Neotrygon Ningalooensis N. Sp. (Myliobatoidei: Dasyatidae), a New Maskray from Australia

aqua, International Journal of Ichthyology

Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia

Peter R. Last, William T. White* and Melody Puckridge

CSIRO Marine & Atmospheric Research, GPO Box 1538, Hobart, TAS 7001, AUSTRALIA *Corresponding author: [email protected]

Received: 30 October 2009 – Accepted: 04 February 2010

Abstract gut unterscheiden lassen. Neotrygon ningalooensis und N. ley- A new maskray, Neotrygon ningalooensis n. sp., is landi zeigen beide eine Schmuckzeichnung auf dem described from material collected near Coral Bay in the Rücken, haben aber nicht die lebhaft blauen Flecken, wie sie Ningaloo Marine Park, off the central coast of Western für N. kuhlii typisch sind. Durch Molekularanalyse ließ sich Australia, where its distribution appears to be restricted bestätigen, dass die drei sympatrischen Arten im Ningaloo- and patchy. However, other recently accessed material, col- Gebiet tatsächlich getrennte Arten sind. lected further south (Shark Bay, Western Australia) and east (Gove, Northern Territory), suggest that this species is Résumé more widespread. Like other members of the genus Neotry- Une nouvelle raie masquée, Neotrygon ningalooensis sp. gon, it lives primarily on sandy substrates but often hides nov. est décrite sur base de matériel collecté près de Coral partly concealed beneath small coral bommies during the Bay, dans le Ningaloo Marine Park, au large de la côte cen- day. Its eyes are relatively more protrusible than its con- trale de l’Australie occidentale où sa distribution paraît geners enabling it to bury deeply in soft sediments with its réduite et clairsemée. D’autres exemplaires accessibles eyes still exposed. The type specimens were speared in shal- depuis peu, collectés plus au sud (Shark Bay, Australie occi- low water near the shore in close association with two con- dentale) et à l’est (Gove, Territoire du Nord), suggèrent que geners, N. leylandi and N. kuhlii, from which it differs in cette espèce est plus largement répartie. Comme d’autres colour and morphology. Neotrygon ningalooensis and N. membres du genre Neotrygon, elle vit surtout sur des sub- ley landi both have an ornate dorsal coloration but lack the strats sableux, mais se cache souvent en partie sous de vivid blue spots typical of N. kuhlii. Molecular analysis has petites branches coralliennes le jour. Ses yeux sont relative- confirmed that the three sympatric species at Ningaloo are ment plus proéminents que chez ses congénères, lui per - specifically distinct. mettant de s’enfoncer profondément dans des sédiments mous, les yeux restant apparents. Les spécimens types ont Zusammenfassung été harponnés en eau peu profonde, près de la plage, en Die neue Maskenrochen-Art Neotrygon ningalooensis sp. proche association avec deux congénères, N. leylandi et N. nov. wird nach Material beschrieben, das nahe der Coral Bay kuhlii, dont elle diffère par la couleur et la morphologie. im Nongaloo Marine Park vor der mittleren Küste Westaus- Neotrygon ningalooensis et N. leylandi ont tous deux une traliens gefangen worden war, wo das Vorkommen offenbar riche coloration dorsale, mais n’ont pas les taches bleu vif beschränkt und lückenhaft ist. Weiteres, erst seit kurzem typiques de N. kuhlii. L’analyse moléculaire a confirmé que verfügbares Material, das weiter südwärts (Shark Bay, West- les trois espèces sympatriques de Ningaloo sont des espèces Australien) und ostwärts (Gove, Northern Territory) gefan- distinctes. gen wurde, legt den Schluss nahe, dass diese Art doch weiter verbreitet ist. Wie andere Vertreter der Gattung Neotrygon Sommario auch leben die Tiere der neuen Art vorwiegend über sandi- Una nuova razza mascherata, Neotrygon ningalooensis n. gem Grund, verstecken sich aber tagsüber gerne zwischen sp., è descritta sulla base di materiale raccolto presso la Korallengestein so, dass sie nur teilweise sichtbar sind. Die Coral Bay del parco marino Ningaloo, situato al largo della Augen treten bei ihnen stärker hervor als bei anderen Arten costa centrale della Western Australia, dove sembra essere der Gattung, sodass sie sich tief in weiches Sediment ein- confinato seppur con una distribuzione disomogenea. graben können, mit den Augen aber noch herausgucken. Altro materiale acquisito recentemente, raccolto più a sud Die Typus-Exemplare wurden in flachem Wasser nahe der (Shark Bay, Western Australia) e ad est (Gove, Northern Küste mit dem Speer erbeutet, wo sie mit zwei anderen Territory), suggerisce che la diffusione di questa specie è in Angehörigen der Gattung: N. leylandi und N. kuhlii, eng realtà più ampia. Come altri membri del genere Neotrygon, vergesellschaftet sind, die sich aber nach Farbe und Gestalt abita principalmente i fondali sabbiosi e spesso durante il

37 aqua vol. 16 no. 2 - 20 April 2010 Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia giorno si occulta parzialmente sotto isolati affioramenti di N. leylandi and no collection location was speci- barriera corallina (bommies). Gli occhi sono relativamente fied. In a subsequent field trip in late 2008, two più protrusibili di quelli dei congeneri consentendole di specimens of the unidentified species were col- in fossarsi in profondità nei sedimenti mantenendo gli lected near Coral Bay in the central area of the occhi ancora esposti. Gli esemplari tipo sono stati arpi- onati in acque poco profonde presso il litorale in stretta park. In addition, a colleague (J. Vaudo), working associazione con due congeneri, N. leylandi e N. kuhlii, dai in the Shark Bay World Heritage Area, recently quali differisce per la colorazione e la morfologia. Neotry- provided underwater photographs and specimens gon ningalooensis e N. leylandi posseggono entrambi una of a similar form from shallow regions of the east- colorazione dorsale ornata ma mancano delle vivide mac- ern gulf. While this manuscript was being chie blu tipiche di N. kuhlii. L’analisi molecolare ha con- reviewed, K. Jensen and J. N. Caira provided a fermato che le tre specie simpatriche presenti a Ningaloo photograph of a mature male specimen speared in sono specie distinte. 1999 near Gove (Northern Territory), which closely resembles this species in coloration. INTRODUCTION Tissue samples obtained from the two captured The Ningaloo Marine Park (NMP), which specimens were DNA barcoded to provide a com- stretches for over 300 km along the western Aus- parison with sympatric congeners. The use of tralian coastline, contains a high diversity of marine DNA barcoding, the sequencing of a ca 655 bp habitats and is considered a global biodiversity region of the mitochondrial cytochrome c oxidase hotspot (Waples & Hollander, 2008). In 1987, the I (COI) gene, has proven to be highly effective at region was declared a marine park and since 2004, discriminating between chondrichthyan species with the establishment of the Ningaloo Research (Ward et al. 2008). Morphological and molecular Program, there has been a surge in research projects data helped confirm that this maskray is unde- in this important area. The NMP and the more scribed. In the following paper, we provide a southern Shark Bay region have surprisingly rich description of this new species and compare it with ray faunas, including at least three sympatric species other members of the genus Neotrygon. of maskrays of the genus Neotrygon. The genus Neotrygon Castelnau was resurrected as MATERIALS AND METHODS a valid generic name for a group of maskrays by Characteristics of the disc (including squamation, Last & White (2008), whose members were previ- tooth row counts and meristic counts) follow stan- ously assigned to the genus Dasyatis. These authors dards used in Manjaji (2004) and Manjaji-Mat- provided a definition of this genus and description sumoto & Last (2006). Meristics were obtained of a new species, and listed four valid nominal from radiographs of the holotype (CSIRO H species: the Australian endemics N. annotata (Last, 6827–01) and paratype (CSIRO H 6826–01) of 1987), N. leylandi (Last, 1987), N. picta Last & the new species. Morphometric methods, includ- White, 2008, and the wide-ranging Indo-West ing tail fold measurements, follow Last & White Pacific N. kuhlii (Müller & Henle, 1841). Prior to (2008). A total of 63 measurements, expressed as the description of N. annotata and N. leylandi, proportional measurements of disc width (DW), only a single species was considered to occur across were taken for the holotype and paratype. Three the Indo-West Pacific. A phylogenetic analysis of Shark Bay specimens, resembling the new species, this genus is currently underway by one of the were also measured in full. Comparative morpho- junior authors (MP). metrics and meristics for N. leylandi and N. picta In 2007, a field-based project was funded by were provided by Last & White (2008). Since the Western Australian Marine Science Institute posterior tail was damaged in both types of the new (WAMSI) to define the species composition of species, only a subsample of the tail fold measure- sharks and rays in the NMP and examine their spe- ments could be taken. Types were deposited in the cific habitat requirements. On the first trip, an Australian National Fish Collection (CSIRO), at unidentifiable species of Neotrygon, was observed the Commonwealth Scientific and Industrial in shallow-water at two localities. Its striking Research Organisation’s Marine Laboratories in colour pattern differs markedly from two sym- Hobart (Tasmania). patric nominal species, N. kuhlii and N. leylandi, Following protocols outlined in Ward et al. but resembles a specimen figured by Kuiter & (2005), COI sequences were obtained and aligned Debelius (2006); they misidentified this species as using ClustalX software program and analysed in aqua vol. 16 no. 2 - 20 April 2010 38 Peter R. Last, William T. White and Melody Puckridge

MEGA 4.0 (Tamura et al. 2007). Using the from snout tip 1.85 (1.92) times in distance from Kimura two parameter (K2P) distance model tip of snout to pectoral-fin insertion; body rela- (Kimura 1980), within and between group dis- tively flattened, thickness 7.4 (7.5) times in disc tance values were calculated and a neighbour-join- width, not raised markedly above cranium; ante- ing tree was constructed to give a graphical repre- rior margin of disc straight to weakly convex; apex sentation of divergence patterns between species. broadly rounded, not angular, pectoral angle 84° Bootstrapping was performed with 1,000 replica- (94°); posterior margin weakly convex; free rear tip tions. broadly angular. Pelvic fins narrowly triangular, anterior margin almost straight, apex narrowly angular, posterior margin moderately convex, Neotrygon ningalooensis n. sp. united with inner margin (free rear tip indis- (Figs 1, 2a, 3–7a, 8; Tables I and II) cernible); of moderate size, length 24.3% (25.3%) DW; 1.61 (1.54) times width across fin bases. Dasyatis leylandi (not Last): Kuiter & Debelius, Claspers of adult males large, subcylindrical to 2006: p 51, fig. (misidentification). moderately depressed, tapering, acutely pointed apically (asymmetric apically in paratype); outer Holotype: CSIRO H 6827–01, adult male 302 length 16.8–17.6% DW. mm DW, Five Fingers Reef, Coral Bay, Western Australia, 23°10’S, 113°45’E, 3 m, 10 December 2008. Paratype: CSIRO H 6826–01, adult male 291 mm DW, Five Fingers Reef, Coral Bay, Western Aus- tralia, 23°10’S, 113°45’E, 3 m, 9 December 2008. Other material. CSIRO H 7046–01, adult male 260 mm DW, CSIRO H 7046–02, female 299 mm DW, WAM P 33140–001, female 261 mm DW, Red Cliff Bay, Shark Bay (eastern Gulf), Western Australia, 25°46’S, 113°41’E, 1.5 m, 12 August 2009. Diagnosis: A relatively large Neotrygon (reaching at least 30 cm DW) with the following combina- tion of characters: disc weakly quadrangular, A slightly broader than long, width about 1.1 times length; pectoral apices broadly rounded; snout fleshy, broadly rounded, angle 110–123°, length 2.1–2.4 times interorbital width; preoral length 2.1–2.4 times mouth width; internasal distance about 1.2 in prenasal length; interspiracular distance 14.8–15% DW; nostril length 4–4.2% DW; nasal curtain width 9.2–10.8% DW; mouth width 8.1–10.5% DW; body and tail naked except for 4–5 thornlets in single continuous row in nuchal region; pectoral-fin radials 105–107; total vertebral centra (including synarcual) 125–126, trunk centra (including synarcual) 37–42; dorsal coloration with a dense, asymmetric scattering of small, orange spots and larger bluish white blotches. B Description: Disc weakly quadrangular, broadly rounded anteriorly and barely produced, slightly Fig. 1A-B. Underwater photographs of Neotrygon ningaloo - broader than long; width 1.13 times length in ensis n. sp.: A. adult male, Bundegi Reef in Ningaloo Marine holotype (1.13 in paratype); axis of greatest width Park. Photo by F. Cerutti; B. adult male, Red Cliff Bay in the of disc just forward of scapular region, its distance Shark Bay World Heritage Area. Photo by J. Vaudo.

39 aqua vol. 16 no. 2 - 20 April 2010 Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia

Fig. 2A-B. Dorsal view: A. Neotrygon ningalooensis n. sp., adult male holotype (CSIRO H 6827–01, 302 mm DW, fresh); B. Neotrygon leylandi n. sp., adult male (CSIRO H 6828–01, 241 mm DW, fresh). aqua vol. 16 no. 2 - 20 April 2010 40 Peter R. Last, William T. White and Melody Puckridge

Tail damaged beyond sting in both types; moder- coincident with apex of second sting, no low ridge ately broad-based, tapering rapidly to stinging before elevated portion, tallest just posterior to tip spines, with two skin folds (folds damaged in of intact stinging spine; elevated portion slightly paratype); base moderately depressed, broadly oval less than snout length. Ventral skin fold relatively in cross section, weakly convex above and below, short, about 42% of disc width, relatively deep, width 1.48 (1.54) times depth; subcircular to tapering, deepest below middle of dorsal skin fold; rhomboidal in cross section near origin of ventral much longer and distinctly taller than dorsal skin skin fold, width 1.74 (1.29–1.82) times height at fold; length 2.37 in disc width; depth at quarter fold origin; tapering evenly in dorsoventral view length 0.60 (0.70–0.90), at mid length 0.93 posterior to stinging spines; moderately com- (0.75–1.22), at three quarter 0.59 (0.18–0.97) in pressed at end of stinging spines; damaged distally adjacent tail height; originating almost below first beyond folds in both types; prominent dorsal and sting origin; distance from cloaca to sting origin ventral skin folds; compressed suboval in cross sec- 1.88 (1.98) in precloacal length. tion above mid ventral fold, width 0.68 Snout fleshy, short, broadly rounded; not acute at (0.72–0.82) times depth; at end of fold rhom- apex, but without obvious apical lobe; angle 110° boidal, width 0.61 (0.93–1.13) times height; dor- (123°); narrowly rounded when viewed laterally, sal surface of tail posterior to stinging spine bases becoming slightly more depressed towards apex; with a weak naked groove (partly housing second preoral snout length 1.70 (1.39) times mouth sting and extending for about half of its length); no width, 1.65 (1.86) times internarial distance, 0.80 skin folds present along lateral margin of tail. Dor- (0.81) times distance between first gill slits; direct sal skin fold well developed, short-based, pro- preorbital snout length 2.44 (2.14) times interor- nounced, length about 11 times its height, 1.26 in bital length; snout to maximum disc width 2.40 snout length, 3.13 in length of ventral fold; its (2.49) in DW; interorbital space narrow, weakly height 1.28 in height of mid-ventral fold; origin concave; eyes large, dorsolateral, strongly protrud-

Fig. 3. Ventral view of Neotrygon ningalooensis n. sp., adult male holotype (CSIRO H 6827–01, 302 mm DW, fresh).

41 aqua vol. 16 no. 2 - 20 April 2010 Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia

Table I. Morphometric data for the holotype of Neotrygon ningalooensis n. sp. (CSIRO H 6827–01), paratype (CSIRO H 6826–01) and ranges for 3 other specimens, with ranges provided for 3 types of Neotrygon leylandi and 7 types of Neotrygon picta. Measurements expressed as a percentage of disc width.

N. ningalooensis N. leylandi N. picta Other material Holotype Paratype Range Range Range Disc width (mm) 302.0 291.0 260–299 190–254 183–275 Total length dam. dam. 184.3–188.3 180.7–198.4 163.6–205.1 Disc length 88.5 88.9 86.9–90.2 79.2–86.3 83.2–87.3 Snout to pectoral-fin insertion 77.2 77.2 76.0–79.9 70.6–75.9 73.0–77.2 Disc thickness 13.6 13.4 14.0–14.9 10.4–11.8 9.8–12.4 Snout (preorbital) length 16.9 16.1 15.2–17.8 16.7–18.5 16.4–18.1 Snout (preorbital) horizontal length 13.5 12.2 12.8–15.1 15.2–15.9 13.5–15.9 Pelvic-fin (embedded) length 24.3 25.3 22.7–25.4 20.5–21.9 20.2–22.4 Width across pelvic-fin base 15.1 16.4 15.8–16.7 13.7–17.4 14.0–18.0 Greatest width across pelvic fins 3.3 37.6 37.4–46.2 24.5–31.0 20.9–34.9 Cloaca origin to tail tip dam. dam. 109.2–110.2 112.6–130.0 92.1–131.6* Tail width at axil of pelvic fins 8.3 8.8 8.1–8.8 7.5–8.2 6.6–8.2 Tail height at axil of pelvic fins 5.6 5.7 5.4–5.7 4.4–5.0 4.9–6.2 Pectoral-fin insertion to sting origin 37.7 39.0 35.9–40.6 36.1–38.8 35.6–39.6 Cloaca origin to sting 38.7 37.9 32.3–42.4 37.3–39.5 36.0–41.4 Tail width at base of sting 4.3 3.8 3.3–4.2 3.1–3.3 3.0–3.3 Tail height at base of sting 3.4 3.3 3.2–3.5 2.6–3.1 2.5–3.4 Sting 1 length 16.3 18.8 14.5–22.2 15.6–15.6 13.4–20.2 Sting 2 length 22.3 23.1 21.2–21.3 18.5–18.5 16.0–23.5 Snout preoral (to lower jaw) length 13.8 14.7 14.4–15.5 16.7–18.3 15.9–18.8 Mouth width 8.1 10.5 9.8–10.9 6.4–7.1 7.1–8.1 Distance between nostrils 8.3 7.9 7.4–8.3 7.0–7.4 7.0–8.5 Interorbital width 6.9 7.5 7.5–8.5 8.1–9.2 8.3–9.7 Inter-eye width 16.7 18.5 19.2–21.4 14.0–14.7 14.1–15.9 Snout to maximum width 41.7 40.1 35.5–40.2 36.8–38.8 37.8–41.5 Eye length 5.7 6,3 6.0–6.5 5.1–5.6 5.1–6.2 Orbit diameter 10.0 9.3 7.9–9.6 6.9–8.4 6.3–7.7 Spiracle length 7.9 7.4 7.7–8.4 5.4–6.1 5.2–6.3 Interspiracular width 15.0 14.8 15.2–16.4 12.7–13.3 13.2–14.6 Orbit and spiracle length 12.2 11.5 10.5–12.2 8.9–10.3 8.9–10.7 Nostril length 4.2 4.0 4.4–4.9 2.6–3.0 3.2–3.6 Snout prenasal length 10.1 9.7 10.4–11.3 12.5–13.6 12.2–14.4 Nasal curtain length 4.8 5.9 6.0–6.4 4.4–5.9 4.8–7.2 Nasal curtain width 9.2 10.8 10.7–11.4 7.8–8.5 8.8–9.9 Orbit to pectoral-fin insertion 53.3 54.0 53.2–56.5 47.8–54.7 49.9–54.3 Snout to origin of cloaca 72.8 75.0 73.1–78.4 68.2–73.2 69.3–73.4 Width 1st gill slit 2.8 3.1 3.0–3.9 2.8–3.1 2.9–3.7 Width 3rd gill slit 3.4 3.4 3.7–3.9 3.0–3.2 2.8–3.5 Width 5th gill slit 2.5 2.6 2.3–2.9 2.1–2.1 1.9–2.3 Head length 40.2 39.8 39.5–42.1 38.3–38.8 38.2–42.3 Distance between 1st gill slits 17.3 18.0 18.2–18.4 15.3–16.2 15.2–17.1 Distance between 5th gill slits 9.6 9.5 9.8–10.3 8.5–9.1 8.7–10.2 Cloaca length 5.7 5.4 5.3–7.0 4.5–6.3 4.6–6.7 Clasper postcloacal length 24.7 24.1 26.2–26.2 20.0–20.0 20.8–23.3 Clasper length from pelvic axil 16.8 17.6 17.5–17.5 12.9–12.9 13.7–15.3 * this measurement is corrected from Last & White (2008) which had incorrect values. ing, ventral margin partly covered by thick skin distance 2.92 (2.94) times eye length. Spiracles fold; orbit greatly elevated above disc and interor- large, crescentic with dorsolateral opening; dorsal bital space, diameter 0.79 (0.79) in spiracle length, margin with a medial protruberance. Nostril nar- eye length 1.38 (1.18) in spiracle length; inter-eye rowly oval to slit-like, directed longitudinally to aqua vol. 16 no. 2 - 20 April 2010 42 Peter R. Last, William T. White and Melody Puckridge

Table II. Morphometry of the dorsal and ventral skin folds of the holotype of Neotrygon ningalooensis n. sp. (CSIRO H 6827.01) and ranges for the 3 other specimens, with ranges and means provided for 3 types of Neotrygon leylandi and 7 types of Neotrygon picta. Measurements expressed as a percentage of disc width.

N. ningalooensis N. leylandi N. picta Holotype Range Range Range

Dorsal fold base length 13.5 12.7–19.4 21.7–25.2 17.3–28.5 Dorsal fold maximum height 1.2 1.3–1.8 1.3–2.0 0.9–1.4 Ventral fold base length 42.2 54.1–59.7 56.8–68.9 54.8–77.6 Tail width at mid-length of ventral fold 1.6 1.3–1.5 1.2–1.2 0.8–1.2 Tail height at mid-length of ventral fold 2.4 1.9–2.7 1.6–1.8 1.2–1.6 Fold height at mid-length of ventral fold 1.6 1.6–2.0 1.0–1.2 1.0–1.6 Ventral fold origin to sting origin interspace 1.1 1.8–3.9 1.3–2.3 0.7–2.9 slightly oblique; anterior margin fleshy; anterior smooth edged, usually partly enveloped by narrow nasal fold internal, very narrow, membranous; posterior fold of nostril; posterior margin strongly broad oronasal groove present; internarial space fringed, concave medially, vaguely following con- 1.21 (1.24) in prenasal length, 1.98 (1.97) times tour of lower jaw, abutting most of lower jaw when nostril length. Nasal curtain relatively broadly mouth closed in paratype (not in holotype). skirt-like, short, width 1.91 (1.85 times length; Mouth small, jaws strongly asymmetric; lateral bilobed, posterior margin of each lobe moderately grooves shallow, curved slightly, extending from convex; surface crenulated, papillate, usually with nostril to slightly below lower jaw, length much weak medial groove and covered with minute shorter than nasal curtain length; not projecting pores; apex recessible within lateral margin of forward when open, not protrusible; skin on chin oronasal groove; lateral margin almost straight, and margin of lower jaw very fleshy, strongly papil-

Fig. 4. Denticle band on midline of dorsal disc of the adult male holotype of Neotrygon ningalooensis n. sp. (CSIRO H 6827–01, 302 mm DW, preserved).

43 aqua vol. 16 no. 2 - 20 April 2010 Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia late; teeth uniformly close-set in both jaws, in their base length; those at symphysis barely larger oblique rows, not arranged in quincunx, rows in than those laterally, directed lingually, with long upper jaw about 25. Upper jaw strongly arched, acute to bluntly pointed cusps, slightly less oblique strongly double convex; teeth of anterior part of than those posterolaterally. Teeth in lower jaw broad upper jaw only partly concealed when mouth closed; based, low, with semi-truncate to slightly concave symphysial part of jaw projecting anteroventrally. distal margins, those toward angle of lower jaw with Lower jaw strongly convex with truncate to weakly slightly shorter cusps. Floor of mouth with 2 very concave anterior margin, interlocking into upper jaw long, lobe-like, very closely spaced, medial oral papil- when mouth closed; teeth not visible when mouth lae; no smaller papilla near angle of each jaw. closed. Teeth in upper jaw of adult male holotype Gill openings elongate S-shaped, forming weakly small, similar in shape, cusps more or less subequal to fringed lobe laterally; length of first gill slit 1.13

Fig. 5. Oronasal region of Neotrygon ningalooensis n. sp., adult male holotype (CSIRO H 6827–01, 302 mm DW, preserved).

Fig. 6. Lateral view of the post-stinging spine tail of Neotrygon ningalooensis n. sp., adult male holotype (CSIRO H 6827–01, 302 mm DW, preserved). Tail tip damaged. aqua vol. 16 no. 2 - 20 April 2010 44 Peter R. Last, William T. White and Melody Puckridge

Fig. 7A-B. Lateral view of the head: A. Neotrygon ningalooensis n. sp., adult male holotype (CSIRO H 6827–01, 302 mm DW, fresh); B. Neotrygon leylandi n. sp., adult male (CSIRO H 6828–01, 241 mm DW, fresh).

45 aqua vol. 16 no. 2 - 20 April 2010 Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia

(1.22) times length of fifth gill slit, 2.91 (3.35) barely larger than those adjacent, angle at about times in mouth width; distance between first gill 45° to horizontal (appearing saw-shaped in lateral slits 2.07 (2.29) times internarial space, 0.43 view); lateral scapular thorns and denticles absent. (0.45) times ventral head length; distance between Two stinging spines, intact, second slightly longer fifth gill slits 1.16 (1.21) times internasal distance, than first; stinging spines very elongate, slender, 0.24 (0.24) times ventral head length. narrow-based, subequal to prespiracular length; Total pectoral-fin radials 106–107 (105–107); enveloping membrane thick, semi-deciduous, propterygium 41–42 (40–41), mesopterygium 21 intact in both types; distance from sting base to (19–20), metapterygium 44 (46). Pelvic-fin radi- pectoral-fin insertion 37.7% (39.0%) DW, 2.31 als: 1 (1) + 15–16 (16). Vertebral centra total (2.08) times first sting length; distance from cloaca (including synarcual) 126 (125); total (excluding to sting base 0.44 (0.43) in disc length. synarcual) 122 (119); monospondylous (including Colour in life: Dorsal surface pale brownish synarcual) 37 (42); monospondylous (excluding yellow, graduating to more intense brown along synarcual) 33 (36); pre-sting diplospondylous 58 margin of disc; densely punctuated with irregularly (57); post-sting diplospondylous 31 (26). distributed, orange (reddish brown) flecks and Squamation: Disc and tail lacking denticles, spots (mostly sharp-edged), and slightly larger pale except for single series of small, spear-shaped to bluish white pseudo-ocelli (outer margins diffuse, narrow lanceolate thornlets along mid-line of disc pale blue grey); mask poorly defined (or obvious as in nucho-scapular region; row continuous, with 5 darker brown regions, most prominent below and (4) closely spaced thornlets; row length much between eyes, and on central disc, extending as a shorter than interspiracular width; largest thornlet network along mid-disc); orange markings more

Fig. 8. Map of the known distribution of Neotrygon ningalooensis n. sp. off north-western Australia. Star denotes location of type specimens, closed circle denotes photographed individuals, open circle denotes underwater observations, and closed square indicates location of other specimens. aqua vol. 16 no. 2 - 20 April 2010 46 Peter R. Last, William T. White and Melody Puckridge densely concentrated on central disc, interorbital Size: Type specimens consist of two mature males and on suborbital, bluish white markings more or 291 and 302 mm DW, both with tails damaged less equally dense over entire disc and tail, anterior beyond sting. Material of the Shark Bay morph margin of disc almost uniformly yellowish brown; consisted of 2 females (261 and 299 mm DW) and dorsal surface of orbit yellowish brown, similar to one adult male (260 mm DW), the largest with a outer margin of disc, eye whitish; post-spine tail total length of 563 mm. with alternating black and white bands. Distribution: Occurs in shallow water near the Colour in preservation based on coast in Ningaloo Marine Park (Fig. 8). Types col- holotype: Dorsal surface pale yellowish, darker lected near Five Fingers Reef, south of Coral Bay greyish on head and across mid-disc and tail; palest (23°10’S, 113°45’E); additional specimens around disc margin, this area broadest along poste- observed (by authors) further north at Lakeside rior margin of disc; orange flecks and spots persis- (22°39’S, 113°55’E) and photographed near Bun- tent; bluish white spots obscure. Ventral surface of degi Reef, in Exmouth Gulf (21°49’S, 114°10’E) disc uniformly pale yellowish white; some irregular, (by F. Cerutti). Types and other material were col- indistinct flecks and spots near outer margin of lected or observed in less than 5 m depth; the disc. Tail darker dorsally than ventrally; folds white species could occur deeper but is unlikely to occur with irregular dusky margins; banding on post-fold much beyond the circalittoral zone as specimens tail missing as tail damaged; stings white, envelop- have never been reported from trawl catches. Mor- ing membrane yellowish with some darker phologically similar forms have been collected at blotches. Claspers similar to tail on dorsal surface, Shark Bay, central Western Australia (25°46’S, paler ventrally. 113°41’E), and near Gove, Northern Territory.

Fig. 9. Neighbour-joining tree of nucleotide sequence divergence at the barcoding region of the COI gene among four Aus- tralian species of the genus Neotrygon. Scale bar represents 1% K2P distance and bootstrap values of ≥ 75% are given. Reg- istration numbers relate to those present on the Barcode of Life Database (www.barcodinglife.org).

47 aqua vol. 16 no. 2 - 20 April 2010 Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia

Etymology: Based on the type locality, Ningaloo, 14.8–15.0% DW vs. 12.7–13.3% and 13.2–14.6% the location of an important marine park rich in DW); dorsal tail fold shorter (length 13.5% DW species of elasmobranchs. Vernacular: Ningaloo vs. 21.7–25.2% and 17.3–28.5% DW, 1.3 vs. Maskray. 0.7–0.8 and 0.6–1.0 in preorbital length, 11.0 vs. Remarks: Neotrygon ningalooensis differs from N. 15.5–17.6 and 15.5–25.8 times its depth); and ven- kuhlii in lacking obvious blue spots on the dorsal tral skin fold shorter (length 42.2% DW vs. disc. It differs from the only other strongly pat- 56.8–68.9% and 54.8–77.6% DW) and taller terned maskrays lacking prominent blue spots, N. (2.4 vs. 1.6–1.8 and 1.2–1.6% DW). The new leylandi (Fig. 2B) and N. picta, in having a colour species also differs from N. leylandi in the following: pattern that is more vivid, being dominated by snout to pectoral-fin insertion longer (77.2 vs. orange markings and pale bluish white spots (rather 70.6–75.9% DW in N. leylandi); nostrils further than black spotted and/or with two-tone floral apart (7.9–8.3 vs. 7.0–7.4% DW); snout to maxi- markings), a larger adult size (to 302 mm DW vs. mum width greater (40.1–41.7 vs. 36.8–38.8% 280 cm DW), more protrusible eyes (see Fig. 7), DW); tail less depressed (height at axil of pelvic fins less angular pectoral fins and snout, more vertebral 5.6–5.7 vs. 4.4–5.0% DW, height at base of sting centra, including synarcual (125–126 vs. 112–122 3.3–3.4 vs. 2.6–3.1% DW); stings longer (second in N. leylandi and N. picta), fewer pelvic-fin radials sting length 22.3–23.1 vs. 18.5% DW); and nasal (15–16 vs. 18–19 in adult males), as well as many curtain broader (9.2–10.8 vs. 7.8–8.5% DW). morphometric ratios: snout shorter (horizontal pre- The type specimens of Neotrygon ningalooensis orbital length 12.2–13.5% DW in N. ningalooensis had identical barcode sequences that differed from vs. 15.2–15.9% DW in N. leylandi and those of its congeners. Average COI sequence 13.5–15.9% DW in N. picta, preoral length divergence between N. ningalooensis and other 13.8–14.7% DW vs. 16.7–18.3% and 15.9–18.8% Australian species of Neotrygon was 11.74%, ca 50 DW, preoral length 1.4–1.7 vs. 2.4–2.9 and times greater than the overall average within 2.1–2.6 times mouth width, preoral length 1.7–1.9 species divergence (0.23%) and slightly higher vs. 2.3–2.5 and 2.1–2.4 times internasal width, pre- than the overall average divergence (8.82%) sepa- nasal length 9.7–10.1% DW vs. 12.5–13.6% and rating existing species within this genus (Fig. 9). 12.2–14.4% DW, prenasal length 1.2 vs. 1.7–1.9 High levels of species separation are consistent with and 1.6–1.8 times internasal width); orbit much those found in other confamilial stingray groups, larger (diameter 9.3–10.0% DW vs. 6.9–8.4% and such as genera Dasyatis and Himantura, which have 6.3–7.7% DW), orbit + spiracle larger ( length average congeneric distances of 15.79% and 11.5–12.2% DW vs. 8.9–10.3% and 8.9–10.7% 13.30% respectively (Ward et al., 2008), and sup- DW); spiracle larger (7.4–7.9% DW vs. 5.4–6.1% port the reproductive isolation of N. ningalooensis and 5.2–6.3% DW); disc longer (88.5–88.9% DW from its congeners. The COI sequence for the vs. 79.2–86.3% and 83.2–87.3% DW) and thicker holotype is given in Appendix 1. (13.4–13.6% DW vs. 10.4–11.8% and 9.8–12.4% The distribution of Neotrygon ningalooensis is pos- DW); adult claspers longer (length from pelvic axil sibly linked to its preference for a particular sub- 16.8–17.6% DW vs. 12.9–12.9% and 13.7–15.3% strate type. Habitats with soft sediments provide DW); pelvic fins larger (length 24.3–25.3% DW selective advantages for this ray. It has highly pro- vs. 20.5–21.9% and 20.2–22.4% DW), width trusible eyes enabling it to bury deeper, and still across pelvic fins larger (34.3–37.6% DW vs. maintain an ability to observe its surroundings, 24.5–31.0% and 20.9 –34.9% DW); mouth larger than its congeners. Inshore sandy habitats off parts (width 8.1–10.5% DW vs. 6.4–7.1% and of Western Australia, which are dominated by red- 7.1–8.1% DW, 2.9–3.4 vs. 2.1–2.5 and 2.1–2.8 dish sediments, provide camouflage for this species times 1st gill-slit width); interorbital width nar- (Fig. 1) and subsequently offer obvious advantages rower (6.9–7.5% DW vs. 8.1–9.2% and 8.3–9.7% for predator avoidance. The Shark Bay specimens DW); inter-eye width broader (16.7–18.5% DW are genetically distinct from those collected at vs. 14.0–14.7% and 14.1–15.9% DW); nostrils Ningaloo, but there were no obvious differences larger (length 4.0–4.2% DW vs. 2.6–3.0% and between populations in morphometrics or meris- 3.2–3.6% DW); tail wider at base of sting tics. Given the close spatial association of N. ninga- (3.8–4.3% DW vs. 3.1–3.3% and 3.0–3.3% DW); looensis and its sympatric congeners at the NMP, spiracles further apart (interspiracular width often occurring within metres of each other, the aqua vol. 16 no. 2 - 20 April 2010 48 Peter R. Last, William T. White and Melody Puckridge assemblage is an ideal candidate group for studying ACKNOWLEDGEMENTS habitat specificity and ecological partitioning in This project was funded by the Western Aus- chondrichthyans. tralian Marine Science Institution (WAMSI) and Comparative material: supported by the Wealth from Oceans Flagship. Neotrygon leylandi. CSIRO CA 2806 (holotype), Field work in the Coral Bay region was supported adult male 192 mm DW; CSIRO T 676 by the Ningaloo Research Centre and we would (paratype), female 190 mm DW; CSIRO T 681 like to acknowledge the considerable contribution (paratype), female 254 mm DW; CSIRO H made by Frazer McGregor (Murdoch University) 6828–01, adult male 241 mm TL. throughout this project. Underwater photographs, Neotrygon picta. CSIRO H 5771–01 (holotype), specimens and tissue samples and habitat informa- female 236 mm DW; CSIRO H 2376–07 tion were provided for specimens of the new (paratype), adult male 217 mm DW; CSIRO H species from Shark Bay by Jeremy Vaudo and Kirk 3374–05 (paratype), female 215 mm DW, CSIRO Gastrich (Florida International University). An H 3374–06 (paratype), adult male 183 mm DW; underwater photograph of the new species was CSIRO H 3385–01 (paratype), female 275 mm provided by Florencia Cerutti (Charles Darwin DW; CSIRO H 5590–02 (paratype), adult male University). The following people assisted with the 221 mm DW; NTM S 16597–001 (paratype), collection of the type specimens: Bernard Séret female 212 mm DW. (Muséum national d’histoire naturelle), Mike Sug- den, Ron Mawbey (Aquenal Pty Ltd), Florencia Appendix 1 Cerutti (Charles Darwin University), Frazer Cytochrome oxidase subunit 1 (CO1) sequence: McGregor and Kristal Wenziker (Murdoch Uni- Neotrygon ningalooensis (holotype CSIRO H versity). Thanks also to other field work partici- 6927–01): pants and supporters: Rory McAuley and Justin CCTTTACTTAGTCTTTGGTGCAT- Chidlow (Department of Fisheries, Western Aus- GAGCAGGGATAGTAGGCACTGGC- tralia), John Stevens, Richard Pillans, Russ Bab- CTCAGTTTGCTTATCCGAACAGAAC- cock (CSIRO), Charlie Huveneers (SARDI), Con- TAAGCCAACCAGGCGCTCTACTAGGT- rad Speed (Australian Institute of Marine Science), GATGATCAGATTTATAATGTAATCGTTACT- Emily Wilson, Roland Mau, Brad Daw (Depart- GCCCATGCCTTCGTAATAATTTTCTT- ment of Conservation, Exmouth), and Dani Rob. TATAGTAATACCAATTATAATCGGCG- John Pogonoski (CSIRO) obtained meristic data GATTCGGCAATTGACTGGTCCCCC- on the types; Alastair Graham (CSIRO) provided TAATAATTGGAGCCCCAGATATAGC- registration information for the types; Louise Con- CTTTCCACGAATAAATAATATAAGCTTCT- boy (CSIRO) for photographing the preserved GACTTCTCCCTCCCTCCTTCCTACTTC- holotype; Daniel Gledhill (CSIRO) provided tech- TACTAGCCTCAGCAGGAGTA- nical assistance; Bob Ward (CSIRO) provided GAAGCTGGGGCTGGGACAGGTTGAACG- advice on the DNA barcoding component. GTTTACCCCCCACTAGCTGGTAACC- TAGCCCATGCCGGGGCTTCTGTAGATCT- TACAATCTTTTCTCTGCACCTAGCAGGT- REFERENCES KIMURA, M. 1980. A simple method for estimating evolu- GTCTCCTCTATTCTAGCGTCCATCAACTT- tionary rates of base substitutions through comparative TATCACAACAATTATTAACATAAAACCACC- studies of nucleotide sequences. Journal of Molecular Evo- CGCAATCTCCCAATACCAAACCCCAC- lution 16: 111–20. TATTCGTCTGATCCATTCTTGTTACAACT- KUITER, R. H. & DEBELIUS, H. 2006. World Atlas of GTCCTTCTCTTATTATCTTTACCAGTTC- Marine Fishes. IKAN-Unterwasserarchiv, Frankfurt, 720 TAGCAGCTGGAATTACCATACTCCTCACA- pp. GATCGAAACCTAAATA- LAST, P. R. (1987). New Australian fishes. Part 14. Two CAACTTTCTTTGATCCAGCTGGGGGAG- new species of Dasyatis (Dasyatididae). Memoirs of the National Museum of Victoria 48: 57–61. GAGATCCCATTCTTTACCAACATCTCTTC LAST, P. R. & WHITE, W. T. 2008. Resurrection of the (655 bp). genus Neotrygon Castelnau (Myliobatoidei: Dasyatidae) with the description of Neotrygon picta sp. nov., a new species from northern Australia, pp. 315–325. In: Descriptions of New Australian Chondrichthyans. (Eds.

49 aqua vol. 16 no. 2 - 20 April 2010 Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia

P. R. Last, W. T. White & J. J. Pogonoski.). CSIRO (MEGA) software version 4.0. Molecular Biology and Marine and Atmospheric Research Paper 022, 358 pp. Evolution 24: 1596–99. MANJAJI, B. M. 2004. Taxonomy and phylogenetic systematic WAPLES, K. & HOLLANDER, E. 2008. Ningaloo Research of the stingray genus Himantura (Family Dasyatidae). Progress Report: Discovering Ningaloo – latest findings and Unpublished PhD thesis, University of Tasmania. their implications for management. Ningaloo Research MANJAJI-MATSUMOTO, B. M. & LAST, P. R. 2006. Coordinating Committee. Department of Environment Description of a new whipray, Himantura lobistoma sp. and Conservation, WA. nov., from Borneo with comments on the status of the WARD, R. D., ZWMLAK, T. S., INNES, B. H., LAST, P. R. & smalleye stingray, Dasyatis microphthalma Chen. Ichthy- HERBERT, P. D. N. 2005. DNA barcoding Australia’s fish ological Research 53: 290–97. species. Philosophical Transactions of the Royal Society of MÜLLER, J. & HENLE, F. G. J. 1841. 1838–41. Systematis- London, Series B 360: 1847–57. che Beschreibung der Plagiostomen. Berlin. Plagiostomen, WARD, R. D., HOLMES, B. H., WHITE, W. T. & LAST, P. R. 200 pp. 2008. DNA barcoding Australasian chondrichthyans: TAMURA, K., DUDLEY, J., NEI, M. & KUMAR, S. 2007. results and potential uses in conservation. Marine and MEGA4: Molecular Evolutionary Genetics Analysis Freshwater Research 59: 57–71.

aqua vol. 16 no. 2 - 20 April 2010 50