Journal of the American Mosquito Control Association, L8(4):301-3O6,2OO2 Copyright @ 2002 by the American Mosquito Control Association, Inc. MOLECULAR DIVERGENCE OF THE MITOCHONDRIAL CYTOCHROME OXIDASE II GENE IN THREE MOSQUITOES WANG JINFU AND HUANG CHAOHUI College of Lift Sciences, Zhejiang University, Hangzhou, Zhejiang 310012, People's Republic of China ABSTRACT. The cytochrome oxidase II (COII) genes in the mitochondrial DNA of 3 mosquito species (Anopheles sinensis, Aedes albopictus, and Culex quinquefasciatus) were amplified and sequenced. Both the gene order and direction of transcription were identical to those of other species of Anopheles, Aedes, and Culex. The polymerase chain reaction-amplified fragments in these mosquitoes were approximately 700 base pairs and the nucleotide sequences exhibited more than 82Vo similarity, whereas amino acids were more than 857o similar. The frequency of transitions was less than that of transversions. Four highly conserved segments of COII proteins are similar to those in other insects. These segments contain the major amino acid residues of cytochrome c oxidase involved in electron transport and ligand binding. KEY WORDS Amino acid sequence, Aedes, Culex, Anopheles INTRODUCTION China. The mosquitoes were kept in screened cages (29 x 22 x 23 cm) and provided Cytochrome c oxidase is an important respiratory with lOVa sucrose solution. Eggs of Cx. quinquefasciatus and Ae. enzyme involved in the terminal oxidation steps of al- bopictus were laid in a 50-ml beaker containing the mitochondrial election transport chain. Cyto- wa- ter. Eggs of An. sinensis were laid chrome c oxidase includes 3 large subunits and is on moist silk encoded by mitochondrial DNA (mtDNA) (Capaldi fabric in a culture plate. Larvae were reared in enamel bowls (Wang et al. 1983; Clary and Wolstenholme 1983, 1985;. containing 200 ml of water et aL 1996). The insectary Among these subunits, cytochrome c oxidase sub- was maintained at SOVorel- ative humidity, unit II (CO[) has been studied extensively in ver- 27"C, and a photoperiod of l4:10 h tebrates (Busse et al. 1978, Bisson et al. 1980, light: dark. The emerging adults were used for ex- tracting Brown and Simpson 1982, Millett et al. 1983, Lee total DNA. et al. 1989, Pan et al. 1993) and insects (Liu and Extraction of total DNA.' Total DNA was extract- Beckenbach 1992, Ho et al. 1995). ed from each adult (Cockburn and Seawright 1988). -70"C Cytochrome c oxidase subunit II has a high af- Fifty adults of each species were frozen at finity binding site for cytochrome c and contains and then ground in a cooled mortar and pestle. ligands for copper. Moreover, this subunit evolves Powdered mosquitoes were homogenized and the at different rates for human, rat, mouse, and cow DNA was extracted by phenol: chloroform from the (Cann et al. 1984). Insects are divergent in both proteinase K digested homogenate. The crude DNA COII amino acid and nucleotide sequences (Liu and solution was obtained by centrifugation and was Beckenbach 1992). The COII gene is locared be- then dialyzed against 10 mM Tris-HCl and I mM tween 2 transfer RNA genes, TRNAL* and tRNALv", ethylenediaminetetraacetic acid (pH 8.0) at 4'C for in mosquitoes (Cockburn et al. 1990, Beard et al. 16 h. The dialysate was concentrated S-fold with 1993, Mitchell et al. 1993, Ho et al. 1995). We PEG 2O,OO0(polyethylene glycol; SANGON, Ltd., isolated the template DNA from 3 species of mos- Shanghai, China) and stored at 4"C. The DNA con- quitoes (Anopheles sinensis Wiedemann, Aedes al- centration was determined by absorbancy at 26O bopictus (Skuse), and Culex quinquefasciatus Say) nm. and amplified the COII gene with the polymerase Oligonucleotide primers: The oligonucleotide chain reaction (PCR) by using primers located primers used in this study were designed according within these 2 tRNAs. The COII gene was analyzed to Ho et al. (1995). The sequence of the 5' forward by sequencing PCR products that had been cloned primer was 5'-AGATTTTATCTTTTGTTAGAA-3' into plasmid DNA. The amino acid sequence of located in the tRNAk'gene and the 3' reverse prim- COII was deduced by using the insect mitochon- er was 5'-TTGCTTTCAGTCATCTAATG-3' situ- drial code and was compared with the sequences of ated at the beginning of the tRNALvs gene. other insect species.The conserved segments ofthe Polymerase chain reaction conditions: Amplifi- physiologically important segments of the COII cation reactions were modified from Kocher et al. gene in these 3 mosquitoes were analyzed. (1989). The total volume of reaction mixture was 5O pl. The reaction mixture contained 0.2 mM each of deoxyadenosine triphosphate, deoxycytidine MATERIALS AND METHODS tri- phosphate, deoxyguanosine triphosphate, and deox- Mosquitoes: Adult Cx. quinquefasciatus and Ae. ythymidine triphosphate; 300 ng of each primer; albopictus were collected in Hangzhou, and An. si- 2.5 units of Taq DNA (SANGON Ltd.); and I pg nensis was collected in Jinhua, Zhejlang province, of the mosquito DNA. This mixture was amplified 3t) z JounNnr- oF THE AMERIcm Mosquno CoNrnol AssocIATIoN Vor. 18,No.4 tRNA""u------l l----*Corr AEAIB AGATTTTATCTTTTGTTAGAA.. AATGGCAACATGAATAAATCTAGGACTTCAAAATA5 6 cxQur ------ --TACT---------C---GC----T--T--T-A------- 60 ANSIN ------ ------GC----T----TT-A---G--- 56 AEALB GTACTTCTCCTTTAATAGAACAATTAAATTTTTTTCATGATCATACTTTATTAATTTTAA116 -AG-T---------- cxQur --T-------A-------- r20 --c-Tc-T------- ANSrN --T----A----------- 116 AEALB TTACAATTACTATTATAATTGCATATATTATATTTATATTATTTTTTAATAAATTTACAA),'l 6 cxQUr ---T------AG-A------A-T---G-A---GG------------c------------- 180 ANSrN CA-T------A---T--G---G----------AGA---C--A-A------C----C--T- AEALB ATCGATATTTACTTCACGGACAAACAATTGAAAITATTTGAACTATTCTTCCTGCAATTA2 3 6 -- cxQur -----------T-A--T--------T--------C--------A- 240 ANSrN ----T------T-A--T-- ------------G--T-A---------- 236 AEAI,B TTTTAATATTTATTGCCTTTCCTTCTTTACGACTTTTATACTTAATAGATGAAATTAATT296 cxQur ----------------T-----A--AC-T--GT-A-----T---T -- 300 ANSrN ----------C-----A--------------TT-A-----T--------C---------A 296 AEALB CTCCTTTAATTACTTTAAAAGTTATTGGCCATCAATGATATTGAAGTTATGAATATTCTA356 cxQur ------ G-C------A-----------C---- -- 360 ANSlN -A----C------A-----GTCGG----T--- -c------------G 356 AEALB ATTTTTTAAATTTAGAATTTGATTCTTACATAATTCCAACTAATGAATTAGATATTAATG4 1 6 cxQur -----A ------A--T-----------A------------T-A---- 420 ANSrN ------ ------A--T--------T--A------C----A-CA---- 416 AEAI,B GATTTCGTTTATTAGATGTTGATAATCGAGTTATTCTTCCAATAAATAATCAAATTCGAA4 7 6 -- cxoul ----c--A-c-------------------A-----T-A---T--- 480 ANSrN -------AC-T------------------A--G--T-A--T---- -- 416 AEALB TTTTAGTAACTGCTACTGATGTAATTCATTCTTGAACAGTTCCCTCTATAGGAATMAAA536 cxQur ------ ---TC----C--A-----------T---T-----G------ 540 ANSrN -------T--A------------T-A-----A--------A--A---T-----G----GG 536 AEAI,B TTGATGCTACTCCCGGACGTTTAAATCAAACTAATTTTTTAATAAATCAACCTGGATTAT596 cxQUr -------------A--c--A------------------c----T------T----TC-T- 600 ANSrN -A--------A--A-----A----------T------------c----G----------- 596 Fig. l. Nucleotide sequences of the cytochrome oxidase II gene and the 5' and 3' flanking regions in TRNAL* and tRNArv- of Anopheles sinensis (ANSIN), Aedes albopictzs (AEALB), and Culex quinquefasciatzs (CXQUI). Dots and asterisk rep."r"nt inserted nucleotide and termination, respectively. Dashes indicate the identical nucleotides among 3 species. For the best alignment, 4 gaps (.) were inserted in AEALB and ANSIN- Dscsrursen2002 MrrocgoNonrel Cvrocunoup Oxn.q.sB II GeNe 303 AEALB TTTATGGACAATGCTCAGAAATTTGTGGAGCAAATCATAGTTTCATACCAATTGTTATTG 656 cxour ---T---------T--T-----c--------T-----------T-----T---------- 660 ANSIN ---T---T-----T----- --*--------T-----------A---- 656 AEALB AGAGAATCCCAATAAATTATTTTATTAAATGAATTTCTTCTCAAATAAATTCATTAGATG116 cxour -A-----T----------- G-----------T '120 '716 ANSrN -A-----T--------C-----------G------A--AA-ATG-CT------------- * l---+IRNA!Y' '7 AEAIB ACTGAAAGCAA 27 avnllT ----------- 13I ANSIN----------- 121 Fig. 1. Continued. in a RoboCycler GRADIENT-4O thermal cycler Wolstenholme 1983, 1985) were used to compare (Stratagene, La Jolla, CA). The PCR profile con- nucleotide and amino acid sequences. sisted of an initial denaturation at 94"C for 3 min, followed by 30 cycles at 94oC for I min, 48"C for RESULTS 1 min, and 72"C for I min. After 30 cycles, exten- sion occurred at 72"C for 8 min. The amolified The amplified fragment was 727 base pairs (bp) product was analyzed and purified by electropho- for An. sinensis and Ae. albopictus, and 731 bp for resis in ethidium bromide-stained 7Vo agarose gel Cx. quinquefasciatus. Figure I shows the DNA se- at 100 V for 30 min in Tris/borate electrophoresis quences for the COII gene and flanking regions on (TBE) buffer. tRNAk" and tRNALv'. The nucleotide sequences of Cloning and sequence analysis of COII gene: tRNALv" are identical in these 3 species. The nucle- Amplified fragments of approximately O.7 kilobas- otide sequences of TRNAL* are also identical be- es were extracted by phenol: chloroform and pre- tween An. sinensis and Ae. albopictus, but an ad- cipitated by ethanol (Sambrook et al. 1989), then dition of 3 nucleotides was found in Cx. ligated to the pUC-T Vector (SANGON Ltd.). quinquefas c iarzs. Five intergenic nucleotides occur Escherichia coli strain DH5ct was transformed with between tRNAk" and the COII gene of Cx. quin- the ligated plasmid DNA. The transformants were quefosciatus, but only I is found in An. sinensis selected by a LB agar (Sigma, St. Louis, MO) plate and Ae. albopictus. No nucleotides separating