. When formed from only one strand, dsRNA can take and generally do not exhibit perfect base-pairing potential the form of a self-complementary hairpin-type molecule that with their targets. doubles back on itself to forma duplex. Thus, the dsRNAs can Without wishing to be bound by theory, perturbation of an be fully or partially double stranded. Specific modulation of antisense polynucleotide by the antisense oligonucleotides gene expression can be achieved by stable expression of described herein can alter the expression of the corresponding dsRNA hairpins in transgenic cell lines, however, in some sense messenger RNAS. However, this regulation can either embodiments, the gene expression or function is up regulated. be discordant (antisense knockdown results in messenger 25 When formed from two strands, or a single strand that takes RNA elevation) or concordant (antisense knockdown results the form of a self-complementary hairpin-type molecule in concomitant messenger RNA reduction). In these eases, doubled back on itself to form a duplex, the two strands (or antisense oligonucleotides can be targeted to overlapping or duplex-forming regions of a single strand) are complemen non-overlapping parts of the antisense transcript resulting in tary RNA strands that base pair in Watson-Crick fashion. its knockdown or sequestration. Coding as well as non-cod 30 Once introduced to a system, the compounds of the inven ing antisense can be targeted in an identical manner and that tion may elicit the action of one or more enzymes or structural either category is capable of regulating the corresponding proteins to effect cleavage or other modification of the target sense transcripts—either in a concordant or disconcordant nucleic acid or may work via occupancy-based mechanisms. manner. The strategies that are employed in identifying new In general, nucleic acids (including oligonucleotides) may be oligonucleotides for use against a target can be based on the 35 described as “DNA-like' (i.e., generally having one or more knockdown of antisense RNA transcripts by antisense oligo 2'-deoxy Sugars and, generally, T rather than U bases) or nucleotides or any other means of modulating the desired “RNA-like' (i.e., generally having one or more 2'-hydroxyl or target. 2-modified Sugars and, generally U rather than T bases). Strategy 1: In the case of discordant regulation, knocking Nucleic acid helices can adopt more than one type of struc down the antisense transcript elevates the expression of the 40 ture, most commonly the A- and B-forms. It is believed that, conventional (sense) gene. Should that latter gene encode for in general, oligonucleotides which have B-form-like struc a known or putative drug target, then knockdown of its anti ture are “DNA-like' and those which have A-formlike struc sense counterpart could conceivably mimic the action of a ture are “RNA-like.” In some (chimeric) embodiments, an receptor agonist or an enzyme stimulant. antisense compound may contain both A- and B-form Strategy 2: In the case of concordant regulation, one could 45 regions. concomitantly knock down both antisense and sense tran In another preferred embodiment, the desired oligonucle Scripts and thereby achieve Synergistic reduction of the con otides or antisense compounds, comprise at least one of ventional (sense) gene expression. If, for example, an anti antisense RNA, antisense DNA, chimeric antisense oligo sense oligonucleotide is used to achieve knockdown, then this nucleotides, antisense oligonucleotides comprising modified strategy can be used to apply one antisense oligonucleotide 50 linkages, interference RNA (RNAi), short interfering RNA targeted to the sense transcript and another antisense oligo (siRNA); a micro, interfering RNA (miRNA); a small, tem nucleotide to the corresponding antisense transcript, or a poral RNA (stRNA); or a short, hairpin RNA (shRNA); small single energetically symmetric antisense oligonucleotide that RNA-induced gene activation (RNAa); small activating simultaneously targets overlapping sense and antisense tran RNAs (saRNAs), or combinations thereof. Scripts. 55 dsRNA can also activate gene expression, a mechanism According to the present invention, antisense compounds that has been termed “small RNA-induced gene activation” or include antisense oligonucleotides, ribozymes, external RNAa. dsRNAS targeting gene promoters induce potent tran guide sequence (EGS) oligonucleotides, siRNA compounds, Scriptional activation of associated genes. RNAa was demon single- or double-stranded RNA interference (RNAi) com strated in human cells using synthetic dsRNAs, termed “small pounds such as siRNA compounds, and other oligomeric 60 activating RNAs (saRNAs). It is currently not known compounds which hybridize to at least a portion of the target whether RNAa is conserved in other organisms. nucleic acid and modulate its function. As such, they may be Small double-stranded RNA (dsRNA), such as small inter DNA, RNA, DNA-like, RNA-like, or mixtures thereof, or fering RNA (siRNA) and microRNA (miRNA), have been may be mimetics of one or more of these. These compounds found to be the trigger of an evolutionary conserved mecha may be single-stranded, doublestranded, circular or hairpin 65 nism known as RNA interference (RNAi). RNAi invariably oligomeric compounds and may contain structural elements leads to gene silencing via remodeling chromatin to thereby Such as internal or terminal bulges, mismatches or loops. Suppress transcription, degrading complementary mRNA, or US 9,410,155 B2 19 20 blocking protein translation. However, in instances described gering enzymatic degradation of the target (Tijsterman et al., in detail in the examples section which follows, oligonucle (2002) Science, 295, 694-697). otides are shown to increase the expression and/or function of In a preferred embodiment, an antisense oligonucleotide the Vascular Endothelial Growth Factor (VEGF) polynucle targets Vascular Endothelial Growth Factor (VEGF) poly otides and encoded products thereof dsRNAs may also act as nucleotides (e.g. accession number NM 001025366.1), vari small activating RNAs (saRNA). Without wishing to be ants, alleles, isoforms, homologs, mutants, derivatives, frag bound by theory, by targeting sequences in gene promoters, ments and complementary sequences thereto. Preferably the saRNAS would induce target gene expression in a phenom oligonucleotide is an antisense molecule. enon referred to as dsRNA-induced transcriptional activation In accordance with embodiments of the invention, the tar (RNAa). 10 get nucleic acid molecule is not limited to Vascular Endothe In a further embodiment, the “preferred target segments’ lial Growth Factor (VEGF) alone but extends to any of the identified herein may be employed in a screen for additional isoforms, receptors, homologs and the like of Vascular Endot compounds that modulate the expression of Vascular Endot helial Growth Factor (VEGF) molecules. helial Growth Factor (VEGF) polynucleotides. “Modulators” In another preferred embodiment, an oligonucleotide tar are those compounds that decrease or increase the expression 15 gets a natural antisense sequence of VEGF polynucleotides, of a nucleic acid molecule encoding Vascular Endothelial for example, polynucleotides set forth as SEQID NOS: 2 and Growth Factor (VEGF) and which comprise at least a 3, and any variants, alleles, homologs, mutants, derivatives, 5-nucleotide portion that is complementary to a preferred fragments and complementary sequences thereto. Examples target segment. The screening method comprises the steps of of antisense oligonucleotides are set forth as SEQID NOS: 4 contacting a preferred target segment of a nucleic acid mol to 9. ecule encoding sense or natural antisense polynucleotides of In one embodiment, the oligonucleotides are complemen Vascular Endothelial Growth Factor (VEGF) with one or tary to or bind to nucleic acid sequences of Vascular Endot more candidate modulators, and selecting for one or more helial Growth Factor (VEGF) antisense, including without candidate modulators which decrease or increase the expres limitation noncoding sense and/or antisense sequences asso sion of a nucleic acid molecule encoding Vascular Endothe 25 ciated with Vascular Endothelial Growth Factor (VEGF) lial Growth Factor (VEGF) polynucleotides, e.g. SEQ ID polynucleotides and modulate expression and/or function of NOS: 4 to 9 Once it is shown that the candidate modulator or Vascular Endothelial Growth Factor (VEGF) molecules. modulators are capable of modulating (e.g. either decreasing In another preferred embodiment, the oligonucleotides are or increasing) the expression of a nucleic acid molecule complementary to orbind to nucleic acid sequences of VEGF encoding Vascular Endothelial Growth Factor (VEGF) poly 30 natural antisense, set forth as SEQ ID NOS: 2 and 3, and nucleotides, the modulator may then be employed in further modulate expression and/or function of VEGF molecules. investigative studies of the function of Vascular Endothelial In a preferred embodiment, oligonucleotides comprise Growth Factor (VEGF) polynucleotides, or for use as a sequences of at least 5 consecutive nucleotides of SEQ ID research, diagnostic, or therapeutic agent in accordance with NOS: 4 to 9 and modulate expression and/or function of the present invention. 35 Vascular Endothelial Growth Factor (VEGF) molecules. Targeting the natural antisense sequence preferably modu The polynucleotide targets comprise VEGF, including lates the function of the target gene. For example, the VEGF family members thereof, variants of VEGF; mutants of gene (NM_001025366.1, FIG. 2). In a preferred embodi VEGF, including SNPs; noncoding sequences of VEGF; alle ment, the target is an antisense polynucleotide of the Vascular les of VEGF; species variants, fragments and the like. Pref Endothelial Growth Factor A gene. In a preferred embodi 40 erably the oligonucleotide is an antisense molecule. ment, an antisense oligonucleotide targets sense and/or natu In another preferred embodiment, the oligonucleotide tar ral antisense sequences of Vascular Endothelial Growth Fac geting Vascular Endothelial Growth Factor (VEGF) poly tor (VEGF) polynucleotides (e.g. accession number nucleotides, comprise: antisense RNA, interference RNA (NM_001025366.1, FIG. 2), variants, alleles, isoforms, (RNAi), short interfering RNA (siRNA); micro interfering homologs, mutants, derivatives, fragments and complemen 45 RNA (miRNA); a small, temporal RNA (stRNA); or a short, tary sequences thereto. Preferably the oligonucleotide is an hairpin RNA (shRNA); small RNA-induced gene activation antisense molecule and the targets include coding and non (RNAa); or, small activating RNA (saRNA). coding regions of antisense and/or sense VEGF polynucle In another preferred embodiment, targeting of Vascular otides. Endothelial Growth Factor (VEGF) polynucleotides, e.g. The preferred target segments of the present invention may 50 SEQID NOS: 2 and 3, modulates the expression or function be also be combined with their respective complementary of these targets. In one embodiment, expression or function is antisense compounds of the present invention to form stabi up-regulated as compared to a control. In another preferred lized double-stranded (duplexed) oligonucleotides. embodiment, expression or function is down-regulated as Such double stranded oligonucleotide moieties have been compared to a control. shown in the art to modulate target expression and regulate 55 In another preferred embodiment, antisense compounds translation as well as RNA processing via an antisense comprise sequences set forth as SEQID NOS: 4 to 9. These mechanism. Moreover, the double-stranded moieties may be oligonucleotides can comprise one or more modified nucle subject to chemical modifications (Fire et al., (1998) Nature, otides, shorter or longer fragments, modified bonds and the 391, 806-811; Timmons and Fire, (1998) Nature, 395, 854; like. Timmons et al., (2001) Gene, 263, 103-112: Tabara et al., 60 In another preferred embodiment, SEQ ID NOS: 4 to 9 (1998) Science, 282, 430-431; Montgomery et al., (1998) comprise one or more LNA nucleotides. Proc. Natl. Acad. Sci. USA, 95, 15502-15507; Tuschl et al., The modulation of a desired target nucleic acid can be (1999) Genes Dev., 13, 3191-3197; Elbashir et al., (2001) carried out in several ways known in the art. For example, Nature, 411,494-498: Elbashir et al., (2011) Genes Dev 15, antisense oligonucleotides, siRNA etc. Enzymatic nucleic 188-200). For example, such double-stranded moieties have 65 acid molecules (e.g., ribozymes) are nucleic acid molecules been shown to inhibit the target by the classical hybridization capable of catalyzing one or more of a variety of reactions, of antisense Strand of the duplex to the target, thereby trig including the ability to repeatedly cleave other separate US 9,410,155 B2 21 22 nucleic acid molecules in a nucleotide base sequence-specific RNA catalyst was recovered and reacted with multiple RNA manner. Such enzymatic nucleic acid molecules can be used, molecules, demonstrating that it was truly catalytic. for example, to target virtually any RNA transcript (Zauget Catalytic RNAs designed based on the “hammerhead' al., 324, Nature 429 1986; Cech, 260JAMA 3030, 1988; and motif have been used to cleave specific target sequences by Jefferies et al., 17 Nucleic Acids Research 1371, 1989). 5 making appropriate base changes in the catalytic RNA to Because of their sequence-specificity, trans-cleaving enzy maintain necessary base pairing with the target sequences matic nucleic acid molecules show promise as therapeutic (Haseloff and Gerlach, (1988) Nature, 334, 585; Walbot and agents for human disease (Usman & McSwiggen, (1995) Bruening, (1988) Nature, 334, 196; Uhlenbeck, O.C. (1987) Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, Nature, 328:596-600; Koizumi, M., et al. (1988) FEBS Lett., (1995) J. Med. Chem. 38, 2023-2037). Enzymatic nucleic 10 228: 228-230). This has allowed use of the catalytic RNA to acid molecules can be designed to cleave specific RNA tar cleave specific target sequences and indicates that catalytic gets within the background of cellular RNA. Such a cleavage RNAs designed according to the “hammerhead model may event renders the mRNA non-functional and abrogates pro possibly cleave specific substrate RNAs in vivo. (see Haseloff tein expression from that RNA. In this manner, synthesis of a and Gerlach, (1988) Nature, 334, 585; Walbot and Bruening, protein associated with a disease state can be selectively 15 (1988) Nature, 334, 196; Uhlenbeck, O. C. (1987) Nature, inhibited. 328:596-600). In general, enzymatic nucleic acids with RNA cleaving RNA interference (RNAi) has become a powerful tool for activity act by first binding to a target RNA. Such binding modulating gene expression in mammals and mammalian occurs through the target binding portion of a enzymatic cells. This approach requires the delivery of small interfering nucleic acid which is held in close proximity to an enzymatic 20 RNA (siRNA) either as RNA itself or as DNA, using an portion of the molecule that acts to cleave the target RNA. expression plasmidor virus and the coding sequence for Small Thus, the enzymatic nucleic acid first recognizes and then hairpin RNAs that are processed to siRNAs. This system binds a target RNA through complementary base pairing, and enables efficient transport of the pre-siRNAs to the cytoplasm once bound to the correct site, acts enzymatically to cut the where they are active and permit the use of regulated and target RNA. Strategic cleavage of such a target RNA will 25 tissue specific promoters for gene expression. destroy its ability to direct synthesis of an encoded protein. In a preferred embodiment, an oligonucleotide orantisense After an enzymatic nucleic acid has bound and cleaved its compound comprises an oligomer or polymer of ribonucleic RNA target, it is released from that RNA to search for another acid (RNA) and/or deoxyribonucleic acid (DNA), or a target and can repeatedly bind and cleave new targets. mimetic, chimera, analog or homolog thereof. This term Several approaches Such as in vitro selection (evolution) 30 includes oligonucleotides composed of naturally occurring strategies (Orgel, (1979) Proc. R. Soc. London, B 205, 435) nucleotides, Sugars and covalent internucleoside (backbone) have been used to evolve new nucleic acid catalysts capable of linkages as well as oligonucleotides having non-naturally catalyzing a variety of reactions, such as cleavage and ligation occurring portions which function similarly. Such modified of phosphodiester linkages and amide linkages, (Joyce, or substituted oligonucleotides are often desired over native (1989) Gene, 82, 83-87; Beaudry et al., (1992) Science 257, 35 forms because of desirable properties such as, for example, 635-641; Joyce, (1992) Scientific American 267, 90-97: enhanced cellular uptake, enhanced affinity for a target Breaker et al., (1994) TIBTECH 12, 268; Bartel et al., (1993) nucleic acid and increased Stability in the presence of Science 261:141 1-1418; Szostak, (1993) TIBS 17, 89-93; nucleases. Kumaret al., (1995) FASEB.J. 9, 1183; Breaker, (1996) Curr: According to the present invention, the oligonucleotides or Op. Biotech., 7, 442). 40 'antisense compounds include antisense oligonucleotides The development of ribozymes that are optimal for cata (e.g. RNA, DNA, mimetic, chimera, analog or homolog lytic activity would contribute significantly to any strategy thereof), ribozymes, external guide sequence (EGS) oligo that employs RNA-cleaving ribozymes for the purpose of nucleotides, siRNA compounds, single- or double-stranded regulating gene expression. The hammerhead ribozyme, for RNA interference (RNAi) compounds such as siRNA com example, functions with a catalytic rate (kcat) of about 1 45 pounds, SaRNA, aRNA, and other oligomeric compounds min-1 in the presence of Saturating (10 mM) concentrations which hybridize to at least a portion of the target nucleic acid of Mg2+ cofactor. An artificial “RNA ligase' ribozyme has and modulate its function. As such, they may be DNA, RNA, been shown to catalyze the corresponding self-modification DNA-like, RNA-like, or mixtures thereof, or may be mimet reaction with a rate of about 100 min-1. In addition, it is ics of one of more of these. These compounds may be single known that certain modified hammerhead ribozymes that 50 Stranded, double-stranded, circular or hairpin oligomeric have substrate binding arms made of DNA catalyze RNA compounds and may contain structural elements such as cleavage with multiple turn-over rates that approach 100 min internal or terminal bulges, mismatches or loops. Antisense 1. Finally, replacement of a specific residue within the cata compounds are routinely prepared linearly but can be joined lytic core of the hammerhead with certain nucleotide ana or otherwise prepared to be circular and/or branched. Anti logues gives modified ribozymes that show as much as a 55 sense compounds can include constructs such as, for 10-fold improvement in catalytic rate. These findings dem example, two strands hybridized to form a wholly or partially onstrate that ribozymes can promote chemical transforma double-stranded compound or a single strand with Sufficient tions with catalytic rates that are significantly greater than self-complementarity to allow for hybridization and forma those displayed in vitro by most natural self-cleaving tion of a fully or partially double-stranded compound. The ribozymes. It is then possible that the structures of certain 60 two strands can be linked internally leaving free 3' or 5' selfcleaving ribozymes may be optimized to give maximal terminior can be linked to form a continuous hairpinstructure catalytic activity, or that entirely new RNA motifs can be or loop. The hairpin structure may contain an overhang on made that display significantly faster rates for RNA phos either the 5' or 3' terminus producing an extension of single phodiester cleavage. Stranded character. The double stranded compounds option Intermolecular cleavage of an RNA substrate by an RNA 65 ally can include overhangs on the ends. Further modifications catalyst that fits the “hammerhead model was first shown in can include conjugate groups attached to one of the termini, 1987 (Uhlenbeck, O. C. (1987) Nature, 328: 596-600). The selected nucleotide positions, Sugar positions or to one of the US 9,410,155 B2 23 24 internucleoside linkages. Alternatively, the two strands can be a different base is present at one or more of the nucleotide linked via a non-nucleic acid moiety or linker group. When positions in the compound. For example, if the first nucleotide formed from only one strand, dsRNA can take the form of a is an adenosine, variants may be produced which contain self-complementary hairpin-type molecule that doubles back thymidine, guanosine or cytidine at this position. This may be on itself to form a duplex. Thus, the dsRNAs can be fully or done at any of the positions of the antisense or dsRNA com partially double stranded. Specific modulation of gene pounds. These compounds are then tested using the methods expression can be achieved by stable expression of dsRNA described herein to determine their ability to inhibit expres hairpins in transgenic cell lines (Hammond et al., (1991) Nat. sion of a target nucleic acid. Rev. Genet., 2, 110-119; Matzke et al., (2001) Curr. Opin. In some embodiments, homology, sequence identity or Genet. Dev., 11, 221-227; Sharp. (2001) Genes Dev., 15, 10 complementarity, between the antisense compound and tar 485-490). When formed from two strands, or a single strand get is from about 40% to about 60%. In some embodiments, that takes the form of a self-complementary hairpin-type homology, sequence identity or complementarity, is from molecule doubled back on itself to form a duplex, the two about 60% to about 70%. In some embodiments, homology, Strands (or duplex-forming regions of a single strand) are sequence identity or complementarity, is from about 70% to complementary RNA strands that base pair in Watson-Crick 15 about 80%. In some embodiments, homology, sequence iden fashion. tity or complementarity, is from about 80% to about 90%. In Once introduced to a system, the compounds of the inven Some embodiments, homology, sequence identity or comple tion may elicit the action of one or more enzymes or structural mentarity, is about 90%, about 92%, about 94%, about 95%, proteins to effect cleavage or other modification of the target about 96%, about 97%, about 98%, about 99% or about nucleic acid or may work via occupancy-based mechanisms. 100%. In general, nucleic acids (including oligonucleotides) may be In another preferred embodiment, the antisense oligo described as “DNA-like' (i.e., generally having one or more nucleotides, such as for example, nucleic acid molecules set 2'-deoxy Sugars and, generally, T rather than U bases) or forth in SEQID NOS: 4 to 9 comprise one or more substitu “RNA-like' (i.e., generally having one or more 2'-hydroxyl or tions or modifications. In one embodiment, the nucleotides 2-modified Sugars and, generally U rather than T bases). 25 are substituted with locked nucleic acids (LNA). Nucleic acid helices can adopt more than one type of struc In another preferred embodiment, the oligonucleotides tar ture, most commonly the A- and B-forms. It is believed that, get one or more regions of the nucleic acid molecules sense in general, oligonucleotides which have B-form-like struc and/or antisense of coding and/or non-coding sequences ture are “DNA-like' and those which have A-formlike struc associated with VEGF and the sequences set forth as SEQID ture are “RNA-like.” In some (chimeric) embodiments, an 30 NOS: 1 to 3. The oligonucleotides are also targeted to over antisense compound may contain both A- and B-form lapping regions of SEQID NOS: 1 to 3. regions. Certain preferred oligonucleotides of this invention are The antisense compounds in accordance with this inven chimeric oligonucleotides. “Chimeric oligonucleotides” or tion can comprise an antisense portion from about 5 to about "chimeras, in the context of this invention, are oligonucle 80 nucleotides (i.e. from about 5 to about 80 linked nucleo 35 otides which contain two or more chemically distinct regions, sides) in length. This refers to the length of the antisense each made up of at least one nucleotide. These oligonucle Strand or portion of the antisense compound. In other words, otides typically contain at least one region of modified nucle a single-stranded antisense compound of the invention com otides that confers one or more beneficial properties (such as, prises from 5 to about 80 nucleotides, and a double-stranded for example, increased nuclease resistance, increased uptake antisense compound of the invention (such as a dsRNA, for 40 into cells, increased binding affinity for the target) and a example) comprises a sense and an antisense Strandorportion region that is a Substrate for enzymes capable of cleaving of 5 to about 80 nucleotides in length. One of ordinary skill in RNA:DNA or RNA:RNA hybrids. By way of example, the art will appreciate that this comprehends antisense por RNase H is a cellular endonuclease which cleaves the RNA tions of 5, 6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, strandofan RNA:DNA duplex. Activation of RNase H, there 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37, 45 fore, results in cleavage of the RNA target, thereby greatly 38,39, 40, 41,42, 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, enhancing the efficiency of antisense modulation of gene 55,56, 57,58, 59, 60, 61, 62,63, 64, 65, 66, 67,68, 69,70, 71, expression. Consequently, comparable results can often be 72.73, 74, 75,76,79, or 80 nucleotides in length, or any range obtained with shorter oligonucleotides when chimeric oligo therewithin. nucleotides are used, compared to phosphorothioate deoxyo In one embodiment, the antisense compounds of the inven 50 ligonucleotides hybridizing to the same target region. Cleav tion have antisense portions of 10 to 50 nucleotides in length. age of the RNA target can be routinely detected by gel One having ordinary skill in the art will appreciate that this electrophoresis and, if necessary, associated nucleic acid embodies oligonucleotides having antisense portions of 10, hybridization techniques known in the art. In one preferred 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, embodiment, a chimeric oligonucleotide comprises at least 28, 29, 30, 31, 32,33, 34,35,36, 37,38, 39, 40, 41,42, 43,44, 55 one region modified to increase target binding affinity, and, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range usually, a region that acts as a substrate for RNAse H. Affinity therewithin. In some embodiments, the oligonucleotides are of an oligonucleotide for its target (in this case, a nucleic acid 15 nucleotides in length. encoding ras) is routinely determined by measuring the Tm of In one embodiment, the antisense or oligonucleotide com an oligonucleotide/target pair, which is the temperature at pounds of the invention have antisense portions of 12 or 13 to 60 which the oligonucleotide and target dissociate; dissociation 30 nucleotides in length. One having ordinary skill in the art is detected spectrophotometrically. The higher the Tm, the will appreciate that this embodies antisense compounds hav greater is the affinity of the oligonucleotide for the target. ing antisense portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, Chimeric antisense compounds of the invention may be 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, or formed as composite structures of two or more oligonucle any range therewithin. 65 otides, modified oligonucleotides, oligonucleosides and/or In another preferred embodiment, the oligomeric com oligonucleotides mimetics as described above. Such; com pounds of the present invention also include variants in which pounds have also been referred to in the art as hybrids or US 9,410,155 B2 25 26 gapmers. Representative United States patents that teach the polyamide backbone (Nielsen et al. (1991) Science 254, preparation of Such hybrid structures comprise, but are not 1497). Oligonucleotides may also comprise one or more sub limited to, U.S. Pat. Nos. 5,013,830; 5,149,797: 5,220,007: stituted Sugar moieties. Preferred oligonucleotides comprise 5,256,775; 5,366,878; 5.403,711; 5,491,133: 5,565,350; one of the following at the 2' position: OH, SH, SCH3, F, 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of 5 OCN, OCH3OCH3, OCH3O(CH2)nCH3, O(CH2)nNH2 or which is herein incorporated by reference. O(CH2)nCH3 where n is from 1 to about 10; C1 to C10 lower In another preferred embodiment, the region of the oligo alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or nucleotide which is modified comprises at least one nucle aralkyl: Cl; Br: CN; CF3; OCF3; O – S , or N-alkyl: O , otide modified at the 2' position of the sugar, most preferably S , or N-alkenyl; SOCH3; SO2CH3; ONO2: NO2: N3; a 2'-Oalkyl. 2'-O-alkyl-O-alkyl or 2'-fluoro-modified nucle 10 NH2: heterocycloalkyl; heterocycloalkaryl; aminoalky otide. In other preferred embodiments, RNA modifications lamino: polyalkylamino; Substituted silyl; an RNA cleaving include 2'-fluoro. 2'-amino and 2 O-methyl modifications on group; a reporter group; an intercalator, a group for improv the ribose of pyrimidines, abasic residues or an inverted base ing the pharmacokinetic properties of an oligonucleotide; or at the 3' end of the RNA. Such modifications are routinely a group for improving the pharmacodynamic properties of an incorporated into oligonucleotides and these oligonucle 15 oligonucleotide and other Substituents having similar proper otides have been shownto have a higher Tm (i.e., higher target ties. A preferred modification includes 2'-methoxyethoxy 2'- binding affinity) than; 2'-deoxyoligonucleotides against a O—CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) given target. The effect of such increased affinity is to greatly (Martin et al., (1995) Helv. Chim. Acta, 78, 486). Other pre enhance RNAi oligonucleotide inhibition of gene expression. ferred modifications include 2'-methoxy (2'-O-CH3), RNAse H is a cellular endonuclease that cleaves the RNA 2'-propoxy (2'-OCH2CH2CH3) and 2'-fluoro (2'-F). Similar strand of RNA:DNA duplexes; activation of this enzyme modifications may also be made at other positions on the therefore results in cleavage of the RNA target, and thus can oligonucleotide, particularly the 3' position of the Sugar on the greatly enhance the efficiency of RNAi inhibition. Cleavage 3' terminal nucleotide and the 5' position of 5' terminal nucle of the RNA target can be routinely demonstrated by gel elec otide. Oligonucleotides may also have Sugar mimetics such as trophoresis. In another preferred embodiment, the chimeric 25 cyclobutyls in place of the pentofuranosyl group. oligonucleotide is also modified to enhance nuclease resis Oligonucleotides may also include, additionally or alter tance. Cells contain a variety of exo- and endo-nucleases natively, nucleobase (often referred to in the art simply as which can degrade nucleic acids. A number of nucleotide and “base') modifications or substitutions. As used herein, nucleoside modifications have been shown to make the oli “unmodified’ or “natural nucleotides include adenine (A), gonucleotide into which they are incorporated more resistant 30 guanine (G), thymine (T), cytosine (C) and uracil (U). Modi to nuclease digestion than the native oligodeoxynucleotide. fied nucleotides include nucleotides found only infrequently Nuclease resistance is routinely measured by incubating oli or transiently in natural nucleic acids, e.g., hypoxanthine, gonucleotides with cellular extracts or isolated nuclease solu 6-methyladenine. 5-Me pyrimidines, particularly 5-methyl tions and measuring the extent of intact oligonucleotide cytosine (also referred to as 5-methyl-2' deoxycytosine and remaining over time, usually by gel electrophoresis. Oligo 35 often referred to in the art as 5-Me-C), hydroxymethylcy nucleotides which have been modified to enhance their tosine (HMC), glycosyl HMC and gentobiosyl HMC, as well nuclease resistance Survive intact for a longer time than as synthetic nucleotides, e.g., 2-aminoadenine, 2-(methy unmodified oligonucleotides. A variety of oligonucleotide lamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalk modifications have been demonstrated to enhance or confer lyamino)adenine or other heteroSubstituted alkyladenines, nuclease resistance. Oligonucleotides which contain at least 40 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxym one phosphorothioate modification are presently more pre ethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-amino ferred. In some cases, oligonucleotide modifications which hexyl)adenine and 2,6-diaminopurine. (Kornberg A., DNA enhance target binding affinity are also, independently, able Replication, W. H. Freeman & Co., San Francisco, 1980, pp to enhance nuclease resistance. Some desirable modifications 75-77; Gebeyehu, G., (1987) et al. Nucl. Acids Res. 15:4513). can be found in De Mesmaeker et al. (1995) Acc. Chem. Res., 45 A “universal base known in the art, e.g., inosine, may be 28:366-374. included, 5-Me-C substitutions have been shown to increase Specific examples of Some preferred oligonucleotides nucleic acid duplex stability by 0.6-1.2°C. (Sanghvi, Y. S., in envisioned for this invention include those comprising modi Crooke, S. T. and Lebleu, B., eds., Antisense Research and fied backbones, for example, phosphorothioates, phosphotri Applications, CRC Press, Boca Raton, 1993, pp. 276-278) esters, methyl phosphonates, short chain alkyl or cycloalkyl 50 and are presently preferred base substitutions. interSugar linkages or short chain heteroatomic or heterocy Another modification of the oligonucleotides of the inven clic interSugar linkages. Most preferred are oligonucleotides tion involves chemically linking to the oligonucleotide one or with phosphorothioate backbones and those with heteroatom more moieties or conjugates which enhance the activity or backbones, particularly CH2 NH O—CH2, CH, cellular uptake of the oligonucleotide. Such moieties include —N(CH3)—O CH2 known as a methylene(methylimino) 55 but are not limited to lipid moieties such as a cholesterol or MMI backbone), CH2 O N(CH3). CH2, CH2 N moiety, a cholesteryl moiety (Letsinger et al., (1989) Proc. (CH3) N(CH3) CH2 and O N(CH3) CH2-CH2 Natl. Acad. Sci. USA 86,6553), cholic acid (Manoharan et al. backbones, wherein the native phosphodiester backbone is (1994) Bioorg. Med. Chem. Let. 4, 1053), a thioether, e.g., represented as O—P O—CH.). The amide backbones dis hexyl-S-tritylthiol (Manoharan et al. (1992) Ann. N.Y. Acad. closed by De Mesmaeker et al. (1995) Acc. Chem. Res. 60 Sci. 660,306; Manoharan et al. (1993) Bioorg Med. Chem. 28:366-374 are also preferred. Also preferred are oligonucle Let. 3, 2765), a thiocholesterol (Oberhauser et al., (1992) otides having morpholino backbone structures (Summerton Nucl. Acids Res. 20, 533), an aliphatic chain, e.g., dodecan and Weller, U.S. Pat. No. 5,034,506). In other preferred diol or undecyl residues (Saison-Behmoaras et al. EMBO J. embodiments, such as the peptide nucleic acid (PNA) back 1991, 10, 111; Kabanov et al. (1990) FEBS Lett. 259, 327; bone, the phosphodiester backbone of the oligonucleotide is 65 Svinarchuk et al. (1993) Biochimie 75, 49), a phospholipid, replaced with a polyamide backbone, the nucleotides being e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di bound directly or indirectly to the aza nitrogen atoms of the O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et US 9,410,155 B2 27 28 al. (1995) Tetrahedron Lett. 36,3651; Shea et al. (1990) Nucl. Representative United States patents that teach the prepa Acids Res. 18, 3777), a polyamine or a polyethylene glycol ration of the above phosphorus containing linkages comprise, chain (Manoharan et al. (1995) Nucleosides & Nucleotides, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 14,969), or adamantane acetic acid (Manoharan et al. (1995) 4476,301: 5,023,243; 5,177, 196; 5,188,897: 5,264,423; Tetrahedron Lett. 36, 3651). Oligonucleotides comprising 5 5,276,019; 5,278.302: 5,286,717: 5,221,131; 5,399,676: lipophilic moieties, and methods for preparing Such oligo 5,405,939; 5,453,496; 5,455,213; 5,466,677; 5,476,925; nucleotides are known in the art, for example, U.S. Pat. Nos. 5,519,126; 5,536,821; 5,541,306; 5,550,111: 5,563,253; 5,138,045, 5,218,105 and 5,459.255. 5,571,799: 5,587,361; and 5,625,050, each of which is herein It is not necessary for all positions in a given oligonucle incorporated by reference. otide to be uniformly modified, and in fact more than one of 10 Preferred modified oligonucleotide backbones that do not the aforementioned modifications may be incorporated in a include a phosphorus atom therein have backbones that are single oligonucleotide or even at within a single nucleoside formed by short chain alkyl or cycloalkyl internucleoside within an oligonucleotide. The present invention also linkages, mixed heteroatom and alkyl or cycloalkyl inter includes oligonucleotides which are chimeric oligonucle nucleoside linkages, or one or more short chain heteroatomic otides as hereinbefore defined. 15 or heterocyclic internucleoside linkages. These comprise In another embodiment, the nucleic acid molecule of the those having morpholino linkages (formed in part from the present invention is conjugated with another moiety includ Sugar portion of a nucleoside); siloxane backbones; Sulfide, ing but not limited to abasic nucleotides, polyether, sulfoxide and sulfone backbones; formacetyl and thiofor polyamine, polyamides, peptides, carbohydrates, lipid, or macetyl backbones; methylene formacetyl and thiofor polyhydrocarbon compounds. Those skilled in the art will macetylbackbones; alkene containing backbones; Sulfamate recognize that these molecules can be linked to one or more of backbones; methyleneimino and methylenehydrazino back any nucleotides comprising the nucleic acid molecule at sev bones; Sulfonate and Sulfonamide backbones; amide back eral positions on the Sugar, base orphosphate group. bones; and others having mixed N, O, S and CH2 component The oligonucleotides used in accordance with this inven parts. tion may be conveniently and routinely made through the 25 Representative United States patents that teach the prepa well-known technique of Solid phase synthesis. Equipment ration of the above oligonucleosides comprise, but are not for Such synthesis is sold by several vendors including limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; Applied Biosystems. Any other means for Such synthesis may 5,214,134: 5,216,141, 5,235,033: 5,264,562; 5,264,564: also be employed the actual synthesis of the oligonucleotides 5,405,938; 5,434,257; 5,466,677; 5,470,967: 5489,677; is well within the talents of one of ordinary skill in the art. It 30 5,541,307: 5,561.225; 5,596,086; 5,602,240; 5,610,289; is also well known to use similar techniques to prepare other 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; oligonucleotides such as the phosphorothioates and alkylated 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of derivatives. It is also well known to use similar techniques and which is herein incorporated by reference. commercially available modified amidites and controlled In other preferred oligonucleotide mimetics, both the Sugar pore glass (CPG) products such as biotin, fluorescein, acri 35 and the internucleoside linkage, i.e., the backbone, of the dine or psoralen-modified amidites and/or CPG (available nucleotide units are replaced with novel groups. The base from Glen Research, Sterling Va.) to synthesize fluorescently units are maintained for hybridization with an appropriate labeled, biotinylated or other modified oligonucleotides such nucleic acid target compound. One Such oligomeric com as cholesterol-modified oligonucleotides. pound, an oligonucleotide mimetic that has been shown to In accordance with the invention, use of modifications such 40 have excellent hybridization properties, is referred to as a as the use of LNA monomers to enhance the potency, speci peptide nucleic acid (PNA). In PNA compounds, the sugar ficity and duration of action and broaden the routes of admin backbone of an oligonucleotide is replaced with an amide istration of oligonucleotides comprised of current chemistries containing backbone, in particular an aminoethylglycine such as MOE, ANA, FANA, PS etc (Uhlman, et al. (2000) backbone. The nucleobases are retained and are bound Current Opinions in Drug Discovery & Development Vol. 3 45 directly or indirectly to aza nitrogen atoms of the amide No 2). This can be achieved by substituting some of the portion of the backbone. Representative United States patents monomers in the current oligonucleotides by LNA mono that teach the preparation of PNA compounds comprise, but mers. The LNA modified oligonucleotide may have a size are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and similar to the parent compound or may be larger or preferably 5,719,262, each of which is herein incorporated by reference. smaller. It is preferred that such LNA-modified oligonucle 50 Further teaching of PNA compounds can be found in Nielsen, otides contain less than about 70%, more preferably less than et al. (1991) Science 254, 1497-1500. about 60%, most preferably less than about 50% LNA mono In another preferred embodiment of the invention the oli mers and that their sizes are between about 5 and 25 nucle gonucleotides with phosphorothioate backbones and oligo otides, more preferably between about 12 and 20 nucleotides. nucleosides with heteroatom backbones, and in particular Preferred modified oligonucleotide backbones comprise, 55 CH2 NH O CH2 , CH2 N(CH3) O but not limited to, phosphorothioates, chiral phosphorothio CH2—known as a methylene (methylimino) or MMI back ates, phosphorodithioates, phosphotriesters, aminoalky bone, -CH2 O N(CH3) CH2-, -CH2N(CH3) N lphosphotriesters, methyl and other alkyl phosphonates com (CH3)CH2 and O N(CH3)—CH2—CH2—wherein prising 3'alkylene phosphonates and chiral phosphonates, the native phosphodiester backbone is represented as phosphinates, phosphoramidates comprising 3'-amino phos 60 - O P O CH2 of the above referenced U.S. Pat. No. phoramidate and aminoalkylphosphoramidates, thionophos 5,489,677, and the amide backbones of the above referenced phoramidates, thionoalkylphosphonates, thionoalkylphos U.S. Pat. No. 5,602.240. Also preferred are oligonucleotides photriesters, and boranophosphates having normal 3'-5' having morpholino backbone structures of the above-refer linkages. 2'-5' linked analogs of these, and those having enced U.S. Pat. No. 5,034,506. inverted polarity wherein the adjacent pairs of nucleoside 65 Modified oligonucleotides may also contain one or more units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, Substituted Sugar moieties. Preferred oligonucleotides com mixed salts and free acid forms are also included. prise one of the following at the 2' position: OH: F: O S , US 9,410,155 B2 29 30 or N-alkyl: O , S: , or N-alkenyl: O S or N-alkynyl: Edition, 1991, 30, page 613, and those disclosed by Sanghvi, or O alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl Y. S., Chapter 15, Antisense Research and Applications, may be substituted or unsubstituted C to CO alkyl or C2 to CO pages 289-302, Crooke, S.T. and Lebleu, B. ea. CRC Press, alkenyl and alkynyl. Particularly preferred are O(CH2)n 1993. Certain of these nucleotides are particularly useful for OmCH3, O(CH2)n, OCH3, O(CH2)nNH2, O(CH2)nCH3, increasing the binding affinity of the oligomeric compounds O(CH2)nONH2, and O(CH2nCN(CH2)nCH3)2 wheren and of the invention. These comprise 5-substituted pyrimidines, m can be from 1 to about 10. Other preferred oligonucleotides 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprise one of the following at the 2' position: C to CO. comprising 2-aminopropyladenine, 5-propynyluracil and (lower alkyl, substituted lower alkyl, alkaryl, aralkyl, 5-propynylcytosine, 5-methylcytosine Substitutions have O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, 10 been shown to increase nucleic acid duplex stability by 0.6- OCF3, SOCH3, SO2CH3. ONO2, NO2, N3, NH2, heterocy 1.2°C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds, cloalkyl, heterocycloalkaryl, aminoalkylamino, polyalky Antisense Research and Applications, CRC Press, Boca lamino, Substituted silyl, an RNA cleaving group, a reporter Raton, 1993, pp. 276-278) and are presently preferred base group, an intercalator, a group for improving the pharmaco substitutions, even more particularly when combined with kinetic properties of an oligonucleotide, or a group for 15 2'-Omethoxyethyl Sugar modifications. improving the pharmacodynamic properties of an oligonucle Representative United States patents that teach the prepa otide, and other Substituents having similar properties. A ration of the above noted modified nucleotides as well as preferred modification comprises 2'-methoxyethoxy (2'-O- other modified nucleotides comprise, but are not limited to, CH2CH2OCH3, also known as 2'-O-(2-methylethyl) or U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 2'-MOE) (Martin et al., (1995) Helv. Chim. Acta, 78, 486 5,130,302; 5,134,066; 5,175.273; 5,367,066; 5,432,272: 504) i.e., an alkoxyalkoxy group. A further preferred modifi 5,457,187; 5,459.255; 5,484,908: 5,502,177; 5,525,711; cation comprises 2'-dimethylaminooxyethoxy, i.e., a O(CH2) 5,552,540: 5,587,469; 5,596,091; 5,614,617; 5,750,692, and 2ON(CH3)2 group, also known as 2'-DMAOE, as described 5,681,941, each of which is herein incorporated by reference. in examples herein below, and 2'-dimethylaminoethoxy Another modification of the oligonucleotides of the inven ethoxy (also known in the art as 2'-O-dimethylaminoethoxy 25 tion involves chemically linking to the oligonucleotide one or ethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. more moieties or conjugates, which enhance the activity, Other preferred modifications comprise 2'-methoxy (2'- cellular distribution, or cellular uptake of the oligonucleotide. OCH3), 2-aminopropoxy (2'-OCH2CH2CH2NH2) and Such moieties comprise but are not limited to, lipid moi 2'-fluoro (2'-F). Similar modifications may also be made at eties such as a cholesterol moiety (Letsinger et al., (1989) other positions on the oligonucleotide, particularly the 3' 30 Proc. Natl. Acad. Sci. USA, 86, 6553-6556), cholic acid position of the sugar on the 3' terminal nucleotide or in 2'-5' (Manoharan et al., (1994) Bioorg. Med. Chem. Let., 4, 1053 linked oligonucleotides and the 5' position of 5' terminal 1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., nucleotide. Oligonucleotides may also have Sugar mimetics (1992) Ann. N. Y. Acad. Sci., 660,306-309; Manoharan et al., Such as cyclobutyl moieties in place of the pentofuranosyl (1993) Bioorg. Med. Chem. Let., 3, 2765-2770), a thiocho sugar. Representative United States patents that teach the 35 lesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20, 533 preparation of Such modified Sugar structures comprise, but 538), an aliphatic chain, e.g., dodocandiolor undecylresidues are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319, (Kabanov et al., (1990) FEBS Lett., 259, 327-330; Svinar 080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; chuket al., (1993) Biochimie 75, 49-54), a phospholipid, e.g., 5,519,134: 5,567,811: 5,576.427: 5,591,722; 5,597,909; di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O- 5,610,300; 5,627,053: 5,639,873; 5,646,265; 5,658,873; 40 hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., 5,670,633; and 5,700,920, each of which is herein incorpo (1995) Tetrahedron Lett., 36, 3651-3654; Shea et al., (1990) rated by reference. Nucl. Acids Res., 18, 3777-3783), a polyamine or a polyeth Oligonucleotides may also comprise nucleobase (often ylene glycol chain (Manoharan et al., (1995) Nucleosides & referred to in the art simply as “base') modifications or sub Nucleotides, 14,969-973), or adamantane acetic acid (Mano stitutions. As used herein, “unmodified’ or “natural nucle 45 haran et al., (1995) Tetrahedron Lett., 36, 3651-3654), a otides comprise the purine bases adenine (A) and guanine palmityl moiety (Mishra et al., (1995) Biochim. Biophys. (G), and the pyrimidine bases thymine (T), cytosine (C) and Acta, 1264. 229-237), or an octadecylamine or hexylamino uracil (U). Modified nucleotides comprise other synthetic and carbonyl-t oxycholesterol moiety (Crooke et al., (1996) J. natural nucleotides such as 5-methylcytosine (5-me-C), 5-hy Pharmacol. Exp. Ther, 277,923-937). droxymethyl cytosine, Xanthine, hypoxanthine, 2-aminoad 50 Representative United States patents that teach the prepa enine, 6-methyl and other alkyl derivatives of adenine and ration of Such oligonucleotides conjugates comprise, but are guanine, 2-propyl and other alkyl derivatives of adenine and not limited to, U.S. Pat. Nos. 4,828,979: 4,948,882: 5,218, guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 105:5,525,465; 5,541,313; 5,545,730;5,552,538; 5,578,717, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 5,580,731: 5,580,731: 5,591584; 5,109,124; 5,118,802: 6-aZO uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 55 5,138,045; 5,414,077; 5,486,603: 5,512,439; 5,578,718; 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hy 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; droxyl and other 8-Substituted adenines and guanines, 5-halo 4,789,737; 4,824.941; 4,835,263; 4,876,335; 4,904,582: particularly 5-bromo, 5-trifluoromethyl and other 5-substi 4,958,013; 5,082,830; 5,112,963: 5,214,136; 5,082,830; tuted uracils and cytosines, 7-methylguanine and 7-methy 5,112,963: 5,214,136; 5,245,022: 5,254,469: 5,258,506; ladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine 60 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,171,241; and 7-deazaadenine and 3-deazaguanine and 3-deaZaad 5,391,723; 5,416.203; 5,451,463: 5,510,475; 5,512,667; enine. 5,514,785: 5,565,552; 5,567,810; 5,574,142: 5,585,481; Further, nucleotides comprise those disclosed in U.S. Pat. 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and No. 3,687,808, those disclosed in The Concise Encyclopedia 5,688.941, each of which is herein incorporated by reference. of Polymer Science And Engineering, pages 858-859, 65 Drug discovery: The compounds of the present invention Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those dis can also be applied in the areas of drug discovery and target closed by Englischet al., Angewandle Chemie, International validation. The present invention comprehends the use of the US 9,410,155 B2 31 32 compounds and preferred target segments identified herein in Kits, Research Reagents, Diagnostics, and Therapeutics drug discovery efforts to elucidate relationships that exist The compounds of the present invention can be utilized for between Vascular Endothelial Growth Factor (VEGF) poly diagnostics, therapeutics, and prophylaxis, and as research nucleotides and a disease state, phenotype, or condition. reagents and components of kits. Furthermore, antisense oli These methods include detecting or modulating Vascular 5 gonucleotides, which are able to inhibit gene expression with Endothelial Growth Factor (VEGF) polynucleotides com exquisite specificity, are often used by those of ordinary skill prising contacting a sample, tissue, cell, or organism with the to elucidate the function of particular genes or to distinguish compounds of the present invention, measuring the nucleic between functions of various members of a biological path acid or protein level of Vascular Endothelial Growth Factor way. (VEGF) polynucleotides and/or a related phenotypic or 10 For use in kits and diagnostics and in various biological chemical endpoint at Some time after treatment, and option systems, the compounds of the present invention, either alone ally comparing the measured value to a non-treated sample or or in combination with other compounds or therapeutics, are sample treated with a further compound of the invention. useful as tools in differential and/or combinatorial analyses to These methods can also be performed in parallel or in com elucidate expression patterns of a portion or the entire bination with other experiments to determine the function of 15 complement of genes expressed within cells and tissues. unknown genes for the process of target validation or to As used herein the term “biological system” or “system” is determine the validity of a particular gene product as a target defined as any organism, cell, cell culture or tissue that for treatment or prevention of a particular disease, condition, expresses, or is made competent to express products of the or phenotype. Vascular Endothelial Growth Factor (VEGF) genes. These Assessing Up-Regulation or Inhibition of Gene Expression: include, but are not limited to, humans, transgenic animals, Transfer of an exogenous nucleic acid into a host cell or cells, cell cultures, tissues, Xenografts, transplants and com organism can be assessed by directly detecting the presence binations thereof. of the nucleic acid in the cell or organism. Such detection can As one non limiting example, expression patterns within be achieved by several methods well known in the art. For cells or tissues treated with one or more antisense compounds example, the presence of the exogenous nucleic acid can be 25 are compared to control cells or tissues not treated with anti detected by Southern blot or by a polymerase chain reaction sense compounds and the patterns produced are analyzed for (PCR) technique using primers that specifically amplify differential levels of gene expression as they pertain, for nucleotide sequences associated with the nucleic acid. example, to disease association, signaling pathway, cellular Expression of the exogenous nucleic acids can also be mea localization, expression level, size, structure or function of Sured using conventional methods including gene expression 30 the genes examined. These analyses can be performed on analysis. For instance, mRNA produced from an exogenous stimulated or unstimulated cells and in the presence or nucleic acid can be detected and quantified using a Northern absence of other compounds that affect expression patterns. blot and reverse transcription PCR (RT-PCR). Examples of methods of gene expression analysis known Expression of RNA from the exogenous nucleic acid can in the art include DNA arrays or microarrays (Brazma and also be detected by measuring an enzymatic activity or a 35 Vilo, (2000) FEBS Lett., 480, 17-24: Celis, et al., (2000) reporter protein activity. For example, antisense modulatory FEBS Lett., 480, 2-16), SAGE (serial analysis of gene expres activity can be measured indirectly as a decrease or increase sion) (Madden, et al., (2000) Drug Discov. Today, 5, 415 in target nucleic acid expression as an indication that the 425), READS (restriction enzyme amplification of digested exogenous nucleic acid is producing the effector RNA. Based cDNAs) (Prashar and Weissman, (1999) Methods Enzymol., on sequence conservation, primers can be designed and used 40 303, 258-72), TOGA (total gene expression analysis) (Sutc to amplify coding regions of the target genes. Initially, the liffe, et al., (2000) Proc. Natl. Acad. Sci. U.S.A., 97, 1976-81), most highly expressed coding region from each gene can be protein arrays and proteomics (Celis, et al., (2000) FEBS used to build a model control gene, although any coding or Lett., 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, non coding region can be used. Each control gene is 2100-10), expressed sequence tag (EST) sequencing (Celis, assembled by inserting each coding region between a reporter 45 et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotech coding region and its poly(A) signal. These plasmids would nol., 2000, 80, 143-57), subtractive RNA fingerprinting produce an mRNA with a reporter gene in the upstream (SuRF) (Fuchs, et al., (2000) Anal. Biochem. 286, 91-98: portion of the gene and a potential RNAi target in the 3' Larson, et al., (2000) Cytometry 41, 203-208), subtractive non-coding region. The effectiveness of individual antisense cloning, differential display (DD) (Jurecic and Belmont, oligonucleotides would be assayed by modulation of the 50 (2000) Curr. Opin. Microbiol. 3, 3.16-21), comparative reporter gene. Reporter genes useful in the methods of the genomic hybridization (Carulli, et al., (1998) J. Cell Bio present invention include acetohydroxyacid synthase chem. Suppl., 31, 286-96), FISH (fluorescent in situ hybrid (AHAS), alkaline phosphatase (AP), beta galactosidase ization) techniques (Going and Gusterson, (1999) Eur: J. (LacZ), beta glucoronidase (GUS), chloramphenicol acetyl Cancer, 35, 1895-904) and mass spectrometry methods (To, transferase (CAT), green fluorescent protein (GFP), red fluo 55 Comb, (2000) Chem. High Throughput Screen, 3, 235-41). rescent protein (RFP), yellow fluorescent protein (YFP), cyan The compounds of the invention are useful for research and fluorescent protein (CFP), horseradish peroxidase (HRP), diagnostics, because these compounds hybridize to nucleic luciferase (Luc), nopaline synthase (NOS), octopine synthase acids encoding Vascular Endothelial Growth Factor (VEGF). (OCS), and derivatives thereof. Multiple selectable markers For example, oligonucleotides that hybridize with such effi are available that confer resistance to amplicillin, bleomycin, 60 ciency and under Such conditions as disclosed herein as to be chloramphenicol, gentamycin, hygromycin, kanamycin, lin effective Vascular Endothelial Growth Factor (VEGF) modu comycin, methotrexate, phosphinothricin, puromycin, and lators are effective primers or probes under conditions favor tetracycline. Methods to determine modulation of a reporter ing gene amplification or detection, respectively. These prim gene are well known in the art, and include, but are not limited ers and probes are useful in methods requiring the specific to, fluorometric methods (e.g. fluorescence spectroscopy, 65 detection of nucleic acid molecules encoding Vascular Endot Fluorescence Activated Cell Sorting (FACS), fluorescence helial Growth Factor (VEGF) and in the amplification of said microscopy), antibiotic resistance determination. nucleic acid molecules for detection or for use in further US 9,410,155 B2 33 34 studies of Vascular Endothelial Growth Factor (VEGF). Factor (VEGF) peptides and/or the Vascular Endothelial Hybridization of the antisense oligonucleotides, particularly Growth Factor (VEGF) protein itself. the primers and probes, of the invention with a nucleic acid The compounds of the invention can be utilized in phar encoding Vascular Endothelial Growth Factor (VEGF) can be maceutical compositions by adding an effective amount of a detected by means known in the art. Such means may include compound to a suitable pharmaceutically acceptable diluent conjugation of an enzyme to the oligonucleotide, radiolabel or carrier. Use of the compounds and methods of the invention ing of the oligonucleotide, or any other suitable detection may also be useful prophylactically. means. Kits using such detection means for detecting the level Conjugates of Vascular Endothelial Growth Factor (VEGF) in a sample Another modification of the oligonucleotides of the inven may also be prepared. 10 tion involves chemically linking to the oligonucleotide one or The specificity and sensitivity of antisense are also har more moieties or conjugates that enhance the activity, cellular nessed by those of skill in the art for therapeutic uses. Anti distribution or cellular uptake of the oligonucleotide. These sense compounds have been employed as therapeutic moi moieties or conjugates can include conjugate groups eties in the treatment of disease states in animals, including covalently bound to functional groups such as primary or humans. Antisense oligonucleotide drugs have been safely 15 secondary hydroxyl groups. Conjugate groups of the inven and effectively administered to humans and numerous clini tion include intercalators, reporter molecules, polyamines, cal trials are presently underway. It is thus established that polyamides, polyethylene glycols, polyethers, groups that antisense compounds can be useful therapeutic modalities enhance the pharmacodynamic properties of oligomers, and that can be configured to be useful in treatment regimes for groups that enhance the pharmacokinetic properties of oligo the treatment of cells, tissues and animals, especially humans. mers. Typical conjugate groups include cholesterols, lipids, For therapeutics, an animal, preferably a human, Suspected phospholipids, biotin, phenazine, folate, phenanthridine, of having a disease or disorder which can be treated by modu anthraquinone, acridine, fluoresceins, rhodamines, cou lating the expression of Vascular Endothelial Growth Factor marins, and dyes. Groups that enhance the pharmacodynamic (VEGF) polynucleotides is treated by administering anti properties, in the context of this invention, include groups that sense compounds in accordance with this invention. For 25 improve uptake, enhance resistance to degradation, and/or example, in one non-limiting embodiment, the methods com strengthen sequence-specific hybridization with the target prise the step of administering to the animal in need of treat nucleic acid. Groups that enhance the pharmacokinetic prop ment, a therapeutically effective amount of Vascular Endot erties, in the context of this invention, include groups that helial Growth Factor (VEGF) modulator. The Vascular improve uptake, distribution, metabolism or excretion of the Endothelial Growth Factor (VEGF) modulators of the present 30 compounds of the present invention. Representative conju invention effectively modulate the activity of the Vascular gate groups are disclosed in International Patent Application Endothelial Growth Factor (VEGF) or modulate the expres No. PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. sion of the Vascular Endothelial Growth Factor (VEGF) pro 6,287,860, which are incorporated herein by reference. Con tein. In one embodiment, the activity or expression of Vascu jugate moieties include, but are not limited to, lipid moieties lar Endothelial Growth Factor (VEGF) in an animal is 35 Such as a cholesterol moiety, cholic acid, a thioether, e.g., inhibited by about 10% as compared to a control. Preferably, hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., the activity or expression of Vascular Endothelial Growth dodecandiol or undecyl residues, a phospholipid, e.g., di Factor (VEGF) in an animal is inhibited by about 30%. More hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexa preferably, the activity or expression of Vascular Endothelial decyl-rac-glycero-3-Hphosphonate, a polyamine or a poly Growth Factor (VEGF) in an animal is inhibited by 50% or 40 ethylene glycol chain, or adamantane acetic acid, a palmityl more. Thus, the oligomeric compounds modulate expression moiety, or an octadecylamine or hexylamino-carbonyl-oxy of Vascular Endothelial Growth Factor (VEGF) mRNA by at cholesterol moiety. Oligonucleotides of the invention may least 10%, by at least 50%, by at least 25%, by at least 30%, also be conjugated to active drug Substances, for example, by at least 40%, by at least 50%, by at least 60%, by at least aspirin, warfarin, phenylbutaZone, ibuprofen, Suprofen, fen 70%, by at least 75%, by at least 80%, by at least 85%, by at 45 bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansyl least 90%, by at least 95%, by at least 98%, by at least 99%, sarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic or by 100% as compared to a control. acid, a benzothiadiazide, chlorothiazide, a diazepine, In one embodiment, the activity or expression of Vascular indomethicin, a barbiturate, a cephalosporin, a Sulfa drug, an Endothelial Growth Factor (VEGF) and/or in an animal is antidiabetic, an antibacterial or an antibiotic. increased, by about 10% as compared to a control. Preferably, 50 Representative United States patents that teach the prepa the activity or expression of Vascular Endothelial Growth ration of Such oligonucleotides conjugates include, but are Factor (VEGF) in an animal is increased by about 30%. More not limited to, U.S. Pat. Nos. 4,828.972: 4,948,882: 5,218, preferably, the activity or expression of Vascular Endothelial 105:5,525,465; 5,541,313; 5,545,730;5,552,538; 5,578,717, Growth Factor (VEGF) in an animal is increased by 50% or 5,580,731: 5,580,731: 5,591584; 5,109,124; 5,118,802: more. Thus, the oligomeric compounds modulate expression 55 5,138,045; 5,414,077; 5,486,603: 5,512,439; 5,578,718; of Vascular Endothelial Growth Factor (VEGF) mRNA by at 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; least 10%, by at least 50%, by at least 25%, by at least 30%, 4,789,737; 4,824.941; 4,835,263; 4,876,335; 4,904,582: by at least 40%, by at least 50%, by at least 60%, by at least 4,958,013; 5,082,830; 5,112,963: 5,214,136; 5,082,830; 70%, by at least 75%, by at least 80%, by at least 85%, by at 5,112,963: 5,214,136; 5,245,022: 5,254,469: 5,258,506; least 90%, by at least 95%, by at least 98%, by at least 99%, 60 5,262,536; 5,272,250; 5,292,873; 5,317,098: 5,371,241, or by 100% as compared to a control. 5,391,723; 5,416.203; 5,451,463: 5,510,475; 5,512,667; For example, the reduction of the expression of Vascular 5,514,785: 5,565,552; 5,567,810; 5,574,142: 5,585,481; Endothelial Growth Factor (VEGF) may be measured in 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and serum, blood, adipose tissue, liver or any other body fluid, 5,688,941. tissue or organ of the animal. Preferably, the cells contained 65 Formulations within said fluids, tissues or organs being analyzed contain a The compounds of the invention may also be admixed, nucleic acid molecule encoding Vascular Endothelial Growth encapsulated, conjugated or otherwise associated with other US 9,410,155 B2 35 36 molecules, molecule structures or mixtures of compounds, as their uses are further described in U.S. Pat. No. 6,287,860, for example, liposomes, receptor-targeted molecules, oral, which is incorporated herein by reference. rectal, topical or other formulations, for assisting in uptake, The present invention also includes pharmaceutical com distribution and/or absorption. Representative United States positions and formulations that include the antisense com patents that teach the preparation of such uptake, distribution pounds of the invention. The pharmaceutical compositions of and/or absorption-assisting formulations include, but are not the present invention may be administered in a number of limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016: ways depending upon whether local or systemic treatment is 5,459,127: 5,521,291; 5,543,165; 5,547,912; 5,583,020; desired and upon the area to be treated. Administration may 5,591,721: 4,426,330; 4,534,899; 5,013,556; 5,108,921; be topical (including ophthalmic and to mucous membranes 10 including vaginal and rectal delivery), pulmonary, e.g., by 5,213,804: 5,227,170: 5,264.221; 5,356,633; 5,395,619; inhalation or insufflation of powders or aerosols, including by 5,416,016; 5,417,978; 5,462,854; 5,469,854: 5,512,295; nebulizer, intratracheal, intranasal, epidermal and transder 5,527,528: 5,534,259; 5,543,152; 5,556,948; 5,580,575; and mal), oral or parenteral. Parenteral administration includes 5,595.756, each of which is herein incorporated by reference. intravenous, intraarterial, Subcutaneous, intraperitoneal or Although, the antisense oligonucleotides do not need to be 15 intramuscular injection or infusion; or intracranial, e.g., administered in the context of a vector in order to modulate a intrathecal or intraventricular, administration. Oligonucle target expression and/or function, embodiments of the inven otides with at least one 2'-O-methoxyethyl modification are tion relates to expression vector constructs for the expression believed to be particularly useful for oral administration. of antisense oligonucleotides, comprising promoters, hybrid Pharmaceutical compositions and formulations for topical promoter gene sequences and possess a strong constitutive administration may include transdermal patches, ointments, promoter activity, or a promoter activity which can be lotions, creams, gels, drops, Suppositories, sprays, liquids and induced in the desired case. powders. Conventional pharmaceutical carriers, aqueous, In an embodiment, invention practice involves administer powder or oily bases, thickeners and the like may be neces ing at least one of the foregoing antisense oligonucleotides sary or desirable. Coated condoms, gloves and the like may with a suitable nucleic acid delivery system. In one embodi 25 also be useful. ment, that System includes a non-viral vector operably linked The pharmaceutical formulations of the present invention, to the polynucleotide. Examples of such nonviral vectors which may conveniently be presented in unit dosage form, include the oligonucleotide alone (e.g. any one or more of may be prepared according to conventional techniques well SEQ ID NOS: 4 to 9) or in combination with a suitable known in the pharmaceutical industry. Such techniques protein, polysaccharide or lipid formulation. 30 include the step of bringing into association the active ingre Additionally suitable nucleic acid delivery systems include dients with the pharmaceutical carrier(s) or excipient(s). In viral vector, typically sequence from at least one of an aden general, the formulations are prepared by uniformly and inti ovirus, adenovirus-associated virus (AAV), helper-depen mately bringing into association the active ingredients with dent adenovirus, retrovirus, or hemagglutinatin virus of liquid carriers or finely divided solid carriers or both, and Japan-liposome (HVJ) complex. Preferably, the viral vector 35 then, if necessary, shaping the product. comprises a strong eukaryotic promoter operably linked to The compositions of the present invention may be formu the polynucleotide e.g., a cytomegalovirus (CMV) promoter. lated into any of many possible dosage forms such as, but not Additionally preferred vectors include viral vectors, fusion limited to, tablets, capsules, gel capsules, liquid syrups, soft proteins and chemical conjugates. Retroviral vectors include gels, Suppositories, and enemas. The compositions of the Moloney murine leukemia viruses and HIV-based viruses. 40 present invention may also be formulated as Suspensions in One preferred HIV-based viral vector comprises at least two aqueous, non-aqueous or mixed media. Aqueous Suspensions vectors wherein the gag and pol genes are from an HIV may further contain Substances that increase the Viscosity of genome and the env gene is from another virus. DNA viral the Suspension including, for example, Sodium carboxymeth vectors are preferred. These vectors include pox vectors such ylcellulose, Sorbitol and/or dextran. The Suspension may also as orthopox or avipox vectors, herpesvirus vectors such as a 45 contain stabilizers. herpes simplex 1 virus (HSV) vector Geller, A. I. et al., Pharmaceutical compositions of the present invention (1995).J. Neurochem, 64: 487; Lim, F., et al., in DNA Clon include, but are not limited to, Solutions, emulsions, foams ing: Mammalian Systems, D. Glover, Ed. (Oxford Univ. and liposome-containing formulations. The pharmaceutical Press, Oxford England) (1995); Geller, A. I. et al., (1993) compositions and formulations of the present invention may Proc Natl. Acad. Sci., U.S.A.: 90 7603; Geller, A. I., et al., 50 comprise one or more penetration enhancers, carriers, excipi (1990) Proc Natl. Acad. Sci USA: 87:1149), Adenovirus Vec ents or other active or inactive ingredients. tors (LeGal LaSalle et al., Science, 259:988 (1993); David Emulsions are typically heterogeneous systems of one liq son, et al., (1993) Nat. Genet. 3: 219; Yang, et al., (1995).J. uid dispersed in another in the form of droplets usually Virol. 69: 2004) and Adeno-associated Virus Vectors (Kaplitt, exceeding 0.1 um in diameter. Emulsions may contain addi M. G., et al., (1994) Nat. Genet. 8:148). 55 tional components in addition to the dispersed phases, and the The antisense compounds of the invention encompass any active drug that may be present as a solution in either the pharmaceutically acceptable salts, esters, or salts of Such aqueous phase, oily phase or itself as a separate phase. Micro esters, or any other compound which, upon administration to emulsions are included as an embodiment of the present an animal, including a human, is capable of providing (di invention. Emulsions and their uses are well known in the art rectly or indirectly) the biologically active metabolite or resi 60 and are further described in U.S. Pat. No. 6,287,860. due thereof. Formulations of the present invention include liposomal The term “pharmaceutically acceptable salts' refers to formulations. As used in the present invention, the term "lipo physiologically and pharmaceutically acceptable salts of the Some” means a vesicle composed of amphiphilic lipids compounds of the invention: i.e., salts that retain the desired arranged in a spherical bilayer or bilayers. Liposomes are biological activity of the parent compound and do not impart 65 unilamellar or multilamellar vesicles which have a membrane undesired toxicological effects thereto. For oligonucleotides, formed from a lipophilic material and an aqueous interior that preferred examples of pharmaceutically acceptable salts and contains the composition to be delivered. Cationic liposomes US 9,410,155 B2 37 38 are positively charged liposomes that are believed to interact 860, which is incorporated herein by reference. Also pre with negatively charged DNA molecules to form a stable ferred are combinations of penetration enhancers, for complex. Liposomes that are pH-sensitive or negatively example, fatty acids/salts in combination with bile acids/ charged are believed to entrap DNA rather than complex with salts. A particularly preferred combination is the Sodium salt it. Both cationic and noncationic liposomes have been used to of lauric acid, capric acid and UDCA. Further penetration deliver DNA to cells. enhancers include polyoxyethylene-9-lauryl ether, polyoxy Liposomes also include “sterically stabilized liposomes, a ethylene-20-cetyl ether. Oligonucleotides of the invention term which, as used herein, refers to liposomes comprising may be delivered orally, in granular form including sprayed one or more specialized lipids. When incorporated into lipo dried particles, or complexed to form micro or nanoparticles. Somes, these specialized lipids result in liposomes with 10 enhanced circulation lifetimes relative to liposomes lacking Oligonucleotide complexing agents and their uses are further such specialized lipids. Examples of sterically stabilized described in U.S. Pat. No. 6,287,860, which is incorporated liposomes are those in which part of the vesicle-forming lipid herein by reference. portion of the liposome comprises one or more glycolipids or Compositions and formulations for parenteral, intrathecal is derivatized with one or more hydrophilic polymers, such as 15 or intraventricular administration may include sterile aque a polyethylene glycol (PEG) moiety. Liposomes and their ous solutions that may also contain buffers, diluents and other uses are further described in U.S. Pat. No. 6,287,860. Suitable additives such as, but not limited to, penetration The pharmaceutical formulations and compositions of the enhancers, carrier compounds and other pharmaceutically present invention may also include Surfactants. The use of acceptable carriers or excipients. Surfactants in drug products, formulations and in emulsions is Certain embodiments of the invention provide pharmaceu well known in the art. Surfactants and their uses are further tical compositions containing one or more oligomeric com described in U.S. Pat. No. 6,287,860, which is incorporated pounds and one or more other chemotherapeutic agents that herein by reference. function by a non-antisense mechanism. Examples of Such In one embodiment, the present invention employs various chemotherapeutic agents include but are not limited to cancer penetration enhancers to effect the efficient delivery of 25 chemotherapeutic drugs such as daunorubicin, daunomycin, nucleic acids, particularly oligonucleotides. In addition to dactinomycin, doxorubicin, epirubicin, idarubicin, esorubi aiding the diffusion of non-lipophilic drugs across cell mem cin, bleomycin, mafosfamide, ifosfamide, cytosine arabino branes, penetration enhancers also enhance the permeability side, bischloroethyl-nitroSurea, buSulfan, mitomycin C, acti of lipophilic drugs. Penetration enhancers may be classified nomycin D. mithramycin, prednisone, hydroxyprogesterone, as belonging to one of live broad categories, i.e., Surfactants, 30 testosterone, tamoxifen, dacarbazine, procarbazine, hexam fatty acids, bile salts, chelating agents, and non-chelating ethylmelamine, pentamethylmelamine, mitoxantrone, amsa nonsurfactants. Penetration enhancers and their uses are fur crine, chlorambucil, methylcyclohexylnitroSurea, nitrogen ther described in U.S. Pat. No. 6,287,860, which is incorpo mustards, melphalan, cyclophosphamide, 6-mercaptopurine, rated herein by reference. 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, One of skill in the art will recognize that formulations are 35 routinely designed according to their intended use, i.e. route deoxycoformycin, 4-hydroxyperoxycyclo-phosphoramide, of administration. 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), Preferred formulations for topical administration include methotrexate (MTX), colchicine, taxol. Vincristine, vinblas those in which the oligonucleotides of the invention are in tine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, admixture with a topical delivery agent such as lipids, lipo 40 gemcitabine, teniposide, cisplatin and diethylstilbestrol Somes, fatty acids, fatty acid esters, steroids, chelating agents (DES). When used with the compounds of the invention, such and Surfactants. Preferred lipids and liposomes include neu chemotherapeutic agents may be used individually (e.g., tral (e.g. dioleoyl-phosphatidyl DOPE ethanolamine, 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oli dimyristoylphosphatidyl choline DMPC, distearoylphos gonucleotide for a period of time followed by MTX and phatidyl choline) negative (e.g. dimyristoylphosphatidyl 45 oligonucleotide), or in combination with one or more other glycerol DMPG) and cationic (e.g. dioleoyltetramethylami Such chemotherapeutic agents (e.g., 5-FU, MTX and oligo nopropyl DOTAP and dioleoyl-phosphatidyl ethanolamine nucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti DOTMA). inflammatory drugs, including but not limited to nonsteroidal For topical or other administration, oligonucleotides of the anti-inflammatory drugs and corticosteroids, and antiviral invention may be encapsulated within liposomes or may form 50 drugs, including but not limited to ribivirin, Vidarabine, acy complexes thereto, in particular to cationic liposomes. Alter clovirand ganciclovir, may also be combined in compositions natively, oligonucleotides may be complexed to lipids, in of the invention. Combinations of antisense compounds and particular to cationic lipids. Preferred fatty acids and esters, other non-antisense drugs are also within the scope of this pharmaceutically acceptable salts thereof, and their uses are invention. Two or more combined compounds may be used further described in U.S. Pat. No. 6,287,860. 55 together or sequentially. Compositions and formulations for oral administration In another related embodiment, compositions of the inven include powders or granules, microparticulates, nanoparticu tion may contain one or more antisense compounds, particu lates, Suspensions or solutions in water or non-aqueous larly oligonucleotides, targeted to a first nucleic acid and one media, capsules, gel capsules, Sachets, tablets or minitablets. or more additional antisense compounds targeted to a second Thickeners, flavoring agents, diluents, emulsifiers, dispersing 60 nucleic acid target. For example, the first target may be a aids or binders may be desirable. Preferred oral formulations particular antisense sequence of Vascular Endothelial Growth are those in which oligonucleotides of the invention are Factor (VEGF), and the second target may be a region from administered in conjunction with one or more penetration another nucleotide sequence. Alternatively, compositions of enhancers surfactants and chelators. Preferred surfactants the invention may contain two or more antisense compounds include fatty acids and/or esters or salts thereof, bile acids 65 targeted to different regions of the same Vascular Endothelial and/or salts thereof. Preferred bile acids/salts and fatty acids Growth Factor (VEGF) nucleic acid target. Numerous and their uses are further described in U.S. Pat. No. 6,287, examples of antisense compounds are illustrated herein and US 9,410,155 B2 39 40 others may be selected from among Suitable compounds portion of the targeted gene, or (ii) capable of forming a stable known in the art. Two or more combined compounds may be duplex with a portion of an mRNA transcript of the targeted used together or sequentially. gene. Dosing: Selection of appropriate oligonucleotides is facilitated by The formulation of therapeutic compositions and their sub using computer programs that automatically align nucleic sequent administration (dosing) is believed to be within the acid sequences and indicate regions of identity or homology. skill of those in the art. Dosing is dependent on severity and Such programs are used to compare nucleic acid sequences responsiveness of the disease state to be treated, with the obtained, for example, by searching databases such as Gen course of treatment lasting from several days to several Bank or by sequencing PCR products. Comparison of nucleic 10 acid sequences from a range of species allows the selection of months, or until a cure is effected or a diminution of the nucleic acid sequences that display an appropriate degree of disease state is achieved. Optimal dosing schedules can be identity between species. In the case of genes that have not calculated from measurements of drug accumulation in the been sequenced, Southern blots are performed to allow a body of the patient. Persons of ordinary skill can easily deter determination of the degree of identity between genes in mine optimum dosages, dosing methodologies and repetition 15 target species and other species. By performing Southern rates. Optimum dosages may vary depending on the relative blots at varying degrees of stringency, as is well known in the potency of individual oligonucleotides, and can generally be art, it is possible to obtain an approximate measure of identity. estimated based on EC50s found to be effective in invitro and These procedures allow the selection of oligonucleotides that in vivo animal models. In general, dosage is from 0.01 g to exhibit a high degree of complementarity to target nucleic 100g per kg of body weight, and may be given once or more acid sequences in a subject to be controlled and a lower degree daily, weekly, monthly or yearly, or even once every 2 to 20 of complementarity to corresponding nucleic acid sequences years. Persons of ordinary skill in the art can easily estimate in other species. One skilled in the art will realize that there is repetition rates for dosing based on measured residence times considerable latitude in selecting appropriate regions of and concentrations of the drug in bodily fluids or tissues. genes for use in the present invention. Following successful treatment, it may be desirable to have 25 An antisense compound is “specifically hybridizable' the patient undergo maintenance therapy to prevent the recur when binding of the compound to the target nucleic acid rence of the disease state, wherein the oligonucleotide is interferes with the normal function of the target nucleic acid administered in maintenance doses, ranging from 0.01 ug to to cause a modulation of function and/or activity, and there is 100g per kg of body weight, once or more daily, to once every a sufficient degree of complementarity to avoid non-specific 20 years. 30 binding of the antisense compound to non-target nucleic acid While various embodiments of the present invention have sequences under conditions in which specific binding is been described above, it should be understood that they have desired, i.e. under physiological conditions in the case of in been presented by way of example only, and not limitation. Vivo assays or therapeutic treatment, and under conditions in Numerous changes to the disclosed embodiments can be which assays are performed in the case of in vitro assays made in accordance with the disclosure herein without 35 The hybridization properties of the oligonucleotides departing from the spirit or scope of the invention. Thus, the described herein can be determined by one or more in vitro breadth and scope of the present invention should not be assays as known in the art. For example, the properties of the limited by any of the above described embodiments. oligonucleotides described herein can be obtained by deter All documents mentioned herein are incorporated herein mination of binding strength between the target natural anti by reference. All publications and patent documents cited in 40 sense and a potential drug molecules using melting curve this application are incorporated by reference for all purposes assay. to the same extent as if each individual publication or patent The binding strength between the target natural antisense document were so individually denoted. By their citation of and a potential drug molecule (Molecule) can be estimated various references in this document, Applicants do not admit using any of the established methods of measuring the any particular reference is “prior art” to their invention. 45 strength of intermolecular interactions, for example, a melt Embodiments of inventive compositions and methods are ing curve assay. illustrated in the following examples. Melting curve assay determines the temperature at which a rapid transition from double-stranded to single-stranded con EXAMPLES formation occurs for the natural antisense/Molecule com 50 plex. This temperature is widely accepted as a reliable mea The following non-limiting Examples serve to illustrate sure of the interaction strength between the two molecules. selected embodiments of the invention. It will be appreciated A melting curve assay can be performed using a cDNA that variations in proportions and alternatives in elements of copy of the actual natural antisense RNA molecule or a syn the components shown will be apparent to those skilled in the thetic DNA or RNA nucleotide corresponding to the binding art and are within the scope of embodiments of the present 55 site of the Molecule. Multiple kits containing all necessary invention. reagents to perform this assay are available (e.g. Applied Biosystems Inc. MeltDoctor kit). These kits include a suitable Example 1 buffer solution containing one of the double strand DNA (dsDNA) binding dyes such as ABI HRM dyes, SYBR Green, Design of Antisense Oligonucleotides Specific for a 60 SYTO, etc.). The properties of the dsDNA dyes are such that Nucleic Acid Molecule Antisense to and/or Sense they emit almost no fluorescence in free form, but are highly Strand of Vascular Endothelial Growth Factor fluorescent when bound to dsDNA. (VEGF) Polynucleotide To perform the assay the cDNA or a corresponding oligo nucleotide are mixed with Molecule in concentrations As indicated above the term "oligonucleotide specific for 65 defined by the particular manufacturer's protocols. The mix or "oligonucleotide targets' refers to an oligonucleotide hav ture is heated to 95°C. to dissociate all pre-formed dsDNA ing a sequence (i) capable of forming a stable complex with a complexes, then slowly cooled to room temperature or other US 9,410,155 B2 41 42 lower temperature defined by the kit manufacturer to allow Primers and probe for the custom designed Taqman assay the DNA molecules to anneal. The newly formed complexes for the VEGF natural antisense VEGFA (SEQ ID NO: 10) are then slowly heated to 95°C. with simultaneous continu (FIG. 6) ous collection of data on the amount of fluorescence that is produced by the reaction. The fluorescence intensity is inversely proportional to the amounts of dsDNA present in Target sequence VEGFA exon 1 : (SEQ ID NO : 10) the reaction. The data can be collected using a real time PCR ATGCCAAGTGGTCCCAGGCTGCACC instrument compatible with the kit (e.g. ABI's StepOne Plus Real Time PCR System or LightTyper instrument, Roche Forward Primer Sequence Diagnostics, Lewes, UK). 10 Veg fas1 ANYf: Melting peaks are constructed by plotting the negative (SEQ ID NO: 11) derivative of fluorescence with respect to temperature (-d GTAGCCTGTCCCCTTCAAGAG (Fluorescence)/dT) on the y-axis) against temperature Veg fas2 ANYf: (SEQ ID NO: 12) (X-axis) using appropriate Software (for example LightTyper 15 (Roche) or SDS Dissociation Curve, ABI). The data is ana GCGGATAGCCTGGGAGCTA lyzed to identify the temperature of the rapid transition from Reverse Primer Sequence dsDNA complex to single strand molecules. This temperature Veg fas1 ANYR: is called Tm and is directly proportional to the strength of (SEQ ID NO: 13) interaction between the two molecules. Typically, Tm will CAGACATCCTGAGGTGTGTTCT exceed 40° C. Veg fas2 ANYR: (SEQ ID NO: 14) Example 2 TGTTCGGTTGCTGTGACTGT

25 Reporter Dye: FAM Modulation of VEGF Polynucleotides Veg fas1 ANYM1 : (SEQ ID NO: 15) HepG2 cells from ATCC (cat #HB-8065) were grown in ATGCCTGCCAAGCCCA growth media (MEM/EBSS (Hyclone cat #SH30024, or Mediatech cat HMT-10-010-CV)+10% FBS (Mediatech cat Veg fas2 ANYM1 : iMT35-011-CV)+penicillin/streptomycin (Mediatech cat 30 (SEQ ID NO: 16) #MT30-002-CI)) at 37° C. and 5% CO. One day before the CAGCCAGCCCTCTGC experiment the cells were replated at the density of 1.5x10/ Results: ml into 6 well plates and incubated at 37°C. and 5% CO. On the day of the experiment the media in the 6 well plates was VEGFAas RNA Downregulation changed to fresh growth media. All antisense oligonucle 35 Real time PCR results show that the levels of the VEGFA otides were diluted to the concentration of 20 LM. Two ul of mRNA in HepG2 cells are significantly increased 48 h after this solution was incubated with 400 ul of Opti-MEM media treatment with one of the siRNAs designed to vegfaas (ve (Gibco cat #31985-070) and 4 ul of Lipofectamine 2000 faas 1 2, P=0.05), and possibly with the second, Vefaas 13 (Invitrogen cat #11668019) at room temperature for 20 min 40 (P=0.1, FIG. 1A). In the same samples the levels of vegfaas and applied to each well of the 6 well plates with HepG2 cells. RNA were significantly decreased after treatment with either Similar mixture including 2 ul of water instead of the oligo Vefaas1 2 or Vefaas 13, but unchanged after treatment with nucleotide solution was used for the mock-transfected con vefaas 15, which also had no effect on the VEGFA mRNA trols. After 3-18 h of incubation at 37° C. and 5% CO, the levels (FIG. 1B). media was changed to fresh growth media. 48 h after addition 45 VEGRas RNA Downregulation of antisense oligonucleotides the media was removed and Real time PCR results show that the levels of the VEGFA RNA was extracted from the cells using SV Total RNA. Iso lation System from Promega (cat #Z3105) or RNeasy Total mRNA in HepG2 cells are significantly increased 48 h after RNA. Isolation kit from Qiagen (cat #74181) following the treatment with two of the siRNAs designed to vegRas (veg manufacturers instructions. 600 ng of RNA was added to the 50 Ras1 2, P=0.02 and vegRas13, P=0.06, FIG. 1C). The reverse transcription reaction performed using Verso cDNA results for the change in VegRas RNA levels are pending. kit from Thermo Scientific (cat #ABI4538) or High Capacity Although the invention has been illustrated and described cDNA Reverse Transcription Kit (cat #4368813) as described with respect to one or more implementations, equivalent in the manufacturer's protocol. The cDNA from this reverse alterations and modifications will occur to others skilled in transcription reaction was used to monitor gene expression by 55 the art upon the reading and understanding of this specifica real time PCR using ABI Taqman Gene Expression Mix (cat tion and the annexed drawings. In addition, while a particular #4369510) and primers/probes designed by ABI (Applied feature of the invention may have been disclosed with respect Biosystems Taqman Gene Expression Assay: to only one of several implementations, such feature may be Hs00173626 ml by Applied Biosystems Inc., Foster City combined with one or more other features of the other imple Calif.). The following PCR cycle was used: 50° C. for 2 min, 60 mentations as may be desired and advantageous for any given 95°C. for 10 min, 40 cycles of (95°C. for 15 seconds, 60° C. or particular application. for 1 min) using StepOne Plus Real Time PCR Machine (Applied Biosystems). The Abstract of the disclosure will allow the reader to Fold change in gene expression after treatment with anti quickly ascertain the nature of the technical disclosure. It is sense oligonucleotides was calculated based on the difference 65 submitted with the understanding that it will not be used to in 18S-normalized dOt values between treated and mock interpret or limit the scope or meaning of the following transfected samples. claims.

US 9,410,155 B2 47 48 - Continued

Ctggaa.gctg ggagctgagg galagaggcaa giggttgagg CCt99tgggg gCttcaatgt 54 O cc.gcacagcc gtggaggcag acaagatggt gtgggggaaa gggcagggca Caggtgctict citct cagt ct citctitt coct ggaagct citt ggtgatgcaa acg 643

<210s, SEQ ID NO 3 &211s LENGTH: 513 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2) . . (2) <223> OTHER INFORMATION: n is a

<4 OOs, SEQUENCE: 3 antggagaca ggctgggatc agcactgctg gcact accca gcc acgc.ca.g atttagg to a 6 O gggaaact C9 Ctgggaagga agaccc.cagg gtctt.cocto Cccagaggtg gaga.gcacag 12 O gccacagtica gttggtgggga gagcc agtgt gtc.cccagag aactgggagg atcCaalacca 18O

Caacggaaca aaaggcaggc ggacticgggg ggg.cggatag Cctgggagct 24 O acagc.ca.gcc Ctctgctggc cgtgggaggg acagt cacag caa.ccgaaca tag to aagtg 3OO gggittatcto caccc.ccaaa ggaatgcaaa cCaggaaagg gaggggagat cc cattaggc 360 tgagcc ct ct tcc cca.gc.cc aggcttgggg aac agggg.cg atgg tagggg Caagtggittt

Ctgggit coct agc cct gcgt. gaaacgggitt ccagaccaaa gag.ccctgat gaaggcatgt 48O cit citat attac totatic cotic titc.cccagcc Cag 513

<210s, SEQ ID NO 4 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 4

Ctgagcaggc tiggtgttgct cittggitt 27

<210s, SEQ ID NO 5 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 5 acagacat Co taggtgtgt totcttg 27

<210s, SEQ ID NO 6 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 6 gtttgcatca cca agagctt cCaggga 27

<210s, SEQ ID NO 7 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide US 9,410,155 B2 49 50 - Continued

<4 OO > SEQUENCE: 7 cagoagtgct gatcc.cagcc tdt ct co 27

<210s, SEQ ID NO 8 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 8 gtatatagag acatgcct tc at Caggg 27

<210s, SEQ ID NO 9 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 9 ggctggctgt agctico Cagg ctatc.cg 27

<210s, SEQ ID NO 10 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 10 atgccaagtg gtcc.caggct gcacc 25

<210s, SEQ ID NO 11 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 11 gtag cctgtc. cccttcaaga g 21

<210s, SEQ ID NO 12 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 12 gcggatagcc tiggagcta 19

<210s, SEQ ID NO 13 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 13

Caga catcct gaggtgttgtt ct 22

<210s, SEQ ID NO 14

US 9,410,155 B2 65 66 - Continued cc cct tcc to gggtgcagcc taaaaggacc tatgtcc to a caccattgaa accactagtt 542O

Ctgtc.ccc cc aggagacctg gttgttgttgttgttgagtggit tacct tcct C catc.ccctg 548 O gtcCtt CCct tcc ctitcc.cg aggcacagag agaCagggca ggat.ccacgt gcc cattgttg 554. O gaggcagaga aaa.gagaaag togttittatat acgg tactta tittaatat co citttittaatt 5 6.OO agaaattaaa acagttaatt taattaaaga gtagggittitt ttitt cagtat t cittggittaa 566. O tatttaattt caactattta tdagatgitat cittittgct ct citcttgct ct cittatttgta 572 O ccggitttittg tatataaaat t catgtttico aatct ct citc. tcc ctdatcg gtgacagtica 578 O. ctagottatc ttgaacagat atttaattitt gctaacactic agctctg.ccc ticcc.cgatcc 584 O cctggctic cc cagcacacat tcc tittgaaa taaggtttca atata catct acatactata 59 OO tatatatttg gcaacttgta tttgttgtgta tatatatata tatatgttta totatatatg 596 O tgattctgat aaaatagaca ttgct attct gttttittata totaaaaa.ca aaacaagaaa 6O20 aaatagagaa ttctacatac taaatctotc. tcc titttitta attittaatat ttgttat cat 608 O ttatttattg gtgctact.gt titatic cqtaa taattgttggg gaaaagatat taa catcacg 614 O totttgtctic tagtgcagtt titt cqagata titc.cg tagta catatttatt tittaaacaac 62OO gacaaagaaa tacagatata t cittaaaaaa aaaaaag cat tttgt attaa agaatttaat 626 O tctgat ct ca a 6271

30 What is claimed is: comprising, peptide nucleic acids, locked nucleic acid (LNA) 1. A synthetic, modified oligonucleotide of 15 to 30 nucle molecules, analogues, derivatives and/or combinations otides in length comprising at least one modification wherein thereof. the modification comprises at least one internucleotide link 6. The oligonucleotide of claim 1, wherein the oligonucle age of alkylphosphonate, phosphorothioate, phospho 35 otide comprises a modified Sugar moiety comprising a 2'-O- rodithioate, alkylphosphonothioate, phosphoramidate, car methoxyethyl modified Sugar moiety, a 2'-methoxy modified bamate, carbonate, phosphate triester, acetamidate, Sugar moiety, a 2'-O-alkyl modified Sugar moiety, or a bicy carboxymethyl ester, or combinations thereof, wherein said clic Sugar moiety. oligonucleotide is an antisense compound which specifically 7. The oligonucleotide of claim 1, wherein the oligonucle hybridizes and is at least 90% complementary to a human 40 otides comprise the sequences set forth as SEQID NOS: 4 to natural antisense polynucleotide of a Vascular Endothial 9. Growth Factor gene and upregulates expression and/or func 8. A composition comprising one or more oligonucleotides tion of said Vascular Endothelial Growth Factor (VEGF) gene according to claim 1 and a pharmaceutically acceptable in vivo or in vitro as compared to a control. excipient. 2. The oligonucleotide of claim 1, wherein the at least one 45 9. The composition of claim 8, wherein the oligonucle modification comprises a combination of phosphorothioate otides comprise a nucleotide sequence identity of at least internucleotide linkages and at least one intemucleotide link about 90% as compared to any one of the nucleotide age selected from the group consisting of alkylphosphonate, sequences set forth as SEQID NOS: 4 to 9. phosphorodithioate, alkylphosphonothioate, phosphorami 10. The composition of claim 8, wherein the oligonucle date, carbamate, carbonate, phosphate triester, acetamidate, 50 otides comprise nucleotide sequences set forth as SEQ ID carboxymethyl ester, and/or combinations thereof. NOS: 4 to 9. 3. The oligonucleotide of claim 1, wherein said oligonucle 11. The composition of claim 10, wherein the oligonucle otide comprises at least one phosphorothioate internucleotide otides set forth as SEQID NOS: 4 to 9 comprise one or more linkage. modified or substituted nucleotides. 4. The oligonucleotide of claim 1, wherein said oligonucle 55 12. The composition of claim 8, wherein the modified otide comprising a backbone of phosphorothioate internucle nucleotides comprise modified bases comprising phosphor otide linkages. thiorate, methylphosphonate, peptide nucleic acids, locked 5. The oligonucleotide of claim 1, wherein the oligonucle nucleic acid (LNA) molecules. otide optionally comprises at least one modified nucleotide k k k k k