^tieMheDame

PUBLISHED WEEKLY — FOUNDED 1867

Volume 73 October 20, 1939 Number 5

CLEVELAND is a Students off doomed city! Nearly For Cleveland 1,000 Irishmen will land in the Lake City before tomorrow noon, and by evening Erin expects to have the situation well in hand—including the Navy. The first student train leaves from the Power House siding at midnight. (See Page 5)

ON HIS LAST trip to Snite Gives the University, Fred Rare Relics B. Snite, Jr., presented to the Rev. John F. O'Hara, C.S.C, and the University some precious relics which he had brought back with him from his recent visit to the Grotto of Lourdes. . . (See Page 7) •

IT IS QUITE ques­ Campbell Sees tionable if Japan can Fall of Japan survive her imperial claims, political ambi­ tions, and diplomatic blunders. Her po­ sition in the world today is highly prob­ lematical and it is quite possible she may destroy herself and sink again into a minor island people of no international importance (See Page 9)

INTO THE Cleveland Irisb Clasb Municipal Stadium to­ Witb Middies morrow will march the Navy, its full fighting force intact. Following closely on its heels _ will trot the squad of Notre Dame's Irish; It is to be a football game on land, not a naval engagement at sea. End of tbe Line — not a new record, but a commendable performance on a wet (See Page 12) track. Campus trolley slides SO feet past usual stopping point. (See Page 6) THE NOTRE DAME SCHOLASTIC

ENJOY THIS WEEK'S POST

SAIL HALF A SHIP TO PORT? FANTASTIC! On the nine millionth wave the freighter Flora Wyatl split in two, Iea\'ing John Orde with only the jagged bow of a ship to command!... If j-ou like sea yarns, turn to Richard HowcUs AVatkins' story. Half a Ship, in this week's Post. NEWEST TRICK IN FOOTBALL Are those kicks that suddenlj- bounce out of bounds in the coffin corneri sheer luck ? No, sir! Football's slj-cst trick is making 'cm bounce out. Here's the story of the system that is putting The Foot Back in Foot­ ball. Franny Murray, former Penn star, tells the story. • • • A FIGHTIN' PARSON GOES TO WAR ^at 64, is England's Man bf the Hour? Roaring, red-headed Rev. Praxiteles Swan was in a mighty •—scanted the Nazi danger from the start and became the bad spot. Only the musketry stabbing red in the night implacable enemy of Britain's poliQ^ of ^'appeasement" ? showed him theposition of those Yankees. The Preacher Learns ^ was so feared for his brilliance they said, "There will hard­ to Pray, a story by Col. John W. Thomason, Jr. ly be room for him in Parliament at 30 or in England at 40" ?" —fought in Cuba, India, Egypt and South Africa; became CAHLE ROUNDUP- a world hero at 25 for his daring escape from a prison camp? 1940 SmE Don't let the movies kid you —bottled tip Germany in 1914 by mobilizing Britain's Navy, that cattle roundups mean wild- on his own initiative, before the official declaration of war? eyed steers stampeding ahead of yelping cowboys. Donald Hough, author of this article. —personally tdok the blame for Britain's disastrous expedi­ Beef Comes From the Hills, takes you with him on a roundup in tion against the Dardanelles? Montana and tells you what a steer's life is really like before —was once tabbed "too clever to be trusted," and yet now he becomes steak. Is the one man in whom the whole Empire puts its faith? MR. ENOCH SETS HIS For years he has been the greatest single force in English political,life. But how well do you know him as a person? CAP FOR REVENGE Mr. Enoch, the gaudy gnome An American friend and noted commentator brings you a in Room 607, certainly looked memorable and intimate portrait of him in this week's Post. like a fugitive from a chain- gang picture. So Mr. Caldwell, the new hotel manager, decided to oops him out. A riotous storj', Clothes Make the Man, by Old Man in a Hurry Nunnally Johnson. GENTLEMEN PREFER ^VINCENT SHEEAN HOOPSKIRTS Author of, "Personal History" and "Not Peace But a Sword" Delia used enough chicken fenc­ ing in building her hoopskirt to take care of twenty brooders. But it was worth it. Wasn't she fto meet a polished gentleman —with a fine black beard and a THE I SJiTUIlDJiY gold tooth in his smile? M. G. EVENING POST Chute brings you the romantic storj' of The Lady and the m.s^ Guinea Hen. WHAT IS A FORDGNER? What happens' when a.family comes from Europe to make its I fortune in America? How do the children, and the children's children, rate as citizens? Louis Adamic traces a significant his­ tory of one such family, in The Woman From Croatia. THE NOTRE DAME SCHOLASTIC

dither, Notre Dame seems to have over­ College Parade byj(mkWillmann looked scouting the Yellowjackets. In the hope that this could be fixed up in time a letter was written to the Tech­ Remarks in Review pending For the hep-cats a swing nique asking for at least 300 words of unmitigated inside dope on what makes A full mail-bag should make for a full band has been organized Among oth­ the Tech team tick. Ever willing to co­ column. We had a full mail-bag. We er books. Gone With the Wind has been operate, the Technique forwarded the hope for a full column. In the mail bag purchased for the library. following: was what might be a none too subtle —St. Edward's Echo. " 'Captain Murphy and alternate Cap­ innuendo in the form of a Rock Island • tain Gibson created a sensation at prac­ time table which offers "first aid in Asleep in the Deep tice last Tuesday by appearing on a wet planning trips anywhere in the U. S." track in white and gold polka dot jer­ If it was a hint to take a walk we ig­ Plebe: "Well, what's the matter, didn't seys! Ector, Ison, and Beard all have nored it, and a Rock Island map now I do all right in the parade?" sleeping sickness; the rest of the team decorates room wall. Not a bad map, 2 P. 0. (sweetly)—"Sure you did all are in the School Abattoir, or hospital, either—^thank you, Rock Island. right. Didn't you win it by half a yard?" —Annapolis Log. due to too much lemonade and cakes at • • Friday's practice. So much to you Sitko! and may Shakespeare be with you on Bad Draft Oddity on the March As the regiment was leaving and a the 8th!'" Your SCHOLASTIC is now on the ex­ crowd cheering, a recruit asked: (Ed. —N.D., 17; Georgia Tech, 14. change list of The Presidio which is ed­ "Who are all these people and why ited and published monthly by and for Thanks very much, but you didn't warn are they cheering?" the inmates of the State Prison at Fort us about that boy Bosch.) "They," replied the veteran, "are the Madison, la Mechanically the mag­ • people who are not going."—Exchange azine is a neat appearing 32 pp. publica­ • S.O.S. tion with many interesting columns and Received this week was the L'Hehdo departments.... among which are "Pen Gopher Goings-on Laval published by the University of Chatter", "Madisonian Murmurings," "What makes the grass grow green" Laval at Quebec, Canada. No further re­ "Canned Chatter," "The Sport Stir," is being investigated by a group of Min­ port can be given until a linguist re­ and "Points on Pens".... Featured in nesota scientists who seek the answer in inforces our high school French. isotopes Dr. Thomas Parran, Sur­ the poetry section was a parody on Kip­ geon-General of the U. S. Public Health ling entitled "Buncha Beans." Service, will address the 50th Anniver­ Toonerville Topic sary of the Medical School ' Gov. Two men were seated together in a Stassen is also slated to speak... Coach Cooperation Won That Game crowded street car. One of them noticed Bierman warns "A Minnesota label In response to the customary request that the other had his eyes closed. doesn't make champions" An investi­ for a pre-write story on the Georgia "Wassamatter, Jazzwell," he asked, gating reporter found no amazons or Tech team no answer was forthcoming, "feeling ill?" muscle women when he checked the but the follo^ving appeared in the news "I'm all right," answered Jazzwell, girls' gym classes—rather he found good column of the Technique: "but I hate to see ladies standing." date-book material Fritz Kreisler "With the football world in such a —The Log. will soon give a concert for the student body.—Minnesota Daily. • All Through the Night Alpha: "Oh yes, he actually had the impudence to kiss me." Delta: "Of course you slapped him." Alpha: "Yes, every time." —California Pelican

Hobby Hint . Here's something for dull Sunday aft­ ernoons—^buy a can of crushed pine­ apple and try to fit the pieces together. —Pitt Panther. • Out of the Panhandle When they changed their nick-name from the "Tigers" to "Crusaders" the men of St. Edward's College decided to scrap their "Tiger Battle Cry" (sung to the tune of the N. D. Victory March) in favor of a new song. The S. A. C. is considering "Fight On, Crusaders"—^to be sung in the rhythm of the "Beer Barrel Polka" Faculty approval is 'Ask Her If She's Gotta Match. THE NOTRE DAME SCHOLASTIC

OPINION The Week ^y ^- ^- Ban^eda

This is the second of a series of ar- I tides concerning student opiyiions on Top of the Week was born in a state of frenzy, and ever I questions submitted by the students The Southern Methodist swing band. since then I have been a moron. Funny, j themselves. The question chosen this Sorely missing was Martha Tilton in a but the folks still tie me Avith chains in week, entered by John Callahan of white shimmering evening gown giving a dark closet. Now are you or ain'tcha Freshmen Hall, is: "Would you, prefer out with "Cooing in the Igloo." going out vnth. me?" the use of the honor system (no faculty He got the date. • supervision) in conducting classroom ex­ • aminations?" Following are typical com­ Idiots' Delight Surprise of the Week ments : Over in the Commerce school they liave a course that goes under the verj' The Notre Dame band jiving hep-for- impressive and practical name of "Busi­ hep with the swing cats from Dallas. From now on it's strictly: Carroll — Bill Olson: "I favor the ness Man's English." This, of course, is honor system because it would deter­ pure sham—^meant only to bring the Swing and canter With Joe Casasanter mine an individual's value of a college boys to the box office at registration education." period. Upon a casual investigation of • the text book the delighted reader can Pursuit Lyons — Bob Burns: "I pi-efer the find a choice lesson on how to make a We're still looking for the sequel to honor system, because after all, if you telephone call. last year's episode when a certain jour­ do cheat you're only hurting yourself, nalism professor asked the t%vins, Tom not the university. It's the student who Copyright laws prohibit us from re­ and John Ferneding, "Are you brothers ?" producing the passage verbatim, but we would suffer." attempt in a haphazard way to give you • the gist of how the wind blows under Peanut Gallery Morrissey—Walter Minder: "I prefer that topic: Jerry Flynn, dean of the cheer leaders, the honor system because it affords the is a man of many friends. Last Satur­ opportunity for character development." If you desire to make a telephone call day when Clashmore Mike had fatigued be siu'e to look up the number in mind Mmself jumping hurdles, Jerrj"^ rewarded Badin—Quentin Marshall: "I believe in the directory. This accomplished, him in the usual way wdth a piece of I'd rather have the honor system because lift the telephone receiver, generally candy. A fellow in the stands, who had the student is going to school for what found on top of the phone, and pause stayed up the night-before thinking he gets out of it other than a grade. So until the operator inquires, "Well, what up the crack, promptly came through it would be the student who would suffer is it?" At tliis sti-ategic moment, de­ if he were to cheat." corum decrees that you give her the vrith, "Now give Flynn one!" number. If the operator responds with • Brownson—^Fred Hoth: "I favor the a "thank you" you are bound to counter Keeper of the Keys honor system because it puts the stu- with a courteous "don't mention it." If We walked over to Cartier field to The students appreciate being so trusted, she fails to thank you then you are watch the teams practice. At the one- and therefore are less inclined to cheat." allowed, under law, to call up the chief and only gate a freshman manager, pro­ operator and get your nickel's worth of ducing a tone of authority, halted us Cavanaugh — George McQuiston: "I beef. momentarily. believe that the honor system should be * "Where do you think you're going?" maintained during examinations because No Blow "Why, to watch the teams scrim­ the honesty of Notre Dame men should Ann Sheridan couldn't come. mage." be something beyond question or doubt." * "Secret practice. Bud." "But Elmer said we could watch." Breen-Phillips—^Leon Ochs: "I should Inquisitive Damsel "I take orders from Joe Hart and the prefer the honor system. It makes for A certain fellow, bent upon making mob." greater self reliance and increases one's the student trip to the Navy game, hap­ "Can't we even watch through a peep­ sense of honor. I believe there is a pens to have a girl friend in Cleveland hole in the fence?" smaller amount of cribbing done or at­ whom he has dated for the weekend. "What? And give away our razzle- tempted under the honor system. Most He is all set, as the saying goes. Yet dazzle, punto reverso, triple-lateral?" people have a high sense of personal he has a friend who also is making the "Oh no, never! We are true blue and honor which prohibits cribbing under the trip. As is natural in the course of gold through and through." honor system, while they may not hesi­ human events, the fellow had to write "Well, what's the password?" tate under the present system." to his date and ask her if she, too, had a "Patty-cake, patty-cake, baker man." friend. The answer was, "Yes, I, too, "Okay, you can go in." Zahm—Bill Guy: "I don't think it do. Or, I do, too. But she wants to • should make any difference which sys­ know what your friend looks like." Oddities tem is used. The student who studies The second fellow felt aggravated. The runaway trolley with the sign, hard enough should be able to pass an So, pencil in hand, he took his spiral "This car to barn." . . . And Pat O'Hara examination under any system." notebook and wrote a sprig or two tells us about the fellow in the caf whose Freshman — Frank Holland: "The about himself: chums surprised him with a birthday present system seems to be the most "What do I look like? Look, lady, cake—candles and everything. effective, but I think we should give the what do Gable, and Taylor, and Power, • honor system a try, anjnvay. I don't and Ben Turpin look like? They wear Bottom of the Week think the student would be any more in­ pants, don't they? Many years ago I The rains came—^to Indiana. clined to cheat than he is now." The Notre Dame Scholastic Entered as second-class matter at Notre Dame. Indiana. Acceptance for maOins at special rate of postage. Section 1103. Oct. 3, 1917. Authorized June 25. 1918. Z 188 VOLUME 73 OCTOBER 20, 1939 NUMBER 5

THE MARCH IS ON — IN CLEVELAND TOMORROW Boys" torpedo the Navy, and Mr. Hunn and his "gators" will set the pace during the evening. Hunn's orchestra will be located at Wade Park Manor, at 107th St. and Euclid Ave., and the charge will be $1.50 per couple to dance to his music. It has been said that an army travels on its stomach and Notre Dame's army is no exceptiion. Taking this into con­ sideration Mr. Connelly has put up box- lunches for those who will make the Saturday morning trip. There will be no charge.—Harry Penrose

Jitney Players to Open Campus Theatre Season The Jitney Players present the year's first supplementary entertainment in Washington Hall when they perform the "Seven Keys to Baldpate," Nov. 2. This melodramatic farce, by George M. Co­ han is one of his really antic plays, and promises good entertainment. A week later Dr. PVancis G. Benedict, First Student Trip Train Ph.D., D.Sc, M.D., lectures on "The Science and the Art of Deception." Dr. Leaves Campus at Midnight Benedict who says, "The art of decep­ tion is so perfect it far surpasses the art of, observation," challenges us to learn the prime importance of distin­ guishing not simply essentials from non­ Cleveland, Navy Varsity ulty members, making the trip by auto­ essentials but the true from the false. mobile, are expected to swell the Notre Await Irish Onslaught Dame contingent well past the thousand The art of deception will be treated mark. The city, anticipating its doom, in its relation to scientific research, has given up all hope of resistance and showing the hazardous nature of faulty is set to welcome its conquerors. Bands observation. This lecture is not offered Cleveland is a doomed city! Nearly will salute the victors at every turn. primarily as entertainment though nu­ 1,000 Irishmen will land in the Lake Among the chief welcomers will be the merous magical effects are shown to City before tomorrow noon, and by eve­ Hotel Statler, Notre Dame headquarters illustrate unsuspected misdirection, and the false security placed in so-called ning Erin expects to have the situation during the week-end. The Statler, in "controls." well in hand—^including the Navy. Lat­ connection with the Notre Dame Alumni est bulletins from Student Council head­ Club of Cleveland, is going to present The Rev. William Carey, C.S.C., also quarters indicate that 500 students will George Hall and his orchestra as the announced the following tentative en­ leave campus at midnight on the first chief tribute to the conquering Irish. gagements. Judge Malcolm Hatfield, of section of the Navy Game Student Trip However, there is the usual fee of $3.00 the Juvenile and Probation Court of St. Special, and that a second section of the couple before you will be allowed to Joseph, Mich., will give a series of lec­ 200 will follow tomorrow morning. dance. They will also oflFer you a com­ tures during the year to students of Law plete dinner for $2.00 the pair. and Sociology. E. Allison Peers, Pro­ The midnight train will leave from fessor of Spanish, University of Liver- the steam plant siding; the morning Not content with what Cleveland will pooU will give a lecture series on Spain. train will leave St. Mary's siding at 7 oflFer, Notre Dame will bring two bands Professor Bunge, of Buenos Aires, will o'clock; breakfast will be served at 6 with them. One will be the ofScial Notre give a series of lectures to Commerce o'clock in the Dining Hall. Dame University band, and the other students. Dr. Alceu Amaroso Lima, An advance guard, two busloads com­ will be Karl Hunn's orchestra. Joie Brazilian critic and philosopher, will posed mostly of native Clevelanders, left "Swing" Casasanta and his boys will lecture during the second semester. at noon today. Other students and fac­ provide incidental music while "Elmer's —JiTii Snigger. THE NOTRE DAME SCHOLASTIC

Linnets Reorganize LASTIC will carry a full membership list "Scrip" Deadline Set later, and also details of the concert pro­ Have you any essays? Book Reviews? Once again the campus will resound grams which will begin late in the Fall. Short Stories? Poems? John Meaney, to the stirring strains of "Stout-Hearted editor of Scrip, the campus literary Men," "Song of the Vagabonds," "The quarterly, will consider contributions Hills of Home," and other typical men's Trolley Tries Hard But mailed to him at 126 Alumni Hall until songs as the Linnets, Freshmen glee Oct. 25—deadline for the first issue of club, again swing into action. Tliis year Fails to Break Record Nov. 10. the Linnets will present a variety of mu­ Morris Moifett Sat on a tuffet A Scrip considerably altered physi­ sic: besides the several examples of out­ Driving car one-five-nine... He slammed cally, and broadened in content, is standing secular music, the group will on the brake... It just wouldn't take... planned. Freshmen are especially in­ learn the Gregorian Requiem Mass, em­ Crash! (He was at the end of the line.) vited to contribute to "Freshmen Sketch­ bellished with special settings imported es," a popular section of the magazine from Rome, which arrangements have It was Monday evening, about ten for the past several years. not yet been heard in this part of the minutes before eight o'clock, that one country. of those streetcars which run between the campus and dowTitouai South Bend This year the glee club will embody failed to stop at the end of the line, and Tiy-Outs for Debate three or four smaller groups, with the crashed into and beyond the pole that Teams to be Held Soon possibility of more being added as the supports the trolley ware and telephone year progi'esses. There will be quartets, boxes. The pole was sheared off neatly "Resolved: That the United States one specializing in concert numbei's, and at the base, and the wire fell to the should follow a policy of strict isolation the other in old ballads. The third ground. Only two students were on the against all nations outside the western group rehearsing is an octet, the Sanc­ car at the time. They avoided injury by hemisphere involved in international or tuary Singers, which group will later running to the rear of the car as soon civil conflict," is the statement hall de­ appear vested at the Sunday afternoon as they and the motorman knew the bate teams will soon be pondering under organ concerts in Sacred Heart Church. crash was unavoidable. the guidance of coaches appointed Mon­ The concert quartet consists of Vail day night from the ranks of the Wran­ A slight drizzle, plus wet leaves on Pischke, James Byrne, William Scully glers, campus forensic society. the track, caused the accident, according and Carl Miller. The ballad quartet is The question will later serve as the to Motorman Morris Moffett. The sand­ composed of Henry Kane, Fred Crockett, bone of contention when the varsity de­ ing device also failed to give the wheels John Hogan and John Kane. The "Sanc­ bate team engages in intercollegiate traction on the slippery rails. tuary Singers" are James Madigan, competition. Lawi-ence Williams, Ray Flynn, Frank It was nearly two hours before a re­ First round inter-hall tilting gets Pachin, Steve Puffer, Tom Dorr and so­ pair crew came to the scene, the tele­ under way, Oct. 27. Each team will loist Edward Duquette. phone communication between police contest two debates in the first round headquarters and dowTitown having been and must win one decision to stay in the Although this year the Linnets will disrupted by the accident. During that race for honors. The list of hall coaches number approximately 40 members (a two hour period, the motorman estimat­ follows: considerable decrease from last year's ed, every student on the campus must Junior division: Zahm—Cotter; Breen- 125), they will continue the attempt to have been around to look over the acci­ Phillips—Meier; Cavanaugh—^Funk; keep the programs on the same high dent. He had a task keeping them clear Brownson and Carroll — Hennessey; level as their first concert last year. The of the "hot" wire on the ground. This Badin—O'Dea; Lyons—O'Dowd. Senior Linnets are a co-curricular activity of trolley wire carries 600 volts—enough division: Howard—Grady; St. Edward's the Discipline Department. The SCHO­ to make one think twice!—John Casey — Flynn; Dillon — Williams; Alumni — Barreda; Sorin — Mahoney; Walsh — McVey. Professor William J. Coyne announced that try-outs for the varsity debating team will be held during the second or third week of November upon the above question. These try-outs are open to all undergraduate students of the Uni­ versity including Freshmen. Contest­ ants will deliver a seven-minute main speech and a four-minute rebuttal. Those who survive the first preliminary will change sides and compete again in the finals which will be held about a week after the preliminaries. These desiring to try out should hand in their names along with their choice of the side they prefer to defend in the first preliminary to some member of the Department of Speech before November 1. A short time after that date lists will be posted giving the schedule and place of the try-outs. As far as possi­ ble contestant's preference as to choice All Througk the Night — Express to Cleveland of sides will be observed, but it may be THE NOTRE DAME SCHOLASTIC

necessary to ignore this in some cases. FRED SNITE, JR. — FROM LOURDES TO NOTRE DAME A Bibliography on the intercollegiate question is now available in the library.

Father Miltner Writes The second of a series of essays on religion begun last week in the Faculty Section by the Rev. Charles C. Miltnei-, C.S.C, will be found this week in the column "Your Religion" which appears on page 17. The column will appear weekly.

Decency in Print Via Radio is Council Aim i=H -i^-^^j^. A pure press for America! That is the aim of the Notre Dame Student Com­ mittee for Decency-in-Print as it begins its second year. Thirty-five thousand more copies of the student No Snuit pamphlet have been ordered. Distribu­ during the apparition (this is a large Dome Data piece, and was chipped off when the tion will start as soon as they are off The Rev. Charles M. Carey, C.S.C, base was levelled for the statue that the press. faculty moderator of the Dome, Thomas now occupies the niche); a small piece Cheaper materials are being used in F. Carty, editor, and Bud Largo, art edi­ of rock from the grotto; and a piece this fifth printing. Lower prices will al­ tor, went to Chicago on Tuesday, Oct. of rosebush secured at the Grotto of low for a wider distribution of the 10, to arrange the layout of the year­ Lourdes. pamphlet. Orders have come in from book, and to plan a definite production various cities: two himdred pamphlets These are rare and interesting relics, schedule. having been recently sent to Honolulu; and Mr. Snite's generosity is deeply ap­ preciated. Associate Editor Kelly announced and the largest single order thus far is that the pictures of the Freshman and 5,000, for the Antwerp Library in Sophomore Halls will be taken during Detroit. Extinct Daubers' Club the week of Oct. 23. The time at which Any one interested in helping this each hall is to be photographed will be campaign against smut is urged to get Revived By Art Group announced later. in touch with the Rev. Francis Gartland, Prosperity may be still just around Pictures of Junior Class members are C.S.C, 117 Dillon Hall. A maximum of the corner for the rest of the United being taken in Walsh Hall basement three hours work a week is assigned to States, but it has arrived for Notre now. members. Dame, according to one omen observed A new angle this year is the adver­ during the past week. Last Monday tisement of No Smut via the radio. A evening the Art Club held an organiza­ Campus Capers Helped short dramatic skit will be prepared for tion meeting which revived a body ex­ Early Vaudeville Star presentation over the local station. Tran­ tinct since 1930. The boom year of scription will follow with recordings be­ 1929 saw it reach its peak, and then News of the revivial of student vaude­ ing sent to all stations who will cooper­ fold with the market crash. Now, under ville at Noti-e Dame has spread even to ate in ridding this country of licentious the patronage of the Prefect of Disci­ far off New England. John Urban Riley literature. pline it is under way again, and invites of Cohasset, Mass., one of the star per­ A parallel pamphlet is also planned all- art students (B,F.A. majors) to formers in our early vaudeville, heard with publication scheduled for later in enroll. of the new show being planned by the the year.—John McDevitt A constitution similar to that of the Knights of Columbus. In a letter to old Daubei*s' Club will be used, but the the Rev. Eugene Burke, C.S.C, he says, name is to be changed. Monthly meet­ "When anyone here in the effete East Snite Gifts ings are planned, offering pleasant and asks me about Notre Dame, I always i-eply that I spent f oui* of the happiest On his last return trip to the Univer­ informal opportunities for art students to discuss their subject with congenial years of my life there, and not the least sity, Fred B. Snite, Jr., presented to of my happy memories are those of the Rev. John F. O'Hara, C.S.C, and the club members. The first of these meet­ ings will probably be a stag dinner or Student Vaudeville we organized for University some precious relics which Washington Hall." he brought back with him from his re­ smoker. Tentative plans indicate sketch­ ing ti-ips within a radius of ten miles or cent visit to the Grotto of Lourdes. As proof that some valuable practical so, and perhaps a trip to Chicago to see The relics consist of the following experience can be gained from partici­ some of the finer art exhibits there. items: a letter by the hand of St. Ber- pation in vaudeville, we again quote nadette on New Year's day, 1859, only The club will be under the direction from Mr. Riley. "Six years ago, because a few months after the last apparition; of Professors Hanley and Sessler, of of experience gained at Notre Dame, I a group (f photographs of St Bema- the Art Department. The committee was able to augment a depression in­ dette, one of which is now on display for organization is at present composed come by managing what is now one of in the University Library; a piece of of Aloysius Redd, Elmer Kamm, and the most successful sununer theatres in rock on which the Blessed Virgin stood Joseph Rastatter. New England, and as a direct result, I 8 THE NOTRE DAME SCHOLASTIC am working on a project that involves For further information inquire at Commerce Forum Fosters the cooperation of a list of summer the­ Room 148. atres selected from among the 152 to Attention! New Placement Bureau be found in the eight northeastern As you probably know all of us here Do you want a job? That's the ques­ states." at Notre Dame are not too blessed with tion the Commerce Forum is asking So if there's anyone interested in val­ the goods of this earth, namely funds Senior members; for this year, a place­ uable stage experience, not to mention for beer drinking. Now all of you men ment bureau under the direction of A. one of those cash prizes, he's asked to realize that beer drinking is a vital part F. Potenziani has been organized to se- drop around to the K. of C. headquar- of a Notre Dame man's education and sure post-graduate positions. tei*s in the basement of Walsh Hall and would not like to deprive any one of us By contacting key industrial men, the sign up for student vaude\Tlle. from enjoying this so essential course. Bureau hopes to arrange personal inter­ —Sam Boyle So I am going to ask each and every views for students. Both national and one of you to cooperate with me in help­ international firms ai*e on the schedule, Booknien Hold Elections, ing me to obtain the money necessary to assure that no fertile field will be for the purchase of great quantities of overlooked. Close cooperation with the Elect DeCoursey Prexy the amber fluid. school placement bureau will be estab-. William DeCoursey was elected secre­ lished. The plan that I have in mind is, in tary of the Bookmen at the meeting held Questionnaires will be issued for gen­ my estimation a good one, for I have Monday evening. DeCoursey has been eral information. Since individual at­ something in mind that will be of inter­ outstanding in discussion and in his dis­ tention will be granted each student, a est to all of you men of Freshmen Hall. play of well-grounded knowledge in all personal photograph is required for reg­ For the past eight summers I have been contemporary literature. istration. These should be submitted employed as a councilor in a girls camp. The Bookmen laid plans for the se­ before December 1. During this time I did considerable sew­ mester's program and selected the first An exchange of ideas between the ing and hem-stitching, with a little books for the society's library. These Notre Dame Forum and other Com­ darning on the side, so if you men will books were: God in an Irish Kitchen, by merce groups is being fostered, with an be so kind as to bring me all your sew­ the "Eev. Leo E. Ward; A Number- of eye to the establishment of a National ing it will enable me to pay off the re­ People, by Sir Edward Marsh; The Web Commerce Forum. Work in this direc­ maining charges on my new electric and the Rock, by Thomas Wolfe; The tion is in the hands of President Herb sewing machine (and believe me fellows Collected Poems of Gerard Manley Hop­ Connolly. kins; and T. S. Eliot's The Family it's a dandy) and of course enable me Reunion. to participate in the festivities at How­ ell's and like places. I sincerely hope Five students vi'ere admitted into the Academy of Science that you, the men of Freshmen Hall, Bookmen. The new members are: Sen­ On Monday evening, Oct. 9, the Notre will help a fellow student who likes to iors, Ray Allen, Bob Stinger, and Joseph Dame Academy of Science met for the have fun and etc. Ryan; Sophomores, Neel McCarty and 169th time. At this first meeting the Charles Kearney. The Bookmen will 148 .... JOE STEVENS .... 148 following men were elected to office: hold the next meeting at a local hotel; Thanking you just loads, Arthur D. Maddalena, president; Wil­ at this meeting new members will be I remain, liam Clark, vice-president; Robert Fish, formally inducted into the organization. "Two Stitch" Stevens. secretary; and Henry G. Armitage, Eu­ (Ed Note: "Runner Joe" Stevens is gene Leonard, and John J. Gilrane were holding embroidery classes, evenings made members of the executive com­ Extra! Freshman Hall from 7:30 until 9:00 p.m.) mittee. Edits Own Newspaper The To^\^l Crier of Freshman Hall moves into the fourth estate. Last week Volimie 1, Number 1, of the Freshman Hall Weekly was hung on the bulletin board for an avid reading public. Under the editorship of Joe Stevens, the paper is expected to be an answer to the wail­ ing need for communication on the northern front. Tending toward adver­ tising, Joe has heavily spaced all of the pages with offers of personal services to its readers. Among the outstanding bargains are: Freshmen! Know the glories of your campus; learn of its lore and history; see the sunrise over beautiful St. Joseph's lake. I personally conduct a cross-campus rim each morning, leaving Freshman Hall at 5:00 a.m. (Cavanaugh Hall at 5:01). Trip covers campus via both lakes. There is a small charge (10c) to cover this guide service. Enjoy a delicious shower upon return (no cover charge). Freshman Hall — Freedom of the Press THE NOTRE DAME SCHOLASTIC

trary to her treaties and supposed inter­ exploits in Eastern Asia have lost her FACULTY national friendships and nobody knows the sympathy and general commercial whether she will attack undefended pos­ confidence of the powers possessing the sessions of other people, such as French raw products she so sadly needs and the Indo-China, the Netherlands East In­ added expense of a great and prolonged Empire of "Rising Sun."' dies, or even Australia, as she attacked war paralyzes her economic and social In Eclipse—Campbell China. life still further.' With all these things in mind, it is quite questionable if Japan In the second place, Japan claims to Japan's political position among the can survive her imperial claims, political be a gi'eat political power, a great nation nations of the world at present presents ambitions, and diplomatic blunders. Her among nations, and has made every something of an anomaly. In the first position in the world today is highly effort to associate herself diplomatically place her poli­ problematical and it is quite possible with the major powers of the world. tical philosophy she may destroy herself and sink again She has been veiy proud to be able to is rooted in a into a minor island people of no inter­ boast of this accomplishment, achieved mythological national importance. after an extraordinarily rapid emergence theology. The from a decadent feudalism less than a —T. Boivyer Campbell. emperor i s di­ century ago. She allied herself Avith vine and the the great powers in the punitive expedi­ Japanese people tion against the Boxers in China in the are the chosen summer of 1900. She engaged in a war Students asked to Join of heaven, con­ with Czarist Eussia from which she sequently the South Bend French Club emerged the victor. She thrust herself, execution of against the advice of the British Govern­ The Alliance Francaise of South Bend any scheme is ment, into the war of 1914, and sat at has extended a sincere welcome to the T. Bowyer Campbell conceived to be the Peace Table at Versailles. She be­ students in French of the University of the direct wish and will of the emperor came a member of the League of Na­ Notre Dame and and the ordained destiny of the Japan­ tions, she signed the Open Door agree­ St. Mary's Col­ ese people and nation. It therefore be­ ment with nine other nations, and also lege to take part hooves any clique, cabal, or political the Kellogg-Briant Pact. Yet she has in their activi­ party to present their case and their jeopardized her good standing with ties, according to aims as the fulfillment of the divine em­ other peoples by. jettisoning most of an announcement peror's command. Superficially, this ap­ these agi-eements, thus beggaring her by Prof- Earl F. pears to be an evidence of national unity moral dignity. Here is seen the conflict Langwell of the and solidarity, but as a matter of fact, between her religious political philoso­ French depart­ it is the breeding ground of parties and phy and her participation in the accepted ment, who is also groups struggling to achieve their own international political life of the world. president of the aims and discredit those of all other par­ Alliance. ties Avithin the nation, by claiming to Lastly, Japan is in a very difficult The Alliance is Earl F. Langwell represent exclusively the will of the situation where her future is concerned. an educational emperor. First, considering her maneuvers in organization for the study of French China which brought her rather sharply literature, culture and civilization. It is (The tvriter, Prof. T. Bowyer Camp- up against Soviet interests, it yet re­ a member of the Federation of French hell, was a member of the faculty of the mains to be seen what solution in the Alliances in New York, a completely University of St. John, Shanghai, for future Japan and Russia can work out. American institution, not subsidized in three years. From tivo additional years The present hiatus of active hostilities any way by outside sources. Meetings of travel in China have come several can not be taken as a settlement of the are held in the clubrooms at 228 W, novels and a deep insight into Far East- mutual problems of the two empires. Colfax Ave. (opposite the South Bend em affairs.) Second, she has thrust her armies into Tribune Building) on Wednesday eve­ China, and although occupying certain For instance, some years ago a group nings at 8:15, and usually consist in a cities and lines of communication (chief­ of naval zealots, declaring that they short, interesting talk by French speak­ ly utilized by western commercial inter­ acted in the interest of the emperor, ing residents of the community. Once a ests rather than for the domestic neces­ month a dinner meeting is held at 6:30 assassinated several members of the cab­ sities of the people of China), she has in the Hotel LaSalle, and an address inet whom they declared to be traitors. not conquered the Chinese people nor delivered by. a distinguished visiting lec­ Further, the war in China has been un­ has she found a face-saving formula turer. This year the first dinner will be dertaken, perhaps blindly, to satiate the allowing her to withdraw. unquenchable ambitions of the army, held next Wednesday^ and the speaker and the diet and the cabinet were forced In spite of her adherence with the will be Mr. Marius Jean of Chicago; his by this military jingoism to approve of Berlin-Rome axis she was plainly the talk, Mon Grand-Oncle, Ma Soeur, et the "China Incident," although it im­ cat's paw of the Nazis and that has Mon Cinema promises to be whimsical poverished the nation, involved Japan in alienated her from her two most power­ and entertaining. a discreditable fashion with other na­ ful and profitable potential friends, tions of the world and jeopardized her Britain and Fi-ance, whose vast stakes "The gracious invitation of the Alli­ best interests both economic, as the re­ in the Par East stood to serve her prof­ ance Francaise of South Bend to the voking of the American Treaty is an itably. Whether her ambition, being a students of Notre Dame," said Mr. example, and diplomatically, as vitiat­ nation in raw products, to shift from Langwell, "will afford our classes an ing her position in the League of Na-' peasant agriculturalism to industrialism excellent opportunity to hear spoken tions and branding her as a treaty- can be accomplished without assistance French and to complement the formal breaker. Yet inspired by her alleged from other nations is more than ever a classroom instruction with outside pro­ divine ideology she plunges forward con­ question now that her treaty-breaking grams of a most valuable nature." 10 THE NOTRE DAME SCHOLASTIC All-American fullback as a box-office attraction to lure Freshmen into the brotherhood of a particular fraternity The Notre Dame Scholastic house. On the contrary, the actions of Disce Qtiasi Semper Vieturtis Vive Quasi Cras Moriturus the man who wears a monogram are FOUNDED lg«7 usually weighed in the balance more carefully than those of the man who wears a plain sweater. From what we hear around the halls, and have seen at the games, John Kelly & Company have WnxiAM C. FAY, DONALD FOSKETT, always taken things in stride, on and off Managing Editor Editor-in-Chief the field. WILLIAM C. MCGOWAN, JAMES NEWLAND, News Editor Sports Editor But we were saying we admired the way Southern Methodist supporters ab­ FRANK WEMHOFF, RICHARD METZGER, Literary Editor Art Editor sorbed what must have been a particu­ larly disappointing defeat. If we have DONAU) DRISCOLL, REV. C. LASKOWSKI, C.S.C, to render "Hail to Tech" or "On North­ Art Editor Faculty Adviser western" some five o'clock these Satur­ day afternoons, no honor will have been Member of Catholic School Press Association and Associated Collegiate Press. Distributor of Collegiate Digest. Represented for national advertising by National Advertising Service, lost if we sing in the same jaunty style Inc., 420 Madison Avenue, New York City—Chicago—^Boston—lios Angeles—San Francisco. the Mustang band swung the "Victory THE SCHOLASTIC is publlrfied 26 times during the school year at the University of March."—WILLIAM C. FAY Notre Dame. Address manuscripts to Editor. 259 Alumni Hall. Notre Dame. Indiana.

Staff meetings Friday evenings In Editorial Rooms, Ave Maria Building; Editorial Staff. S:30 P.M.: General Staff. 7:00 P.M. Tke Flag, My Friend

Across the Editor's Desk E WRITE this at the risk of being W called a crank, a patriotic show- On a Saturday Afternoon Speaking of sportsmanship, did you off, and a menace to the future happi­ notice Bob Saggau hopping along the ness of all those who subscribe to "it's a free country, ain't it?" school of GAME worth playing is worth sideline as the last 30 seconds ran off the clock? Instead of breaking for the thought. But we feel that a regi'ettable A winning. In intercollegiate foot­ situation has arisen in recent years, due ball circles the term "good sportsman- dressing room he galloped onto the field to shake hands with Harry Stevenson— solely to a careless and inconsiderate at­ sMp" often times covers up a multitude titude on the part of many American of half-efFoi-t and sham. The smiling the man who had usurped his place at left half most of the afternoon. people. The most glaring example of loser is generally the consistent loser. what we mean can be seen on any Sat­ But there was no trace of half-effort in urday afternoon in the football stadia the Southern Methodist team that In the Hollywood version of "The throughout the nation. Traditionally, at Spirit of Notre Dame" our left half was blocked Harry Stevenson's punt in the most schools, no football game begins final seconds of last Saturday's football a prima donna with callouses on thumb until the national anthem has been game—^and the jaunty Mustang band, and forefinger from scissoring press played. At the first note the crowd which swung over to the Irish stands at clippings. Saggau didn't follow the rises, becomes fairly quiet, and looks the gun-crack, played the "Victory script. He might have felt very sorry around to see what all the commotion March" with no indication that a tough for himself The newspapers had elected is about. Failing to discover anything ball game had just been lost by the him All-American in September. There exciting, our friends discuss punts and twitch of a toe. it was the middle of October and a com­ bination of injuries and Stevenson's fine passes with their neighbors or beckon play had lost him his starting job—at to the pop-corn vendor, completely ob­ The Mustangs can come back again, least temporarily. But he was wildly livious of the fact that two or three any time. They play hard football and happy the team had won—^unperturbed policemen and a Boy Scout are standing they play to win. In two stadium ap­ by his own demotion . . . and in that at attention down on the field. The band pearances they have fought two of the he was already an All-American. stops, the crowd roars at something or most exciting games in Irish grid his­ other,, and the policemen and the the tory. If, as we read in the papers, the Boy Scout relax. Notre Dame football schedule is being And speaking of AU-Americans the narrowed gradually to a fixed card of senior class must be very well satisfied To put it briefly, there seems some­ "natural" opponents (Northwestern and with its members on the varsity football thing mightly inconsistent in arguing Army and Southern California, for in­ team. Some of them may butcher a peace, democracy, and liberty, while at stance), it might be a good idea to find three-spade bid, or make too much the same time we fail to show proper a permanent place for the Mustangs. racket in the showers, but they are no respect to the most concrete symbol we worse and no better than the fellow have of these principles. Various vet­ The senior class would elect them next-door. On a campus that has no erans' organizations have brought this unanimously. No home game in the fraternity houses a monogram can some­ situation to the attention of many peo­ past four years—not even the 7-2 battle times be more of a liability than an ple. We consider it our duty to remind with Ohio State—^built up to the climax asset. •the students of their obligation. that saw Jackie Sanders punch the tying point barely right off the posts. There is no tendency here to use an —^DONALD A. FOSKETT THE NOTRE DAME SCHOLASTIC 11 The Spirit of the Founders

A full text of the Founder's Day Sermon delivered by The Rev. J. Leonard Carrico, C.S.C., at the Anmial Founder's Day Mass, in Sacred Heart Church, October 13.

The thirteenth of October, the feast and a college be built within two years. unexpected donation. Prejudice, also, of St. Edward, king and confessor, is The oifer was accepted, and Father was prompt in offering its discourage­ traditionally and solemnly observed at Sorin and his brothers set out at once, ment. Some of the fervent non-Catho­ Notre Dame — that day being the pa- by ox-cart, braving for ten days the lics of the neighborhood, alarmed at this tronal feast of Father Edward Sorin, severity of one of the worst winters in sudden intrusion of Catholicity into their the chief founder of the University. the history of the State. midst, threatened to bum the proposed This solemn holiday would, however, be Arriving here toward the middle of college as soon as it was built. in vain if we did not think somewhat the November of 1842, they found noth­ In 1854 Notre Dame was visited by of its meaning, if we did not learn some­ ing but a small log structure, in the the terrible plague of cholera, which was thing of what it is meant to teach, if woods to the south of St. Mary's Lake, then raging through the country and we did not take some inspiration from in which were a chapel and one living which for two months wrought death on the heroism it commemorates. room. Their total wealth consisted of the little community. Those who escaped It takes some eifort for us to realize four hundred dollars and the promise of the contagion were too few to serve that less than a century ago there was a thousand, with which to establish them- medicine to the sick and bury the dead. no Notre Dame, to picture these grounds Of those that survived, several were per­ as being so recently a part of the prime­ manently disabled from active duty. val forest, in which the savage redmen Through the Sixties and the Seventies roamed, as being such a short time ago Precursor the institution grew slowly, year by year, a scene of Avigwams and wilderness. The in numbers and strength — but just as story of the transfonnation should be It is peaceful, too much so I say. the long, hard struggle for existence was of abiding interest to the student of this These fields have been quiet too long relaxing into success, the fire of 1879 school. Fi-om it he should learn to re­ And need to taste a bitter day wi-ought in a few hours the ruin of all vere the memory of the men who, by the Before they greet another dawn. that had been accomplished in the forty- grace of God, have wrought the miracle six years. The destruction was practi­ of his Alma Mater. And in that story Someone must prepare them cally complete and the insurance covered he may find for himself fine practical For fire and sioord and shell. only a slight part of the loss. ideals of Christian life and Christian pa­ Someone must xvarn them The venerable founder. Father Sorin, triotism — ideals actually realized in the Of the violence of hell. lives of the men who have founded and then sixty-five years of age, had just started by way of Canada on a trip to developed his University. Of course, So I rush madly about in the few minutes we have we cannot Europe, in the interest of his Congrega­ And stamp and crush the grass tion. From Montreal he was called back do more than sketch the story in merest And pierce the sky with frenzied shouts outline, noting chiefly the difficulties to the ruins of his lifetime of labor. But To make the fiitiire pass. with which the founders had to contend. Father Sorin was not the man to waste —^JACK RILEY. time in lamenting misfortune however On August 8, 1841, Father Edward dire. Reviving that splendid courage Frederick Sorin, newly-ordained priest and energy of his youth, he set to work in the Congregation of Holy Cross, and to build a greater Notre Dame on the six brothers of that religious community selves and build their college. They set ruins of the old. The fire occurred about left France for America in response to to woi'k at once, however, with as much the middle of April, and the students, who were loath to leave, were told that a request made to the superior general. spirit as if they had an abundance of a new college would be ready for them of the Congregation by Bishop Helan- means. in September. When they returned they diere, of Vincennes, for missionaries For several months these seven reli­ found the present main building await­ and teachers for his vast diocese in the gious had to sleep on the floor of their ing them. Many other buildings have new world. In practice of the poverty one poor room, with the winter's snow been added through the years since then, they professed, these religious made the sifting in upon them. During the whole one by one as need required and means first half of her history, indeed, Notre slow ocean trip as steerage passengers permitted, until we have the Notre Dame Dame felt severely the pressure of pov­ to New York and came thence by canal of today — humble in her origin, heroic erty. More than once the institution boat and stage coach to Vincennes, in in her days of trial, grateful in her pres­ was on the point of being sold for debt. Southern Indiana, spending in all two ent development, and hopeful that her At one time the available operative cap­ full months of weary and dangerous future may be worthy of her past. travel. They opened promptly two ital of the community amounted to just schools for boys near Vincennes, but a fifty cents. At another time the horses Surely we have reason to honor the year or so later the Bishop offered them were taken from the stable and sold to memory of the men who with such odds the tract of land here at Notre Dame, the highest bidder in order to satisfy an against them have done so much in our left to him by the pioneer missionary urgent creditor. Once after the college behalf — the memory of Father Sorin, Father Stephen Badin, for educational was built there was no food whatever who as priest, dreamer, and builder was purpose. The property would be given for either the students or the commun­ the genius of Notre Dame, the memory to them under condition that a novitiate ity — a situation that was relieved by an —Turn to Page 22— 12 THE NOTRE DAME SCHOLASTIC

Irish To Enter Navy Game Can Stevenson Run th With Full Strength Squad

Layden Warns Team Not practice sessions this week. Talking to To Give Middies Breaks the players, he stressed this point first: "Charitj'^ is a wonderful virtue, granted. But, it is most virtuous when it begins at home. On the football field, Into the Cleveland Municipal Stadium two instances of our giving nature were tomorrow will march the Na\'y, its full displayed, not subtly, by a fumble and fighting force intact. Following closely a blocked kick. Needless to say, those on its heels will trot the squad of Noti-e two misplays were potent factors in Dame's Irish. It is to he a football making up the final score. game on land, not a naval encounter at sea. Still, there are analogies to be "I think I have seen veiy few games made. The Midshipmen will use their comparable to the S.M.U. battle in dreadnoughts in the center of the line, clean, hard playing, spoi-tsmanship, and their cniisers will guard the flank sector, spirit. We definitely want that kind of the backfield can well take care of the football, but we want a little less of the aerial tactics. gift horse style of play." Na-s'y's line has been built around A little anxiety was expressed con­ Captain Allen Bergner, 220 pound cerning the injured list. To any worries tackle. As a running mate, Bergner along these lines, Mr. Layden had this has big Tom McGrath. The ends are answer: Corbett and Burke. Last year Burke was responsible for many pass comple­ Last week Saggau, Hargrave, and tions against Notre Dame. . He made Crimmins got needed rest. All three Irish fans uncomfortable for four quar­ will be ready for all the action possible Navy stopped Harry Stevenson's thrusts at tach ters until Notre Dame finally came against the Navy. As for Zontini—^lie scored toiichdoivns to win the Battle of Baltimore, li tlu-ough 15-0. Trimble, Witter, and was shaken up last week, but will be in loose tomorrow? Harwood stand ready in the center of perfect shape for our coming game. The the Navy line. squad will go to Cleveland with every man ready to play ball. We will pit our The Starting Short, stocky "Pumpkin" Wood, full force against Navy." trouble-maker for the Irish these past Notre Dame Navy two years, is again back, more adept There will be a packed house for the Kerr L.E... Hansen than ever at slipping off tackle for first big event in Cleveland tomorrow. Notre Gallagher : L.T.... -Bergner (C) downs. Archie Mayo and Ralph Ander­ Dame's Irish meet Navy's Midshipmen. DeFranco L.G—. McGrath son return to hai-ass opposition • with It's a natiu-al rivalry. Two fighting Mclntyre C Harwood swift - exploding passes. Other promi­ teams, two well-trained teams, two un­ Riffle R.G Trimble nent backs are Whitehead, Leonard, defeated teams. Notre Dame goes out Harvey R.T Opp and Lenz. to turn back the plunging heavy-boat J. Kelly (C) R.E Burke il type fullbacks, to knock down the foot­ Sitko Q.B Wood The sailors never have been a team ball bombs thrown by quick-moving Stevenson L.H Gebert to consider lightly. During lean years halfbacks, to sink the Navy. Then we'll Zontini R.H Malcolm la down in Crabtown the great spirit of think of the Scotchmen.—Joh?i Patterson Piepul F.B Gray C the corps overcomes lack of material. Remember 1937 — on a snow-covered field the Midshipmen fought the Irish to a standstill until Chuck Sweeney Jots between dots. . . . broke through to block the kick which ^^^^pSS^SiirWSMi'i3:'5iii-~-.?.' '^r'i:^-^^ ^„-„--icife'i»&""i*?iiiiiJ spelled Anctory for Notre Dame, 9-7. Allen Bergner, Na^^r captain, has Last year Navj' opened up in the first won awards in four Navy sports during half, threw 30 passes, and had Lay den's the past two years. The big fellow has men running in circles for a while. starred in football, wrestling, lacrosse, and boxing. . . . the Middies' starting Against Southern Methodist, Notre line will average 204 lbs., while the Dame kicked too many extra points for backfield will average 175 lbs. . . . the Mustangs. Although greatly im­ Major "Swede" Larson, Navj"^ coach, proved over the previous two weeks, the was captain of the 1921 Navy team and Irish were inclined to give away some was center on Walter Camp's 1921 sec­ points. Coach Layden was intensely in­ ond Ail-American team. . . . Harold terested in cutting down, on the chari­ Har\vood, Na^vy center, is one of the table tendencies of his team during best in the East. Cleveland Municipal Stadium — 80 THE NOTRE DAME SCHOLASTIC L3

Splinters From The Pressbox the Navy Blockade? by Frank Aubrey

Theoretically, a fullback is not the another ball game for L.S.U., and by the most important cog in a Notre Dame same method too. Ken took a pass over backfield. All action centers around his shoulder while racing into Rice's the capabilities of the left-half whose end zone. In this game as well as the performance is supposed to determine Yale-Penn affair, the beaten teams lost the fate of the team. Our l.h.b. post because they fumbled into the end zone was ably handled last week by Harry while in the act of scoring a touchdown. Stevenson and Benny Sheridan, but the Ernie Lain performed the 'feat' for king-pin role was usurped by a fullback. Rice, while Hovey Seymour obliged for Whether we needed a yard or five, Yale. — The outstanding performance of whether the blockei-s had done a good last week's football saturnalia was the job or not, whether there was a hole or Merriwell-feat of Tom Harmon, Michi­ not, we had a fullback who had the gan's AU-American boy. As a running stuff to come thi'ough. There's no se­ back Tom must have convinced lowans cret to Milt Piepul's success. Big, burly, that he was the oft-mentioned irresis­ and tough, he's a typical bone-crushing tible force. Since Iowa, however, was back. But in addition, he runs with the not the immovable object, a possible so­ niftiness of a 175 lb. half; he keeps that lution to this age-old problem of logic head up until he find a hole, chums was not attained. Thanks to Harmon's through it, and then drives for the goal four touchdowns and trio of points line. Once he was through that Metho­ after, Michigan's afternoon was not a dist line it generally took at least two total flop anyway. — This Harmonized men to bring him down. It was almost Michigan team seems a shoo-in to win like tempting Providence when Elmer the Big-Ten title — bar accidents to sent Milt in during the last quarter with Crisler's bread - and - butter boy. The the count 4th down and one to go. There rub is that a player who's on the spot was no deception. The Methodists knew like Harmon is more likely to get hurt Milt would carry the ball, and they knew than not. The great Fritz Pollard found ackle last year, but Bob Saggau ayid Joe Thesing the type of play he would run on, but this out while playing for Brown a , 15-0. Will a harder-running Stevenson break the couldn't do anything about it. Milt couple of decades ago. In fact Fritz made the yardage with the whole South­ was the object of all the 'accidental' ern Methodist team set for him. bumps dealt out by Brown's opponents. 1 g Lineups In one early season game Brown was Of course Milt didn't do it all by him­ meeting a smaller school. The under­ - Time—1 p.m. (CST). self. His effectiveness was enhanced by dogs met in solemn conference before Place—Cleveland Municipal Stadium. the brilliant running of our halves off the game and decided that their chances Attendance—78,899. the Methodist flanks. They kept the of winning over the Bruins would be Referee—L. Dilweg (Marquette). defense spread out to guard against greatly improved if Mr Pollard didn't Umpire—H. G. Hedges (Dartmouth). sweeps, and meanwhile Mr. Piepul was remain in the game very long. Oh well, Linesman—Herb Steger (Michigan. slicing through the middle for chunks boys will be boys! So, when Fritz, got Field Judge—Dick Bray (Xavier). of yardage. While we're riding this the ball and smacked into the line for Coaches—Elmer F. Layden, Notre Dame; Piepul band-wagon it might be well to the first time—. After that, the smaller Capt. E. E. Larson, U.S.M.C, Navy. look around and discover the reason for school was very much in the ball game. Radio Broadcasts—WHK-WCLE, Cleve­ all this grade A fuUbacking. It won't —^Let it be clearly stated, however, that land and MBS; WTAM Cleveland; WGAR take long. There's a fellow around here this column does not condone sucli con­ Cleveland; WLW Cincinnati. who was quite a fullback in his day and duct. If you are playing a hard game of the chances are he was able to give football and the urge comes to" slug Milt a few pointers. Back in '24 Elmer someone, just remember this: there are was a different type of fullback—^lithe "eleven" men on the other team! and wii*y, he depended on his speed for S^g^SSai«S«C™^ic£r quick knifing thrusts through the slight­ Picking Splinters: est crevices in the enemy line. With Notfe Dame over Navy Piepul as a pupil Mr. Layden must have Alabama over Tennessee had to use the Savoldi technique. He Army over Yale of the wrestling Savoldis had one favor­ Holy Cross over Brown ite method of getting two yards which Nebraska over Baylor we haven't seen Milt use as yet. Joe Harvard over Penn used to dive high over the pile in mo­ California over Washington State ments of stress, thus netting Notre Dame Columbia over Princeton many a touchdown. As time goes on Georgia Tech over Vanderbilt we may see a little more of this Savoldi Ohio State over IVIinnesota influence creeping into the Piepul era. Northwestern over Wisconsin We see that: — Ken Kavanaugh won Tulane over North Carolina 80,000 Will Watch the Irish 14 THE NOTRE DAME SCHOLASTIC Interhall Tournament Introducing by Pete Sheehan Started in Memorial Entries opened today at the busy Rockne Memorial in two more tourna­ Last year he saw plenty of action be­ Bud Kerr was a pi-ominent figure on ments, freshman handball and freshman hind AU-American Earl Brown. In the the Newburgh Free Academy football foul shooting. A frosh swimming meet Carnegie Tech battle, it was he who field every Saturday afternoon a few was concluded last night. years ago. The fans enjoyed his ex­ carried the ball over the goal line on ploits on the gr'idiron. But Bud did not an end-around play for the game's only Entries will close next Fi-iday with rush down under punts, catch passes, or touchdowTi. competition starting Monday, Oct. 30. heckle the enemy wing backs. He This year the experts are comparing As far as could be learned, the intra­ marched behind the Newburgh drum Kerr's defensive play to the sterling mural tournament in foul shooting will major, clutched a gold-plated instru­ work of Chuck Sweeney, and his pass be the first of its kind in the Univer­ ment in liis hands, and saved his breath catching ability is rated as high as Mill- sity's history. Each player may have to enteilain the spectatoi's. Bud Kerr ner's and Brown's. End coach Joe as many practice throws as he wishes, rode to gloiy on a trumpet! Benda has his fingers crossed but he but when he's ready to go, his shots After Saturday's game must be continuous. According to ten­ Bud was tempted to linger tative plans, each competitor will be awhile and listen to that given fifty shots, twenty-five the first S.M.U. jam session. He had day and the same number on another always liked music. The day. high school band leader used Memorial Director Tommy Mills to borrow him from the foot­ urges all freshmen to compete in either ball coach every Saturday of the two tournaments and if possible, and Kerr will tell you that both. The experienced leader said, his gi'id mentor never raised "I've seen many boys who weren't good any objections. The music basketball players, but whizzes at mak­ lover, not the football enthu­ ing free throws." siast, was sad when Bud re­ There are a number of baskets avail­ ceived his diploma. able for practice. On the third floor A factory job was Bud's there is a huge court for different first duty after graduation. games. Besides two basketball courts He was forced to work for separated by coz'd backstops, there are awhile before continuing his two baskets at each end of the floor for education but every day as practice shooting only. There are also he went back and forth from two badminton courts, one large and Ms job he used to think and one small volley ball court, and one reg­ talk football. The idea of ulation-sized indoor tennis court. There emulating Clyde McCoy or is also room on the floor for ping-pong Heniy Busse had been dis­ and archery tournament. carded long since. Ever since Bud had first been able to Competition in the handball tourna­ read the daily sports page, ment will be restricted to singles play. Notre Dame football players had been his heroes. When the hour of Bud's Kelleher Vows It Takes depai-ture for Notre Dame arrived his would like to have his third all-American Practice to Placekick fellow townsmen told him that they end in as many seasons as end coach would try to spot his trumpet when the here. Back in Lorain, Ohio, high school music of the Notre Dame band was Bud has not given up his music. He football coach Earl McCaskey told his broadcast between the halves. They now plays the guitar and together with players the art of kicking helped a lot never imagined that Bud would play saxaphonist Mike Corgan, his roommate, in making up for lack of size. One of football. If the Newburgh residents provides plenty of entertainment for the these hopefuls with no surplus of avoir­ had heard of the Southern Methodist dead end kids from Lyons Sub. dupois was John Kelleher, present 155- Swing Band they, no doubt, would have Bud played basketball and baseball pound second string Notre Dame quar­ urged him to continue his education at back home but has not participated in terback. Although the Irishman didn't the Dallas institution. these sports since he enrolled here He make the football team, he had started kicking field goals anyway. Four years Unknown, Bud arrived upon the cam­ doesn't mind the bumps he receives on ago he came to Notre Dame. He kept pus in the Pall of 1936. Shortly after the gridiron because he was Hudson kicking. Last year he was on the fifth Freshman practice had begun the Valley's champion ice skater during his team. Moved up this year behind Steve coaches and students were watching tliis early high school days and took many a Sitko, he continued his high school big blonde left end. When Spring rolled spill while practicing. coach's advice. around they were talking about him. Statistics: Bom in Tarrytown, New Although he did not win a monogram York. Now resides in Newburgh. Full Came the Purdue game and the true in his Sophomore year, the Hudson name—^William Howard Kerr. Weight "Frank Merriwell" reward arrived. River boy became known to Fighting 194 pounds; height, 6 feet 1 inch. An With the score tied 0-0, a huge crowd Irish fans when he stood up like a vet­ honor student in Physical Education. of 40,000 in the overt stadium, John eran against the Army during forty Bud hopes to teach the Notre Dame, converted from the 15-yard line. minutes of the gruelling battle. system after his graduation in June. Down in his room in Morrissey sub, THE NOTRE DAME SCHOLASTIC 15

John admitted that kick was his greatest rugged and is counted on to be a real the whistle blows. Notre Dame teams thrill. Even his game-winning point tower of strength in the Navy line. He from the past know this boy is mighty after touchdown in the S.M.U. game weighs 200 pounds and towers 6 ft. 2% tough. does not eclipse this thrill. But when in. The cards are dealt. Who'll gamer he missed his first attempt earlier in the Navy's only starting Irishman, Thom­ the first trick?—James G. Newland. game, it made him mighty sad. as P. McGrath, is said to be a real power Asked how he gained his skill in the on both offense and defense. He is re­ art of placekicking, the gum-chewing, ported to be at his best when the going THE SCORE BOARD pre-med generalissimo replied, "Prac­ is hardest. If that's the case he should tice." He used the form Mr. Layden go like a house afire. teaches his players: two steps and the An Evansville, Ind., boy, Bex A. PUNTS ball should be travelling end-over-end Trimble, Jr., will start at right guard. Player Punts Yards Av. toward the pay-off vacuum. We've heard little about this man, but Saggau 9 431 48 In the stands tomorrow at the Navy he is said to be big and strong and car­ Bagarus 1 33 33 game will be another Kelleher, William ries out his assignments well. Inciden­ Stevenson 19 592 31 A. "Bill" Kelleher, Notre Dame mono­ tally, he is the only Hoosier on the start­ Piepul 4 119 30 gram man in football and basketball in ing eleven. Zontini 1 21 21 '12, '13, and '14. "Bill" is also John's father, and exerted the proper Notre RUNS Dame influence ever since the second Player Times Yards Av. Kelleher was two years old—at least Sheridan 5 36 7 that's the age John said he started want­ Piepul 21 126 6 ing to come to the Notre Dame plains. Bagarus 5 19 4 John practices about 30 minutes Juzwick 3 13 4 each Wednesday, Thursday, and Friday Stevenson 17 64 SVz on his art and about 15 minutes before Thesing 25 94 3% the game. He has played about 30 min­ Zontini 33 115 3% utes this year and needs 30 more for Crimmins 12 29 2% his monogram. He's hopeful, and so McGannon 7 20 3 are we.—John E. Lewis Leonard 2 7 S^A Saggau 32 65 2

Unbeaten Navy Eleven PASSES (Throwing) Player Times Comp. Av. Yds. May Surprise Laydenmen Sheridan 1 1 1000 7 Stevenson 11 5 .454 113 When "Billy," Navy's famous goat, Saggau 5 2 .400 41 leads the Midshipmen onto the field to­ Who'll Be Goat Tomorrow? McGannon 2 0 morrow at Cleveland's Municipal Stadi­ um, 80,000 fans will be looking at a team with a host of good backs, a very Lois P. Gray, one of the Midshipmen's RUNBACKS (Punts and Kickoff) strong defensive line and a squad of ball hardest hitting and running backs, will Player Times Yards Av. players capable of upsetting anybody's probably give the Irish more ti'ouble Thesing 1 23 23 dope bucket. than they may want. He's from Hous­ Piepul 1 18 18 ton; Texas, and Texans always are tough Zontini 1 16 16 The middies' deception isn't anything on N.D. football men. He weighs 185 Sitko '. 7 78 11 to brag about, nor are they noted for pounds and is 5 ft. 11 in. tall. Kelleher 1 7 7 good secondary blocking, but Layden One of Navy's few starting seniors Hargrave 12 2 knows from experience that playing a will be Everett A. Malcolm. He is one McGannon 12 2 Navy football team is like playing with of the least heralded backs who is ex­ fire in a big gasoline tank. They are pected to give a good account of him­ apt to explode any minute. TOTAL YARDS GAINED self tomorrow. He is a hard running Player Times Yards Av. Louis E. Burke, Jr., a senior tipping wing back and throws 'em left handed. Kerr 5 85 17 the scales at 190 pounds and a letterman The middies only starting sophomore O'Brien 1 11 11 from the 1938 team, will hold down the back is Wesley R. Gebert, Jr., a fast Sitko . 9 78 8% right end spot for the sailors. They say stepping, shifty type runner as well as Hargrave 2 16 8 he is big and rugged and is a natural an excellent kicker. He weighs only 167 Piepul 22 144 7 60 minute player. All of which should lbs., but dynamite still comes in small Sheridan 5 36 7 keep Bud Kerr plenty busy. packages. Thesing 28 139 5 Harold (Swede) Hansen, a former Emmett W. Wood, quarterback and Zontini 40 172 4 backfield man, is expected to use his spark plug of the Navy offense may Bagarus 5 19 4 225 pounds to advantage at left end. view proceedings from the sidelines to­ Stevenson 18 66 3% He was outstanding in his pass defense morrow. Injuries received in last week's Saggau 24 82 3 work against all Navy opponents last Dartmouth battle are not as yet healed. Kelly ., 2 7 3^ year and his play so far this season has He is serving his third and last year on McGannon 8 22 3 been commendable. the Navy varsity. Leonard 2 7 3^ Richard Opp, Jr., will start at right Captain Allen A. Bergner, 215 pound Crimmins 13 29 2 tackle. He is reputed to be rangy and tackle, will be on the firing line when Mclntyre 12 2 16 THE NOTRE DAME SCHOLASTIC

er, of the Saints (A cunctis) 3d, Against main floor of the Main Building depict OUR DAILY BREAD Persecutors and Evil Doers. Votive or various stages in the life and history Requiem. of Columbus—and are said to have the likenesses of well-known men in Notre Thursday, 26—St. Evaristus, Pope, Dame history. In the sixth portrait of LITURGY Martyr. Mass, Statuit (in Common) 2d Columbus discovering land, the late Eev. prayer, of the Saints (A cunctis) 3d The Liturgy of this Sunday is a prac­ Matthew Walsh, C.S.C, president of the Against Persecutors and Evil Doers. tical application of the doctrine of the University in 1882 when the paintings Votive or Requiem. Mystical Body of Christ. The Sunday is were made, and Professors Stase, Lyons dedicated to the Missions, those "other Friday, 27—The Vigil of Sts. Simon and Edwards are included. Father sheep," potential members of the Mys­ and Jude, Apostles. Mass proper. No Walsh is Columbus in the mural. tical Body. "That they all may be one, Gloria. 2d prayer, of the Blessed Virgin as thou. Father, in me, and I in thee; The first portrait is of Columbus, the that they may also be one in us." (John (Concede) 3d, for the Church or the second depicts Queen Isabella, and the 17, 21). Pope, 4th Against Persecutors and Evil third shows Columbus and his son at Doers. the gate of the convent. Father Diez Pope Pius XI declared the Missions blesses Columbus in the next scene while Saturday, 28—Feast of Sts. Simon to be "the greatest and holiest of all another shows the mutiny at sea. The and Jude, Apostles. Mass proper. Credo. Catholic undertakings." He gave the others shown are: Columbus taking pos­ Preface of the Apostles. plan of operation in the encyclical Re- session of the new world; his presenta­ riim Ecclesiae (28 Feb. 1926). He es­ tion at the court (which includes a self- tablished the second last Sunday of Oc­ portrait of the artist); Bobadilla be­ tober as Mission Sunday. Its observance Met Club Prepares For trays Columbus; the death of Columbus; was to take the form of a solemn votive and individual portraits of the Father mass for The Propagation of the Faith, Annual Army Game Trip Protector and Treasurer of Aragon. the collect from the same mass to be A §300 treasury surplus featured the The Murals were painted in 1882 added in private masses, (the Bishops so opening meeting of the Metropolitan when Gregori visited Notre Dame,! In ordering); the sermon of the day, and Club, Wednesday night. Treasurer Larry the Library is the Opera of Giovanni a collection to be taken up for the work Bracken reported that this was the first Pico Delia Mirandula, which has a spot of the missions. Thus by prayer and time since 1935 that the club has been of prominence in the main aisle. The good works all should imite to sustain in the black. book, once owned by Columbus, is be­ both spiritually and materially the ad­ President Doug Bangert revealed that lieved to have been written in 1503. vance guard of the faith, the sowers of the club obtained the permission of the the Word. Rev. James D. Trahey, C.S.C., Prefect Pittsburgh Club Plans This week the Liturgy further wit­ of Discipline, to run a student trip to nesses to our spiritual inheritance: New York for the Army game. "The Carnegie Tech Special Thursday, St. Raphael, Archangel, in cost," he said, "is $24.85 for the round trip by coach, exclusive of game tickets." A Pittsburgh rooting contingent 38 his own words "one of the seven who strong is expected to leave the campus stand before the throne of God"; Sat­ The train leaves South Bend at approxi­ mately 5:30 p.m., November 2. It will at 4 o'clock next Friday afternoon boimd urday, Sts. Simon and Jude, Apostles,' for the Carnegie Tech game, Edward G. who preached the Gospel in the East, return to Notre Dame in time for Mon­ day morning classes. No cuts will be Huff, president of the Pittsburgh cam­ suffered martyrdom in the same place, pus club, announced yesterday. and whose names are mentioned togeth­ excused. er in the first list in the Canon of the It was also announced that the club If present plans follow through, the Mass. has given a $100 scholarship this year trip will be made by bus, with departure to a dcser\'ing member. This was the from Pittsburgh scheduled for 11 o'clock highlight of last year's work and the Sunday morning. The round trip fare is Mass Calendar: October 22-28 club will attempt to make two such $8.50. A limited number of $3.30 seats Sunday, 22—^Twenty-first after Pen­ awards next year. —^perhaps one for each bus passenger— tecost. 2d prayer, of the Saints (A Plans for the annual Christmas danee will be available. Reservations can be cunctis), 3d, Against Persecutors and were discussed. Myles Walsh was select­ made with Edward Huff, in Room 1, Evil Doers, 4th, For the Propagation of ed general chairman, and John Martin, Sorin Hall. the Faith. financial head to guard the $300. The reports of the various committees will Mission Sunday. The Solemn mass be heard at the next meeting. St. Louis Soccer Team Tnay he the votive inass for the Propaga­ Wins Two—Record Intact tion of the Faith. 2d prayer, of the Sun­ • Norv Hunthausen's St. Louis soccer day. Preface of the Trinity. Last Gos­ team retained its undefeated status last pel of the Sunday. Columbus Remembered week by defeating two more challengers. Monday, 23—^Ferial Day. Mass of the In Murals By Gregori The La Raza Club was the first to go preceding Sunday. 2d prayer, of the Columbus Day found ample exhibi­ down before the St. Louisans, losing Saints (A cunctis) 3d, the Faithful De­ tions at the University: In the Main 5-0, while three days later the All Stars, parted. 4th, Against Persecutors and building. Brother Angelus, C.S.C, head a group of outstanding players from the Evil Doers. Votive or Requiem. guestmaster, and his corps of student various halls on the campus met the same fate to the tune 3-0. Tuesday, 2U—St. Raphael, the Arch­ assistants displayed the 12 outstanding angel. Mass proper. Credo. works of Luigi Gregori, noted Italian Two more games are scheduled for painter, while the Library proudly ex­ the coming week with a return game Wednesday, 25—Sts. Chrysanthus and hibited a book once owned by Coltmibus. against the strengthened La Raza Club Darias, Martyrs. Mass proper, 2d pray­ The paintings in the lobby of the a highlight. THE NOTRE DAME SCHOLASTIC 17

to Whom all owe their existence and to­ YOUR RELIGION ward Whom all tends. On this, as Com­ At the price we sell Pipes, we parative Religion shows, all the races of men agree; on this they are all united. can hardly afford to wrap *em! If religious questions, theology, lie at It constitutes that irreducible minimum the basis of all controversies or discus­ of belief in the supernatural which is DR. GRABOWS sions that get down to first principles meant by the term Religion. Religions, Everywhere else and pre-suppositions, it can only be be­ and the strife between them, result from ^1.00 the variant conceptions men have of the cause something essential to religion is Our Price Only a Buck! the final criterion of both truth and ac­ nature of this Supreme Being, and of tion. That essential element is God, how He may most suitably be served. Who brought all things into existence Religion, or as Belloc says, theology, and stamped upon each its distinctive the science of religion, lies at the basis nature, gave to each its mode of activ­ of all controversy because God, its ob­ RVQQNEWS ity and detemined the end of its being. ject, is at once the source of all being, NEUISQ^CORNER While it is true that religions divide and therefore of all truth—^which is men, religion unites them. Men have nothing more than a relation of confor­ been willing to fight and to die in de­ mity of the mind to being—and the ulti­ SOUTH BEND, INDIANA fense of one or other form of religion. mate end of human action and so of man. The supreme object of religion Religious wars have been of all wars Louie BraKKner, N. D. '23 the most fiercely fought, and quarrels is also the supreme object of conduct. over religious doctrine have ever been As it is needed to satisfy the mind's the hardest to heal. But what is all this craving to know the reason for the exist­ but evidence that in the judgment of ing world, so it is also needed to satisfy men religion is of supreme worth?' the will's craving for the possession of a good that can fully and finally justify "GOD Given man's rational nature, it could its choices. He therefore who even not be otherwise. It so happens that raises the question about the importance IN AN IRISH human actions are not determined by of religion shows that he has not as yet the moral law, as are the actions of in­ apprehended the fact, which even the KITCHEN" animate things and of brute animals by untutored peoples of the wilderness have the physical law. The latter necessitates done, that without it, life has no mean­ Rev. Leo R. Ward, C.S.C. action by the agent; the former respects ing, conduct no ultimate goal, and man­ the freedom of the agent. The robin kind no gi'ounds of hope. sings as it does because God made it so. Chemical elements combine as they do —Rev. Charles C. Miltner, C.S.C. "Readable and lively because such is the nature and mode of story of The Celt to­ action given them by the Creator. In day . . . a nostalgic this sphere there is no choice. But charm at once con- whenever a man acts as a man, with years of experience at taffous and delight­ foreknowledge of the end of his action your command. ful."—Scholastic and w^ith deliberation upon the means 36 years of reliable, compe­ Review. to be used, he selects one in preference tent service. to another, he displays the possession of freedom of choice. He displays too his A story of the Irish ability to make value judgments, to rec­ Devoted exclusively to at home in Ireland ognize that not all things are of equal the examination of the — and it has been worth. He knows things not only as eyes and the making of said that "the Irish they are in themselves, but also in their fine glasses. are good copy." several relations to one another. He dis­ ^2.50 covers that in the objective world there is an "order of things," that its multi­ tudinous individuals are so constructed LEMONIREES You'll enjoy this book and remember it! and arranged that one ministers to an­ Optometrists and Opticians other, one depends upon and is subor­ dinated to another, so that while each 314 South Michigan St. fulfills its own function, it conspires with South Bend, Ind. N. D. BOOKSTORE all the rest toward the reaching of some common end and purpose. Next, he realizes that he too is a part of this order, related to other beings in certain definite ways. He learns that, Skate for Healfh... and Enjoyment... whereas other earthly creatures serve one another, he can make them all serve PLAYLAND ROLLER RINK him; that he is above them and so not (Melody Gardens Ballroom) made for them, but they for him. From TWO SKATING FLOORS — ONE FOR BEGINNERS such observation and reflection comes the realization, common to all peoples, Every Night Except Monday — Matinee Sunday and Thursday that at the apex of this hierarchy of Sfudenfs of ways 25c "A Good Way to Make Money for Your Club' things there must be a Supreme Being 18 THE NOTRE DAME SCHOLASTIC

Dame Conference be continued next getaway at the Famous Door last week. week.—Richard Leo Fallon, Jr. Now that Bunny Berigan has filed bank­ VINCENTIANS ruptcy, it would not surprise this col­ umn if he joined Benny Goodman. Ben­ A typical phrase heard Sunday morn­ THE BANDSTAND ny has been having his share of trouble ings through the Knights of Columbus finding men since his former stars have lounge at about 11 o'clock and after is Observation Department: The band of started bands of their own. The band "May I suggest?" To this observer it is tomorrow is "Woody" Herman and his of the mid-west: Dick Jurgens. The typical because it stands for the nature "Band that Plays the Blues," to these reason: vocalist Eddie Howard. The man of the group meeting in Walsh Hall, a eyes. The "blues" are not coming back; group of Vincentians in which each they are here. "Woody" is a Marquette member contributes something to the boy and his Irish titled vocalist, Mary GLASSES PROPERLY FIHED functioning of the whole. Ann McCall, is Jewish. Her favorite If we were to drop into the meeting pastime is dyeing her hair to fit the sur­ Sunday we would find something like roundings. I saw her a brunette in Bos­ 1900 this: Rev. John C. Kelley, C.S.C., spir­ ton, and a redhead two days later at the itual adviser of the Conference, opens Famous Door. the meeting with prayer followed by the Notes: Did you know that Charlie DR. J. BURKE spiritual reading. President Joe Mul- Barnet's father was vice - president of DR. W. G. BOGARDUS queen (Sioux City, Iowa) calls upon the New York Central Railroad? Bob Tom Kennedy of New Rochelle, N. Y. as Chester, Tommy Dorsey's protege, is DR. E. C. BEERY skyrocketing to the top of the orchestra secretary to read the minutes of the Optometrists and Mfs. Opticians last meeting. These approved, the pres­ world. Glen Miller recordings are out­ selling Goodman and Shaw. Tommy ident asks for the report of the treas­ 228 South Michigan St. urer, Ed Corey (Skiatook, Oklahoma), Dorsey recently signed a contract with South Bend, ind. who says that the annual report of the Victor to make 52 recordings within the Conference has been made up and next year. Tommy, by the way, will turned into the superior council. Mr. spend the winter season in Chicago in­ Corey ^\all comment in detail upon the stead of New York, because of the com­ financial report next week. petition that Goodman, Shaw, Miller, et al, would present. In The Mr. Mulqueen then swings into the less formal part of the meeting with: Addenda: "Teddy" Powell and his "Now the Conference would like a word $23,000 orchestra made an auspicious SHOE DEN for from the 'dean' of the Healthwin group, Mario Peroni. Have you got some news of the boys this week, Mario?" HOWELL'S CAFE "Yes, I have Joe. Tuesday afternoon VlM MEM'S SnVES cuperating. We were driven out to the for Sanatorium by one of the South Bend ladies who is so helpful in providing FINE FOOD Most styles transportation and in bringing cheer to Your favorite Beer, draft or bottle. the fellows at Health\vin. I would like 0.50 some magazines and the book section of the New York Times to bring to the 211-213 N. MICHIGAN ST. men as we go around out there." Mr. Mulqueen, satisfied that one of the most important works of the Con­ ference has been taken care of, turns his attention to St. Augustine's, the col­ ored parish of South Bend. HERMAN'S "Paul Hackman, what arrangements have been made to provide missals for for St. Augustine's? Does our Conference library need a new supply and will we In brown or black Scotch keep up the work of furnishing Our SPORT grain. Leather or Smiday Visitor to the parish? You have crepe soles. that information as conference li­ GOODS brarian?" See oar Campos representatve, Cleveland's Paul Hackman reports Fio Lopardo, and ask him about Comlete line of these Fine, Stnrdy SHOES for that St. Augustine's has the missals hearty campns wear. supplied as last year and that Our Sun­ Shotguns, Rifles and day Visitor has been ordered. Mr. Hack- Ammunition for the man announces further that N. D. Vin­ hunting season. centians are at • St. Augustine's each Sunday morning.teaching catechism. 108 Nordi Michigan Street Limited space requires that this de­ Soudi Bend, Indiana 120 S. Michigan scription of a meeting of the Notre THE NOTRE DAME SCHOLASTIC 19 packs that certain something into a of Ravel's "Bolero," "Sea Breeze," "My in auditions by young actors, singers, song. Del Coumey's band is meeting Prayer," "South of the Border," and and instrumentalists attempting to crash approval everywhere they go. Their "Man in His Dreams." It is Karl who the gates of radio chains. style is adapted for dancers and not the decides on instrumentation and all the The chief complaints of audition "Jitterbugs."—George F. Grogan. details of interpretation. Members of heads, interviewed by the writer of the the band seldom question his judgment article, were that talent too often tries MUSIC NOTES in mattei's of swing! to outdo itself on auditions; comes with­ The man with the baton is Bob out adequate preparation; doesn't know Henegan. Besides being front man. its best metier; and, what is probably Karl Hunn and his band, a group of most important, doesn't realize that, be­ Bob can-ies the vocal on the sweeter twelve swing artists who have dedicated cause of the tremendous supply of talent numbers. Stan Huff is a new and a themselves to the presentation of the available to the network stations, being powerful addition to the trumpet sec­ best dance music, are now ready to be just good or even very good is not sufl5- recognized. They will play in Cleveland tion. He and Bob Robinett, trombone, tomorrow night at Wade Pai-k Manor, do the solo work in the brass depart­ located at 107th St. at Euclid Ave. ment. Gene Quinn and Chunk Schmied, Dancing will start at nine o'clock; ad­ second and third trumpet, respectively, mission is $1.50 the couple. complete the brass choir. Julie Bercik Those who attended the Victory and Bob Richardson on alto sax, to­ Dances have been thoroughly pleased gether with leader Karl and Chuck Ken­ by their music, and the orchestra de­ nedy, tenor sax, supply the reed support. serves great respect. It is more than Karl and Julie take the rides. The per­ just a good college dance band. cussion section is made up of Carl If any band is to raise itself above Quinn, drums, Tom Delia, guitar, and mediocrity it must be built around Bob Sinon, piano. This accumulation of players possessing sound technical abil­ jive masters is capable of giving a very ity. Only in this way can an individual solid treatment to all the modem mel­ style be developed. Karl Hunn's band odies. is well equipped in this respect. Each member is qualified to play arrange­ ments which give the band color and RADIO distinction." Karl Hunn is master. Besides play­ The October 7 issue of the Billboard, ing first tenor, Karl writes all those a weekly magazine of amusement trade arrangements which catch the ear so news, contains an article which every­ delightfully. The next time you hear one interested in radio work should read. the Hunn ensemble, take particular note It deals with the diflficulties experienced LIFESAVER FOR POOR MEMORIES

THE HUDDLE South %ore Trains Leave Every Hour on the "Pipe Headquarters" on the Campus Hour, 6 A. M. to Midnight - (Exception — 6:50 A.M.)

A THRILL TO SMOKE- THE For complete information CALL C. V. VEACH City Passenger Agent 301 N. Michigan Street Phone 3-3111

For all star performance choose Dr. Grabow— the pipe of champions. ^ —ONIY _ CHICAGO SOUTH ^^ jR. GRABOW Pipes are pre- AMVm smoked with fine tobacco (EMWOnH) to break them in by linkmon'i Ex- HtUMOVS «'«*'»• •*'?• Smoking Machine- KpikTuna tana MADE BY M. UNKMAN * CO.. CHICAGO WXWi NO BREAKING IN • NO BITE • NO BITTER TASTE 20 THE NOTRE DAME SCHOLASTIC

cient. The really successful radio artist fairly new plot. You've probably only builds up to letdown after letdown, will first gain experience and learn his seen it a few hundred times. We wish but was also in bad taste. The only sig­ own limitations and sti-ong points by we had one of Rockefeller's dimes for nificant words in the picture were those work in a small station. each time we've groaned thi'ough the sad of the German petty officer who, taunted The large network stations in New tale of the poor rich family who get no by Wallace Beery as to the ultimate win­ York and Chicago are no place for the fun out of life till someone from the ner of the war, i-eplied, "No one." How amateur, no matter how talented. For other side of the tracks shows them how. this propaganda slipped into a picture is when the strain of the audition is on, the In fact we are thinking of nominating cause for wonder. It should be discour­ inexperienced actor or singer is usually Mr Grimm as the prize script-writer of aged. We hope Hollywood can forget too tense to give a good account of his the year. His tale of Cinderella has box-office and remember instead the talents. Often, he is a poor judge of been the most used story of the year. preservation of American neutrality. what material will suit him best. An­ However, this picture is exceptional in —Paid Vignos, Jr. other fault that many managers find that it has Ginger Eogers with new life with those trxang to break into the big and zest for this old theme. time is that they are unable to take fair, "Thunder Afloat." ... At a time when constructive criticism. the Athenia disaster is still fresh in our Log for the Week of Oct. 22 minds, and while submarine attacks I could stand Bing Crosby's "El Oct. 24: 7:00—Radio Stage occur daily this is a timely picture. Here Rancho Grande" with a few "cokes" but Oct. 24: 9:15—^Jlusic of the Masters the virtues of this submarine saga end. Tommy Dorsey's version requires an Oct. 25: 7:45—Facu% Talk It is not only a poor melodrama wliich out-and-out root beer binge for enjoy- Oct. 26: 4:15—^Academy of Politics Oct. 26: 7:30—Sportscast Oct. 27: 4:15—Periscope Oct. 28: 7:30- -Little Jamboree Follow Arrow And You Follow The Style —Ray Kelly It's National Arrow Week THEATRE

The cinema fare downtown these weekends makes us doublj'^ thankful that we have home football games to keep us on the campus. After this past weekend we are at least triply thankful. "Fifth Avenue Girl." . . . Here is a

South Bend's Largest Selection of ARROW SHIRTS

His Master's

N Arrow combination hard to beat A' is this AEROLANE feature . . . Arrow shirt ($2) and Arrow tie ($ I) .. . both made precisely for each other. Oxfords and Broadcloths in al! collar styles. Featured are Hal­ This distinctive spaced stripe broad­ yard stripes, at §2.25, and the HJtt, a fine white shirt at §2. cloth shirt, tailored by Arrow, will win many compliments for you. Set yours today, in colors, blue, tan and green— all sizes. Sanforized Shrunk (Fabric shrinkage less than 1%). ARROIV SHIRTS ADM COLLARS . . . TIES . . . HANDKERCHIEFS . . . UNDERWEAR Michigan at Washington THE NOTRE DAME SCHOLASTIC 21

ment. Hughie Prince sort-of sings the sort-of lyrics with a lot of other people shouting. You may like "Shoot the Sher- bert to Me, Herbert"; I didn't. (Victor) Benny Goodman, no longer king and not so swingy, has recorded two num­ bers from Rogers and Harts' "Too Many Girls." His "I Didn't Know What Time It Was" is good. Louise Tobin's vocal is pleasant and the accompaniment alone is worth the price. "Love Never Went to College" is not so good but more Goodman. (Columbia) Ginny Simms, one of my favorite girl singers, has paired two of my favorite songs: "Sweet and Slow" and "I Gotta Right to Sing the Blues." While that part of Kay Kyser's Band that backs her up seems a little inadequate, the vocals are up to Miss Simms' usual high stan­ dard. (Vocalion) Glen Gray is still one of our top bands. His record of "Shadows" and "Beautiful Love" seems, however, to lack something. "Shadows" by Frankie (Sunrise Serenade) Carle, is a fair num­ ber done very well. "Beautiful Love" —Bill Geddes.

vl ChShir; t of the month ^

THE VODER, nicknamed Pedro, is an amazing elec­ trical device which actually talks—the first machine in the world to do that!

By pressing keys, singly or in combination, a skilled operator can make Pedro talk in almost human fash­ AEROLANE! ion—^with varying inflections and in either a man's or a woman's voice. T^ID TOU see the big ad in the Saturday Evening Post The Yoder is an outgrowth of fundamental research aboat Arrow's newest shirt pattern, AEROLANE? WeD, in speech sounds, articulation and voice reproduction this handsome shirt is right here on oar shelves—^in yoor being carried on at Bell Telephone Laboratories. Such size and sleeve • length and studies have led—and will lead—to constantly im­ yonr favorite color. Come in to­ day and get it—and win compli­ proving telephone service for you. ments for it all Fall and Win­ ter. Sanforized-Shmnk (fabric shrinkage less than I%!) ELLSWORTH'S

ARROW 22 THE NOTRE DAME SCHOLASTIC

prompted them to establish here in the Notre Dame was their ardent devotion Founders Day wilderness of Northern Indiana a school to the Blessed Virgin Mary. They pro­ (Continued from Page 11) for the Christian education of American fessedly and persistently relied on her of Father Granger, the lifelong compan­ youth; it was faith that sustained them intercession for the favor of Heaven ion of Father Sorin in Ms great work through their years of struggle; it was and the success of their undertaking. and for fifty years the favorite confessor faith which in 1879 inspired the aged You may observe that the highest point of the students, of Father Cointet, one founder to begin his lifework all over. at Notre Dame is the cross of Christ of the pioneers who succumbed to the In that hour of extremity, when there and that second to it is the statue of the contagion of 1854, of Father Lemonnier, was so much need of means to rebuild Virgin. The name Notre Dame is sim­ founder of the University library, of the the institution, a generous friend sent a ply the French for Our Lady. The beloved Father Thomas Walsh, of the letter of sympathy and a check for sev­ characteristic tradition of Notre Dame, brothers that came with Father Sorin eral hundred dollars, to be used as best and their successors. I trust that I am it might. Father Sorin promptly sent not detracting from the credit that is the whole amount to an oi'phan asylum due them when I say that the founders with request that Masses be said for Specializing in the ex­ of Notre Dame were ordinary men who Notre Dame. That act, altogether un­ amination of the eyes. did an extraordinaiy work, men who by intelligible to the unbeliever, was char­ their faith and zeal and industry became acteristic of the man and of his faith, heroes to the full measure of their op- charactei'istic of the faith that has made poi-tunity. Notre Dame what it is. DR. E. J. CAIN In looking for the reasons for the Fi'om the beginning the founders of OPTOMETRIST success of these founders we find that this school were sure that the work of Successor to the first was their invincible faith. Their God which they were doing here could ROGERS faith in God was in reality their sole en­ not fail — unless it should be by their dowment, necessaiy and sufficient for lack of faith. And yet, with all their Prompt Lens or Frame repair their purpose. The love of God, which reliance on the providence of God, they is bom of faith, is the most effective never for a moment believed that faith service in our own laboratory. motive that can inspire the mind and alone is sufficient for salvation or for will of man to great acliievement. To any other purpose. They understood recall at random just a few examples of well that God helps those who help them­ 212 S. Michigan St. its effect — it was faith which sent the selves, that whilst they could do nothing Twelve Apostles forth to convert a very without God, God would do nothing at Phone 4-8251 hostile world to the Gospel of Christ; it all without their most earnest coopera­ was faith that made the thousands of tion. And so they prayed as if all de­ martjTs of the early Church; it was pended on divine pro^^dence and then Christian faith that conceived, and worked as if all depended on their own planned, and executed the cathedrals of effort. Their faith was of the kind that the Middle Ages, which are the despair can move mountains, and their works THINK OVER . . of the faithless centuries of our modern were worthy of their faith. times; it was Catholic faith that made the thirteenth century the most intellec­ The second secret of the founders of tual and creative in history; it was apos­ tolic faith that sent Francis Xa\'ier to convert the Mohammedan empire of the Orient. In like manner, it was faith that SPORT JACKETS brought Father Sorin and his six brothers to America, then a very new world, that

TROUBLED? THIS BARGAIN FOR $45.00! # Free Trial Lesson # Guaranteed Solo Course # ^3.00 Individual Lesson Wool, leather and # Free transportation to gabardines in very and from the airport newest patterns TRY See your own hall representative $3.25 up or Don Marietta, 232 Alumni tilLLf* HAMBURGERS PIES CHILE THE "RECO" STORE 317 N. MICHIGAN 113 N. Main St. South Bend INDIANA 216 W. COLFAX 109 E. WAYNE LOOK FOR THE LOG FRONT AIR SERVICE THE NOTRE DAME SCHOLASTIC 23

shared alike by priests, brothers, sisters, Mother, but none of us doubts that she lay professors, and students, has always had much to do with this very remark­ been, is, and may it ever remain, a fer­ able development. And well may we vent devotion to the Mother of God. This trust that under her protection the fu­ GOOD t sacred tradition is from the chief found­ ture will give still further proof of her er himself. Father Sorin was, as Father favor upon her school and her children. John Cavanaugh, former president of the University, in sketching the life and There are other good lessons in the NEWS/ lives of the founders, but the ones we work of the founder, remarks, a true We have been able to get another knight of the Blessed Virgin, if there have taken are sufficient for today. In fact, the others are implied in the two shipment and we are repeating our ever was one. In the day of adversity OPENING SPECIAL OFFER and in the day of prosperity he said his we have observed. These two are, in beads with all the simplicity and confi­ a sense, but one. Any reasonable faith • dence of a child. In 1865, against the in God inevitably prompts a special ven­ advice of prudent counsellors, he found­ eration of his Blessed Mother. In honor­ While they last... ed the Ave Maria, the weekly family ing the Mother, who is human, we are magazine devoted to the honor of the honoring the Son, who is divine. In $14.95 RCA Blessed Virgin. Nearly everyone told neglecting her we should be sadly neg­ him that his venture would fail, but lecting Him. Victrolo Father Sorin knew that with its pur­ The Notre Dame of today, my dear pose it must succeed — and through all friends, is our heritage. The 'our' does Atfachment the years since 1865 the Ave Maria has not refer merely to the Congi'egation of gone every week to thousands of homes Holy Cross but to the lay faculty and and 12 Months Subscription throughout the English-speaking world, students as well. The Notre Dame of to Victor Record Society carrying its message of religion and pro­ today, with its wealth of tradition and claiming the praises of Mary, its patron. inspiration, is our heritage from Father Both C Sorin and from the priests, brothei's, • for We had better not try to say how professors, and students who helped him much of the success of Notre Dame has create it. In justice to them let us ap­ been due to the patronage of the Blessed preciate it, and appreciate it in a way worthy of such inheritance. Ours is not the work of pioneers, as was theirs, but it is none the less serious and respon­ J)rs. Jvose ana Jvose sible. It is ours to perpetuate in our lives and to transmit unimpaired to DENTISTS those who are to come after us the ideals 430 SHERLAND BUILDING which they established here — the ideals TELEPHONE 3-4269 of faith in God and of devotion to the Blessed Virgin, the ideals of zeal, indus­ try, courage, perseverance, patriotism KliiiiiiiiimiiiiiitiiiiiiiiiiiimiiimiiiiiiiiiiiiiiimiiiiiiiiiiiiiiiiinrSl — in short, the ideal of the complete OFFICE 4-5661 RES. 3-4080 Christian life. It is ours to preserve and extend the mission of Notre Dame, so J)r. Jv. ^. J^ucas that she may be able to do an ever DENTISTRY — X-RAYS larger and better work for the glory of 702 J. M.S. BLDG. SOUTH BEND God and the salvation of men.

Qiiiiiiiii iiiiiiiiiiiiiiiiiiiiiitiiiniiiiii iiiiiiiiiiniiiniiil^

"Apologetics?" Save 510. This RCA Victor attachmeoit Q)r. 0. J. plays records through your radio electric­ "Apologetics? It's a Sophomore reli­ ally. Its list price is 514.95. During open­ Registered Podiatrist—Foot Ailments gion course, isn't it?" ing you get it for §4.95—and the Victor Record Society membership, worth $2.00, 434 Associates - South Bend That is the answer nine times out of absolutely FREE. But you must hurry, this sensational offer is limited. Office Phone 3-2574 ten Notre Dame students would give if asked. However, we also have at Notre Dame a course in Apologetics which leads to the degree of Master of Arts in FREE! Apologetics It is a two year post-gradu­ with every Record Purchase ate course which allows minor sequences regardless of size in History, Philosophy, English Litera­ RECORD BRUSH ORTHODONTIST ture, Politics, and Economics.

ASSOCIATES BUDS., SOUTH BEND Admission to this special course is Visit Michiands largest and most ^H^ given to those who have received A.B. complete Record Department degrees; the University offers several aCJCJCJCaCJCJC3CJCJCJC3CJCJC3CJCX3C3CJC3CJC3C3CJC3C3CX: scholarships. Competition is open to any graduate of an American college or (Drs. [ProDst ana Sinqier university who has completed Scholastic DENTISTS Philosophy. Requirements for qualifica­ RODIN'S 405 Associates - South Bend • tion include exceptional writing ability; 132 N. Michigan Phone 4-1184 Phone 3-1254 and with his application, the student Open Toes., Thars. and Sat. eTcninis. must submit an essay of 1500 words. .opens Doors to Relds where People Live,^\^rk & Achieve

Voday there are about 1,000,000 cigar stores, drug stores, country and grocery stores where you can buy cigarettes in the United States. These re­ tailers, and the jobbers who serve them, have built up a service of courier and convenience unmatched by any other industry catering to the American public's pleasure. THERE ARE ANOTHER MILLION people who are engaged directly or indirectly in the transportation of cigarettes to every town, hamlet and crossroads.

IT IS ESTIMATED that there are 1,602,000 tobacco farmers raising tobacco in 20 out of the 48 states. Good tobacco is one of the hardest crops to raise and bring to market, requiring great skill and patience from seed-bed planting to harvesting and curing. The modem tobacco farmer has done well the job of constantly improving the quality of his product.

THE AVERAGE LENGTH of service of the 13,230 people working in the Chesterfield factories, storage houses, leaf-handling and redrying plants is over 10 years. This means that every step in the making of Chesterfields, regardless of how small, is handled by people who have had 10 years of experience and abil­ ity in knowing their jobs. TRULY TOBACCO OPENS DOORS to fields where people live, work and achieve, and Chesterfield takes pride in its ever increasing part in this great in­ dustry that is devoted entirely to the pleasure of the American public. To SMOKERS, Chesterfield Cigarettes have always said, and now repeat, that in no other cigarette made can you find the same degree of real mildness and good taste, or the same high quality of properly cured and aged tobaccos. Chesterfield Cigarettes are made with one purpose only...to give smokers everywhere the MILDER, BETTER-TASTING SMOKING PLEASURE they want. You can't buy a better cigarette.

MAKE YOUR NEXT PACK ^^^^'^^--^f CHESTERFIELD

Copiff%fatl9}9.lJGCElT4lcMyEt5ToBMXX>Ga ^^fSW .' ^ame

PUBLISHED WEEKLY — FOUNDED 1867

Volume 73 October 27, 1939 Number 5

ATTENTION Sophs! Breese Signs Get out those tuxedos For Cotillion and polish up those dance steps, because on Friday evening, Nov. 17, handsome Lou Breese, a trumpet-tooting bango-buster is coming to town to provide music for the 1939 Sophomore Cotillion. The dance will be held in the Palais Royale. (See page 5)

BARRING blowouts. Met Club Set broken axles, or busted For Army Trip windshield wipers, the New York trip, spon­ sored by the Metropolitan and New Jersey clubs, will begin at 5:33 p.m. Thursday. Elmer Layden will speak Friday night at a rally at the Manhat­ tan Center Club in New York City. (See page 6)

THE FIRST of a ser- Local Mission ies of weekly meetings Crusade Begins of the Catholic Student . Mission Crusade will be held Sunday morning at 11 o'clock. The Rev. Michael A. Mathis, C.S.C., formerly in charge of mission activities. Congregation of Holy Cross, will direct the group. . (See page 7)

HIGH ABOVE the Irish Invade Smokey City stands a Carnegie Tech football battle ground. Tomorrow afternoon, on that field, the turf of Pitt Stadium, an old feud will be renewed. The Scotch will face the -Irish. Carnegie Tech's Tartans, on their own field, will be out to scar the unbeaten record of Notre The Rev. President John F. O'Hara, C.S.C., with Archhishop Joseph Schrembs Dame's Fighting Irish. (See page 12) and Msgr. John P. Treacy, watches Notre Dame sink Navy, 14-7. THE NOTRE DAME SCHOLASTIC

HERBERT HOOVER OUTLINES PROGRAM TO KEEP THE U. S. OUT OF WAR. From his experience in the last war, Herbert Hoover speaks out in this week's Post with an authority in many ways unrivalled by any living American. Read his five-pointprogramfortheU.S.inWieMustJ£cepOufc

"COO!" SAID THE SUBSTANTIAL BLONDE, ACCORDING TO P. G. WODEHOUSE. When Freddie Widgeon took Bingo's baby to the beach to get a whack of ozone ... When the well-nourished blonde with golden hair flung her arms around Freddie... (It's no use! We defy anyone to describe this plot! It's 99-44/100% pure Wodehouse!) HOW MUCH ARE

DETECTIVE IN A WHEEL CHAIR. Rather odd that Aunt COLLEGE FOOTBALL Sue was giving the detectives precise instructions for finding the kidnapers of her nephew. But even from her wheel chair she had a hawk-eyed way of noting trivia others overlooked. Read Mtss PLAYERS PAID? Useless and the Underworld by Almet Jenks. # And when pay gets so high the blow-off comes, what happens to the school? Francis Wallace, sports STEPHEN VINCENT BENET BRINGS YOU A MEMO­ authority, takes you through the complete cyde of RABLE SHORT STORY... Daniel Webster and the Ides of pay, bigger pay, championship teams, then school March, a simple, moving story of how the history of the United explosion—as it happened at the University of Pitts­ States was changed by one casual visit of Mr. Webster's with a burgh. Uncovering actual financialrecord s foryou.he hermit in the New Hampshire mountains. reveals startling ftocts. In two parts—both plenty hot! • • • GRANTLAND RICE INTRODUCES THE WORLD'S Test Case at Pitt GREATEST GOLF TEACHER. Here he is, duffers. The Malignant Morrison, who has the whole exasperating game by FRANCIS WALLACE boiled down to eight simple words! ALSO... stories, editorials, cartoons—all in this week's Post. i. THE SATUIipAY EVENING POST THE NOTRE DAME SCHOLASTIC

\vith speaker on a minor point, but be­ College Parade by jack WUlmann ware of overdoing it. -5. Last Eesort— Take a deep breath and hold it until you collapse. Your friends will carry you out, revive you, and send you on your On the Editorial Side nation's leading universities. John K. Tunis to the contrary, the Big Three way.—Ohio State Lantern The old cry has been resounded. In • a letter to the editor of the St. Bona- was, is and will be free of commercial­ venture, a student has the following to ism in athletics, thanks to cooperation Test for A Good Cold Remedy say: and a mutual determination to preserve Connect 20,000 volts across a pint. If the current jumps, the product is poor. "At Notre Dame they have a magni­ the highest possible standards of ath­ If the current causes a precipitation ficent school loyalty and a faith in the letic conduct."—Daily Princetonian of lye, tin, arsenic, iron slag and alum, football team that almost amounts to the whiskey is fair. fanaticism, but here at St. Bona's there Winner Take All If the liquor chases the current back is a spirit of fellowship and camarad­ to the generator, you've really got your erie, the like of which is not to be found "Ah wins." money's worth.—Pelican at Notre Dame. At Notre Dame the "What yuh got?" • ordinary student gets to know a few "Three aces." fellows in his own hall, and everyone "No yuh don't. Ah wins." 'Swing Barometer' else is a stranger." "What yuh got?" To an enthusiastic audience of Wis­ "Two eights and a razor." The obvious corollary of the above is consin jitter-bugs "Duke" Ellington re­ "Yuh sho' do. How come you so lucky?" vealed that he is playing the same ar­ that there must be no "ordinary" stu­ <• —Siren. dents at Notre Dame. We owe it to that rangement, note for note, of "Mood In­ Bona student to ban all inter-hall asso­ Bored With Lectures? digo" that he played ten years ago. The ciation—else we should be proving him For those classes in which the prof ebony nobleman added that he does not to be a prevaricator. However, we be­ talks too loud for comfortable sleeping, arrange and compose for individual in­ lieve that that writer was unwittingly the Social Problems Institute offers struments, but rather for the characters deluded, or he was plucking from the these suggestions. 1. Doodling—^with a behind the horns. ^Tiile he is a featured vines of sour-grapes. The fundamental knife or other sharp instrument. 2. piano soloist, he thinks in terms of brass. differences between a large and small Thimib-twiddling—try a change of pace. Of college students he says, "They are school must be considered, but rash 3. Social Gatherings—^refined conversa­ an excellent barometer of what will go youths must be more prudent with uni- tion, black-jack, or bridge in large class­ over and what will not." versals and particulars. Should such es only. 4. Intellectual Method—debate —Daily Cardinal statements be uttered in this vicinity, the perpetrator would find all halls united in a chant—"In the lake!" •

Not in College •'f-,, - ~.' Breathes there a man with soul so dead Who has never turned his head and said: "MMmm-m-m not bad!" ..•:^:^.i^^^W.^--:-<..'••.:-.-:.^>,^-^^. • Purple Pickings A special feature of Dad's Day at Northwestern had the fathers attending lecture classes—only pre-requisite course was Cradle-rocking 109 Despite the movement to oust Chicago from the Big Ten, that member leads in unshared championships with seven Wildcat gridders like their evening training table Some 300 men on the Big Ten varsity athletic roster have academic scholarships Already Purple pulps are pointing for the Notre Dame game. • Headline Warranted Frosh reporter: "I gotta scoop, chief." Campus Editor: "What happened — man bite dog?" Frosh: "No, a bull threw the pro­ fessor." • Don't Break an Arm! "Today, Harvard, Yale and Princeton are firmly resolved to eliminate by means of close cooperation all possibility of athletic subsidization or any other practice unbefitting their position as the 'But They Gave Us the Key to the City" THE NOTRE DAME SCHOLASTIC

The Week % ^- ^- Bamda OPINION

This is the third of a series of student opinions on questions submitted by the Top of the Week Gullible students themselves. The question this Getting away /rem it all. Jack (Yankee Doodle) Wilkinson, week, submitted by Bill Olson, Carroll pride of Nick's baton men, was minding Hall, is: "Would you prefer a change his own business as he rubbed elbows En Route in the cut system which would reduce with the crowd getting into the Muni­ the number of cuts and lengthen vaca­ Belief runs rampant that the railroad cipal Stadium. A clever hawker quickly tions?" Following are typical replies: people must have hauled that train out spied our New England boy and went of the Smithsonian Institute for the stu­ after him for his bread and butter. Plan­ • dent trip even Cro - Magnon man ning to reap a surplus profit from our Sorin—George Milford:: "I feel that would call it an artifact wagon boy's innocence, the hawker pinned a I'd prefer to extend the vacations and wheels never make good time Bulg­ miniature American flag on Jack's lapel. reduce the number of cuts. As it is ing coaches surrendered student mobs The button - holing had been consum­ now, there is too much time wasted be­ at all the stops Eight fellows, on one mated. fore and after vacations. If the vaca­ occasion, tried to sleep in one of the "Oh, thank you, kind sir," Yankee tions were lengthened, this situation crude make-shift bunks they gave it Doodle bowed, and walked away. would be more or less remedied." up in Elkhart The late arrival The hawker was stunned. neatness of apparel unknown and Dillon — Eugene Ryan: "I think it on to the conquest of Cleveland. "Just a minute, bud," he called, "We would be an excellent idea to lengthen appreciate a donation for our auxil- vacations and reduce the cuts I do feel, liary's skimmed milk fund." however, that at least one round of cuts In Cleveland "OoooOh, I see." Jack pulled out a must remain to the student. If the cuts quarter and a dime. were abolished entirely, the first time The band in top form tooting to the a fellow slept in he'd be cut out of a cheers of 80,000 fans Yells from the The man took the two-bits and van­ class." student section heard far out into Lake ished. It was not until the third quarter that the light finally dawned on Yankee Erie Clashmore Mike, ignoring the Doodle dandy. Badin — Joseph Kirchoff: "I prefer embarrassed pleadings of Jerry Flynn, • that the present system be kept in prac­ abandoned hurdle-jumping to take a few tice. If a fellow wants a longer vaca­ chaws out of the Navy goat Bennie Two-Stitch Steve7is: tion, he can take his weeks of cuts and Sheridan took off from second base "My Aunt Emma is certainly peculiar. probably get a longer vacation than and came in all the way to home plate She never could understand what she would be possible even with lengthened under the goal posts After the game, read unless she heard herself read. Now vacations. Then, under the present back to the Hotel Statler Most of she's deaf and can't understand any­ system, he would have some cuts left the fellows got their dates on the Statler thing at all." for the rest of the year." mezzanine... Room 1147 looked like Grand Central Station maybe that's •> Howard — Bill Nagengast: "You can why Hank Collins slept on a bench in Stumped put me down as being definitely in favor the hall of the 11th floor Breakfast Over in one of the halls the telephone of longer vacations and reduced cuts. next morning at $1.25 minimum... cof­ rang long and loud until a certain A great many fellows live some dis­ fee, in the demitasse size, came in for gentleman left his accounting sheets in tance from school, and require longer 30 cents a cup. desperation. time in which to travel. I say reduced cuts and more traveling time would be "Well, let's have it—^what's his name a much better plan than the present and room number?" Returning system." Karl Himn and his quartet obliged "Will you please call Joe Snitch to with a red, hot, and blue jam session the phone. I believe he lives in room Zahm—^Hoyt Kirkpatrick: "I definite­ that was A fleet of men in blue tak­ 432." The feminine voice was all milk ly prefer reducing the number of cuts ing inventory of light bulbs and stuff... and honey. and lengthening vacations. Take me, The, mad scramble for the coach seats Four flights up went the fellow, with­ for example; I live about 1,000 miles and the bunks-to-be A few card out a murmur, and after canvassing the from school, and as a result must take games in progress Tellers of tales wings he finally found the room and my cuts in order to have any time at and whatnots Making those eight rapped on the door. No one answered. all at home during vacations. A lot of o'clock classes Monday morning. The fellow came down again. profs are known to throw quizzes be­ "Look, lady. Snitch ain't in. Is there fore and after vacations, so it isn't very any message?" profitable to cut. I think, therefore, "No, never mind." that it would be a swell idea to reduce Overheard from Two Purdue Men "Who shall I say called?" the cuts and give us more time at va­ "What the heck is the Grotto, a "Helen Dillon." cations." movie?" "You're sure it isn't heaven in Lyons — Joe Szikora: "I prefer the Hummph Alumni?" present system because as it is, a fellow And he slammed down the receiver, can take a few cuts during the year and Highway sign in Cleveland along the complimenting himself all the way back save the rest for vacations; or, if he lake front: "The Judge says: 'This is to the room for the inimitable way in doesn't want to do that, he can save up not Daytona Beach! Ten dollars and which he had handled the pun. People and leave early for vacations Leave costs'." have more fun than anybody. the system the way it is!" The Notre Dame Scholastic

Entered as second-class matter at Notre Dame, Indiana. Acceptance for mailing at special rate of postage. Section 1103, Oct. 3, 1917. Authorized June 25, 1918. Z 188 VOLUME 73 OCTOBER 27,1939 NUMBER 6

THE PALAIS — SCENE OF ALL COTILLIONS Tense Days On 'Iroquois' Kecalled by Fr. Carroll The Eev. Patrick J. Carroll, C.S.C, editor of the Ave Maria and passenger on the threatened S. S. Iroquois revealed that Catholic prayers were plentiful on the ship throughout its voyage, "Ninety Irish-Americans who had been visiting Ireland," he said. "Among them were two nuns, and 24 priests who celebrated Mass daily. This practice was begun on the first day, before the submarine alarms were sounded." He told of difficulty in finding a boat bound for the United States. "I already had reservation on one ship," he said, "but that sailing was cancelled on ac­ count of the war." Father Carroll then heard of the Iroquois over the radio and secured accommodations immediate­ ly. He boarded the boat at Cobh. "After we were a few days at sea," he continued, "the United States gov­ Sophomores Sign Lou Breese ernment notified the captain of the ru­ mored danger, and he relayed the news to us. About the same time, a cable was For Annual Cotillion Dance received from Cobh stating that there might be a time bomb aboard. All lug­ gage was inspected, but no trace of a bomb was found." Event Is Scheduled For Sophomore dance. Among his prede­ Northwestern Game Eve cessors are: Mark Fisher and his Edge- "Many of the passengers were fright­ water Beach Hotel orchestra; Ben Pol­ ened by the news but none became hys­ lack and his orchestra; Carlton Kelsey terical. Later, storms rocked the heavily- and his Hollywood orchestra; Eeggie laden ship, causing passengers to forget Attention Sophs! Get out those tuxes Childs and his NBC orchestra; and, last the ominous report for a time. The Iro­ and polish up those dance steps, because year, Johnny Hamp and his orchestra. quois is a coastwise steamer, not meant on Friday evening, Nov. 17, handsome for trans-oceanic travel, and 600 passen­ Bids to the Cotillion, to be held on the Lou Breese, a trumpet-tooting banjo- gers were far above its ordinary capac­ eve of the Northwestern - Notre Dame buster, is coming to town to provide ity. On Sunday, Oct. 8, a Coast Guard football game, are available at three music for the 1939 Sophomore Cotillion. cutter and two destroyers met us in mid- dollars a couple. If bought with two Class President George Sobek showed ocean," added Father Carroll. "This, of game tickets, the block price will be extreme satisfaction at being able to course, relieved the minds of the trav­ $8.20. A special section for Cotillionites get the sei-vices of this popular dance elers. These ships escorted us aU the and their partners has been set aside in band. way to port where we docked on "Wed­ the stadium, with tickets reduced to nesday." $5.20 a pair. Breese's orchestra features, beside In the midst of all this tension. Fath­ the leaderman's antics, the very popu­ Further plans are in the hands of: er Carroll recalled a particularly hum­ lar Don Huston singing ballads and Skip Jim Magai'ahan, general chairman; John orous situation. Practically all of the Morr handling the rhythm songs. The Birmingham, decorations; Frank Quinn, passengers had English money, he re­ site of the dance is the ever reliable tickets; Ed Monahan, music; Bill Regan, lated, but only American money was ac­ Palais Royale, the houi's from nine to program; Pat Fitzgerald, patrons; Mar­ cepted on the Iroquois. About midway one. tin McGowan, publicity; and Jim Games, in the voyage, the American money sup­ Lou Breese and his.iorchestra carry arrangements. Formal invitations may ply was exhausted and no purchases on the tradition of top-notch maestros be secured from either Jim Magarahan could be made. "A case of water, water, who have been invited to. play at the or George Sobek.—Bill Scanlan eversrwEere " he smiled. 6 THE NOTRE DAME SCHOLASTIC

To ease the minds of those aboard, an "Dome" Offers Prizes year by Herbert J. Connelly, is already Irish night was held at sea. Singing and cooperating actively with the Placement dancing in true Irish style were enjoyed. Calling all lensmen! The pockets of Bureau, Mr. Dooley said. A. F. Poten- This was an exceptionally apt diversion some lucky camera shark will be fuller ziani is chairman of the Forum's place­ and helped marvelously to lighten spir­ this year. The Dome is awarding cash ment committee and will supervise the its.. Father Carroll was especially im­ prizes for the six best snapshots and art building of a list of suggested placement pressed by the fine work of the captain creations submitted. Snapshot Editor contacts with industry, with the assist­ and crew of the Iroquois. "There was Jack Burke is anxious to secure pictures ance of all Forum members. Mr. Dooley plenty of food and drinking water; quar­ of campus life. In addition to the regu­ will welcome similar assistance from ters were excellent, too, considering the lar prizes, extra booty for the best pic­ like groups in other colleges of the Uni­ large crowd aboard." tures of special events \vill be distrib­ versity, he said. uted—as this week $2.50 is being offered Speaking of Ireland in relation to the for the top series of pictures on the "It is to be particularly emphasized," present war, Father Carroll said, "Ire­ student Trip. Mr. Dooley pointed out, "that the Place­ land is very much upset. They have The prize money will be distributed as ment Bureau was organized only to help blackouts like the rest of Europe, but the student find a job, to offer sugges­ the populace is noticeably in favor of follows: Cartoons: first prize, $5.00; four second prizes of $1.50 each. Snap­ tions and encouragement in a difficult neutrality. The country is now very process. The main burden of job-finding prosperous anyu^ay, and with the Eng­ shots: first prize, $7.50; second prize, $5.00; four third prizes of $1.50. rests squarely upon the shoulders of the lish trade increasing even better times individual student. It's up to him to get should be had. Premier DeValera has out and scratch. And this scratching the confidence of the people, and Presi­ Placement Bureau must be done at once—not next May. I dent Hyde is a most popular figure." urge upon every senior the advisability "To smn it up: Ireland is as determ­ Within the next few weeks each senior of using the Christmas holidays, espe­ ined to stay out of the war as the will receive from the Placement Bureau cially, to make initial contacts with United States should be," concluded in the Alumni Office, a letter outlining prospective employers in his home com­ Father Carroll.—John McDevitt. the services of the Bureau for the year munity." and specifying plans of procedure. This was announced this week by William R. Students Follow Team Dooley, director of the Bureau. With each letter will be enclosed a Forum Seeks Members To Army Game, Thursday postcard on which the senior will be The Commerce Forum membership asked to indicate whether or not he Barring blowouts, broken axles, or drive has been proceeding satisfactorily, needs placement assistance. Seniors de­ busted windshield wipers, the New York and within a short time every eligible siring such assistance will later be re­ trip, sponsored by the Metropolitan and Commerce student will have been inter­ quired to appear in the Placement Office New Jersey Clubs, will begin at 5:33 viewed by a Forum representative. A to fill out placement application forms. p.m., Thursday. The return wU be goal of 300 members has been set by the These will be used as basic references made from New York on The Pace­ chairman of the membership committee, maker, New York Central Lines, 5:00 for placement contacts with industry in James M. Hufnagel, and a member has p.m., Sunday, Nov. 5; this train will the second semester. been assigned to every hall to insure arrive on time for classes, Nov. 6. A The Commerce Forum, headed this the interviewing of all prospects. round-trip rate has been fixed at $24.85, which does not include the price of a game ticket. This expedition to watch Army's downfall is under the authori­ zation of the Rev. James D. Trahey, C.S.C, prefect of discipline. The Rev. Hugh O'Donnell, C.S.C, Mr. Elmer Layden, Captain William Wood, and Fi-ancis Wallace, and others, will address a rally and reunion Friday eve­ ning at the Manhattan Center Club, in New York City. The admission price of $1.25 per person includes rally, re­ freshments, and informal dancing later to the music of Bugs Walther. Arrangements must be made in ad­ vance for the Army-Notre Dame Ball, at the Hotel Astor, Saturday night. Bids are ?5.00, and may be had through the President of the Metropolitan Club, Doug Bangert, at 415 Walsh. Johnny Queen and his band will play at the Astor. Tickets for the trip will be sold in lower lobby of the Dining Hall after supper from 6:30 to 7:00, and in 415 Walsh and 43 Sorin any time. Cleveland — Met Club Will See Packed Stands THE NOTRE DAME SCHOLASTIC

Knights Will Initiate THE KNIGHTS' NIGHT IN New Members, Tuesday Grand Knight Timothy R. King, an­ nounced at the third general council meeting of Notre Dame Council No. 1477 Knights of Columbus, that the council's ritualistic ceremonies for the first class of the current academic year will com­ mence with the confeiTing of the degrees on some 25 candidates, Tuesday evening. Other dates for first degrees will be Nov. 21 and Dec. 5. By that date, the local Council, commencing its 30th year of continuous operation on the campus, expects to have nearly 100 candi­ dates ready for the bestowing of the major degrees on Sunday, Dec. 10. This procedure is in line with the Council's annual policy of conferring the major rituals twice during a school year. The second class is planned for mid-April. students, over 18 years of age, and possessing other pre-requisites for ad­ mission to the Order of the Knights of department of religion of the Univer­ the history of the Catholic Church—that Columbus, desiring to join through the sity, taught scripture at Holy Cross of the Graeco-Roman world by early local council, may obtain information Seminary from 1914 to 1921, and organ­ Christianity—was largely through the concerning the Knights either by inquir­ ized the Holy Cross Mission and the efforts of the ordinary layman; the Ro­ ing from the 200 members on the cam­ Bengal Mission. man soldier, in particular, was helpful pus or by visiting the Knights of Colum­ in carrying Christianity throughout the "The greatest thing that the Crusade bus headquarters in AValsh Hall, which Empire, Father Mathis explained. The can do here," Father Mathis stated, "is are open daily from 9 a.m. to 5:30 p.m. Crusade will conduct a study and dis­ to cultivate the missionary spirit among The K. of C. recreation room in Walsh cussion club to consider Ramonull, the the laymen. Every Catholic, by the name Hall, containing bowling alleys, pool, most distinguished lay missionary of all Catholic, is called to a specific mission­ billiard and table tennis facilities has time. ary work—that of living out the prin­ been renovated and is ready for opera­ ciples of his religion in his professional Having traveled extensively in Asia in tion. life and carrying them to those within his missionary pursuits. Father Mathis James P. Metzler, senior, Kansas City, the zone of his influence." has become familiar with many sections was appointed chairman of the council of India, and has taken several thousand athletic program consisting of a bowling As a proximate example of this mis­ feet of movie film, which he plans to league, handball tournament, possibly a sionary spirit, Father Mathis cited the exhibit at the meetings of the C.S.M.C. swimming meet and the annual Spring conversion of our own Knute Rockne, golf tournament. Assisting Metzler are which was greatly influenced by the In 1925, Father Mathis was the co- Dan Hushek, bowling and Bill Cotter, players of one of his national cham­ founder of the Society of Catholic Med­ swimming. John Reed, senior, Fort pionship teams. Needing only the vic­ ical Missionaries, a community of sisters Wayne, was appointed chairman of the tory over Southern California to insure who devote themselves to professional council's Catholic Activity committee; them of the coveted honor, "Rock" prom­ medical aid in the foreign missions. This Harry E. Murray, charities; Bob Matth­ ised his "boys" a trip to any destination was the first organization of its kind in ews, press; Art Selna, senior lawyer, they cared to choose, if they were vic­ the history of the Church, and in 1936 Insurance. Several other appointments torious. the Holy See extended the privilege of were considered and will be announced For many weeks after their successful studying medicine and performing med­ at the next council meeting. season, the players failed to announce ical work to sisters of all orders per­ their choice to ease the anxiety of the forming foreign mission service. Campus Student Mission coach. After a huddle with Mrs. Rockne, the captain finally informed "Rock" that Campus Theatre Group Crusade Begins Sunday there was only one trip in which the fellows were interested — that of their The first of a series of weekly meet­ Selects Opening Play beloved coach to the baptismal font in ings of the Catholic Student Mission "Brother Orchid," a play adapted Sacred Heart Church. Crusade will be held Sunday morning at from the short story by Richard O'Con- 11 o'clock. The Rev. Michael A. Mathis, Realizing the signficance of such a nell which appeared in Collier's maga­ C.S.C., director of the campus group, statement from those young men, Rock­ zine, will be the next dramatic produc­ will announce the place of meeting— ne was moved deeply; he agreed to take tion presented by the Notre Dame probably a Main Building class room— instructions, and was baptized the fol­ Players. The first production of this in the Religious Bulletin. lowing Holy Saturday, making his First play was given at Catholic University. Father Mathis, formerly in charge of Communion with his own boys on East­ The three-act tragi-comedy is sched­ mission activities of the order, and this er Sunday morning. uled for presentation in Washington year a professor of apologetics in the The greatest missionary conquest in Hall on December 14 and 15. 8 THE NOTRE DAME SCHOLASTIC Military Club Elects Dilatorj' methods used to increase the group is composed of 32 members and is client's bill, not only frustrate the ad­ under the direction of Mr. Orville Foster. Wallace as Commandant ministration of justice but give the pro­ The harmonized parts of the Mass will War in Europe had little effect on the fession a black eye. be sung by the entire chorus, and the Notre Dame Military Club, which re­ Mr. Butler listed a number of impor­ plain chant will be done by the Sanctu­ cently held its first meeting with 40 tant rules of trial techniques and illus­ ary Singers, 12 picked members of the members. The faculty adviser. Major trated them by his own experiences on chorus. The group will be vested. Robert B. Eiordan, spoke on Notre Dame trials in the South Bend area. William military history, including in his re­ Mahoney, Phoenix, Arizona, was toast- marks the interesting life of Colonel master of the affair. Dr. McMahon to Advise Lynch, of Notre Dame, who held the Eugene Zinn, head of the speaker position of brigadier general in the Un­ committee, announced that he is making Undergrad Peace Drive ion Army during the Civil War. effoi-ts to secure as guest talker for the What is the position of the United Another colorful figure. Col. Sweeney, next meeting one of the prominent at­ States in the present war? What would distinguished himself in the World War, torneys engaged in the General Motors be the economic, social, and political and is now the only American officer trial which is being held in South Bend. results if we were to enter it? These in the French Foreign Legion. The club November 15 has been set as the date and other pertinent questions of war voted George Wallace, commandant; Jer­ for the next smoker. and peace are under the scrutiny of a ry Donovan, vice - conunandant; and group of 35 seniors Avho compose the Lewis Peck, adjutant. Organized in 1937, Commission of Peace. It is their pur­ the Military club aims to promote inter­ Third Order Meets pose to arrive at a sound basis for Cath­ olic Peace Action by a thorough study est in national defense, contemporary On next Sunday, the feast of Christ of the specific problem in back of the martial affairs and in military tradi­ the King, an investiture will be held present European war today, and in tions of Notre Dame. It also assists stu­ by the Third Order of St. Francis in wars of the past. dents to obtain commissions in the Re­ Morrissey Hall Chapel at 11 o'clock. serve Corps of the Army, Navy and the Any one interested is urged to see the Under the direction of Harry Bois- Marines. director, the Rev. William Craddick, vert, three meetings have been held to C.S.C., or one of the following officers: discuss and initiate a systematic method Members have been attending meet­ Richard Cowling, prefect; Norbert Mer- ings of the South Bend regiment, Indi­ of peace study. As a result, several dzinski, vice president; or Robert Sulli­ members are now working on papers ana National Guard, to study such new van, secretary-treasurer. military formations as the close and op­ dealing with various phases of the topic. en order drill. Plans for the next meet­ At the conference of Oct. 16, Father It is hoped that these papers may later ing include movies of recent naval ma­ Craddick discussed the history of the be incorporated in pamphlet form, and neuvers.—Jim Brugger. Order, its value, and its possibilities published for general distribution. At here at Notre Dame. The Third Order the last meeting. Dr. Francis McMahon is a fraternal organization seeking unity agreed to act as faculty adviser, and Law Club Smoker and mutual aid in perfecting the spirit­ supplied the group with a number of ual life of laymen. pamphlets of great value in the search A criticism of the stalling tactics for information about peace. used during the trial of law suits by When the Commission has become the few unscrupulous men in the prac­ Linnets Make Debut more securely established, membership tice of law, formed a major phase of The Linnets, freshmen choral group, the interesting speech delivered by Paul will be opened to the other classes, and will hold their premiere Wednesday it is hoped that the entire student body Butler, South Bend attorney, last Wed­ morning, when they will sing a Requiem nesday night at the Law Club smoker. will join in this effort for peace. High Mass at Sacred Heart Church. The —Roger Behm.

The Linnets Freshmen Choral Group Will Don Cassocks and Surplices THE NOTRE DAME SCHOLASTIC

have as much technical knowledge and ing. Both have adequate technique for ability to play swing as to play the their purposes, although, technically, I FACULTY classics? believe Benny Goodman is much more A. It is true that a good technical competent. equipment is as essential to play s\ving Professor Daniel F. Pedtke, head of Q. Does the popularization of swing successfully as it is to render the clas­ the department of music, takes the stand music necessarily denote a lowering of sics. More than mere technique, how­ to answer questions on the current craze, public taste in music? "Swing Music." Edmund Butler, manag­ ever, is necessary for the classics. The er of the Linnets Orchestra which classical musician is first of all an artist A. Any type of music built on a pre­ brought "Swing" to Washington Hall who feels and lives his music from the dominance of percussions and strong last year, asks the questions. heart up. This is not true of any other monotonous rhythm characterizes a low type of music. (Watch the feet of the stage of public taste. Primitive music Q. How would you define "Swing?" swing man in a "jam" session.) Swing was primarily rhythm. More intelligent A. Swing is a new name for a type music cannot change tempos because it races and higher artistic people resort of dance music we've had with us for is essentially dance music where regu­ to more expressive forms of music built more than 30 years with perhaps, a few larity of rhythm is necessary. Many a on a more melodic and harmonic basis variations in rhythms; this music was good musician is driven to play in the \vith controlled free rhythms. A certain formerly called "Eagtime" and "Jazz." dance band for financial reasons. amount of 3^ving in one's diet, however, will offer variety and prove harmless. The additions of countermelodies or so- Q. Is Larry Clinton's treatment of called "Take-offs" can be found in many Claude DeBussey's "Reverie" or his ver­ old time "ragtime" arrangements. sion of Tchaikowsky's "Fifth Symph- Technically, we call it Discant, which Belgians Convert Homes has been used since the tenth century. Swing is primarily dance music and as Into Garages—^Fr. Riter such ranks with folk dances of other "Some of the people drive their cars ages, including the sarabande, polka, through the front door of their homes tarantella, minuet and Vienese Waltz. and park them there for the night," Folk songs, however, were more sincere said the Rev. Regis Riter, C.S.C., of as they were the individual expression the University faculty, who recently re­ of the common people. Swing, some­ turned from a year's study at Louvain times referred to as the folk music of university in Belgium. But Father Riter America, is built on more commercial amended this hastily: "This is because standards. Swing, or modern "ragtime," the houses are built close together, leav­ is dance music of strong rhythmical ing no room for driveways. What form­ patterns with a variety of Discant. erly were vestibules, in some cases have been transformed into garages." Q. In your opinion, is swing music a valuable contribution to progress and This and many other interesting com­ experimentation in the field of music? ments were made by Father Riter as he spoke about his stay in Belgium. One A. The contribution of swing to the of the impressions which he got was the entire field of music is very small since Daniel F. Pedtke leisurely manner in which the Belgiimis it can only affect dance music. As such, conduct their businesses. "One day I it is doubtful whether any contemporary ony," which is now popularized as sent some clothes to be pressed and was swing tune will live as long as a Strauss "Moon Love," a detrimental move on told to come back for them the follow­ waltz. This is due partly to too many the pai't of such a musician? ing Thursday. I returned to the shop repetitions and a form too simple to A. Larry Clinton's treatment of the Thursday and the proprietor told me the create enough variety to hold interest articles were not yet ready, but to come for any length of time. Some influence, classics has accomplished some good in bringing good music within reach of back the next day. It took nine trips to however, of rhythms and harmonic pro­ get the clothes!" laughed Father Riter. gressions in modern concert music can more people who ordinarily would never be traced to swing. This is usually found take the trouble to learn the original, Many of the Louvain buildings which in program music where the composer is partly because of fear of going "high­ had been demolished during the course trying to attain moods of local color. brow." Now perhaps, many of the con­ of the last war have been re-constructed There is a possibility of development of verts will search deeper into classic lit­ from funds supplied by the American present popular music under American erature for even greater themes which people. Father Riter added. The library composers of the George Gershwin or were made with a higher purpose. I was rebuilt entirely from money sup­ Ferdi Groffe type. would advise anyone to listen to "Moon plied by Americans, and a great many Love" and follow it immediately u-ith houses of Louvain have small metal Q. Is this new, or rejuvenated, type the original "Andante Cantabile" of plaques above the door way with "1914" of music here to stay—^wholly or par­ Tschaikowsky's Fifth Symphony. The inscribed, indicating that the house was tially? many "terrific" performances of the constructed with American contributions. A. No. A look back over the last ten swing arrangements are definitely detri­ years will answer that. Even the past mental to the cause of better music. American movies make a dissimilar year has brought a considerable change hit with the populace: Robert Taylor in the style of performance, particularly Q. To return to the question of tech­ and Ginger Rogers give way to the hard- in instrumentation of the orchestral ar­ nical ability—^who do you think is the riding, fast shooting Westerns. rangements. It will lose its identity in better clarinetist?—Benny Goodman or When asked his most interesting ex­ some new terminology just as "jazz" is Artie Shaw? perience. Father Riter said that it was, now swing, A. Benny Goodman and Artie Shaw without a doubt, the coronation of the Q. Is it true that a musician must represent two individual styles of play­ Pope.—Don Heltzel 10 THE NOTRE DAME SCHOLASTIC

and insulting phrase of all they held most sacred would the men be greeted on station platforms, in hotel lobbies, The Notre Dame Scholastic from the sidewalks and even from the Disce Quasi Semper Victwnis Vive Quasi Cras Moritwnis side lines. FOUNDED 1867 Recognition came slowly and, strange irony, from afar. The qualifier 'Fight­ ing' quite naturally was prefixed to 'Irish' and so it remained. The epithet WiLLiAJi C. FAY, DONALD FOSKETT, of opprobrium to one generation be­ Editor-in-Chief Managing Editor came one of distinction to the next. The link between them all but uncon- WILLIAM C. MCGOWAN, JAMES NEWLAND, Neivs Editor Sports Editor .sciously melted away. It was reforged by a new set of circumstances. FRANK WEMHOFF, ElCHARD METZGER, Literary Editor Art Editor The war and post-war hysteria among WILLIAM KELLEHER REV. C. LASKOWSKI, C.S.C, other things centered upon the hyphen­ Art Editor Faculty Adviser ated American. Attempts were even made to tone down recorded history. Bunker Hill, Lexington, Ticonderoga Member of Catholic School Press Association and Associated Collegiate Press. Distributor of Collegiate Digest. Eepresented for national advertising by National Advertising Service, henceforth should be symbols of an un­ Inc., 420 Madison Avenue, New York City—Chicago—Boston—Los Angeles—San Francisco. fortunate misunderstanding to be con­ doned instead of symbols of a principle THE SCHOL.A.STIC is published 26 times during the school year at the University of to be safeguarded. Catholics in particu­ Notre Dame. Address manuscriptj? to Editor, 259 Alumni Hall. Notre Dame, Indiana^ lar were suspect The frenzies that fol­ lowed down to our own day need no re­ Staff meetings Friday evenings in Editorial Rooms, Ave Maria Building; Editorial Staff. 6:.^0 P.M.: General Staff. 7:00 P.M. counting here. "Fighting Irish," thought some, should be dropped. Not quite so simply, however, is the course of Mstory or of tradition to be changed. The Americanism of Notre Dame needs no Across the Editor's Desk such subterfuge. The last decade might well be termed A Tradition Defined tration here in a name gave us a hal­ the era of slogans. Advertising experts lowed tradition. Indeed opposition to stayed up nights to invent them. Man- HE SCHOLASTIC'S column "Splin­ the founding of a Catholic institution in ufactui-ers arranged contests to discover T ters from the Press Box" last week these parts found concrete expression in them. Sports writers tapped them out carried what purported to be an explan­ many ways. One of these still exists on the keys. Nor was Notre Dame im­ ation of the origin of the expression in the local to^^^l as a building which, mune. Dictionaries were bereft of ad­ intended for a college, is now part of a "Fighting Irish" as applied to the repre­ jectives to characterize the prowess of factorj;^, and an adjoining street which is sentatives of Notre Dame in the field of her men and, lo, there came forth the called "College." spoi-ts. Commenting upon an editorial "Wanderers," the "Vikings," the "No­ in the Indianapolis Neivs, the writer of mads," the "Ramblers," and a multitude the column placed the nickname as aris­ From the very beginning games of others that had their brief vogue in ing from an incident in the Micliigan- played an important part in the life the editorial rooms where they origin­ Notre Dame game of 1909, and credited of the students at Notre Dame. The ated. Their justification was the fact it to an aleii newspaper correspondent. natural impulse was to seek outside that Notre Dame travelled so much, and competition At first this was reluctant­ that "Fighting Irish" was no longer ap­ ly given. The events themselves were (This editorial, which appeared in propriate since so many racial strains not always charactei-ized by pleasant­ THE SCHOLASTIC, April 7, 1933, is now composed her teams. We hope to ness. The receptions accorded did not reprinted for the benefit of this year's have shown that the first was a contrib­ always represent what we have come to Freshman class, and for those newcom­ uting factor to the original name and know as sportsmanship. Advance no­ ers to the University who are unfamiliar the second as a determining element in ivith origin of the expression "Fighting tices referred to the "Notre Dame Cath­ the makeup of the teams never had any Irish.") olics," the "Notre Dame Irish." foundation in fact. Even then, as now, the terms were not It has been well said that a people The fact is, the expression derives its inclusive of the men on the teams. Dim- without ti-adition is already decadent. origin from no such casual occurrence mick, Philbrook, and Edwards, to men­ It is also true of institutions. No one and antedates 1909 by many years. The tion only a few, were not Catholics. can consciously sit down and say "let spirit out of which it grew was typical Eggeman, Neizer, Miller, Davila, among us create a tradition." It is sometliing neither of any one time, nor any one many others, were not of Irish blood. that unconsciously identifies itself, gi'ows place in this country. This spirit mani­ In point of fact, "Catholic" and "Irish" out of what is adequately described as fested itself often in open insult, not in those far-off days—^not to speak of the genius of a people. As such it is a infrequently in destruction of propei-ty more recent ones—^were synonymous, sacred thing. To consciously ignore it anl almost invariably in social ostracism. and either one stood for something partakes of the nature of a betrayal. Be­ Seared upon the pages of our historj'' which, to say the least, should be avoid­ cause of this we treasure and defend are examples of that spirit. Its concen­ ed. So with ribald jest, derisive taunt. "Fighting Irish" THE NOTRE DAME SCHOLASTIC 11

A Sunken Submarine

By Walter Desel

The heavy black fog deadened all blackness of the swirling waters outside dumb faces, trying to agree, but they noise. Still and calm was the water. the sub poured through the walls of the couldn't. The lookouts on the sub were lulled into two rooms. The air in the rooms was "I'd just as well be dead as waiting quiet. becoming heavy and acrid and at the to die," Fitz murmured in a monotonous least exertion a man would start to One of the men slowly got up from tone silence. his squatting position and wheeled breathe heavily an^ suck for air. Then a sharp metallic sound; heads around on one heel; his eyes grew The air made the moods of the men jerked up; Chris was working with the large; his neck craned out to starboard. dull and cold. Colby was trying to make clamps on the watertight door. Horror He recognized a few lights.... then a himself believe that he was hearing the stricken, the men pounced on him and ship. tapping of someone come to rescue them. dragged him away from the door. Chris "Look, lights.... a ship," he mur­ bleated. mured. "I gotta get out of here, I'll go nuts The ship kept in a direct line, almost if I have to stay cooped up any longer. headed for the sub. Impressions of a Street Lemme go, lemme go!!!" "Surely they see us," he spoke a little Broad artery of the Motor City: His eyes were glassy and his hands louder, nervously. Stretching like a piece of golden taffy trembled, like thin leaves fluttering in a "Lord! our lights. . . . they're out." From the river to the hills.... breeze; his face was drawn and pale Neoyis like irridescent moths blue. His knees sagged. His body crum­ The other men jerked up and stood Describing sudden volutes pled and slipped to the floor. behind him, motionless, like figures in Of green and red light "Dead," said Evans so casually he stone, their feet glued to the iron deck, Hawkers whining commerce frightened himself. their mouths hanging open in an effort Beloiv the unblinking cats' eyes The men took this incident dimibly. to yell, their wet, white hands frozen Of the Detroiter. to the railing. Silence and then the dron­ Here was death and that was that. But The fat-flanked trolleys shuttling not Hayes; he was sure that some help ing of the huge motors of the ship, Monotonously across the steel warp of louder and louder till the looming sides would come from above to them in the street.... the sub. of the ship were almost on top of them, Toivard the river at the Circus Three of the men were breathing like like a gigantic sea monster coming for Pigeons float down in ivhite, dramatic puffing engines and when Scott tried to its prey. Then a deadening, screaming sph-als do something for them they refused, say­ C R -A. s H ! To eat peanuts from floaters ing, almost soundlessly, that there was The hiss of rushing water echoed Gulls moving in nothing that could be done. About a through the sub; the black water bil­ Like passive clumps of snoiv half hour later two of them, Colby and lowed through the wound in the side of And Time as endless as the river, Hayes, collapsed; the third one, Fitz, the sub into the damaged torpedo room As long and short as the street went in about ten minutes. Four were and through the conning tower. Sud­ The' street as old arid wise still alive. denly three rooms were filled with As Time tonight. water; the men in there were dead. AVALTER HAGEN, JR. For another hour or so the four men sat still and motionless, merely waiting Two compartments were watertight for it to happen. Twice the sub rolled and the men there were apparently safe, over on its side and then balanced itself with about a half foot of water gurgling again; the men huddled themselves to­ around their feet. But the sub lay help­ He was sitting still like a stone, strain­ ing for a soxmd; twice he jumped when gether for warmth; they breathed like less, 140 feet down in black, inky wat­ panting dogs. That was the only noise ers. Inside these two rooms lurked dead­ one of the men clinked his foot against some metal. Once he put his ear against the stale air being sucked into their ly silence; a book which one man had lungs in short gasping spasms and then been reading lay on the floor under the the wall of the sub but he sat down again with blank, desolate face. being exhaled, like steam escaping water. Those two rooms seemed so safe, through a tight valve. They were breath­ yet so uncertain. In the minds of the Hayes dwelt over the death of his ing harder, harder, harder. men there was a vacant spot where they buddies in the flooded compartments. Scott murmured something to Evans, were trying to solve the problem, a problem that was unsolvable, an idea "Think how lucky we are, fellers, to and then to the other two men. that just weighed in their minds. There be still alive while all the other guys Evans said, "O. K." were eight men alive in the sub; only are floating around in that black water," The others nodded. Scott sloshed his those in the engine room and motor he smiled sickly. His gimis were blackly heavy feet through the oily water to the room were still living... but for how blue. watertight door and loosened the clamps. long, for an hour, maybe minutes. "We'll be 0. K." The black, murky water splashed into The rooms grew icy cold and the'inky The other looked at him with sober. the room. 12 THE NOTRE DAME SCHOLASTIC

Skibos Are Set to Spill Irish Hold Tight, Johnnie— In Crucial Game Tomorrow

Muha and Condit Expected up. Each week finds the blocking prog­ TO Give Laydenmen Trouble ress, defense strengthen, and victories increase. There is a w^ealth of backfield material. Benny Sheridan found him­ self against S. M. U., and ran wild against the Midshipmen. Zontini is as High above the Smoky City stands a steady as ever. As a whole, there has football battle ground. Tomorrow after­ been great improvement shown. noon, on that field, the turf of Pitt Sta­ dium, an old feud will be renewed. The All credit can not be given to the Scotch will face the Irish. Carnegie backs. Up front, blocking is picking up. Tech's Tartans, on their o^^m field, A\all Do^^^lfield, a little more wiping up could be out to scar the unbeaten record of be used. But both lines progress wi^ Notre Dame's Fighting Irish. each game. And we cannot complaih about improvement. Each week the Laydenmen face a team which is pointed for victory. Every Coach Layden has pointed out some opponent on the Notre Dame schedule significant facts about the team, facts is out to wm, knowmg the prestige that that are knowai to few outside of the comes with a victory over the Irish. Car­ coaching staff: negie is not the exception, but the real "As these future games come up, more example of this rule. The Skibos lost plays will come into use. It is our policy last week to an underdog N. Y. U team. to use a minimum of plays at first, and But that defeat, by no means, will make to get those few down pat. But each Tech a soft touch. On the contrary, the week we bring out something new. In Tartans will be all the tougher. They football the old saying, 'quality before are not counting on losing two in a row. quantity' is as fool-proof as along any Last year, as shown above, a strong Irish line k atvay from Touchdoiun-land, Kelly and C And Tech has the manpower to come other line of activity. through. Remember last year. From "We are getting our combinations set, that powerful Carnegie club we saw in handsome prospects for the "B" team. using settled line-ups that have sho\\Ti our stadium, only four men have been The biggest attraction was a game with well in competition. Of course, that does lost. Eighteen of twenty-two from the an unnamed Eastern college. This game not mean that the other boys have no first two teams will be playing ball to­ was called off. Well, that was all right. chance. Ability, new stars, "are always morrow. The boys started to point for the North­ watched for. Changes are always very western game, but evidently they didn't A spectacular duo of halfbacks, possible." point enough, because that, too, was George Muha and Merlyn Condit, vsdll cancelled. The climax to such doings Tomorrow, the Tartans will be eager spark the ruimmg attack of Carnegie. was reached when a scheduled game ' to regain the prestige they lost against Directing the maneuvers from the quar­ wath Illinois was dropped fi'om the N. Y. U. last Aveek. Notre Dame must terback position will be "Whitey" books because, with the Illinois varsity win to keep intact a record of victories. Moersch; as an alternate Moersch will playing in Los Angeles, there weren't Driving, slashing George Muha is Tech's have capable "Chang" Dunn. Fullbacks enough men on the Champaign campus version of our owm "Moose" Piepul. are plentiful. Jerry White, Walt Ingalls, to play the locals. Let's watch the "Moose" outdo Muha. and Tony Laposki have shown plenty Now, however, things are looking up Let's watch the Irish outscore the of stuff bucking the line. again. Not much is known about Sun­ Scotch.—John Patterson day's opponents who, if you are inter­ The center of the Tech line is manned ested, are the men from St. Francis Col­ by briUiant "Tarzan" Schmidt, towering lege. It will be Coach Cerney's first center, and two fast guards, BiU Eeith Surprise! "B" Team To chance to see Ms men in a real test. At and Bob Dominy. Pete Dobrus is a Play First Game Sunday the present things in general indicate tackle second to none the Irish have a Adctory (if the game is played). faced this year. His running mate, Ted Don't look now, but a vicious Pruger is a pillar of defensive strength. rumor has just reached us. It seems Five interchangeable ends wiU make it that the Notre Dame "B" team has a Frosh Outstanding In something of a feat to encircle the Car­ game definitely scheduled for Sunday, negie flanks. Striegel, Betz, How^arth, October 29, at Loretta, Pa. Those who Handicap Track Races Church, and Fisher can also snare pass­ have foUoAved the fortunes of Coach A quintet of newcomers, Tony Malon- es wdth grace and assurance. Cerney's men thus far this season are ey. Bill Wood, Jim Delaney, Gibson inclined to scoff at such a suggestion, Molt, and Dick Tupta, provided smiles But the Irish have some fair-to- but it is true nevertheless. for Track Coach John P. Nicholson as middlin' football men in their ovm line­ At the start of the season, there were first-year men took top honors in the THE NOTRE DAME SCHOLASTIC 13

SpHnters From The Pressbox -That's Mr. Muha! by Frank Aubrey

From now on we are no longer play­ in Wladeslaw's name in order to throw ing out the schedule, but in 18-point crafty officials off the scent. From now type "Notre Dame is marching toward on to play football in the Big-Three you a National Championship." After four must be one of three things: first, inde­ straight victories over anybody, a team pendently wealthy; second, a student must expect things like that; it's the who plays football merely for the love sports writers' inalienable prerogative, of the sport; or third, a smart 'tramp that is, you can't stop him. Thus, such athlete,' and we mean smart; smart a team becomes the favorite in every enough to get away with it, now that a game; it is lauded to the skies in pre- special investigating committee is on the game puffery; and it is narrowly ex­ prowl. amined and picked-over in post-game The former All-American, Larry Kel- critiques. ley, recently took a blast at the Big- • Thi-ee. Dollars to doughnuts Larry was Once a team starts "marching" in­ not a magnate's son or exclusively a stead of playing, things begin to tighten 'lover of sports' while he played at Yale. up too. Game tension increases so that However, it remains common knowledge any little deviation from perfection in that Larry's playing brought more fav­ play calls forth a sad shaking of heads orable interest and attention to the Big- among the cognoscenti of the press box, Three than any other phenomena since and a ringing chorus of razzberries from the days of Albie Booth. But all this is the bleacher section. When Jones who distasteful to the powers that are; it has been fumbling all year fumbles now smacks too much of professionalism. that the "march" is under way, with They want to take the game away from mounting blood pi-essure we demand, the promoters, so they say, and give it "Judas Priest! What's wi'ong with back to the—^Indians," you guessed it. Jones today!" or words to that effect. With the imposition of this embargo Jones himself is mentally boiling Ip­ on talent, it looks like hard times are 3 kept George Muha, Carnegie's great back, swich in oil for his lousy pass from cen­ ahead for Messrs. Ducky Pond, Dick I Company must repeat tomorrow. ter. Ipswich is calling upon Moses to Harlow, and Tad Weiman. Of course, witness the terrible blocking of Mui-phy if these gentlemen should devote them­ University fall handicap track races, on that last play. In short, the team selves to 'building character' for a few last week. morale approaches the jagged edge. years, the possibilities are enormous. Maloney turned in one of the out­ Of course, if we should lose a game We might be able to say in time that standing pei'formances of the event then the scene changes. We begin to Big-Three footballers are the highest when he toui'ed Cartier Field route in philosophize -with an 'I told you so' atti­ type of homo sapiens, and that is some­ 4:38 for the mile—^highly commendable tude. The hacks remark dryly that thing to look forward to, gentlemen. for a fall mark for freshmen. Maloney poor old Jones is doing the best he can, • finished second to Curt Hestor in the so we shouldn't criticize. . . . The bleach­ Suggestion to Mr. Flyim: Personally, 880. Delaney, however, was the out­ er fans sit back and break another label we'd holler a lot more if some cute little standing individual competitor when he or else stay away from the stadium en­ girl out in front looked like she kinda upset Bill Faymonxalle in the shot put. tirely. The team, with the pressure off, wanted us to, than if the whole male Delaney, Avho has a high school niai'k usually starts to play football again, as student body turned a dozen hand­ of better than 59 feet for the 12 pound a team. All of which leads up to the springs From the Carnegie Tartan shot, heaved the 16 pound ball 46 feet, moss-covered homily that 'one swallow we quote: "Notre Dame will undoubt­ 4 inches to win. Molt won the broad doesn't make a summer,' and therefore, edly be the toughest hurdle in. Tech's jump, leaping 20 feet. despite the four birds we have bagged race towards the mythical national Wood captured the 100 yai'd dash in so far, we ought not to start "marching" championship. After this game the 10:1, followed by Gibson who came until along about 5 p.m. on Nov. 25. team wiU be given the week's rest through to vnn the 220 in 23:1. Tupta • they'll deserve, and probably need." displayed his versatility by winning the Yale, Haiward, and Princeton have re- That was predicted before N.Y.TJ. need javelin with a toss of 127 feet, 6 inches, emphasized their 'mutual assistance' and we add. Sic semper progjiosticatoris. placed second in both the quarter mile 'hunky-exclusion' agreement. So, if Picking Splinters: and the 220. Ray Roy won the quarter you're thinking of sending some worthy Notre Dame over Carnegie in 51:2. lad through Harvard to major in the Michigan over Yale A group of veterans won the other art of football, you'd better be careful Southern California over California events. Dave Lawrence led Bill Nichol­ how you go about it. For instance, all Iowa over Wisconsin son, son of the coach, across the finish checks must be accounted for, if sent to Santa Clara over Purdue line in the 75-yard high hurdles in :10 said 'worthy.' That means if you mail Cornell over Ohio State flat; Johnny Dean captured the pole AVladeslaw his tuition fee or weekly Louisiana over Vanderbilt vault at 12 feet; and Ted Leonas took pay, you must either send it as father Georgia Tech over Auburn the high jump at 6 feet.—Bill Scanlon to son, or else establish a bank account Oregon over TJ.CL.A. 14 THE NOTRE DAME SCHOLASTIC Gregory In Final Round Introducing by Pete Sheehan Of Fall Tennis Tourney "It's souring on us." Coach Lang- ford was bemoaning the turn of the local weather which has allowed but "What a block!" These three words type nor is he popular around the South one round of the Fall Tennis Tourna­ were on the lips of all the experts who Bend Drug stores. Steve goes his way ment to be played in the last two weeks. filled the press box at Cleveland's Mimi- quietly but his classroom and gridiron The pairing sheet, blown from the bulle­ cipal Stadium last Saturday afternoon. accomplishments tell more about his tin board with the arrival of the fall While 80,000 gridiron enthusiasts were character than he could relate in thous­ winds, shows Whit Gregory in the final going mad over the sensational running ands of words. round waiting to meet the -wanner of the ability which the Irish backs displayed, Hecklei'-Fay match for the title. the Gentlemen of the Press were raving Last year many of the experts and Unexpectedly the winner of his match about the finest blocker they had seen curbstone quarterbacks denounced Steve Avith defending champion Canale, Greg­ this vear. when he called a running play against ory upset the pre-tourney speculation Southern California with seconds re­ by his march to the finals. The match That blocker was Steve Sitko. Steve maining in the first half. The play failed Gregory played with Canale was a not only is considered Notre lengthy affair neither of the pair anx­ Dame's best interferer since snve IS oNt BLOCKEH ious to beat the other. The two South­ WHO fPALLY MOWS Marty Brill but also is recog­ 'KI^ OOWN erners who'd rather play on the same nized as its greatest field gen­ WHAT HIT side of the net than on opposite sides, eral since Frank Carideo. Bob MB r volleyed through an exchange of com­ Zuppke, Illinois mentor, rated pliments ending finally with a 3-6, 7-5, the blonde signal caller as the 9-7 score. The scores scarcely show country's number one quarter­ the proximity of a Canale ^^ctory, "Ace" back last year—and Mr. Zuppr having a 1-5 advantage in the second ke saw quite a few, set and a 0-5, double match point chance in the final set. Both smiled Sitko attended Central High when they mentioned this. Gregory in Fort Wayne and made the said, "Then I began to serve," and ex- first team in both football and champ Canale claims, "Whit's won so basketball as a sophomore. many cokes from me before that I The quarterback position was in his capable hands for three couldn't get out of the habit." years and he won recognition Gregory played No. 2 singles and is throughout the Hoosier State ineligible for competition this spring be­ when he was awarded a posi­ cause of his three previous seasons on tion on the all-Indiana team the Irish courts. in 193.5. Captain Fay's many time postponed match with Heckler is scheduled for the Right guard on the cage first "break in the clouds." Little count­ team was his position for ed on before play began, "Hecky" has three years and as a senior he taken all his opponents with an unusual­ was chosen on the all - State ly steady, well paced game. Unless his five. This is a much desired game has cooled with the postpone­ award, because Indiana is ments, his chances are rated high in kno\vn throughout the country and the Trojans countered with a touch- meeting Gregory in the title match. for its high brand of scholastic basket­ do\vn pass but Steve has no alibis. "I —John Qiiinji ball. still would call the same play in the same situation." When we have a man Steve's greatest individual feat was of determination, such as Steve, at the Owens and Doerr Shine his last minute basket against Kokomo helm of the Fighting Irish is it any won­ from the center of the court. This bucket der that they are marching toward the In Frosh Swimming Meet enabled Central to win the regional national title. tournament and go on to the state finals. In the years to come when Bob Owens of Brownson and John Doerr of Cava- Although Fort Wayne was nosed out in Bill McGannon and Bob Hargrave, the final round her ace guard and our naugh sit around the dinner table and Irish reserve backs, were Steve's oppon­ tell of the feats they have accomplished, ace quarterback received the Gimbel ents in high school. Lou Wagner, varsity Award for outstanding sportsmanship. one they Avill probably not shy away basketball forward, opposed Steve in the from telling will be that they jointly We can readily understand why he was State regional tournament. so honored. were high scorers in the first Freshman Fort Wayne is proud of Steve and swinuning meet ever held at Notre The young athlete had two objectives several of his townsmen will be in the Dame. when he entered Notre Dame—^to study Notre Dame stadium when the Wildcats The meet, concluded on Thursday a engineering and play football. That he invade the den of the Fighting Irish. week ago, was rather warm insofar as attained them is easily seen when we competition was concerned, and the look up Steve's scholastic average and Statistics: Born in Fort Wayne, Ind., milky-green waters of the Rockne glance at the sport section of any news­ Nov. 16, 1918. Full name—Stephen Jo­ Memorial pool at the finish had been paper. seph Sitko. Weight, 185 pounds, height, churned to a white, frothy mass by 5 ft. 11% ins. Will be graduated in June flutter kicks, scissor kicks, crawls, and He is not the man about the campus in Mechanical Engineering. various other strokes. THE NOTRE DAME SCHOLASTIC 15

Owens took first honors in the 50- 50-yard backstroke: Doerr; Henry cal education program, the soccer league yard breast stroke and the diving con­ Priester, Breen-Phillips; Bob Pelton, is this year imder the supervision of test. Doerr was ahead in the 50-yard Brownson. Time 32:7. Frank Gaglione, assisted by Norv Hunt- backstroke and 70-yard medley. 50-yard free style: Tom Miller, Cav- Since this was the initial freshman anaugh; Lawrence McCarthy, Breen- swimming meet, there is no basis for Phillips; Jim Stagge, Zahm. Time 26:2. comparison of records. However, Ed Owens total points in the diving con­ Slezak, in charge of SAvimming, said the test was 102 He was followed by Disney time in the various events compares Lewis Schim of Freshman with 97, and HATS favorably with other freshman aquatic behind him with 87 was Richard Schiltz. meets throughout the country. Breen-Phillips. Doerr nosed out Robert 0.00 to ^10.00 Russell and Henry Priester in the special This meet was the prelude of other 75-yard medley.—Chuck Ferrell tournaments to come. Starting Monday will be the freshman foul shooting and badminton tournaments. Entries closed Soccer League Starts SY^EATEkS today. Paced by "Mack" McBride, leading Sleeveless vests—button and Results of the swimming carnival fol­ scorer of the league, Freshman Hall was slipover styles—^2.50 up low: 100-yard free style: Robert Rus­ well on its way to the top of the stand­ sell, off-campus; Lawrence McCarthy, ings until the team from Breen-Phillips Breen-Phillips; Bernard O'Connor, Cav- handed them a 1-0 setback last week to anaugh. Time 59:7. put them into a tie with Brownson for GLOVES 50-yard breast stroke: Owens; John first place. Pigskins, all shades—^2.50 up Bosak, Freshman; David Fitch, Zahm. An extension of the Freshman physi­ Time 37:7. Wesfminsfer 9HB| ^1 HOSIERY ^Pl years of experience at 6x3 Wool Ribs l^lf^ your command. Camel Hair 36 years of reliable, compe­ and Wool tent service. \^t Handmade English Argyles Devoted exclusively to the examination of the THE HUDDLE eyes and the making of fine glasses.

"Pipe Headquarters" TVAoa wuM «•• w « •«* o** [[MONIREE5 for the Campus RENFRANZ-RASMUSSEN Optometrists and Opticians 106-108 South Main 314 South Michigan St. Opposite the Court House South Bend, Ind.

PREVENTS ^Uf^^ BAFFLE FILTER TONGUE BITE Specializing in the ex­ amination of the eyes. MEDIO PIPES, CIGARCTTE ft CIGAR HOLDERS NLY filter combimqg 66 baffle DR. E. J. CAIN O interior and cellophane exte* OPTOMETRIST nor, keeps nicotine, juices, flakes ''"-TER.c Successor to out of mouth. No brealdng in. No tongue bite ROGERS Breaks up hot mSS'S&iml smoke stream, Prompt Lens or Frame repair resulting in service in our orvn laboratory. mild, healthy nNESTBUAK ICD nLTEREDSHOmG. . MONEir CAR BUT CEHIME FILTHS FM HSSW* PIPES 212 S. Michigan St. mtMamumvm \_^)i^^m KB* nACII MI Phone 4-8251 Most beautiful new styles—unheard-of-va/ue 16 THE NOTRE DAME SCHOLASTIC

hausen. The schedule of the forthcom­ ly a practical subject. Eeligious knowl­ tical and ultimately theoretical. It is at ing games is as follows: edge is acquired, as someone remarked once an ideal in the speculative and the Oct. 27—^Zahm vs. Cavanaugh; Oct. "to get to Heaven, and not to learn how practical order. One wants to know re­ 29—Breen-Phillips vs. Bro\mson; Nov. the heavens go." To say that knowledge ligious truth in order to live rightly, 1—Freshman vs. Zahm; Nov. 2—Cavan­ is practical means that it is useful or and the highest form of intellectual life augh vs. Breen-Phillips; Nov. 3—Car­ necessary in the perennial business of is found in the contemplation of God, roll vs. Breen-Phillips; Nov. .5.—Zahm living, of carrying over into the order Who is truth itself. vs. Carroll. of doing the conclusions reached in our Very probably man's first impulse to processes of thinking. Unless we are Standings of teams: acquire a knowledge of God springs prepared to admit that we live in a Freshman 1113 from the mystery which he is to himself. world of anarchy, a chaos, and not in a BroA\Tison 1 12 The sense of limitation, of helplessness world of law, a cosmos, we must pre­ Breen-Phillips 11 2 in the presence of certain events, a Zahm 11 2 sume that this process is governed by certain definite rules, and that presump­ vague feeling of dependence upon some Carroll 1 2 higher power, though certainly not the Cavanaugh 2 tion is all the more respectable because in fact there is order in the lives of men. adequate cause of religion, may well be Scoring: 2 points for a win; 1 point In a general way, too, there is agree­ the occasion for the simple forms of re­ for a tie. ment as to what that order should be, for flection which culminate in some con­ we find it rather easy to distinguish be­ ception of God. The questions: Whence? What? AVhy? Whither, impose them­ YOUR RELIGION tween order and disorder, between AVIS- dom and foolishness. The principle of selves, as the French say, on our minds, that order, as stated in this column last and our minds are ill at ease until some G. K. Chesterton once said that "the week, is God, the formal object of re­ kind of an answer has been found for most impractical of all ideals is the ligion and the supreme good in the them. Karrer in his Religions of Man­ ideal of the immediately practical." The moral order. kind, says that "the religious attitude obvious point he was trying to make presupposes a native and substantial was that so-called "practical" knowledge As a consequence of this double role presence of God in man, a personal pres­ may turn out to be quite impractical, of divinity as supreme object of human ence which pre-exists man's conscious­ and that theoretical, or "useless" knowl­ speculation and as supreme good in the ness of it." And if that is true, as he edge, may in the long run become the order of action, religious knowledge be­ continues, "religion is an invasion from most practical. The question is of in­ comes an exception to the Chesterton without, the illumination of man's con­ terest here because religion is notorious­ rule. For it is both immediately prac- sciousness, his mind and heart by an objectively existing divine Eeality." The serious-minded man must find God, or suffer perpetual bewilderment . We not only pursue religious knowledge, but it

•S3

Corduroy S L A X $298

i Chalk Stn'pc PdHcmt . . 1W new Corduroy Favorit* . • . PIe«!e(j College Modal .... T«Io(vZp fly. •

SWEATERS MUSIC OF TOMORROW to match AT DINNER AND SUPPER DANCING $098 A Varied and Captivating Program Continuous from 7 P. M. Until Closing Hw perfect garment fo ttn^ plet* your entembls. FtJI-Z^ •i!r •MttlyW. .Te!on-Z;pPoa«t. JOSKA DE BABARY and his Hungarian Gypsy Orchestra Play for Luncheon Daily and for Dinner on Sundays

SPECIAL STUDENT ROOM RATES THE BILTMORE i Madison Ave. at 43rd St. See BENNY SHERIDAN, New York, Our "SPECIAL" Representative 2 Lyons Hall THE NOTRE DAME SCHOLASTIC 17 also pursues us, in the sense at least, that the questions it raises and answers refuse to be ignored. In that sense, not only Christ, Our Lord, deserves to be called the "Hound of Heaven," to bor­ row a title from Francis Thompson, but also the saving truth which He came to So good looking teach. The himian heart must love, and it must find some object worthy of its affection, something which will not leave its hunger unappeased, which will bring and so practical! r- A

\~A

^1

iUiMVERSITY €OACH£R RAINCOAT ^Mm :•• BY ALLIGATOR

At Better Dealers

Not style alone ... but guaranteed protection against rain, too! Yes ... this most handsome of raincoats with fly front, full sweeping lines, casual collar, smart brass buttons . . . actually keeps you dry even in the severest downpour' The CARBURETOR University Coacher by Alligator is one ol those things lJ.S.PjI.Na.2.082.10S X « where there's no need to sacrifice style for downright practicability ... in fact, no coat equals it KAYWOODIE ^i for either style or protection. Better get In this Kaywoodie pipe, called the Car­ one today . . . IT'S SURE TO RAIN! ////'F // buretor Kaywoodie, a wonderfully sweet- smoking pipe has been improved by the application of a neat little principle of The "Coacher'' by Alligator also available tn Samthur "Special Finiih" $14.75 physics. When you take a pufF at one of Caleclolh $18.50 these Carburetor Kaywoodies, you auto­ matically ^r^ji' air in through a tiny inlet Other Alligator Raincoats, $5.75 to $25 in the bottom of the bowl. That incom­ ing air keeps the smoke cool, sweet and serene, no matter how belligerendy you puff. In fact, the harder you puflF, the The Alligator Co., St. Louis, New York, los Angeles more air comes in. That's why it's called a Carburetor Kaywoodie. Everybody knows that a Kayv,'Oodie is the most so­ ALLIGATOR cially-conscious of pipes—gets itself ad­ mired everj-where. And the Kaywoodie Flavor is famous. But don't let us urge ^^gmcou&andi you—Shown above. No. 22. KAYWOODIE COMPANY because IT'S SURE TO RAIN! Rockefeller Center, New York and London 18 THE NOTRE DAME SCHOLASTIC it that peace and serenity it spontan­ tween halves the band opened with the eously craves. This impulse to love, to MUSIC NOTES "HELLO" formation playing the "Hike find some object proof against ultimate Song" which was followed with "An­ disillusionment, is another source of re­ chors Aweigh." Then, facing the Navy ligious knowledge. For if it is true that More than 80,000 people who saw the stands, the boys spelled out, NAVY. In the wall can love only what the mind Navy game last Saturday cheered the this position they played a concert med­ has made known to it, it is also true work of the Notre Dame Band. The ley of southern tunes. A quick change that the will can and does spur the mind older members agreed that they had placed the band in a large ND facing on to the acquisition of knowledge itself. never marched before a more enthusias­ the Notre Dame stands. During this It was Schiller who said that "The tic crowd. Each maneuver brought a change we heard, for the first time this man of his time is the man of all time. roar of applause, and Director Joe Casa- year, "The Irish Washerwoman." "The He has done his work: he has had a santa can be proud of his boys. Victory March" followed and then fac­ ing a neutral corner the boys rocked out share in the creation of things which The Navy band was not present, so it on that terrific arrangement of "Tiger last." With even greater reason may one was the duty of the Notre Dame Band Rag." This fairly brought down the say that the religion of his time is the to entertain the customers both before house. religion of all time, for God, the object the game and during the entire half- of religion, is above time, perduring time intermission. The band marched on The number one man in the band is throughout all time, even unto eternity. the field before the game forming a Graham Starr who missed the train go­ It has done and will ever do its work, huge anchor in honor of the Navy. Be­ ing down. Rather than allow the band and its work is to teach man the vir­ tues, the practical arts of living, to ele­ vate his mind and put it into intimate communion with the source of all being and of all truth. Thus it too shares in the production of all things which last, in the production of that which of all things lasts longest. Eternal Life. —Charles C. Miltner, C.S.C

NOTICE THE SCHOLASTIC regrets the inadver­ tent mistake made on page 16 of last issue. The i-eference should have read "Reverend Thomas Walsh" instead of "Reverend Matthew Walsh."

SAMl SPIRO & CO. STADIUM STAR South Bend's Most Complete When spectator sports are the order Hat Department of the day, the Stetson Tyrolean is the best hat you can wear. Rugged, yet casual lines and a graceful brim Features make this Stetson your Americans ticket to smartness at any game! Famous STETSON STETSON HATS STETSONS ARE PRICED AT $5, $7.50, $10 $5 to $7.50 THE NOTRE DAME SCHOLASTIC 19 to go on the field horribly crippled with­ ets. But added to this we now sell South out him, he chartered a plane and flew Shore Railroad tickets. to Cleveland. That, friends, is without "According to reports from the Vin- precedent. centian Service Bureau, our Notre Dame A few of the band men, including my­ Vincentians are doing excellent work on self, following Mr. Starr's example, the Red Cross Safety Drive. After the tXtS missed the return train and flew all request from the Bureau for volunteers yoor over Cleveland Saturday night. Karl in this Conference, seven fellows offered Hunn's boys rocked and rode to a large to help. They got their instructions at and appreciative audience at the AVade the Vincentian Service Bureau and went sw«<»?'*i Park Manor. Karl's treatment of the out and interested the principals of the "Victory March" was indeed sweet and Catholic schools in town and distributed low. The 100 men in the University the lists of questions concerning safety Band will leave next Thursday for New THI TiSTID INK in the home and on the farm. The school FOt IVIKY PtH York and the Army game. children will bring the lists to their —William Mooney. parents who are asked to answer the questions and have the children return them to the schools. GLASSES PROPERLY FIHED VINCENTIANS "Then there's the matter of the talks before the religion classes. Permission has been granted for us to give these 1900 Healthwin Hospital and St. Augus­ summaries of our work, and I'll ask for tine's reports having been made (see volunteers later when we have the the SCHOLASTIC, Oct. 20), President Joe schedule of class hours. Mulqueen turns to Executive Secretary DR. J. BURKE Jack Reddy in charge of" the office at "Bob Marbach and Jim White, have DR. W. G. BOGARDUS you a report from St. Joe's Hospital?" No. 23 Lyons Hall: DR. E. C BEERY Keeper of the Wardrobe Jim White "Jack, have you something you want Optometrists and Mfg. Opticians brought up now?" rf-"' '•.. ..-v-^--- "Yes, Joe. First, I want to remind rp;rr- '"rm 228 South Michisan St, you fellows that our oifice in No. 23 South Bend, Ind. Lyons continues to serve as an agency for the purchase of bus and airline tick- t- Detiiuth

/f€ (/wife t/te iniereit INA RAY HUnON and Her Playboys

^om ^ s-t^^'y^^

1?-^ „.-i.„-.^ •...-•-.».y,»*Vi..---

Headquarters for WHY WORRY? STETSON /HILL/' HATS See the new Rustic Shades . . exclusive mixtures of Autumn Leaf hues.

Vor Good HALLOWEE'N DANCE Palais Royale HAMBURGERS - PIES - CHILE October 31, 1939 Tickets on sale at Walgreen's, Clark's or 317 N. Michigan Palais Royale. ADM 216 W. Colfax 109 E. Wayne ADVANCE. 6oc AT DOOR, 80c Michigan at Washington 20 THE NOTRE DAME SCHOLASTIC most interesting that a man with great speaks for himself and Vice-President powers of imagination and an infinite Bob Marbach: RADIO amount of patience can enter. These "Bob asks me to speak for us, Jack. two qualities are the prime requisites He and a few others laid the ground­ for a sound man. The sound depart- work last year for my visits to the To the average radio listener the Children's Ward. Tve been going do\vn sound effects department is one of the Friday afternoons and reading to the least important of those engaged in We Never Read youngsters. Poor little kids are awrfuUy building a dramatic production. The fhe Ads Either! glad to see someone come in I guess clever announcer, the brilliant actor are heralded by the fans and deluged with JUST TO PROVE THAT YOU DON'T my reception equals those given 'dean' WE WILL GIVE AWAY ABSOLUTE. Mario and the Healthwin groups by the letters of praise. However, the sound UY FREE ONE OF OUR SENSA- man is working all the time behind the SATIONAL NEW AIRCLEAN PIPES men out at the Hospital!" TO EACH OF THE FIRST FIVE N. scenes, often contributing much more to D. STUDENTS WHO BRING IN Pat O'Neil is recognized and asks the success of a show than the actors, THIS AD. whether or not more fellows are needed yet he is unglorified and unsung. to make the visits to St. Joseph's Hos­ pital. With perhaps a touch of paternal The greatest actors in the world have affection for the youngsters, Jim White w^orked without benefit of scenery or any says that there are only a few of them other aid to the imagination. In radio, and that one visitor is enough. too, they could perform magnificently CORNER wathout sound which after all is the With the business of the meeting com­ scenery of radio, but how many great pleted, Mr. Reddy checks his meeting actors are there? The exceptional man SOUTH BEND, INDIANA outline, then says: in the exceptional play can consistently get along without any aids to his drama. LOUIE BRUGGNER, N. D. '23 "Ed Corey, will you take this copy But as a general rule we accept scenery of the annual report and read off a few on the stage and sound on the air as of the interesting and enlightening part and parcel of every production. We items, please?" don't stop to figure out how a certain Treasurer Ed Corey reports that 407 effect was achieved but we do realize that it took place and added a certain persons were assisted during the year, amount to the whole show. Oct. 1, 1938 to Sept. 30, 1939. Three hundred and ninety - seven visits were The field of radio sound is one of the made. These include the homes of fam­ ilies assisted, hospitals and institutions, and incidental visits made during the course of the work. Such visits include THINK OVER .. those to families and institutions and Who is America's the like. The poor in families and the poor in prisons, hospitals or other insti­ No. 1 Men's Stylist? tutions received 1,240 religious articles, magazines, newspapers, and books.

The hall bell rings 11:50 a.m., some New Yorker remarks that it's time for dinner, and the closing prayer is said. —RicJiard Leo Fallon, Jr.

Arrow—and Arrow has been for 78 years. But we've never seen smarter THIS BARGAIN shirts than Arrow has HERMAN'S tailored this year. Pat­ FOR $45.00! terns their style scouts for culled from the fashion # Free Trial Lesson capitals of the world. 9 Guaranteed Solo Course Fabrics as fine as fabrics come. Sanforized, (fabric SPORT # ^3.00 Individual Lesson shrinkage less than 1%) # Free transportation to a new shirt free if one GOODS and from the airport shrinks out of fit. Come in today and take your See your own hall representative pick. $2 up. Comlete line of or Don Marietta, 232 Alumni Shotguns, Rifles and Ammunition for the hunting season.

108 Nordi Midiigan Street INDIANA Soiidi Bend, Indiana AIR SERVICE ARROW THE NOTRE DAME SCHOLASTIC 21

ments of the larger stations especially Nov. 1 Faculty Talk 7:45 "The gain by a victorious nation in any are working all the time to develop new Nov. 2 Academy of Politics 4:15 wars is a conquered people hating the sounds and to improve the old ones. Nov. 2 Sportcast 7:30 conqueror, and continually watching^ for The rise, in recent years, of shows on Nov. 3 Periscope 4:15 an opportimity to revolt." the order of "Lights Out" as well as the Nov. 3 Little Jamboree 7:30 Ted Kmiecek will deliver the main enormous number of afternoon and —Ray Kelly paper at the next meeting, on the im­ morning serials has increased the prob­ portant embargo issue. Attention is lems of sound and has lead to an in­ called to the fact that associate mem­ creased interest in the subject. Too Academy of Politics berships are open to all juniors and many, when they speak of going into The Academy of Political Science held seniors who-are not political science ma­ radio as a profession, think only of po­ its first meeting of the year yesterday, jors, but who wish to join the academy. sitions as announcers, commentators, when a general program for the year and similar performers, forgetting that, was outlined and all committees ap­ like every other large industry, there is pointed. The club will sponsor a radio a larger number working behind the discussion of current political ideas, ev­ scene, unknown to the general public, ery Thursday at 4:15 p.m. « and contributing perhaps more than The main paper, read by Harold Bow­ those in the limelight. ler, expoimded the ideas on peace held Heads or Tails Log for October 28 by the last three "Popes of Peace." i^s always Oct. 31 Music of the Masters 7:15 War's fruitlessness is the subject of the Oct. 31 Radio Stage 9:00 following quotation from tlie speech: HeweH's OUT TODAY Cafe A new Arrow shirt Notre Dame Headquarters for with FINE FOOD Your favorite Beer, draft or bottle A new Arrow collar 211-213 N. MICHIGAN ST.

UBe Sussex $2 up Headquarters for HE Sussex type collar is the current favorite of Tstudents at Oxford and Cambridge, England, it is definitely a young man's collar, cut on a low Arrow Shirts drape template, the square points flare away from The Newest Style. Northern the tie knot and are moderately wide-spread, held Indiana's Largest Stocks. rigid by a celluloid insert which may be removed if desired. Quick to discern the style importance of this smart collar, Arrow designed the Sussex par­ ticularly for American 4jniversity men. It will strike hard on your campus . . . better get one today while they last. In white, colors, and striped patterns with French cuffs. All neck sizes and sleeve lengths. ARROW SHIRTS ADM COLLABS .. .TIES ... HANDKEBCHDEFS ... UNDEBWEJIB Michigan at Washington 22 THE NOTRE DAME SCHOLASTIC

convention which has for one of its Sunday night, the night of peace, and Engineering Notes features the National Metal Exposition. parks, and cold suppers, found Breen- Professor F. N. M. Bro^vll, head of Phillips seething with a hidden under­ the department of aeronautical engin- tow of intrigue. Seems that a certain eermg, and Dean Dugal Jackson will callow lamb backed up his loyalty to attend the Michigan-Life Conference on Frosh Show First Signs S.M.U. with a little green and silver. "New Technologies in Transportation," Of Lusty Glass Spirit Suddenly came the assertive yell of at Ann Arbor, Mich., Nov. 1-3. This right over wrong. Freshmen streamed convention is sponsored by the Univer­ The Class of 1943 after lethargic days out of indignant rooms. A queue quick­ sity of Michigan's college of engineering of indecision has finally cast irrevocable ly formed. Well, to make the story and Life magazine. dice on this matter of class spirit. Swift short ... he also swam Thus, again Glimpses into the future of transpor­ decisive ruthlessness has been declared the purge.—Sam Boyle tation and allied scientific developments against all spiritless Freshmen. Two \\ill be disclosed by university and in­ members, whose heai-ts were not yet dustrial leaders. shields of loyalty to the team, found themselves suddenly and imperatively Notre Dame's Department of Metal- lagooning in St. Joseph's lake. Thus, lurgiJ^ was represented at the national the purge! convention of the A.S.M., held in Chi­ cago this week Monday thi-ough Satur­ (What well-known Zahmite was seen day. On Thursday, Dean Jackson, Pro­ recently slinking toward the Badin fessors Shilts and McLellan and Messrs. Cleaners with a suspiciously damp suit Ferguson and Sheppard attended this over his arm? Tsk. Tsk.)

New line of Pennants, Triangles SAVE and Banners

WITH US! 4x9 — 9 X 24 Painted 9x24 — 15x36 Sewed 12 X 24 — 12 X 30 Banner 13 X 36 New Flag Design HOURLY 30 X 24 X 36 Triangle SERVICE SHIRTS LAUNDERED Six Convenient 2 for 25c Chicago Stations

SUITS DRY CLEANED • Make your plans hours or days ahead of time. A Only 65c South Shore train is ready whenever you are. From South Bend, hourly service 6 A. M. to Midnight . . . Out of Chicago, service LAP ROBES till 2:30 A. M. For de­ tailed information call Quality — Service — Economy 100 percent wool, waterproof and SPEED! Size 50 X 70 $4.75 C W. VEACH HOUR LAUNDRY City Passenger Agent 4 Colfax near Mtun N. D. BOOKSTORE Ticket Office 301 N. Michigan Sf. Phone 3-31II Sirofe for Health ... ond En/oymenf... PLAYLAND ROLLER RINK CHKMGO MUTH SfKMIk (Melody Gardens Ballroom) « aavm •BID RAILKOAO TWO SKATING FLOORS — ONE FOR BEGINNERS Every Ni^t Except Monday — Matinee Sunday and Thursday S0U[H,S|ORf Sf tf denfS of WOyS 25c "A Good Way to Make Money for Your THE NOTRE DAME SCHOLASTIC 23

PROFESSIONAL CARDS OUR DAILY BREAD Visif Micfcfono's LITURGY Most Compfefe The word mystical, akin to mystery, Record Deporf menf became current in the thirteenth century to describe the Church as the Body of at Christ. From earliest Christian times it was used of the sacraments and espe­ cially of the Mass as the "Mystical Ob­ RODIN'S lation." It distinguishes the Church as the Body of Christ from His natural, physical body glorified in heaven and 3)r, 0. J. Cjrunoif His Body contained substantially in the Registered Podiatrist—Foot Ailments Eucharist. AXbum of Lily Pons 434 Associates - South Bend Mystical Body, then, expresses the M599 $6^ Office Phone 3-2574 spiritual, corporate relationship that ex­ La Capinera (The Wren) Julius Benedict ists between the member and the person Green {from Debussy's "Ariettes of Christ, the head. This inward and Oubliees") spiritual nature of the kingdom of God Mandaline—^Debussy A Des Oiseaux—George Hue is the essence of the Gospels. Une Tabatiere A Musique—Liadow DR. H. R. FRASER The feasts of the coming week bring Comment Disaient-ils ? (Victor Huso— REGISTERED PODIATRIST us concrete experience of this doctrine. Franz Liszt) They renew the thought of Pius XI that Les Koses D'Ispahan—Gabriel Faure SHERLAND BUILDING participation in the solemn celebration Les Filles de Cadix—^Leo Delibes PHONE 4-8989 SOUTH BEND, INDIANA Le Beau Danube Bleu—Strauss of the sacred mysteries is the most Villanelle—Eve dell'Acqua fruitful source of relig^ious instruction: Lily Pons, soprano, with orches­ B isiiiiiiiiiiiaiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii El Sunday, of Christ the King, who by sole tra conducted by Ande Kostelan- right rules over the minds and hearts etz. Flute obligato by Frances OFFICE 4-5661 RES. 3-4080 Blaisdell. Piano accompaniment of men; Wednesday, of All Saints, the by Frank La Forge. unnumbered multitude that stands be­ 3 ten-inch Discs J)r. JL. £/. J^ucas fore the throne of the Lamb; Thursday, 1 twelve-inch disc DENTISTRY — X-RAYS of All Souls, the members of the Mys­ 36234—"The Rhinegold — Entrance of the 702 J. M.S. BLDG. SOUTH BEND tical Body who are yet in bonds. Gods into Valhalla and the Kainbow Qniniiiinitlil •••••••••••••I •••••• imiiniiniimipl Bridge" — Wagner. Victory S3rmphony Orchestra. Parts 1 and 2, Scene 4. Mass Calendar: Oct. 29-Nov. 4 Sunday, 29—Twenty-second after Pen­ CDrs. [ProDsl and Sin^Ler tecost. Feast of Christ the King. 2d Hits of fhe Week prayer, of the Sunday. Last Gospel of DENTISTS the Sunday. South of the Border Victor 26373—Kenny Baker 405 Associates - South Bend Victor 26337—Sammy K^ Monday, 30—Ferial Day. Mass of the Bluebird B-10376—Shep Fields Phone 3-1254 preceding Sunday, No Gloria. 2d prayer, gacacagacacacagacacacacacacacacacacaearjrjcacacacacaeac: of the Saints (A cunctis). 3d, Against Scatterbrain Victor 26387—Sammy Kay i^R«B-ai ^_M—•i«^Mi^—M^—•i^'M Persecutors and Evil Doers. Bluebird B-10436—Freddie Martin I •~T Tuesday, 5i—Vigil of All Saints. SOUTH BEND HERE AND NOW HE HAVE — JACK X-RAY LABORATORY (Fast Day). Mass proper. No Gloria. LEONARD VOCALIZING with TOMMY 2d prayer, of the Holy Ghost. 3d for the DORSET recording "So Many Times"— 825 SHERLAND BUILDING other side, "Baby What Else Can I Do?." Church or the Pope. 4th Against Perse­ with ANITA BOYER singing. Victor re­ I cording No. 26386. i L. E. FISHER, M. J. THORNTON, i cutors and Evil Doers. I M.O. M.D. I Wednesday, Nov. 1—F east of All FREE! with every Record Saints. Mass proper. Credo Common Purchase resardiess of Preface. size —RECORD BRUSH. Thursday, 2—Commemoration of All CDrs. JCose ana Jvose the Faithful Departed. Three masses as DENTISTS in Missal, first place. Sequence: Dies Irae. 430 SHERLAND BUILDING 6ListenmgBooths,ElectncMachimes TELEPHONE 3-4269 Friday, 3—Day within the Ortave. Mass of the Feast. 2d prayer, of the Complete stock of Accessories Holy Ghost. 3d, for the Church or the Well-informed Clerks Pope. 4th, Against Persecutors and Evil Doers. Votive or Requiem. -^ Saturday, U—St. Charles. Bishop. Con­ RODIN'S fessor. Mass: Statuit (in Common). 2d 132 N. Michigan Phone 4-1184 ORTHODONTIST prayer, of the Octave. 3d, Sts. Vital and Open Tuesday, Thursday and Satordar Companions, Martyrs. 4th, Against Per­ evenings until 9 p. m. ASSOCIATES Bl-Oe.. SOUTH BEND secutors and Evil Doers. XR. PAUL BIRMEt UBRART, NOTHE HUME, IND* ^^^^Keal IVlild ness

CHESTERFIELD'S RIGHT COMBINATION of the world's best cigarette tobaccos You'll enjoy every Chesterfield you smoke because you'll find them cooler, you'll

.<<^^ like the taste, and Chesterfields are definitely milder. There's a big preference for the cigarette that really satisfies. Chesterfield's RIGHT COMBINATION of the world's best cigarette tobaccos is the perfect blend to give you more smoking pleasure. Make your next pack Chesterfield.. .you can *t buy a better cigarette.

Copyt^ht 1939. LIGGETT & MYEKS TOBACCO CO