DOCSLIB.ORG

Molecular Divergence of the Mitochondrial Cytochrome Oxidase Ii Gene in Three Mosquitoes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Divergence of the Mitochondrial Cytochrome Oxidase Ii Gene in Three Mosquitoes Journal of the American Mosquito Control Association, L8(4):301-3O6,2OO2 Copyright @ 2002 by the American Mosquito Control Association, Inc. MOLECULAR DIVERGENCE OF THE MITOCHONDRIAL CYTOCHROME OXIDASE II GENE IN THREE MOSQUITOES WANG JINFU AND HUANG CHAOHUI College of Lift Sciences, Zhejiang University, Hangzhou, Zhejiang 310012, People's Republic of China ABSTRACT. The cytochrome oxidase II (COII) genes in the mitochondrial DNA of 3 mosquito species (Anopheles sinensis, Aedes albopictus, and Culex quinquefasciatus) were amplified and sequenced. Both the gene order and direction of transcription were identical to those of other species of Anopheles, Aedes, and Culex. The polymerase chain reaction-amplified fragments in these mosquitoes were approximately 700 base pairs and the nucleotide sequences exhibited more than 82Vo similarity, whereas amino acids were more than 857o similar. The frequency of transitions was less than that of transversions. Four highly conserved segments of COII proteins are similar to those in other insects. These segments contain the major amino acid residues of cytochrome c oxidase involved in electron transport and ligand binding. KEY WORDS Amino acid sequence, Aedes, Culex, Anopheles INTRODUCTION China. The mosquitoes were kept in screened cages (29 x 22 x 23 cm) and provided Cytochrome c oxidase is an important respiratory with lOVa sucrose solution. Eggs of Cx. quinquefasciatus and Ae. enzyme involved in the terminal oxidation steps of al- bopictus were laid in a 50-ml beaker containing the mitochondrial election transport chain. Cyto- wa- ter. Eggs of An. sinensis were laid chrome c oxidase includes 3 large subunits and is on moist silk encoded by mitochondrial DNA (mtDNA) (Capaldi fabric in a culture plate. Larvae were reared in enamel bowls (Wang et al. 1983; Clary and Wolstenholme 1983, 1985;. containing 200 ml of water et aL 1996). The insectary Among these subunits, cytochrome c oxidase sub- was maintained at SOVorel- ative humidity, unit II (CO[) has been studied extensively in ver- 27"C, and a photoperiod of l4:10 h tebrates (Busse et al. 1978, Bisson et al. 1980, light: dark. The emerging adults were used for ex- tracting Brown and Simpson 1982, Millett et al. 1983, Lee total DNA. et al. 1989, Pan et al. 1993) and insects (Liu and Extraction of total DNA.' Total DNA was extract- Beckenbach 1992, Ho et al. 1995). ed from each adult (Cockburn and Seawright 1988). -70"C Cytochrome c oxidase subunit II has a high af- Fifty adults of each species were frozen at finity binding site for cytochrome c and contains and then ground in a cooled mortar and pestle. ligands for copper. Moreover, this subunit evolves Powdered mosquitoes were homogenized and the at different rates for human, rat, mouse, and cow DNA was extracted by phenol: chloroform from the (Cann et al. 1984). Insects are divergent in both proteinase K digested homogenate. The crude DNA COII amino acid and nucleotide sequences (Liu and solution was obtained by centrifugation and was Beckenbach 1992). The COII gene is locared be- then dialyzed against 10 mM Tris-HCl and I mM tween 2 transfer RNA genes, TRNAL* and tRNALv", ethylenediaminetetraacetic acid (pH 8.0) at 4'C for in mosquitoes (Cockburn et al. 1990, Beard et al. 16 h. The dialysate was concentrated S-fold with 1993, Mitchell et al. 1993, Ho et al. 1995). We PEG 2O,OO0(polyethylene glycol; SANGON, Ltd., isolated the template DNA from 3 species of mos- Shanghai, China) and stored at 4"C. The DNA con- quitoes (Anopheles sinensis Wiedemann, Aedes al- centration was determined by absorbancy at 26O bopictus (Skuse), and Culex quinquefasciatus Say) nm. and amplified the COII gene with the polymerase Oligonucleotide primers: The oligonucleotide chain reaction (PCR) by using primers located primers used in this study were designed according within these 2 tRNAs. The COII gene was analyzed to Ho et al. (1995). The sequence of the 5' forward by sequencing PCR products that had been cloned primer was 5'-AGATTTTATCTTTTGTTAGAA-3' into plasmid DNA. The amino acid sequence of located in the tRNAk'gene and the 3' reverse prim- COII was deduced by using the insect mitochon- er was 5'-TTGCTTTCAGTCATCTAATG-3' situ- drial code and was compared with the sequences of ated at the beginning of the tRNALvs gene. other insect species.The conserved segments ofthe Polymerase chain reaction conditions: Amplifi- physiologically important segments of the COII cation reactions were modified from Kocher et al. gene in these 3 mosquitoes were analyzed. (1989). The total volume of reaction mixture was 5O pl. The reaction mixture contained 0.2 mM each of deoxyadenosine triphosphate, deoxycytidine MATERIALS AND METHODS tri- phosphate, deoxyguanosine triphosphate, and deox- Mosquitoes: Adult Cx. quinquefasciatus and Ae. ythymidine triphosphate; 300 ng of each primer; albopictus were collected in Hangzhou, and An. si- 2.5 units of Taq DNA (SANGON Ltd.); and I pg nensis was collected in Jinhua, Zhejlang province, of the mosquito DNA. This mixture was amplified 3t) z JounNnr- oF THE AMERIcm Mosquno CoNrnol AssocIATIoN Vor. 18,No.4 tRNA""u------l l----*Corr AEAIB AGATTTTATCTTTTGTTAGAA.. AATGGCAACATGAATAAATCTAGGACTTCAAAATA5 6 cxQur ------ --TACT---------C---GC----T--T--T-A------- 60 ANSIN ------ ------GC----T----TT-A---G--- 56 AEALB GTACTTCTCCTTTAATAGAACAATTAAATTTTTTTCATGATCATACTTTATTAATTTTAA116 -AG-T---------- cxQur --T-------A-------- r20 --c-Tc-T------- ANSrN --T----A----------- 116 AEALB TTACAATTACTATTATAATTGCATATATTATATTTATATTATTTTTTAATAAATTTACAA),'l 6 cxQUr ---T------AG-A------A-T---G-A---GG------------c------------- 180 ANSrN CA-T------A---T--G---G----------AGA---C--A-A------C----C--T- AEALB ATCGATATTTACTTCACGGACAAACAATTGAAAITATTTGAACTATTCTTCCTGCAATTA2 3 6 -- cxQur -----------T-A--T--------T--------C--------A- 240 ANSrN ----T------T-A--T-- ------------G--T-A---------- 236 AEAI,B TTTTAATATTTATTGCCTTTCCTTCTTTACGACTTTTATACTTAATAGATGAAATTAATT296 cxQur ----------------T-----A--AC-T--GT-A-----T---T -- 300 ANSrN ----------C-----A--------------TT-A-----T--------C---------A 296 AEALB CTCCTTTAATTACTTTAAAAGTTATTGGCCATCAATGATATTGAAGTTATGAATATTCTA356 cxQur ------ G-C------A-----------C---- -- 360 ANSlN -A----C------A-----GTCGG----T--- -c------------G 356 AEALB ATTTTTTAAATTTAGAATTTGATTCTTACATAATTCCAACTAATGAATTAGATATTAATG4 1 6 cxQur -----A ------A--T-----------A------------T-A---- 420 ANSrN ------ ------A--T--------T--A------C----A-CA---- 416 AEAI,B GATTTCGTTTATTAGATGTTGATAATCGAGTTATTCTTCCAATAAATAATCAAATTCGAA4 7 6 -- cxoul ----c--A-c-------------------A-----T-A---T--- 480 ANSrN -------AC-T------------------A--G--T-A--T---- -- 416 AEALB TTTTAGTAACTGCTACTGATGTAATTCATTCTTGAACAGTTCCCTCTATAGGAATMAAA536 cxQur ------ ---TC----C--A-----------T---T-----G------ 540 ANSrN -------T--A------------T-A-----A--------A--A---T-----G----GG 536 AEAI,B TTGATGCTACTCCCGGACGTTTAAATCAAACTAATTTTTTAATAAATCAACCTGGATTAT596 cxQUr -------------A--c--A------------------c----T------T----TC-T- 600 ANSrN -A--------A--A-----A----------T------------c----G----------- 596 Fig. l. Nucleotide sequences of the cytochrome oxidase II gene and the 5' and 3' flanking regions in TRNAL* and tRNArv- of Anopheles sinensis (ANSIN), Aedes albopictzs (AEALB), and Culex quinquefasciatzs (CXQUI). Dots and asterisk rep."r"nt inserted nucleotide and termination, respectively. Dashes indicate the identical nucleotides among 3 species. For the best alignment, 4 gaps (.) were inserted in AEALB and ANSIN- Dscsrursen2002 MrrocgoNonrel Cvrocunoup Oxn.q.sB II GeNe 303 AEALB TTTATGGACAATGCTCAGAAATTTGTGGAGCAAATCATAGTTTCATACCAATTGTTATTG 656 cxour ---T---------T--T-----c--------T-----------T-----T---------- 660 ANSIN ---T---T-----T----- --*--------T-----------A---- 656 AEALB AGAGAATCCCAATAAATTATTTTATTAAATGAATTTCTTCTCAAATAAATTCATTAGATG116 cxour -A-----T----------- G-----------T '120 '716 ANSrN -A-----T--------C-----------G------A--AA-ATG-CT------------- * l---+IRNA!Y' '7 AEAIB ACTGAAAGCAA 27 avnllT ----------- 13I ANSIN----------- 121 Fig. 1. Continued. in a RoboCycler GRADIENT-4O thermal cycler Wolstenholme 1983, 1985) were used to compare (Stratagene, La Jolla, CA). The PCR profile con- nucleotide and amino acid sequences. sisted of an initial denaturation at 94"C for 3 min, followed by 30 cycles at 94oC for I min, 48"C for RESULTS 1 min, and 72"C for I min. After 30 cycles, exten- sion occurred at 72"C for 8 min. The amolified The amplified fragment was 727 base pairs (bp) product was analyzed and purified by electropho- for An. sinensis and Ae. albopictus, and 731 bp for resis in ethidium bromide-stained 7Vo agarose gel Cx. quinquefasciatus. Figure I shows the DNA se- at 100 V for 30 min in Tris/borate electrophoresis quences for the COII gene and flanking regions on (TBE) buffer. tRNAk" and tRNALv'. The nucleotide sequences of Cloning and sequence analysis of COII gene: tRNALv" are identical in these 3 species. The nucle- Amplified fragments of approximately O.7 kilobas- otide sequences of TRNAL* are also identical be- es were extracted by phenol: chloroform and pre- tween An. sinensis and Ae. albopictus, but an ad- cipitated by ethanol (Sambrook et al. 1989), then dition of 3 nucleotides was found in Cx. ligated to the pUC-T Vector (SANGON Ltd.). quinquefas c iarzs. Five intergenic nucleotides occur Escherichia coli strain DH5ct was transformed with between tRNAk" and the COII gene of Cx. quin- the ligated plasmid DNA. The transformants were quefosciatus, but only I is found in An. sinensis selected by a LB agar (Sigma, St. Louis, MO) plate and Ae. albopictus. No nucleotides separating
Load more

Recommended publications
  • Saint Louis Encephalitis (SLE)
    Encephalitis, SLE Annual Report 2018 Saint Louis Encephalitis (SLE) Saint Louis Encephalitis is a Class B Disease and must be reported to the state within one business day. St. Louis Encephalitis (SLE), a flavivirus, was first recognized in 1933 in St. Louis, Missouri during an outbreak of over 1,000 cases. Less than 1% of infections manifest as clinically apparent disease cases. From 2007 to 2016, an average of seven disease cases were reported annually in the United States. SLE cases occur in unpredictable, intermittent outbreaks or sporadic cases during the late summer and fall. The incubation period for SLE is five to 15 days. The illness is usually benign, consisting of fever and headache; most ill persons recover completely. Severe disease is occasionally seen in young children but is more common in adults older than 40 years of age, with almost 90% of elderly persons with SLE disease developing encephalitis. Five to 15% of cases die from complications of this disease; the risk of fatality increases with age in older adults. Arboviral encephalitis can be prevented by taking personal protection measures such as: a) Applying mosquito repellent to exposed skin b) Wearing protective clothing such as light colored, loose fitting, long sleeved shirts and pants c) Eliminating mosquito breeding sites near residences by emptying containers which hold stagnant water d) Using fine mesh screens on doors and windows. In the 1960s, there were 27 sporadic cases; in the 1970s, there were 20. In 1980, there was an outbreak of 12 cases in New Orleans. In the 1990s, there were seven sporadic cases and two outbreaks; one outbreak in 1994 in New Orleans (16 cases), and the other in 1998 in Jefferson Parish (14 cases).
    [Show full text]
  • Data-Driven Identification of Potential Zika Virus Vectors Michelle V Evans1,2*, Tad a Dallas1,3, Barbara a Han4, Courtney C Murdock1,2,5,6,7,8, John M Drake1,2,8
    RESEARCH ARTICLE Data-driven identification of potential Zika virus vectors Michelle V Evans1,2*, Tad A Dallas1,3, Barbara A Han4, Courtney C Murdock1,2,5,6,7,8, John M Drake1,2,8 1Odum School of Ecology, University of Georgia, Athens, United States; 2Center for the Ecology of Infectious Diseases, University of Georgia, Athens, United States; 3Department of Environmental Science and Policy, University of California-Davis, Davis, United States; 4Cary Institute of Ecosystem Studies, Millbrook, United States; 5Department of Infectious Disease, University of Georgia, Athens, United States; 6Center for Tropical Emerging Global Diseases, University of Georgia, Athens, United States; 7Center for Vaccines and Immunology, University of Georgia, Athens, United States; 8River Basin Center, University of Georgia, Athens, United States Abstract Zika is an emerging virus whose rapid spread is of great public health concern. Knowledge about transmission remains incomplete, especially concerning potential transmission in geographic areas in which it has not yet been introduced. To identify unknown vectors of Zika, we developed a data-driven model linking vector species and the Zika virus via vector-virus trait combinations that confer a propensity toward associations in an ecological network connecting flaviviruses and their mosquito vectors. Our model predicts that thirty-five species may be able to transmit the virus, seven of which are found in the continental United States, including Culex quinquefasciatus and Cx. pipiens. We suggest that empirical studies prioritize these species to confirm predictions of vector competence, enabling the correct identification of populations at risk for transmission within the United States. *For correspondence: mvevans@ DOI: 10.7554/eLife.22053.001 uga.edu Competing interests: The authors declare that no competing interests exist.
    [Show full text]
  • Application of the Mermithid Nematode, Romanomermis
    THE UNIVERSITY OF MANITOBA Application of the Mermithid Nematode, Romanomermis culicivorax Ross and Smith, 1976, for Mosquito Control in Manitoba and Taxonomic Investigations in the Genus Romanomermis Coman, 1961 by Terry Don Galloway A·THESIS SUBMITTED IN THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT OF THE REQUIRENiENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTlflENT OF ENTOI\�OLOGY WINNIPEG, MANITOBA 1977 Applicati.on of the Mermi.thid Nematode, Romanomermis culicivorax Ross and Smith, 1976, for Mosquito Control in Manitoba and Taxonomic Investigations in the Genus Romanomermis Coman, 1961 by Terry Don Galloway A dissertation submitted to the Faculty of Graduate Stuuics of the University or Manitoba in partial fulfillmcnl of the requirements or l he degree of DOCTOR OF PHILOSOPHY © 1977 Permission has been granll'd lo lhc LIBRARY OF TIIE UNIVER­ SITY OF MAN ITO BA lo lend or sell copies of this dissertation, lo lhc NATIONAL LIBRARY OF CANADA to mil:mfilrn this dissertation and lo lend or sell copies or the film, and UNIVERSITY MICROFILMS to publish :111 abstr:tct of this dissert:1lion. The author reserves other public.ition rights, and· neither lht' dissertation nor extensive extracts from it may be printed or otl11:r­ wise reproduced without lhc author's written p,mnission. ii ABSTRACT Successful invasion by the mermithid Romanomermis culicivorax declined linearly from 93.6 to 1.5% in Culex tarsalis and from 73,1 to 1.6% in Aedes dorsalis larvae ° exposed in the laboratory at 18, 16, 14, 12 and 10 C for 48 hours, Larvae of C. tarsalis were more susceptible than ° those of A.
    [Show full text]
  • Downloadable Data Collection
    Smetzer et al. Movement Ecology (2021) 9:36 https://doi.org/10.1186/s40462-021-00275-5 RESEARCH Open Access Individual and seasonal variation in the movement behavior of two tropical nectarivorous birds Jennifer R. Smetzer1* , Kristina L. Paxton1 and Eben H. Paxton2 Abstract Background: Movement of animals directly affects individual fitness, yet fine spatial and temporal resolution movement behavior has been studied in relatively few small species, particularly in the tropics. Nectarivorous Hawaiian honeycreepers are believed to be highly mobile throughout the year, but their fine-scale movement patterns remain unknown. The movement behavior of these crucial pollinators has important implications for forest ecology, and for mortality from avian malaria (Plasmodium relictum), an introduced disease that does not occur in high-elevation forests where Hawaiian honeycreepers primarily breed. Methods: We used an automated radio telemetry network to track the movement of two Hawaiian honeycreeper species, the ʻapapane (Himatione sanguinea) and ʻiʻiwi (Drepanis coccinea). We collected high temporal and spatial resolution data across the annual cycle. We identified movement strategies using a multivariate analysis of movement metrics and assessed seasonal changes in movement behavior. Results: Both species exhibited multiple movement strategies including sedentary, central place foraging, commuting, and nomadism , and these movement strategies occurred simultaneously across the population. We observed a high degree of intraspecific variability at the individual and population level. The timing of the movement strategies corresponded well with regional bloom patterns of ‘ōhi‘a(Metrosideros polymorpha) the primary nectar source for the focal species. Birds made long-distance flights, including multi-day forays outside the tracking array, but exhibited a high degree of fidelity to a core use area, even in the non-breeding period.
    [Show full text]
  • Downloaded from the National Center for Cide Resistance Mechanisms
    Zhou et al. Parasites & Vectors (2018) 11:32 DOI 10.1186/s13071-017-2584-8 RESEARCH Open Access ASGDB: a specialised genomic resource for interpreting Anopheles sinensis insecticide resistance Dan Zhou, Yang Xu, Cheng Zhang, Meng-Xue Hu, Yun Huang, Yan Sun, Lei Ma, Bo Shen* and Chang-Liang Zhu Abstract Background: Anopheles sinensis is an important malaria vector in Southeast Asia. The widespread emergence of insecticide resistance in this mosquito species poses a serious threat to the efficacy of malaria control measures, particularly in China. Recently, the whole-genome sequencing and de novo assembly of An. sinensis (China strain) has been finished. A series of insecticide-resistant studies in An. sinensis have also been reported. There is a growing need to integrate these valuable data to provide a comprehensive database for further studies on insecticide-resistant management of An. sinensis. Results: A bioinformatics database named An. sinensis genome database (ASGDB) was built. In addition to being a searchable database of published An. sinensis genome sequences and annotation, ASGDB provides in-depth analytical platforms for further understanding of the genomic and genetic data, including visualization of genomic data, orthologous relationship analysis, GO analysis, pathway analysis, expression analysis and resistance-related gene analysis. Moreover, ASGDB provides a panoramic view of insecticide resistance studies in An. sinensis in China. In total, 551 insecticide-resistant phenotypic and genotypic reports on An. sinensis distributed in Chinese malaria- endemic areas since the mid-1980s have been collected, manually edited in the same format and integrated into OpenLayers map-based interface, which allows the international community to assess and exploit the high volume of scattered data much easier.
    [Show full text]
  • Potentialities for Accidental Establishment of Exotic Mosquitoes in Hawaii1
    Vol. XVII, No. 3, August, 1961 403 Potentialities for Accidental Establishment of Exotic Mosquitoes in Hawaii1 C. R. Joyce PUBLIC HEALTH SERVICE QUARANTINE STATION U.S. DEPARTMENT OF HEALTH, EDUCATION, AND WELFARE HONOLULU, HAWAII Public health workers frequently become concerned over the possibility of the introduction of exotic anophelines or other mosquito disease vectors into Hawaii. It is well known that many species of insects have been dispersed by various means of transportation and have become established along world trade routes. Hawaii is very fortunate in having so few species of disease-carrying or pest mosquitoes. Actually only three species are found here, exclusive of the two purposely introduced Toxorhynchites. Mosquitoes still get aboard aircraft and surface vessels, however, and some have been transported to new areas where they have become established (Hughes and Porter, 1956). Mosquitoes were unknown in Hawaii until early in the 19th century (Hardy, I960). The night biting mosquito, Culex quinquefasciatus Say, is believed to have arrived by sailing vessels between 1826 and 1830, breeding in water casks aboard the vessels. Van Dine (1904) indicated that mosquitoes were introduced into the port of Lahaina, Maui, in 1826 by the "Wellington." The early sailing vessels are known to have been commonly plagued with mosquitoes breeding in their water supply, in wooden tanks, barrels, lifeboats, and other fresh water con tainers aboard the vessels, The two day biting mosquitoes, Aedes ae^pti (Linnaeus) and Aedes albopictus (Skuse) arrived somewhat later, presumably on sailing vessels. Aedes aegypti probably came from the east and Aedes albopictus came from the western Pacific.
    [Show full text]
  • Apapane (Himatione Sanguinea)
    The Birds of North America, No. 296, 1997 STEVEN G. FANCY AND C. JOHN RALPH 'Apapane Himatione sanguinea he 'Apapane is the most abundant species of Hawaiian honeycreeper and is perhaps best known for its wide- ranging flights in search of localized blooms of ō'hi'a (Metrosideros polymorpha) flowers, its primary food source. 'Apapane are common in mesic and wet forests above 1,000 m elevation on the islands of Hawai'i, Maui, and Kaua'i; locally common at higher elevations on O'ahu; and rare or absent on Lāna'i and Moloka'i. density may exceed 3,000 birds/km2 The 'Apapane and the 'I'iwi (Vestiaria at times of 'ōhi'a flowering, among coccinea) are the only two species of Hawaiian the highest for a noncolonial honeycreeper in which the same subspecies species. Birds in breeding condition occurs on more than one island, although may be found in any month of the historically this is also true of the now very rare year, but peak breeding occurs 'Ō'ū (Psittirostra psittacea). The highest densities February through June. Pairs of 'Apapane are found in forests dominated by remain together during the breeding 'ōhi'a and above the distribution of mosquitoes, season and defend a small area which transmit avian malaria and avian pox to around the nest, but most 'Apapane native birds. The widespread movements of the 'Apapane in response to the seasonal and patchy distribution of ' ōhi'a The flowering have important implications for disease Birds of transmission, since the North 'Apapane is a primary carrier of avian malaria and America avian pox in Hawai'i.
    [Show full text]
  • WHO VBC 80.766 Eng.Pdf (‎1.320
    5E:e Ai::>b ./ /fj S€f>ARAT£ t=".::.c..·l:::.c--Q WORLD HEALTH ORGANIZATION ~ WHO/VBC/80.766 VBC/BCDS/80.09 ORGANISATION MONDIALE DE LA SANTE ENGLISH ONLY DATA SHEET ON THE BIOLOGICAL CONTROL AGENT(l) INDEXED Romanomermis culicivorax (Ross and Smith 1976) Romanomermis culicivorax is an obligatory endoparasitic nematode, the parasitic larvae of which develop inside larval mosquitos. It has little genus and species specificity within the Culicidae faplily. A total of 87 species (including Anopheles stephensi, An. albimanus, An. gambiae and many other vector species) have been exposed to it either in the laboratory or in the field and were infected. R. culicivorax has been extensively studied for the past 10 years. It can be easily mass produced, is safe to mammals and other non-target organisms, and its environmental limitations are well documented. This parasite is effective when used in water habita~s with the following characteritstics: fresh and non polluted, semi-permanent or permanent, temperature rarely exceeding 40°C, and little water movement. Several natural predators among the aquatic organisms likely to dwell in mosquito pools have been shown to prey on R. culicivorax; but the size, amounts of open water, pH, vegetation densities and host densitie; are not significant factors in the successful use of this biological control agent. This nematode should now be operationally evaluated against vectors during large scale field trials in endemic areas. 1. Identification and Synonymy Nematoda: Mermithidae Romanomermis culicivorax (Ross and Smith, 1976), is a segregate of a complex known previously as Reesimermis nielseni (Tsai and Grundmann, 1969).
    [Show full text]
  • RDL Mutations Predict Multiple Insecticide Resistance in Anopheles Sinensis in Guangxi, China Chan Yang1,2, Zushi Huang1, Mei Li1, Xiangyang Feng3 and Xinghui Qiu1*
    Yang et al. Malar J (2017) 16:482 https://doi.org/10.1186/s12936-017-2133-0 Malaria Journal RESEARCH Open Access RDL mutations predict multiple insecticide resistance in Anopheles sinensis in Guangxi, China Chan Yang1,2, Zushi Huang1, Mei Li1, Xiangyang Feng3 and Xinghui Qiu1* Abstract Background: Anopheles sinensis is a major vector of malaria in China. The gamma-aminobutyric acid (GABA)-gated chloride channel, encoded by the RDL (Resistant to dieldrin) gene, is the important target for insecticides of widely varied structures. The use of various insecticides in agriculture and vector control has inevitably led to the develop- ment of insecticide resistance, which may reduce the control efectiveness. Therefore, it is important to investigate the presence and distribution frequency of the resistance related mutation(s) in An. sinensis RDL to predict resistance to both the withdrawn cyclodienes (e.g. dieldrin) and currently used insecticides, such as fpronil. Methods: Two hundred and forty adults of An. sinensis collected from nine locations across Guangxi Zhuang Autono- mous Region were used. Two fragments of An. sinensis RDL (AsRDL) gene, covering the putative insecticide resistance related sites, were sequenced respectively. The haplotypes of each individual were reconstructed by the PHASE2.1 software, and confrmed by clone sequencing. The phylogenetic tree was built using maximum-likelihood and Bayes- ian inference methods. Genealogical relations among diferent haplotypes were also analysed using Network 5.0. Results: The coding region of AsRDL gene was 1674 bp long, encoding a protein of 557 amino acids. AsRDL had 98.0% amino acid identity to that from Anopheles funestus, and shared common structural features of Cys-loop ligand- gated ion channels.
    [Show full text]
  • Host Preference of Mosquitoes in Bernalillo County New Mexico'''
    Joumal of the American Mosquito Control Association, l3(l):71J5' L99'l Copyright @ 1997 by the American Mosquito Control Association' Inc. HOST PREFERENCE OF MOSQUITOES IN BERNALILLO COUNTY NEW MEXICO''' K. M. LOF[IN,3j R. L. BYFORD,3 M. J. LOF[IN,3 M. E. CRAIG,T t'ro R. L. STEINERs ABSTRACT. Host preference of mosquitoes was determined using animal-baited traps. Hosts used in the study were cattle, chickens, dogs, and horses. Ten mosquito species representing 4 genera were collected from the animal-baited traps. Aedes vexans, Aedes dorsalis, Culex quinquefasciatus, Culex tarsalis, and Culiseta inomata were used as indicator species for data analysis. Greater numbers of Ae. vexans, Ae. dorsalis, and C.s. inornata were collected from cattle and horses than from chickens or dogs. In addition, engorgement rates were higher on mammals than on chickens. Engorgement and attraction data for Cx. quinquefasciatrs suggested a preference for chickens and dogs over cattle and horses. A slight preference for chickens and dogs was seen with Cx. tarsalis, but the degree of host preference of C.r. tarsalis was less than that in either Ae. vexans or Cx. quinquefasciatus. INTRODUCTION used cattle-baited traps to determine the biting flies and mosquitoes attacking cattle in Canada. Host preference is an important aspect of arthro- Studiesin the USA comparing relative attraction pod-borne diseases. Determining the host prefer- of multiple host species in traps are limited. In a ence of mosquitoes can aid in understanding the Texas rice-growing area, Kuntz et al. (1982) used transmissionof diseaseswithin a geographicalarea multiple, paired host speciesto determine that cattle (Defoliart et al.
    [Show full text]
  • Mosquito Surveillance in the Demilitarized Zone, Republic of Korea, During an Outbreak of Plasmodium Vivax Malaria in 1996 and 19971
    Journal of the American Mosquito Control Association, 16(2):lOO-l 13,2000 Copyright O 2000 by the American Mosquito Control Association, Inc. MOSQUITO SURVEILLANCE IN THE DEMILITARIZED ZONE, REPUBLIC OF KOREA, DURING AN OUTBREAK OF PLASMODIUM VIVAX MALARIA IN 1996 AND 19971 DANIEL STRICKMAN,, MARY E. MILLER,3 HELTNG-CHUL KIM INo KWAN-WOO LEE 5th Medical Detachment, 18th Medical Command, Yongsan Garrison, Seoul, Republic of Korea (APO AP 96205-0020) ABSTRACT, Since 1993, more than 2,0OO cases of vivax malaria have occurred in the Republic of Korea in an epidemic that ended nearly 20 malaria-free years. Most malaria has occurred in the northwestern part of the country, mainly affecting Korean military personnel. As a part of an operational surveillance effort, we sampled mosquitoes in and near the Demilitarized Zone (Paju County, Kyonggi Province) during the last 2 wk of July in 1996 and from May 15 to September 10 in 1997. The 1st year, landing collections were done at 5 different sites; the 2nd year, carbon-dioxide-baited light traps at 5 sites, larval collections in 10 adjacent fields, and landing collections at 1 site in the Demilitanzed Zone were performed weekly. Of 17 species collected, Anopheles sinensis was consistently the most abundant mosquito, comprising 79-96Vo of mosquitoes. The diel pattern of biting by An. sinensis varied by location and season, with the majority of individuals biting late at night during warm weather (>20"C) and early at night during cool weather. In contrast, Aedes vexans nipponii (the 2nd most abundant species) bit in the greatest numbers at the same time all season, from 2000 to 2300 h.
    [Show full text]
  • Unprecedented Genomic Diversity of RNA Viruses In
    RESEARCH ARTICLE elifesciences.org Unprecedented genomic diversity of RNA viruses in arthropods reveals the ancestry of negative-sense RNA viruses Ci-Xiu Li1,2†, Mang Shi1,2,3†, Jun-Hua Tian4†, Xian-Dan Lin5†, Yan-Jun Kang1,2†, Liang-Jun Chen1,2, Xin-Cheng Qin1,2, Jianguo Xu1,2, Edward C Holmes1,3, Yong-Zhen Zhang1,2* 1State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing, China; 2Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Hangzhou, China; 3Marie Bashir Institute for Infectious Diseases and Biosecurity, Charles Perkins Centre, School of Biological Sciences and Sydney Medical School, The University of Sydney, Sydney, Australia; 4Wuhan Center for Disease Control and Prevention, Wuhan, China; 5Wenzhou Center for Disease Control and Prevention, Wenzhou, China Abstract Although arthropods are important viral vectors, the biodiversity of arthropod viruses, as well as the role that arthropods have played in viral origins and evolution, is unclear. Through RNA sequencing of 70 arthropod species we discovered 112 novel viruses that appear to be ancestral to much of the documented genetic diversity of negative-sense RNA viruses, a number of which are also present as endogenous genomic copies. With this greatly enriched diversity we revealed that arthropods contain viruses that fall basal to major virus groups, including the vertebrate-specific *For correspondence: arenaviruses, filoviruses, hantaviruses, influenza viruses, lyssaviruses, and paramyxoviruses. We [email protected] similarly documented a remarkable diversity of genome structures in arthropod viruses, including †These authors contributed a putative circular form, that sheds new light on the evolution of genome organization.
    [Show full text]