UC San Diego UC San Diego Electronic Theses and Dissertations

Title Use of retroviral peptide libraries for the identification of novel cellular targets of HIV-1 and the discovery of novel inhibitors

Permalink https://escholarship.org/uc/item/60q2v5fq

Authors Stotland, Aleksandr Borisovich Stotland, Aleksandr Borisovich

Publication Date 2012

Peer reviewed|Thesis/dissertation

eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO SAN DIEGO STATE UNIVERSITY

Use of Retroviral Peptide Libraries for the Identification of Novel Cellular Targets of HIV-1 and the Discovery of Novel Inhibitors

A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy

in

Biology

by

Aleksandr Borisovich Stotland

Committee in charge:

University of California, San Diego

Professor Michael David Professor Deborah H. Spector Professor Celsa A. Spina

San Diego State University

Professor Roland Wolkowicz, Chair Professor Ralph Feuer Professor Christopher C. Glembotski

2012

Copyright © 2012

by

Aleksandr Borisovich Stotland

All Rights Reserved

The Dissertation of Aleksandr Borisovich Stotland is approved, and it is acceptable in quality and form for publication on microfilm and electronically:

______

______

______

______

______

______Chair

University Of California, San Diego

San Diego State University

2012

iii

DEDICATION

I would like to dedicate this thesis to all of my family, friends and lab mates without whose support none of my work would be possible.

iv

TABLE OF CONTENTS Signature Page……………………………………………………………………………iii

Dedication………………………………………………………………………………...iv

Table of Contents………………………………………………………………………….v

List of Figures……………………………………………………………………………vii

List of Tables……………………………………………………………………………...x

Acknowledgements……………………………………………………………………….xi

Vita………………………………………………………………………………………xii

Abstract………………………………………………………………………………….xiv

Introduction to Dissertation……………………………………………………………….1

References…………………………………………………………………………6

Chapter I: Purification of the COP9 Signalosome Complex and Binding Partners from

Human T-cells in the presence of HIV-1 Proteins ……………………………………...... 9

Introduction………………………………………………………………………10

Materials and Methods…………………………………………………………...14

Results…………………………………………………………...... 18

Discussion………………………………………………………………………..28

References………………………………………………………………………..33

Appendix…………………………………………………………………………38

Chapter II: Development of Random Retroviral Nuclear-Targeted Peptide Libraries as

Tools for Discovery of Novel HIV-1 Inhibitors…………………………………………59

Introduction………………………………………………………………………60

Materials and Methods…………………………………………………………...62 v

Results…………………………………………………………...... 68

Discussion………………………………………………………………………..81

References………………………………………………………………………..84

Chapter III: Further Applications of Retroviral Peptide Libraries for Targeting HIV-1

Gag-Pol and Envelope Processing……………………………………………………….87

Introduction………………………………………………………………………88

Materials and Methods…………………………………………………………...91

Results…………………………………………………………...... 94

Discussion………………………………………………………………………102

References………………………………………………………………………105

vi

LIST OF FIGURES

Figure 1-1: Establishment of an SBP-CSN1 expressing cell line. (A) Representation of pBMN.SBP-CSN1.i.mCherry, the pBMN.i.mCherry retroviral vector harboring the SBP sequence fused to the N′ terminus of CSN subunit 1. (B) Retroviral particles produced from pBMN.SBP-CSN1.i.mCherry were used to infect naive SupT1 cells. ……………19

Figure 1-2: Schematic representation of the SBP-based pulldown technique for the purification of the CSN and binding partners. ………………………………………….20

Figure 1-3: Purification of the CSN from T cells. (A) Coomassie stain of the eluted fractions isolated from SBP-Citrine control and SBP-CSN1 cell line lysates. (B) Confirmation by Western blots (B) and LC-MS (Scaffold3 Software) (C) of the presence of all subunits of the CSN in the eluted fractions from the SBP-CSN1 lysate…………..20

Figure 1-4: Western blot analysis of SBP-Citrine and SBP-CSN1 cell lysates to confirm CSN binding partners. (A) Cell line eluates were probed with anti-Nedd8 antibody to show the interaction of the CSN with neddylated proteins (three arrows) in the SBP- CSN1 lysate but not in the SBP-Citrine control. Anti-Cullin 4A ……………………..25

Figure 1-5: 14-3-3 interacts with the subunits of the CSN in the presence of HIV-1 proteins. Scaffold3 readout of the LC-MS data demonstrating the presence of the 14-3-3 Zeta/Delta in the SBP-CSN1 eluate from pCMV ΔR8.2 cell lysate (A). Western blot of a pulldown experiment with lysates transfected with pCMV ΔR8.2 and 3XFLAG-Vpr probed with pan 14-3-3 antibody (B)…………………………………………………..27

Figure 2-1: Schematic representation of scaffolds used in library construction………...69

Figure 2-2: Expression of scaffold constructs (A) Fluorescent micrographs of 293T cells transiently transfected with the GNF scaffold and SupT1 cells infected with MLV produced with the GNF as the transfer vector. (B) Coomassie stain of the eluted fraction of a pulldown from 293T cells transfected with SBP-GNF……………………………70

Figure 2-3: Analysis of library complexity and ligation efficiency (A) Restriction digest analysis (BamHI and XhoI) of the bacterial colonies produced by the ligation of the 3XF(GGS)3Blast library. (B, C, D) Peptide sequences produced as a result of the 3XF(GGS)3Blast ligation, GNF ligation and SBP-GNF ligation………………………72

Figure 2-4: Sub-cellular localization of the 3XF(GGS)3 NLS RPL and 3XFmCherry NLS RPL (A) Immunofluorecent staining for FLAG expression of 293T cells transfected with either the 3XF(GGS)3Blast scaffold or the 3XF(GGS)3 NLS RPL. (B)…………………74

vii

Figure 2-5: Establishment of NLS RPL-expressing SupT1 cells. (A) The retroviral library is transfected along with the VSVg envelope into Phoenix-GP cells, for the production of (B) non-replicative MLV virions carrying the peptide sequences, which are used to infect (C) naïve SupT1 cells…………………………………………………………………….76

Figure 2-6: Screening of the 3XF(GGS)3 NLS RPL library for inhibitors of HIV-1 Graphical representation of the screening process (A). Infection rates of mCherry and 3XF(GGS)3 NLS RPL SupT1 cells after the second round of screening (B) compared to infection rates after the twelfth round of screening (C)………………………………….77

Figure 2-7: Screening of clonal populations derived from the 3XF(GGS)3 NLS RPL library. Infection of selected clones with sinHIV-GFP (A) compared to infection with sinMLV-GFP (B)………………………………………………………………………...78

Figure 2-8: Recovery and Identification of Sequences from the 3XF(GGS)3 clones Amplification of the clone sequences from genomic PCR of 3XF(GGS)3 clones 2 and 6 (A) Full peptide sequences rescued by genomic PCR from Clones 2, 6, and 8 (B)……..79

Figure 3-1: Schematic Overview of the T-cell-based PR Assay. The assay is based on a conditional (Tet-On) expression of the Gal4 transcription factor driving the expression of GFP from the UAS promoter (A, B). The autocatalytic activity of PR, inserted between the DBD and TAD domains inhibits GFP expression…………………………………...95

Figure 3-2: Expression of GFP in Assay Cells SupT1 cells expressing either Gal4 (A), Gal4 in fusion with a mutant PR (B), or Gal4 in fusion with wild-type PR (C) activated with 1 µg/ml of Dox in the absence or presence of 10 µM Indinavir (IDV)…………….95

Figure 3-3: Random Cytosolic Retroviral Peptide Library The library scaffold in the context of the MoMLV retroviral transfer vector pmGIB MG*XhoI (Nolan Lab, Stanford, CA) (A) and the detailed DNA sequence of the SKVILFE dimerization scaffold (B)………………………………………………………………………………………..96

Figure 3-4: Assay Cells Transduced with the RPL Flow cytometry profiles of SupT1 cells expressing the PR assay transduced at an MOI of 1 with the RPL virions and activated with 1 µg/ml Dox (A). Clonal cell populations 5 and 6 expanded from the screen and activated with Dox (Forward Scatter Area on the X-axis, FITC on the Y-axis) (B)…….97

Figure 3-5: Clonal Populations Isolated from The Screen Flow cytometry profiles of the 18 clonal cell lines established from the screen (Forward Scatter Area on the X-axis, FITC on the Y-axis)………………………………………………………………….…..98

Figure 3-6: Amplification of the Peptide Sequence from the Genomic DNA of Selected Clones Peptide sequences amplified by PCR from the genomic DNA of Clones 1, 10, 11, and 12 recovered by the screen…………………………………………………………..99

viii

Figure 3-7: Random peptide library targeted to the ER (A) Schematic representation of the retroviral scaffold for ER localization. (B) Design of the RPL insert oligo. (C) Confocal microgarphs of 293T cells transfected with the ER scaffold and stained for FLAG-FITC and ER resident protein GRP 78 to confirm ER localization…………….101

ix

LIST OF TABLES

Table 1-1: Peptides of the CSN Subunits Identified by LC-MS…………………………21

Table 1-2: Peptides of Proteins Binding to the CSN Identified by LC-MS……………...24

Table 1-3: Putative CSN-Interacting Proteins Identified With an 80% or Greater Probability………………………………………………………………………………..38

Table 1-4: All Putative CSN-Interacting Proteins Identified by LC-MS………………..42

Table 2-1: Possible amino acid residues created by the NLS-RPL oligo polymerization…………………………………………………………………………...71

Table 2-2: Summary of the constructed NLS-RPL libraries…………………………….75

Table 2-3: Sequences with significant alignments as determined by Protein BLAST®…80

x

ACKNOWLEDGEMENTS

I would like to acknowledge my advisor, Dr. Roland Wolkowicz, for his guidance and support during my doctoral studies.

Chapter 1 has been published in part as Stotland A, Pruitt L, Webster P,

Wolkowicz R. Purification of the COP9 Signalosome complex and binding partners from human T-cells. OMICS. 2012 Mar 13. The dissertation author was the primary author of this material.

Chapter 2 is being prepared for publication as Stotland A, Torres J, Wolkowicz R.

Development of Random Retroviral Nuclear-Targeted Peptide Libraries as Tools for

Discovery of Novel HIV-1 Inhibitors. The dissertation author is the primary author of this material.

Chapter 3 figures 3-1 and 3-2 have been previously published in Hilton BJ,

Wolkowicz R. An assay to monitor HIV-1 protease activity for the identification of novel inhibitors in T-cells. PLoS One. 2010 Jun 3;5(6):e10940. Reproduced by kind permission of the authors, Brett Hilton and Dr. Roland Wolkowicz.

xi

VITA

Education Bachelor’s of Science, General Biology (2003) Department of Biology, University of California, San Diego, CA Doctor of Philosophy, Biology (2012) Department of Biology, San Diego State University, San Diego, CA Department of Biology, University of California, San Diego, CA Advisor: Dr. Roland Wolkowicz, Ph.D. Experience Research Assistant (2002-2006) The Scripps Research Institute, La Jolla, CA Supervisor: Dr. Nora Sarvetnick, Ph.D., Professor Awards and Honors 2008-2012 Achievement Rewards for College Scientists (ARCS) Scholar, SDSU

Publications 1. Stotland A, Torres, J, Wolkowicz R. Development of Random Retroviral Nuclear- Targeted Peptide Libraries as Tools for Discovery of Novel HIV-1 Inhibitors. 2012 In preparation

2: Stotland A, Pruitt L, Webster P, Wolkowicz R. Purification of the COP9 Signalosome complex and binding partners from human T-cells. OMICS. 2012 Mar 13.

3. Zhang YQ, Sterling L, Stotland A, Hua H, Kritzik M, Sarvetnick N. Nodal and lefty signaling regulates the growth of pancreatic cells. Dev Dyn. 2008 May;237(5):1255-67.

4: Hill NJ, Stotland A, Solomon M, Secrest P, Getzoff E, Sarvetnick N. Resistance of the target islet tissue to autoimmune destruction contributes to genetic susceptibility in Type 1 diabetes. Biol Direct. 2007 Jan 25;2:5.

5: Hill NJ, Stotland AB, Sarvetnick NE. Distinct regulation of autoreactive CD4 T cell expansion by interleukin-4 under conditions of lymphopenia. J Leukoc Biol. 2007 Mar;81(3):757-65. Epub 2006 Dec 12.

xii

6: Kayali AG, Stotland A, Gunst KV, Kritzik M, Liu G, Dabernat S, Zhang YQ, Wu W, Sarvetnick N. Growth factor-induced signaling of the pancreatic epithelium. J Endocrinol. 2005 Apr;185(1):45-56.

7: Flodström-Tullberg M, Hultcrantz M, Stotland A, Maday A, Tsai D, Fine C, Williams B, Silverman R, Sarvetnick N. RNase L and double-stranded RNA-dependent protein kinase exert complementary roles in islet cell defense during coxsackievirus infection. J Immunol. 2005 Feb 1;174(3):1171-7.

8: Kayali AG, Van Gunst K, Campbell IL, Stotland A, Kritzik M, Liu G, Flodström-Tullberg M, Zhang YQ, Sarvetnick N. The stromal cell-derived factor- 1alpha/CXCR4 ligand-receptor axis is critical for progenitor survival and migration in the pancreas. J Cell Biol. 2003 Nov 24;163(4):859-69.

9: Flodström-Tullberg M, Yadav D, Hägerkvist R, Tsai D, Secrest P, Stotland A, Sarvetnick N. Target cell expression of suppressor of cytokine signaling-1 prevents diabetes in the NOD mouse. Diabetes. 2003 Nov;52(11):2696-700.

xiii

ABSTRACT OF THE DISSERTATION Use of Retroviral Peptide Libraries for the Identification of Novel Cellular Targets of HIV-1 and the Discovery of Novel Inhibitors

by

Aleksandr Borisovich Stotland

University of California, San Diego, 2012 San Diego State University, 2012

Professor Roland Wolkowicz, Chair

Great strides have been made toward understanding and fighting the Human

Immunodeficiency Virus-1 in the thirty years since its discovery (HIV-1). Unfortunately, a true cure remains elusive due to the fact that all of the current pharmaceutical approaches are rendered ineffective by HIV’s rapid mutation rate. Furthermore these drugs have severe side effects and, while effective at delaying the onset of Acquired

Immunodeficiency Syndrome (AIDS) and extending the lifespan of the infected individuals, are very expensive and ultimately fail to stop the virus. Researchers may

xiv

spend years using rational design approaches to model a drug that would block the active site of an HIV enzyme, to realize the virus develops resistance within several months of treatment. It is therefore imperative to develop novel approaches to finding direct and indirect means of blocking infection.

This dissertation describes the adaptation of retroviral technology in order to discover novel peptide inhibitors of HIV-1 or HIV-1-interacting proteins. It describes the development of high-complexity libraries of random peptides, targeted to specific cellular compartments. The aim of these libraries is to block HIV-1 during various discrete steps in its lifecycle: specifically post-entry, pre-integration early events in the cytoplasm or nucleus, and late events such as processing of the viral polypeptide by its Protease enzyme. It also describes the discovery of a potential new binding partner: the COP9

Signalosome complex. The COP9 Signalosome complex, identified through a screen utilizing one of the libraries, could become a potential new target for HIV-1 inhibition.

The complex as well as the interacting 14-3-3 Zeta/Delta protein, which was shown to bind only in the presence of HIV-1 proteins, was purified via a novel approach that allows for a rapid, efficient and specific isolation of large protein complexes and their binding partners.

xv

INTRODUCTION TO DISSERTATION

Thirty years after being isolated by Robert Gallo and Luc Montagnier, great strides have been made toward understanding and treating the Human Immunodeficiency

Virus (HIV-1). Unfortunately, while the infection rate has largely declined in the United

States and Europe, and has stabilized in Africa, it is spreading rapidly throughout many developing countries, especially in Eastern Europe and Asia. Furthermore, although the rates of new infections have stabilized in sub-Saharan Africa, as of 2010, there are 22.9 million adults and children are living with HIV/AIDS, emphasizing the need to continue the fight against the virus [1].

The cure remains frustratingly elusive due to the fact that all of the current pharmaceutical approaches are rendered ineffective over the long term by HIV’s rapid mutation rate [2]. Further, these drugs have severe side effects; and while effective at delaying the onset of AIDS, are very expensive and ultimately futile, with the virus developing resistance within several months of treatment. Other approaches such as fusion inhibitors, adenoviral vaccines or neutralizing antibodies, while initially encouraging, have so far been unable to live up to their potential in clinical trials [3–5].

It is therefore essential to attack the virus from another angle, by targeting direct or indirect host-virus interactions.

HIV-1 Virus

HIV-1 belongs to the Lentivirus genus of the Retroviridae family of viruses, classified by having a single-stranded RNA genome and reverse transcriptase. The virus

1

2 enters the body through unprotected sexual intercourse or transfer of blood (such as intravenous drug use or blood transfusion). HIV-1 preferentially targets the cells of the immune system, CD4+ T cells, macrophages, and dendritic cells. It gains entry into the cell through the interaction of its gp120/gp41 Env protein with the cellular CD4 receptor and the co-receptors CXCR4 or CCR5 [6, 7]. The virus then fuses with the cell, releasing the capsid that contains two copies of the RNA genome and the proteins Nucleocapsid

(NC), Reverse Transcriptase (RT), Vpr, and Matrix (MA) [8]. The Capsid un-coats in the cytoplasm, releasing the RNA molecules which are reverse transcribed into DNA by RT

[9]. Viral DNA then forms a pre-integration complex (PIC) with Integrase (IN), NC, and

MA, which enters the nucleus [10]. Integrase then inserts the viral genome into the host genome, and new viral RNA (vRNA) is made by the host cell machinery [11]. The RNA is translated into a polyprotein that is then cleaved into Gag, Pol, and Env proteins by the viral protease (PR) and these are further cleaved into functional viral proteins such as

Capsid (CA), Vpr, Nef, Vif, Tat, Rev, and others [12]. The proteins assemble near the membrane, and the vRNA is packaged into the Capsid along with the other viral proteins, after which the mature virions bud out of the cell to continue the infection [13].

Viral-Host Protein Interactions

In order to successfully establish infection, the virus must engage the host cell machinery upon entry and override or subvert a number of important cellular processes at every step of its lifecycle. For example, to evade innate cellular immunity, the Vif protein suppresses the expression of cellular protein APOBEC3G. In the absence of Vif, this protein is incorporated into the new virions and hypermutates the viral cDNA coding strand in newly infected cells through its actions as a cytidine deaminase, causing G-to-A

3 mutations. Vif appears to act in concert with cellular proteasomal machinery to create a scaffold for the E3 ligase to ubiquitinate APOBEC3G protein and target it for degradation [14].

Another biological process that is hijacked during infection is the cell cycle, through the actions of the accessory protein Vpr. When the cell senses DNA damage, it initiates cell cycle arrest at the G2/M checkpoint, a process mediated by the ATR kinase that phosphorylates a number of targets including p53, BRCA1, Chk1 and other proteins. Vpr appears to induce this arrest through interactions with a cellular protein DCAF-1, which is a part of Cullin4-E3 ligase complex, and together might be responsible for targeting as yet unknown cellular targets for degradation [15, 16]. One reason for this interaction could be the fact that the LTR of HIV-1 is highly active promoter during the G2 arrest, allowing for a large number of vRNA transcripts to be made [17]. It is also possible that during the G2/M arrest, 5’ capped mRNA-dependent translation that is the feature of most cellular protein translation is greatly diminished. This attenuation confers an advantage to the HIV-1 RNA transcripts, which appear to contain an internal ribosome entry site (IRES)-like element in the 5’ leader sequence and can hijack the ribosomal machinery to produce large amounts of viral proteins while cellular protein translation is attenuated [15, 18].

Another biologically important process appropriated upon HIV-1 infection is apoptosis. Although the function of this interaction is unclear, studies have shown that cells infected with HIV-1 undergo apoptosis that is caused by internal stress rather than

Fas ligand mediated caspase cascades [19]. Furthermore, Vpr has been implicated as the factor that causes apoptosis in these cells as it is responsible for the G2/M cell cycle

4 arrest which often leads to apoptosis in normal cells [20]. Much controversy surrounds the subject of Vpr-induced apoptosis, both in its pathway and its purpose. A set of studies has demonstrated that rather than activating apoptosis by causing G2/M arrest,

Vpr can bind directly to the adenine nucleotide transporter (ANT) on the mitochondrial membrane and trigger cytochrome c release initiating apoptosis [15, 21]. A possible explanation may be that activated CD4+ T-cells are highly sensitive to cell cycle arrest, and apoptosis is induced simply though stress induced by the virus, while non-dividing cells that are infected by HIV are forced to undergo apoptosis by the Vpr binding to the

ANT [15].

HIV-1 Inhibitors

As of 2012, FDA has approved 34 treatments for HIV-1 infection [22]. Those treatments are often administered as a cocktail of drugs consisting of nucleoside (NRTIs) and non-nucleoside reverse transcriptase inhibitors (NNRTIs), as well as Protease inhibitors (PIs), fusion inhibitors (FIs), and most recently, an Integrase inhibitor. While these drugs have helped to greatly extend the lifespan of infected individuals, they are ultimately rendered ineffective by the extremely high mutation and replication rates of

HIV-1 (1010 virions produced per day in an infected individual) [23]. Furthermore, by directly targeting the viral proteins, evolutionary pressure is applied on the virus, which further enhances or leads to the development of resistance, often as early as initial trial stages of new drugs [24]. In addition, the latest development in treating HIV-1,

“prevention as treatment,” where the HIV-1-negative partners of HIV-1 infected individuals are administered antiretroviral drugs as prophylaxis remains highly controversial and is not likely to be the “silver bullet” to cure HIV-1 [25]. It is therefore

5 imperative to not only search for novel compounds and peptides that target viral proteins, but also those that may indirectly target HIV-1 by interfering with the cellular proteins necessary for a successful establishment of infection.

Chapter 1 describes a novel way to purify the COP9 Signalosome (CSN) and its binding proteins from T-cells. The CSN is a cellular complex that may be used by HIV-1

Vpr in order to establish a favorable cellular milieu for viral infection. The novel interaction between the CSN and 14-3-3 Zeta/Delta protein in the presence of HIV-1 proteins is also described.

Chapter 2 describes the design and development of a complex, random, nuclear- targeted retroviral library for the purpose of discovering novel HIV-1 Integrase inhibitors.

The chapter also describes the screening of library-expressing populations, isolations of resistant clones, and potential new peptide inhibitors of HIV-1 Integrase.

Chapter 3 describes the use of a complex, random, cytoplasm-targeted retroviral library in conjunction with a T-cell-based assay for the monitoring of HIV-1 Protease activity for the purpose of discovering novel Protease inhibitors, as well as presenting several candidate peptides that may block HIV-1 protease.

6

REFERENCES

[1] Worldwide HIV & AIDS Statistics, AVERT. (n.d.).

[2] L.M. Mansky, H.M. Temin, Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase, J. Virol. 69 (1995) 5087–5094.

[3] W. Pang, S.-C. Tam, Y.-T. Zheng, Current peptide HIV type-1 fusion inhibitors, Antivir. Chem. Chemother. 20 (2009) 1–18.

[4] J. Bradac, C.W. Dieffenbach, HIV vaccine development: Lessons from the past, informing the future, IDrugs. 12 (2009) 435–439.

[5] L.M. Walker, S.K. Phogat, P.-Y. Chan-Hui, D. Wagner, P. Phung, J.L. Goss, et al., Broad and Potent Neutralizing Antibodies from an African Donor Reveal a New HIV-1 Vaccine Target, Science. (2009).

[6] Edward A. Berger, Philip M. Murphy, Joshua M. Farber, Chemokine Receptors As Hiv-1 Coreceptors: Roles in Viral Entry, Tropism, and Disease, (2003).

[7] R.W. Doms, Beyond Receptor Expression: The Influence of Receptor Conformation, Density, and Affinity in HIV-1 Infection, Virology. 276 (2000) 229– 237.

[8] D.J. Dismuke, C. Aiken, Evidence for a Functional Link between Uncoating of the Human Immunodeficiency Virus Type 1 Core and Nuclear Import of the Viral Preintegration Complex, J. Virol. 80 (2006) 3712–3720.

[9] S.G. Sarafianos, B. Marchand, K. Das, D.M. Himmel, M.A. Parniak, S.H. Hughes, et al., Structure and Function of HIV-1 Reverse Transcriptase: Molecular Mechanisms of Polymerization and Inhibition, Journal of Molecular Biology. 385 (2009) 693–713.

[10] M.I. Bukrinsky, N. Sharova, T.L. McDonald, T. Pushkarskaya, W.G. Tarpley, M. Stevenson, Association of integrase, matrix, and reverse transcriptase antigens of human immunodeficiency virus type 1 with viral nucleic acids following acute infection, Proceedings of the National Academy of Sciences of the United States of America. 90 (1993) 6125–6129.

[11] P.O. Brown, B. Bowerman, H.E. Varmus, J.M. Bishop, Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein, Proceedings of the National Academy of Sciences of the United States of America. 86 (1989) 2525–2529.

7

[12] B.K. Ganser-Pornillos, M. Yeager, W.I. Sundquist, The structural biology of HIV assembly, Current Opinion in Structural Biology. 18 (2008) 203–217.

[13] P.D. Bieniasz, The Cell Biology of HIV-1 Virion Genesis, Cell Host & Microbe. 5 (2009) 550–558.

[14] B. Romani, S. Engelbrecht, R. Glashoff, Antiviral roles of APOBEC proteins against HIV-1 and suppression by Vif, Archives of Virology. (n.d.).

[15] J.L. Andersen, E. Le Rouzic, V. Planelles, HIV-1 Vpr: Mechanisms of G2 arrest and apoptosis, Experimental and Molecular Pathology. 85 (2008) 2–10.

[16] E. Le Rouzic, N. Belaïdouni, E. Estrabaud, M. Morel, J.-C. Rain, C. Transy, et al., HIV1 Vpr arrests the cell cycle by recruiting DCAF1/VprBP, a receptor of the Cul4- DDB1 ubiquitin ligase, Cell Cycle. 6 (2007) 182–188.

[17] W.C. Goh, M.E. Rogel, C.M. Kinsey, S.F. Michael, P.N. Fultz, M.A. Nowak, et al., HIV-1 Vpr increases viral expression by manipulation of the cell cycle: A mechanism for selection of Vpr in vivo, Nat Med. 4 (1998) 65–71.

[18] A. Brasey, M. Lopez-Lastra, T. Ohlmann, N. Beerens, B. Berkhout, J.-L. Darlix, et al., The Leader of Human Immunodeficiency Virus Type 1 Genomic RNA Harbors an Internal Ribosome Entry Segment That Is Active during the G2/M Phase of the Cell Cycle, J. Virol. 77 (2003) 3939–3949.

[19] HIV-1 Vpr Induces Apoptosis through Caspase 9 in T Cells and Peripheral Blood Mononuclear Cells, (2002).

[20] J.L. Andersen, J.L. DeHart, E.S. Zimmerman, O. Ardon, B. Kim, G. Jacquot, et al., HIV-1 Vpr-Induced Apoptosis Is Cell Cycle Dependent and Requires Bax but Not ANT, PLoS Pathog. 2 (2006) e127.

[21] E. Jacotot, L. Ravagnan, M. Loeffler, K.F. Ferri, H.L.A. Vieira, N. Zamzami, et al., The HIV-1 Viral Protein R Induces Apoptosis via a Direct Effect on the Mitochondrial Permeability Transition Pore, J. Exp. Med. 191 (2000) 33–46.

[22] AIDSinfo | Information on HIV/AIDS Treatment, Prevention and Research, AIDSinfo. (n.d.).

[23] K.J. Williams, L.A. Loeb, Retroviral reverse transcriptases: error frequencies and mutagenesis, Curr. Top. Microbiol. Immunol. 176 (1992) 165–180.

[24] M. Desai, G. Iyer, R.K. Dikshit, Antiretroviral drugs: Critical issues and recent advances, Indian J Pharmacol. 44 (2012) 288–298.

8

[25] M. Rayment, Prevention of HIV-1 infection with early antiretroviral therapy, J Fam Plann Reprod Health Care. 38 (2012) 193–193.

CHAPTER I Purification of the COP9 Signalosome Complex and Binding Partners from Human T-

cells in the presence of HIV-1 Proteins

9

10

INTRODUCTION

Most of the cellular processes affected by HIV-1, as described in the introduction of the dissertation, require both direct and indirect interaction between viral proteins and a multitude of host proteins. Many of these interactions are absolutely critical to the successful establishment of infection. These interactions, therefore, present an attractive target for therapy, specifically because they do not apply direct evolutionary pressure on the virus itself. A great tool for finding moieties that block these interactions is a random peptide library screen [1]. Utilizing one such screen, Dr. Wolkowicz and colleagues were able to isolate a short peptide that appeared to efficiently block HIV-1 infection in T-cells

(Data Unpublished). When the peptide was analyzed for binding partners via GST-fusion column pulldown, two major binding partners were identified; Casein kinase 2 (CK2) and the COP9 Signalosome Subunit 3 (CSN3).

COP9 Signalosome Structure and Known Functions

The COP9 Signalosome (CSN) is an eight-subunit complex originally discovered in

Arabidopsis thaliana whose main function was determined to be the control of light- regulated genes in plant development [2]. The complex is highly conserved in all living organisms and its subunits share homology with the 26S Proteasome and the translation initiation factor 3 (eIF3), with which they can form mini-complexes of currently unknown function [3–5]. The CSN has several important roles in the eukaryotic cell, the best understood and studied of which is protein degradation via control of the de- neddylation of cullins [6]. Briefly, when a protein is targeted for degradation by the proteasomal machinery, it is marked for destruction by the addition of ubiquitin molecules by SCF ligase complexes. The complex consists of a cullin protein CUL1, a

11

RING-finger protein Rbx1, Skp1, and an F-box protein that recruits the target and confers specificity to the scaffold [7]. The activity of the SCF complex is modulated by the level of neddylation of the CUL1 protein under the CSN control. CSN removes the Nedd8 molecules from CUL1 through the metalloprotease activity of subunit 5 (CSN5), resulting in the dissociation of the Skp1/Skp2 complex from the SCF. The result of this dissociation is the binding of the TBP-interacting protein p120 (CAND1) to de- neddylated CUL1, preventing the binding and ubiquitination of substrates by the SCF complex [8–10]. The ability of the CSN to negatively regulate the ubiquitin-dependent proteasomal machinery is used by the cell to regulate the levels of cell-cycle proteins such as CDK inhibitor p27kip1, NF-κB inhibitor IκB, and HIF-1α [11–13].

Another important function of the CSN complex performed either as a whole or by independent subunits, is the association with kinase activity. Several targets are known to be phosphorylated by the CSN-associated kinases, some of which are yet to be discovered, at least in vitro. Those targets include c-Jun, IκBα, NF-κB p105 precursor, and most importantly p53 [4,14]. Furthermore, several of the CSN subunits, specifically

CSN2 and CSN7, are known to be phosphorylated by CKII and PKD kinases with yet-to- be-discovered consequences [15]. The best characterized role of individual CSN subunits is that of subunit 5 (CSN5) in Jun signaling and AP-1 activation. CSN5, also known as

Jun-activating binding protein 1 (Jab1), directly interacts with c-Jun and facilitates its binding to JNK kinase, resulting in phosphorylation and stabilization of c-Jun upon binding to AP-1 promoter sites [16, 17].

12

COP9 Signalosome and Viruses

Given the wide range of pathways and processes that are affected by the CSN, it is perhaps not surprising to find that various viruses exploit it during pathogenesis. One study demonstrated that Hepatitis B protein X (HBx) interacts with CSN5, enhancing

AP-1 signaling and possibly inducing hepatocarcinoma [18]. Another intriguing function of CSN5 is demonstrated by the study on the West Nile virus capsid protein (WNVCp), which is targeted by the CSN for phosphorylation-dependent proteasomal degradation as well as physical translocation of the WNVCp from the nucleus to the cytoplasm by

CSN5, suggesting a novel innate immunity role for the CSN [19]. Most fascinatingly, a link already exists between the CSN and HIV-1. In a study done by Mahalingam et al., it was discovered that Vpr binds CSN6 in a yeast two-hybrid pulldown interaction as well as in HeLa cells [20]. A follow-up paper suggested that Vpr binds to the C-terminus of

CSN6 and causes its translocation to the nucleus as a part of a glucocorticoid response

[21]. However, other than those two studies, little is known about the role of this complex in HIV-1 pathogenesis.

The findings to date indicate that CSN is a major player in most cell processes, and yet only one wide-ranging proteomic study analyzing the binding partners of the

CSN by liquid chromatography/mass spectrometry has been undertaken [22].

Furthermore, virtually nothing is known about the interaction of the CSN in T-cells with the ubiquitin ligase machinery or other proteins, nor the role the entire complex may play in HIV-1 life cycle. In order to help address this question, we have purified the entire

CSN from a human T-cell line through one of its subunits utilizing the Streptavidin-

Binding Peptide (SBP) tag. Purification of the CSN and binding partners was further

13 analyzed by liquid chromatography-mass spectrometry. Finally, the purification of the

CSN was performed in the presence of HIV-1 proteins in order to discover novel binding partners that may play a role in viral infection.

14

MATERIALS AND METHODS Cells:

Human T-cell line SupT1 was obtained from the American Type Culture

Collection (ATCC, Manassas, VA). Cells were maintained in complete RPMI 1640 media supplemented with 10% fetal bovine serum (Gemini Bio-Products, West

Sacramento, CA), glutamine (2 mM), penicillin G (100 units/mL), and streptomycin (100

µg/mL). Phoenix GP cell-line (Nolan Lab, Stanford University, CA) was maintained in

Dulbecco’s Modified Eagle’s media supplemented with 10% fetal bovine serum (Gemini

Bio-Products, West Sacramento, CA), glutamine (2 mM), penicillin G (100 units/mL), and streptomycin (100 µg/mL).

Antibodies and reagents:

The antibodies to CSN1 (A300-026A), CSN2 (A300-027A), CSN4 (A300-014A),

CSN7b (A300-240A), and Cullin-4a (A300-738A) were obtained from Bethyl

Laboratories (Montgomery, TX). Antibodies to CSN3 (sc-100693), CSN6 (sc-137122) and Merlin (sc-55575) were obtained from Santa Cruz Biotechnology, Inc (Santa Cruz,

CA). The CSN8 antibody (BML-PW8290-0025) was provided by Biomol, Inc

(Plymouth Meeting, PA). The antibody for Nedd8 (2745) was obtained from Cell

Signaling (Beverly, MA). The anti-mouse IgG-HRP (115-035-003) and anti-rabbit IgG-

HRP (115-035-045) antibodies were provided by Jackson Immunoresearch (West Grove,

PA). Dynabeads MyOne Streptavidin Beads (656-01) were purchased from Invitrogen

(Carlsbad, CA).

15

Plasmids:

The retroviral transfer vector pBMN.i.mCherry was constructed by amplifying mCherry from pmCherry-C1 (Clontech) using the forward primer with extending NcoI site ATCGATGGATCCCCACCATGGTGAGCAAGGGCGAGGAG and reverse primer with extending XhoI site ATGGACGAGCTGTACAAGTAACTCGAGGATCGATC, and inserting it into partially digested pBMN-i-eGFP (Gary Nolan, Stanford University) with NcoI/SalI. The SBP-Citrine construct was a kind gift from Shari Kaiser (Fred

Hutchinson Cancer Research Center, Seattle, WA). The construct pBMN.SBP-

Citrine.i.mCherry was created by amplifying SBP-Citrine from SBP-Citrine with the forward primer with extending BglII site TATAGCTAGCAGATCTC-

CACCATGGACGAGAAGACCACCGGC and reverse primer with extending XhoI site

ATGGACGAGCTCTATAAATAACTCGAGTATA, and inserted into pBMN.i.mCherry digested with BamHI/XhoI. The SBP tag was cloned into pcDNA3.1/Zeocin (Invitrogen,

Carlsbad CA) by amplifying the SBP sequence with the forward primer

TATAGCTAGCAGATCTCCAC-CATGGACGAGAAGACCACCGGC which contains a Kozak sequence and a BglII site and a reverse primer TATACTCGAGTCTAGAG-

GATCCGGGCTCCCTCTGGCCCTGGGGG that contains a linker consisting of an XbaI and an XhoI site. This product was ligated into pcDNA3.1/Zeocin using BamHI/XhoI restriction enzymes. pcDNA3.1/Zeocin SBP-CSN1 construct was created by amplifying

CSN1 from HeLa cDNA (courtesy of Christopher Glembotski, SDSU) by using a forward primer containing an XbaI site TATAGGATCCTCTAGACC-

GCTGCCGGTTCAGGTGTTT and a reverse primer containing an XhoI site

TATACTCGAGTCACATGTTGGTGCTCATCCGGG, digesting it with XbaI/XhoI and

16 ligating it into pcDNA3.1/Zeocin. The construct pBMN.SBP-CSN1.i.mCherry was created by digesting pcDNA3.1/Zeocin SBP-CSN1 with BamHI/XhoI and ligating the extracted fragment into pBMN.i.mCherry digested with BamHI/XhoI.

Virus production and transductions:

For the production of MLV based virus, a 10cm2 plate of Phoenix GP cells at 50% confluence was transfected with 3µg of the packaging vector (pBMN.SBP-

Citrine.i.mCherry or pBMN.SBP-CSN1.i.mCherry.) and 3µg of a vector expressing the

Envelope glycoprotein of the Vesicular Stomatitis Virus (pCI-VSVg) by mixing the plasmids in 125µl of FCS-free DMEM and 30µg of Polyethylenimine (linear, MW

24000; Polysciences, Inc, Warrington, PA). Media (DMEM with 10% FCS, Pen-Strep and L-Glutamine) was replaced 24 hours post-transfection and viral supernatant was collected 48 hours after transfection and filtered with 0.45 micron PTFE filters (Pall

Corporation). The supernatant was used to spin-infect naïve SupT1 cells in a six-well plate format. Briefly, viral supernatant was mixed with polybrene (5g/mL final concentration) and added to the cells, the mixture plated in a six-well plate and spun at

1500 x g, 32C for 80 min in a hanging bucket rotors centrifuge (Becton Dickinson). 24 hours post-infection, cells were resuspended in fresh media.

Flow Cytometry and Sorting:

Flow Cytometry and sorting were performed on a BD FACSAria with 405nm,

488nm and 633nm lasers at the .San Diego State University FACS core facility. Data was collected on FACSDiva 6.1.1.

17

Pulldowns and Western blotting:

Cells were spun and resuspended in modified NP-40 buffer (150mM NaCl, Tris-

Cl 50mM, 10% Glycerol, 0.25% NP-40) supplemented with Complete Protease Inhibitor cocktail (Roche) at a concentration of 108 cells/mL. After incubation on ice for 30 minutes, cell lysates were spun at 14,000 x g for 15 minutes at 4 C and supernatants were transferred to new tubes. The lysates were incubated for 1 hour with 100µl of

Dynabeads® MyOne Streptavidin T1 beads (Invitrogen, Carlsbad, CA) on a rotating rack at 4°C. The beads were separated from the sample with a magnetic rack, and the supernatant was retained for lysate control. The beads were washed at least 5 times with

1 mL lysis buffer, and the bound proteins were eluted with lysis buffer containing 2 nM

D-biotin. Lysates and elutes were boiled in SDS sample buffer, run in a 12% polyacrylamide gel and then transferred to a PVDF membrane. After blocking with 5% milk in PBST (PBS+ 0.05% Tween 20), the membrane was incubated with the indicated primary antibodies followed by HRP-conjugated secondary antibodies. Proteins were subsequently detected using the Amersham ECL kit.

Preparation of Samples for Liquid Chromatography-Mass Spectrometry:

Samples were first run in a 12% Mini-PROTEAN TGX gel (BioRad), and the appropriate gel slices containing the sample were sent to Stanford University Mass

Spectrometry Core (SUMS) for LC-MS analysis.

18

RESULTS

Purification of the CSN holocomplex from SupT1 Cells

In order to purify the CSN complex from T-cells we decided to engineer a tagged version of one of the CSN subunits, and express the tagged subunit endogenously. For that purpose, we utilized a 38-amino acid peptide (SBP) shown to have high binding affinity to streptavidin (SA) [23]. Previous studies have demonstrated that it is feasible to purify the entire complex through CSN1 [24]. We thus introduced the SBP sequence at the N’ terminus of CSN1, cloned into the pBMN.i.mCherry retroviral vector. In this vector, referred to as pBMN.SBP-CSN1.i.mCherry, the translation of the SBP-CSN1 protein is coupled to the IRES-mCherry cassette (i.mCherry) (Fig. 1- 1A). This vector was used to create MLV particles and infect naïve SupT1 cells, as previously described

[25], which were then FACS-sorted, clonally selected on the basis of high mCherry expression, and probed with anti-CSN1 antibody to confirm the expression of SBP-CSN1

(Fig. 1-1B-D). As a control, we utilized a similar construct where CSN1 was substituted with Citrine, a modified yellow fluorescent protein chosen to exclude the non-specific protein-protein interaction of the SBP-tag fusion protein. Citrine, a protein of non- mammalian origin, serves here as a stricter control than the empty vector. Total extracts from SBP-Citrine- and -CSN1-expressing cells were then subjected to streptavidin-coated magnetic beads in order to pull down SBP-tagged proteins (Fig. 1-2). The eluted fractions were then analyzed for the presence of CSN subunits. Preliminary results (data not shown) indicated that the lysis buffer utilized was too stringent to pulldown the entire

CSN holocomplex, probably due to the high concentration of the non-ionic Nonidet P-40 detergent and the presence of the ionic sodium deoxycholate detergent, both of which can

19 disrupt weak protein-protein interactions. Interestingly, at these high-stringency conditions (150 mM NaCl, 1.0% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, and 50 mM Tris, pH 8.0), CSN subunits 1, 2, 3 and 8 could be detected. This finding is consistent with a recent study demonstrating that the CSN subunits form two distinct mini-complexes, one of which is composed of CSN1, 2, 3, and 8, that together, assemble into the holocomplex [26]. Decreasing the stringency of the lysis buffer by reducing the amount of NP-40 detergent and gentler mechanical lysis resulted in the purification of all eight of the CSN subunits from SupT1 cells, including both known isoforms of CSN7, as confirmed by Western blots and LC-MS (Fig. 1-3 and Table 1-1).

Fig. 1-1. Establishment of an SBP-CSN1 expressing cell line. (A) Representation of pBMN.SBP-CSN1.i.mCherry, the pBMN.i.mCherry retroviral vector harboring the SBP sequence fused to the N′ terminus of CSN subunit 1. (B) Retroviral particles produced from pBMN.SBP-CSN1.i.mCherry were used to infect naive SupT1 cells. The flow cytometry plot shows the analysis of infected cells sorted on the basis of mCherry expression. (C) Individual sorted cells were grown in 96-well plates, and the brightest clone was selected to establish the SBP-CSN1 cell line. The fluorescence microscopy images of the cell line obtained shows high expression of mCherry. (D) Expression of SBP-CSN1 was confirmed by Western blot analysis. The SBP-Citrine cell line was used as control. The arrows show SBP-CSN1 and endogenous CSN1 (eCSN1) only in the SBP-CSN1 cell line.

20

Fig. 1-2. Schematic representation of the SBP-based pulldown technique for the purification of the CSN and binding partners.

Fig. 1-3. Purification of the CSN from T cells. (A) Coomassie stain of the eluted fractions isolated from SBP-Citrine control and SBP-CSN1 cell line lysates. (B) Confirmation by Western blots (B) and LC-MS (Scaffold3 Software) (C) of the presence of all subunits of the CSN in the eluted fractions from the SBP-CSN1 lysate

21

Table 1-1. Peptides of the CSN Subunits Identified by LC-MS

Subunit Number of Amino Acids Representative Peptide Sequence(s) Peptides Identified

CSN1 15 42% (R)GHDDLGDHYLDCGDLSNALK(C) (R)ALIQYFSPYVSADMHR(M)

(K)MLDEMKDNLLLDMYLAPHVR(T)

CSN2 6 17% (K)SINSILDYISTSK(Q)

(K)WTNQLNSLNQAVVSK(L)

(K)SGINPFDSQEAK(P) CSN3 7 25% (R)FIKPLSNAYHELAQVYSTNNPSELR(N)

(K)YVLHMIEDGEIFASINQK(D)

(R)VQLSGPQEAEK(Y)

CSN4 8 29% (K)LYNNITFEELGALLEIPAAK(A)

(R)NAAQVLVGIPLETGQK(Q)

(K)IASQMITEGR(M)

CSN5 4 18% (R)VNAQAAAYEYMAAYIENAK(Q)

(K)GYKPPDEGPSEYQTIPLNK(I)

(R)SGGNLEVMGLMLGK(V)

CSN6 3 16% (K)FNVLYDR(Q)

(R)SQEGRPVQVIGALIGK(Q)

(R)NIEVMNSFELLSHTVEEKIIIDKEYYYT K(E) CSN7a 1 3.3% (R)LEVDYSIGR(D)

CSN7b 3 18% (K)ATASSSAQEMEQQLAER(E)

(R)TQQQVEAEVTNIK(K)

(R)ELEDLIIEAVYTDIIQGK(L)

CSN8 7 62% (K)FIPLSEPAPVPPIPNEQQLAR(L)

(K)SANSELGGIWSVGQR(I)

(R)AFALVSQAYTSIIADDFAAFVGLPVEE AVK(G)

22

Known and Predicted Binding Partners of the CSN isolated from SupT1 Cells

One of the major functions of the CSN is the cleavage of Nedd8 from Cullin proteins [9]. Prior to LC-MS analysis, we probed our eluted fraction with a Nedd8 antibody in order to ascertain if any binding proteins were pulled down along with the

CSN holocomplex. Several protein bands were detected, indicating the presence of neddylated proteins in the eluate from the lysate of the SBP-CSN1 cell line (Fig. 1-4A).

We next addressed whether this technique enabled us to isolate the binding partners of the CSN, either as previously described in literature or predicted by bioinformatics tools in silico (Table 1-2). The eluted fractions from SBP-CSN1- and SBP-Citrine whole cell lysates were analyzed by LC-MS at the Stanford University Mass Spectrometry facility.

Hits from the SBP-Citrine pulldown were used to eliminate non-specific binding proteins.

355 proteins were identified as putative CSN-binding partners. Out of 355, 78 showed an

80% or greater protein identification probability, as determined by the probability of peptide identification and the number of hits identified per protein (Table 1-3, Appendix

A). The specific hits listed in Table 2 (16 in total), represent hits that have been characterized in other studies, predicted to interact with the CSN in silico or confirmed in our manuscript. From the putative CSN-binding proteins, we identified two Cullin proteins, Cullin 3 and Cullin 4B, in addition to Cullin 4A, which we detected by Western blot [27] (Fig. 1-4B). We have also identified CAND1 and DDB1, a subunit of the damaged-DNA binding protein DDB. These are two of the proteins known to interact with Cullin 4 during the process of ubiquitination of target proteins by the CSN [28].

Another probable hit was Ubiquitin ligase E2N (UBE2N), a human analog of

Saccharomyces cerevisiae ubiquitin ligase Ubc13. The interaction between E2N and the

23

CSN has previously been predicted by genome-scale genetic interaction maps, but never confirmed in either yeast or human cells [29]. Other members of the ubiquitination machinery included Ubiquitin protein ligase E3A (UBE3A) and Isoform 4 of Ubiquitin protein ligase (UBR4).

Several protein hits from our pulldown corresponded with predictions made by the

Human Protein-Protein Prediction Interaction database (PIP), a bioinformatic tool which predicts the likelihood of interaction between two proteins [30]. These included Long

Isoform of 14-3-3 protein beta/alpha (YWHAB, interaction score of 5.28) and Eukaryotic translation initiation factor 5A-2 (EIF5A2, interaction score of 2.68). The CSN has previously been shown to associate with the 26S Proteasome, most likely in order to direct very specific proteolysis [31]. We indeed were able to identify several of the proteosomal subunits, including Proteasome subunit alpha type-2 (PSMA2) and 4

(PSMA4), beta type-3 (PSMB3), and Proteasome activator complex subunit-1 (PSME1).

Interestingly, the BioGrid 3.1 protein interaction database [32] and the Drosophila protein interaction map based on a yeast two-hybrid screen [33] hinted at the interaction between the Ribosomal protein L23A and CSN3, a high-probability hit obtained in our pulldown

(Table 1-2).

24

Table 1-2 Peptides of Proteins Binding to the CSN Identified by LC-MS

Protein Accession Protein Protein Name Peptide Sequence Ident. Number Probability IPI00179057.6 CUL4B Cullin-4B* (K)TIDGILLLIER(E) 90% IPI00014312.1 CUL3 Cullin-3* (R)SPEYLSLFIDDK(L) 95%

IPI00100160.3 CAND1 Cullin-associated NEDD8- (K)LGTLSALDILIK(N) 95% dissociated protein*

IPI00293464.5 DDB1 DNA Damage-binding (R)LFMLLLEK(E) 85% protein*&

IPI00299155.5 PSMA4 Proteasome subunit alpha type- (R)TTIFSPEGR(L) 95% 4

IPI00028004.2 PSMB3 Proteasome subunit beta type-3 (R)LYIGLAGLATDVQTVAQR(L) 95%

IPI00479722.2 PSME1 Proteasome activator complex (K)APLDIPVPDPVK(E) 95% subunit 1

IPI00219622.3 PSMA2 Proteasome subunit alpha type- (K)LVQIEYALAAVAGGAPSVGIK(A) 95% 2

IPI00216318.5 YWHAB Long Isoform of 14-3-3 protein (K)TAFDEAIAELDTLNEESYK(D) 95% beta/alpha#

IPI00006935.3 EIF5A2 Eukaryotic translation (K)VHLVGIDIFTGK(K) 91% initiation factor 5A-2#

IPI00385649.2 LRCH3 Isoform 2 of Leucine-rich (Q)YEEEKIRTK(Q) 95% repeat and calponin homology domain-containing protein 3*

IPI00003949.1 UBE2N Ubiquitin-conjugating enzyme (R)YFHVVIAGPQDSPFEGGTFK(L) 95% E2 N

IPI00329038.5 CDK5RAP2 Isoform 1 of CDK5 regulatory (R)DKQKENDK(L) 89% subunit-associated protein 2

IPI00021266.1 RPL23A 60S Ribosomal Protein 23A& (K)IEDNNTLVFIVDVK(A) 95%

IPI00220308.1 NF2 Isoform 2 of Merlin (K)LLAQKAAEAEQEMQR(I) 89%

*Proteins predicted to interact with the CSN by PIPs (Human Protein-Protein Interaction Prediction).

&Proteins predicted to interact with the CSN by BioGRID3.1.

25

Novel CSN Binding Partner Neurofibromin 2

One of the strong hits identified in our pulldown was Neurofibromin 2 (Merlin).

Merlin is a 70kD protein related to proteins that anchor the actin cytoskeleton to specific membrane proteins, and appears to function as a tumor suppressor. A recent study determined that Merlin is targeted to the Roc1-CUL4A-DDB1 E3 ligase complex for degradation by Vpr-binding protein (VprBP) [34]. We further confirmed the presence of

Merlin in the SBP-CSN1 eluate by Western blotting (Fig. 1-4C).

Fig. 1-4 Western blot analysis of SBP-Citrine and SBP-CSN1 cell lysates to confirm CSN binding partners. (A) Cell line eluates were probed with anti-Nedd8 antibody to show the interaction of the CSN with neddylated proteins (three arrows) in the SBP-CSN1 lysate but not in the SBP-Citrine control. Anti-Cullin 4A (B) and anti- Merlin (NF2) (C) antibodies were used to confirm the interaction of the CSN with Cullin 4A and Merlin.

26

14-3-3 Protein Zeta/Delta binds the CSN in the Presence of HIV-1 Proteins

In order to reveal proteins that bind the CSN only in the context of HIV, it was necessary to perform the pulldown in the presence of large amount of viral proteins. SBP-

CSN1 and SBP-Citrine SupT1 cells were lysed as described previously, and incubated with the streptavidin-coated magnetic beads. The beads were then added to lysates from

293T cells that were either non-transfected, or transfected with 6 µg of pCMV ΔR8.2 plasmid, which allows for expression of all HIV-1 proteins except Envelope [35]. The purification was performed as described above, and the eluted fractions were sent for LC-

MS.

The results of the LC-MS identified two proteins that potentially interact with the

CSN in the presence of HIV-1 proteins, UBR4 (Isoform 4 of E3-Ubiquitin Ligase UBR4) and YWHAZ (14-3-3 protein Zeta/Delta) (Fig 1-5A). Interestingly, both of these proteins have been described in literature in connection to HIV-1. UBR4 has been shown to recognize the N-degron sequence (N-terminal phenylalanine) of HIV-1 Integrase and participate in its degradation [36]. Another study has identified several 14-3-3 isoforms as Vpr-interacting proteins, which together form a complex with Cdc25C phosphatase, and cause it to be translocated from the nucleus to the cytoplasm [37]. In order to validate the interaction between the CSN and 14-3-3, the pulldown experiment was repeated, this time with the addition of a lysate from 293T cells transfected with

3XFLAG-Vpr. While the Western blot did not detect any 14-3-3 proteins in either the control or pCMV ΔR8.2 eluates, the band for 14-3-3 was present in the SBP-CSN1 eluate from cells transfected with 3XFLAG-Vpr (Fig. 1-5B). In order to validate the interaction between the CSN, Vpr and 14-3-3, a co-immunoprecipitation with the pan 14-3-3

27 antibody (recognizing a common epitope in all 14-3-3 proteins) was performed on cell lysates from cells that were transfected with either 3XFLAG-CSN5 or 3XFLAG-Vpr.

The Western blot of the eluates was then probed with anti-FLAG antibody, detecting

3XF-CSN5 and 3XF-Vpr pulled down through the pan 14-3-3 antibody (Fig. 1-5C).

Fig. 1-5 14-3-3 interacts with the subunits of the CSN in the presence of HIV-1 proteins. Scaffold3 readout of the LC-MS data demonstrating the presence of the 14-3-3 Zeta/Delta in the SBP-CSN1 eluate from pCMV ΔR8.2 cell lysate (A). Western blot of a pulldown experiment with lysates transfected with pCMV ΔR8.2 and 3XFLAG-Vpr probed with pan 14-3-3 antibody (B). Western blot of a co-immunoprecipitation with the pan 14-3-3 antibody from cells transfected with either 3XFLAG-CSN5 or 3XFLAG-Vpr, probed with anti-FLAG antibodies (C).

28

DISCUSSION Although the COP9 Signalosome plays a major role in many vital cellular functions, few proteomic studies analyzing its binding partners in human cells have been performed, and none in T-cells. In this work, we used retroviral technology to efficiently deliver the SBP-tagged CSN1 subunit into a T-cell line. The SBP-tag provides a fast, efficient and relatively specific one-step method for the isolation of protein complexes, as demonstrated here with the CSN. Fang et al. successfully purified the CSN holocomplex from fibroblasts utilizing a long tag of around 110 amino acids in length. This tag included two six-Histidine residue sequences, a 75 amino acid-long sequence as in vivo substrate for biotinylation and a 29 amino acid-long Tobacco Etching Virus protease cleavage site with linkers [22]. The SBP-tag is only 38 amino acids-long and does not rely on the efficiency with which the biotinylation process occurs in the cell.

Furthermore, in the SBP-tag system, biotin is used as competitor at the time of purification and purification does not rely on the activity of a protease. Using the SBP- tagged CSN1 subunit expressed endogenously, we were able to recover all eight subunits of the CSN through the pulldown, demonstrating that tagging the CSN subunit did not disrupt its ability to interact with the rest of the subunits and form the CSN holocomplex.

Previous studies for the purification of the CSN holocomplex in human cells were performed in fibroblasts. Here we have successfully purified the complex from T-cells, a non-adherent cell type with very different biological characteristics and functionalities, such as those related to immune activation. While SupT1 cells are not primary cells, they are easily activated by many physiological and non-physiological factors, and infectable by viruses such as HIV-1. This is not to say that parallel experiments should not be

29 performed in primary T-cells where similar results should nonetheless be expected.

Furthermore, combining this approach with LC-MS yielded a large number of potential

CSN binding partners. These included previously-documented members of the ubiquitin- ligase machinery, such as CAND1, DDB1, and various Cullins as well as novel ubiquitin ligases UBR4, UBE3A, and UBE2N. In addition, we were also able to detect several protein components of the 26S Proteasome, a finding that is consistent with the model of the CSN-Proteasome super-complex, where the CSN directly interacts with the barrel of the 26S Proteasome to specifically degrade protein targets [31]. Importantly, we were able to detect several proteins predicted by in silico tools such as BioGrid 3.1 and PIP, such as YWHAB, EIF5A2, and L23A. The nature of this interaction is unknown.

Nevertheless, the fact that one of the main roles of the CSN in involves phosphorylation via CSN-associated kinases and the fact that both YWHAB and L23A are known to be phosphorylated during cellular processes gives us confidence that purification of these targets will reveal a significant biological role [38, 39]

Interestingly, another putative novel binding partner of the CSN with no known relation to the proteasomal and/or ubiquitination machineries was Neurofibromin 2

(Merlin). In a recent study, it was found that the cellular levels of Merlin are controlled by the HIV-1 Vpr-Binding Protein, a protein known to act as a substrate-recognition subunit of the ROC1-CUL4A-DDB1 ubiquitin ligase complex and which appears to direct Merlin for degradation via ubiquitination [34, 40]. The finding that Merlin is associated with the COP9 Signalosome is consistent with the model describing the control of Merlin expression, as one of the functions of the CSN is to de-neddylate Cullin

30 proteins, including CUL4A, in order to negatively regulate the ubiquitination of their targets [7].

The identification of all eight subunits of the CSN (including both isoforms of

CSN7, as demonstrated by LC-MS and Western blotting) and a number of its binding partners from T-cells, including Merlin, demonstrates that the purification method through intracellularly-expressed SBP-tag is a robust method for protein-binding discovery. A large number of hits were found to be non-specific and bind to the SBP tag, streptavidin and/or beads, particularly mitochondrial proteins. The method described here for the purification of the CSN may thus not be appropriate for targeting protein complexes such as those associated with the mitochondria, emphasizing the importance of a control, SBP-Citrine in our experiments, for determining specific binding. The advantages of using the SBP tag include the relatively rapid pulldown procedure (20 minutes incubation for most protein isolations combined with rapid magnetic rack-based washes) and high specificity of streptavidin to SBP as compared to immunoprecipitation methods involving antibodies. The ease of this procedure makes the method an attractive alternative for sample preparation for LC-MS analysis.

The pulldown method has also identified two cellular proteins that may interact with the CSN only in the presence of HIV-1, UBR4 and 14-3-3 Zeta/Delta. UBR4 is an

E3 ubiquitin ligase that follows the N-end rule. HIV-1 Integrase has been shown to be one of its targets for ubiquitination and degradation, probably due to its N’-terminal phenylalanine residue, a result of HIV-1 Gag-Pol processing by PR [36]. The purpose of

Integrase degradation is unclear; however, Integrase is a catalytic enzyme that engages

DNA-dependent protein kinase pathway in completing the process of viral cDNA

31 integration. Continued DNA damage caused by the presence of Integrase in the nucleus can potentially override the repair pathway which would lead to apoptosis and the termination of viral integration [41]. Due to the fact that the CSN is largely a nuclear complex that can function as a platform for other ubiquitin ligases, it is possible that it is engaged in the ubiquitination and subsequent degradation of the Integrase during infection [42, 43].

Several members of the Protein 14-3-3 family have also been previously shown to interact with HIV-1 Vpr [37]. Kino et. al. demonstrated that co-expression of 14-3-3η with Vpr enhanced cell cycle arrest, and other 14-3-3 proteins would bind to Vpr in the context of binding Cdc25C phosphatase, a cell-cycle checkpoint protein that is phosphorylated on Serine 216 and translocated from the nucleus to the cytoplasm to prevent it from dephosphorylating its target Cdc2, arresting G2/M cell cycle progression.

Vpr appears to bypass the phosphorylation step of this cell-cycle arrest by directly bridging the 14-3-3 proteins and Cdc25C, resulting in translocation from the nucleus.

Another study by Choi et. al. demonstrated that CSN6 mediated the levels of 14-3-3σ by recruiting the COP1 E3 ubiquitin ligase, resulting in Akt-mediated cell survival [44].

This finding is intriguing due to the fact that Vpr has previously been shown to bind

CSN6, possibly to interfere with COP1-mediated degradation of 14-3-3 and thereby inhibiting Akt-mediated cell survival, especially in the late stages of infection. Another possible function of the interaction between CSN, Vpr, and 14-3-3ζ is suggested by the finding that over-expression of 14-3-3ζ leads to the de-stabilization of p53, probably by translocating the MDM2 E3 ubiquitin ligase to the nucleus after its phosphorylation by

PI3K/Akt [45]. Previous studies have demonstrated that Vpr, together with Tat can

32 inhibit expression of p53, possibly preventing p53 from prohibiting the expression of viral genes from the HIV-1 LTR [46]. Other studies, however, have demonstrated that p53 may in fact enhance HIV-1 expression [47]. The seemingly conflicting roles may point to a strategy the virus may have developed to block the pro-apoptotic functions of p53 while maintaining the activity of p53 required for transcription from the HIV-1 LTR.

The interaction between the CSN, Vpr, and 14-3-3ζ may therefore represent a potential pathway that the virus could utilize in modulating the activity of p53 by using the CSN to regulate its expression levels: by interfering in the interaction between 14-3-3ζ and

MDM2, and thereby increasing the stability of p53.

Purification of the CSN holocomplex together with its binding partners from a natural environment such as a T-cell as presented in this chapter can greatly facilitate the study of the CSN and its interactions as well as the regulation of its binding partners under different conditions, such as T-cell activation or the presence of specific HIV-1 proteins.

33

REFERENCES

[1] R. Wolkowicz, G.C. Jager, G.P. Nolan, A random peptide library fused to CCR5 for selection of mimetopes expressed on the mammalian cell surface via retroviral vectors, J. Biol. Chem. 280 (2005) 15195–15201.

[2] N. Wei, X.W. Deng, COP9: A New Genetic Locus Involved in Light-Regulated Development and Gene Expression in Arabidopsis, Plant Cell. 4 (1992) 1507–1518.

[3] B. Karniol, A. Yahalom, S. Kwok, T. Tsuge, M. Matsui, X.W. Deng, et al., The Arabidopsis homologue of an eIF3 complex subunit associates with the COP9 complex, FEBS Lett. 439 (1998) 173–179.

[4] M. Seeger, R. Kraft, K. Ferrell, D. Bech-Otschir, R. Dumdey, R. Schade, et al., A novel protein complex involved in signal transduction possessing similarities to 26S proteasome subunits, FASEB J. 12 (1998) 469–478.

[5] C. Schwechheimer, The COP9 signalosome (CSN): an evolutionary conserved proteolysis regulator in eukaryotic development, Biochimica Et Biophysica Acta (BBA) - Molecular Cell Research. 1695 (2004) 45–54.

[6] N. Wei, X.W. Deng, The COP9 signalosome, Annu. Rev. Cell Dev. Biol. 19 (2003) 261–286.

[7] R.J. Deshaies, SCF and Cullin/Ring H2-based ubiquitin ligases, Annu. Rev. Cell Dev. Biol. 15 (1999) 435–467.

[8] Ning Wei and, Xing Wang Deng, The Cop9 Signalosome, (2003).

[9] G.A. Cope, G.S.B. Suh, L. Aravind, S.E. Schwarz, S.L. Zipursky, E.V. Koonin, et al., Role of Predicted Metalloprotease Motif of Jab1/Csn5 in Cleavage of Nedd8 from Cul1, Science. 298 (2002) 608–611.

[10] J. Zheng, X. Yang, J.M. Harrell, S. Ryzhikov, E.-H. Shim, K. Lykke-Andersen, et al., CAND1 Binds to Unneddylated CUL1 and Regulates the Formation of SCF Ubiquitin E3 Ligase Complex, Molecular Cell. 10 (2002) 1519–1526.

[11] M. Morimoto, T. Nishida, R. Honda, H. Yasuda, Modification of Cullin-1 by Ubiquitin-like Protein Nedd8 Enhances the Activity of SCFskp2 toward p27kip1, Biochemical and Biophysical Research Communications. 270 (2000) 1093–1096.

[12] Y. Miyauchi, M. Kato, F. Tokunaga, K. Iwai, The COP9/signalosome increases the efficiency of von Hippel-Lindau protein ubiquitin ligase-mediated hypoxia- inducible factor-alpha ubiquitination, J. Biol. Chem. 283 (2008) 16622–16631.

34

[13] M.A. Read, J.E. Brownell, T.B. Gladysheva, M. Hottelet, L.A. Parent, M.B. Coggins, et al., Nedd8 Modification of Cul-1 Activates SCFbeta TrCP-Dependent Ubiquitination of Ikappa Balpha, Mol. Cell. Biol. 20 (2000) 2326–2333.

[14] D. Bech-Otschir, R. Kraft, X. Huang, P. Henklein, B. Kapelari, C. Pollmann, et al., COP9 signalosome-specific phosphorylation targets p53 to degradation by the ubiquitin system, EMBO J. 20 (2001) 1630–1639.

[15] S. Uhle, O. Medalia, R. Waldron, R. Dumdey, P. Henklein, D. Bech-Otschir, et al., Protein kinase CK2 and protein kinase D are associated with the COP9 signalosome, EMBO J. 22 (2003) 1302–1312.

[16] F.X. Claret, M. Hibi, S. Dhut, T. Toda, M. Karin, A new group of conserved coactivators that increase the specificity of AP-1 transcription factors, Nature. 383 (1996) 453–457.

[17] R. Kleemann, A. Hausser, G. Geiger, R. Mischke, A. Burger-Kentischer, O. Flieger, et al., Intracellular action of the cytokine MIF to modulate AP-1 activity and the cell cycle through Jab1, Nature. 408 (2000) 211–216.

[18] Y. Tanaka, F. Kanai, T. Ichimura, K. Tateishi, Y. Asaoka, B. Guleng, et al., The hepatitis B virus X protein enhances AP-1 activation through interaction with Jab1, Oncogene. 25 (2005) 633–642.

[19] W. Oh, M.-R. Yang, E.-W. Lee, K.-M. Park, S. Pyo, J.-S. Yang, et al., Jab1 mediates cytoplasmic localization and degradation of West Nile virus capsid protein, J. Biol. Chem. 281 (2006) 30166–30174.

[20] S. Mahalingam, V. Ayyavoo, M. Patel, T. Kieber-Emmons, G.D. Kao, R.J. Muschel, et al., HIV-1 Vpr interacts with a human 34-kDa mov34 homologue, a cellular factor linked to the G2/M phase transition of the mammalian cell cycle, Proceedings of the National Academy of Sciences of the United States of America. 95 (1998) 3419–3424.

[21] M.P. Ramanathan, E. Curley, M. Su, J.A. Chambers, D.B. Weiner, Carboxyl terminus of hVIP/mov34 is critical for HIV-1-Vpr interaction and glucocorticoid- mediated signaling, J. Biol. Chem. 277 (2002) 47854–47860.

[22] L. Fang, X. Wang, K. Yamoah, P. Chen, Z.-Q. Pan, L. Huang, Characterization of the human COP9 signalosome complex using affinity purification and mass spectrometry, J. Proteome Res. 7 (2008) 4914–4925.

[23] A.D. Keefe, D.S. Wilson, B. Seelig, J.W. Szostak, One-step purification of recombinant proteins using a nanomolar-affinity streptavidin-binding peptide, the SBP-tag, Protein Expression and Purification. 23 (2001) 440–446.

35

[24] S. Menon, V. Rubio, X. Wang, X.-W. Deng, N. Wei, Purification of the COP9 signalosome from porcine spleen, human cell lines, and Arabidopsis thaliana plants, Meth. Enzymol. 398 (2005) 468–481.

[25] R. Wolkowicz, G.P. Nolan, M.A. Curran, Lentiviral vectors for the delivery of DNA into mammalian cells, Methods Mol. Biol. 246 (2004) 391–411.

[26] M. Sharon, H. Mao, E. Boeri Erba, E. Stephens, N. Zheng, C.V. Robinson, Symmetrical modularity of the COP9 signalosome complex suggests its multifunctionality, Structure. 17 (2009) 31–40.

[27] M.H. Olma, M. Roy, T. Le Bihan, I. Sumara, S. Maerki, B. Larsen, et al., An interaction network of the mammalian COP9 signalosome identifies Dda1 as a core subunit of multiple Cul4-based E3 ligases, J Cell Sci. 122 (2009) 1035–1044.

[28] T. Bondar, A. Kalinina, L. Khair, D. Kopanja, A. Nag, S. Bagchi, et al., Cul4A and DDB1 Associate with Skp2 To Target p27Kip1 for Proteolysis Involving the COP9 Signalosome, Molecular and Cellular Biology. 26 (2006) 2531 –2539.

[29] C. Huttenhower, E.M. Haley, M.A. Hibbs, V. Dumeaux, D.R. Barrett, H.A. Coller, et al., Exploring the human genome with functional maps, Genome Res. 19 (2009) 1093–1106.

[30] M.D. McDowall, M.S. Scott, G.J. Barton, PIPs: human protein-protein interaction prediction database, Nucleic Acids Research. 37 (2009) D651–D656.

[31] X. Huang, B.K.J. Hetfeld, U. Seifert, T. Kähne, P. Kloetzel, M. Naumann, et al., Consequences of COP9 signalosome and 26S proteasome interaction, FEBS Journal. 272 (2005) 3909–3917.

[32] C. Stark, B.-J. Breitkreutz, A. Chatr-Aryamontri, L. Boucher, R. Oughtred, M.S. Livstone, et al., The BioGRID Interaction Database: 2011 update, Nucleic Acids Res. 39 (2011) D698–704.

[33] L. Giot, J.S. Bader, C. Brouwer, A. Chaudhuri, B. Kuang, Y. Li, et al., A protein interaction map of Drosophila melanogaster, Science. 302 (2003) 1727–1736.

[34] J. Huang, J. Chen, VprBP targets Merlin to the Roc1-Cul4A-DDB1 E3 ligase complex for degradation, Oncogene. 27 (2008) 4056–4064.

[35] R. Zufferey, D. Nagy, R.J. Mandel, L. Naldini, D. Trono, Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo, Nat. Biotechnol. 15 (1997) 871–875.

36

[36] T. Tasaki, L.C.F. Mulder, A. Iwamatsu, M.J. Lee, I.V. Davydov, A. Varshavsky, et al., A Family of Mammalian E3 Ubiquitin Ligases That Contain the UBR Box Motif and Recognize N-Degrons, Mol Cell Biol. 25 (2005) 7120–7136.

[37] T. Kino, A. Gragerov, A. Valentin, M. Tsopanomihalou, G. Ilyina-Gragerova, R. Erwin-Cohen, et al., Vpr Protein of Human Immunodeficiency Virus Type 1 Binds to 14-3-3 Proteins and Facilitates Complex Formation with Cdc25C: Implications for Cell Cycle Arrest, J. Virol. 79 (2005) 2780–2787.

[38] M.-S. Dai, S.X. Zeng, Y. Jin, X.-X. Sun, L. David, H. Lu, Ribosomal Protein L23 Activates p53 by Inhibiting MDM2 Function in Response to Ribosomal Perturbation but Not to Translation Inhibition, Mol Cell Biol. 24 (2004) 7654–7668.

[39] Y. Liu, J.F. Ross, P.V.N. Bodine, J. Billiard, Homodimerization of Ror2 tyrosine kinase receptor induces 14-3-3(beta) phosphorylation and promotes osteoblast differentiation and bone formation, Mol. Endocrinol. 21 (2007) 3050–3061.

[40] X. Wen, K.M. Duus, T.D. Friedrich, C.M.C. de Noronha, The HIV1 Protein Vpr Acts to Promote G2 Cell Cycle Arrest by Engaging a DDB1 and Cullin4A- containing Ubiquitin Ligase Complex Using VprBP/DCAF1 as an Adaptor, Journal of Biological Chemistry. 282 (2007) 27046 –27057.

[41] L.C.F. Mulder, M.A. Muesing, Degradation of HIV-1 Integrase by the N-end Rule Pathway, J. Biol. Chem. 275 (2000) 29749–29753.

[42] N. Wei, X.W. Deng, Characterization and purification of the mammalian COP9 complex, a conserved nuclear regulator initially identified as a repressor of photomorphogenesis in higher plants, Photochem. Photobiol. 68 (1998) 237–241.

[43] D.A. Wolf, C. Zhou, S. Wee, The COP9 signalosome: an assembly and maintenance platform for cullin ubiquitin ligases?, Nature Cell Biology. 5 (2003) 1029–1033.

[44] H.H. Choi, C.P. Gully, C.-H. Su, G. Velazquez-Torres, P.-C. Chou, C. Tseng, et al., COP 9 Signalosome Subunit 6 Stabilizes COP1, which Functions as an E3 Ubiquitin Ligase for 14-3-3σ, Oncogene. 30 (2011) 4791–4801.

[45] C.G. Danes, S.L. Wyszomierski, J. Lu, C.L. Neal, W. Yang, D. Yu, 14-3-3ζ Down- regulates p53 in Mammary Epithelial Cells and Confers Luminal Filling, Cancer Res. 68 (2008) 1760–1767.

[46] S. Amini, K. Khalili, B.E. Sawaya, Effect of HIV-1 Vpr on Cell Cycle Regulators, DNA and Cell Biology. 23 (2004) 249–260.

37

[47] E. Pauls, J. Senserrich, B. Clotet, J.A. Este, Inhibition of HIV-1 replication by RNA interference of p53 expression, J Leukoc Biol. 80 (2006) 659–667.

38

APPENDIX

Table 1-3. Putative CSN-Interacting Proteins Identified With an 80% or Greater Probability

Identified Protein Accession Molecular Protein Number Weight Identification IPI:IPI00021266.1 Tax_Id=9606 Gene_Symbol=RPL23A 60S IPI00021266 18 kDa 100% ribosomal protein L23a (+4) IPI:IPI00015833.1 Tax_Id=9606 Gene_Symbol=CHCHD3 IPI00015833 26 kDa 100% Coiled-coil-helix-coiled-coil-helix domain-containing protein 3, (+4) mitochondrial IPI:IPI00335168.9 Tax_Id=9606 Gene_Symbol=MYL6;MYL6B IPI00335168 17 kDa 100% Isoform Non-muscle of Myosin light polypeptide 6 (+5) IPI:IPI00003949.1 Tax_Id=9606 Gene_Symbol=UBE2N IPI00003949 17 kDa 100% Ubiquitin-conjugating enzyme E2 N (+2) IPI:IPI00328415.1 Tax_Id=9606 Gene_Symbol=CYB5R3 cDNA IPI00328415 38 kDa 100% FLJ56301, highly similar to NADH-cytochrome b5 reductase (+3) IPI:IPI00848331.1 Tax_Id=9606 Gene_Symbol=RPL31 IPI00848331 15 kDa 100% ribosomal protein L31 isoform 2 (+6) IPI:IPI00006579.1 Tax_Id=9606 Gene_Symbol=COX4I1 IPI00006579 20 kDa 100% Cytochrome c oxidase subunit 4 isoform 1, mitochondrial (+1) IPI:IPI00045396.1 Tax_Id=9606 Gene_Symbol=CALU Isoform IPI00045396 37 kDa 100% 2 of Calumenin (+3) IPI:IPI00935969.1 Tax_Id=9606 IPI00935969 9 kDa 80% Gene_Symbol=LOC100290821;LOC100292037;LOC100287334 hypothetical protein XP_002343201 IPI:IPI00009960.6 Tax_Id=9606 Gene_Symbol=IMMT Isoform IPI00009960 84 kDa 99% 1 of Mitochondrial inner membrane protein (+6) IPI:IPI00027252.6 Tax_Id=9606 Gene_Symbol=PHB2 IPI00027252 33 kDa 98% Prohibitin-2 (+1) IPI:IPI00924839.1 Tax_Id=9606 Gene_Symbol=- Putative IPI00924839 20 kDa 86% uncharacterized protein ENSP00000393291 IPI:IPI00748360.2 Tax_Id=9606 Gene_Symbol=KIAA1797 IPI00748360 200 kDa 82% Uncharacterized protein KIAA1797 IPI:IPI00025849.1 Tax_Id=9606 IPI00025849 29 kDa 100% Gene_Symbol=ANP32A;LOC723972 Acidic leucine-rich (+2) nuclear phosphoprotein 32 family member A IPI:IPI00299155.5 Tax_Id=9606 Gene_Symbol=PSMA4 IPI00299155 29 kDa 100% Proteasome subunit alpha type-4 (+2) IPI:IPI00478410.2 Tax_Id=9606 Gene_Symbol=ATP5C1 IPI00478410 33 kDa 100% Isoform Liver of ATP synthase subunit gamma, mitochondrial IPI:IPI00550991.3 Tax_Id=9606 Gene_Symbol=SERPINA3 IPI00550991 51 kDa 100%

39

cDNA FLJ35730 fis, clone TESTI2003131, highly similar to (+1) ALPHA-1-ANTICHYMOTRYPSIN IPI:IPI00012493.1 Tax_Id=9606 Gene_Symbol=RPS20 40S IPI00012493 13 kDa 99% ribosomal protein S20 IPI:IPI00012750.3 Tax_Id=9606 Gene_Symbol=RPS25 40S IPI00012750 14 kDa 99% ribosomal protein S25 (+1) IPI:IPI00298662.5 Tax_Id=9606 Gene_Symbol=C19orf25 IPI00298662 17 kDa 86 Isoform 1 of UPF0449 protein C19orf25 (+2) IPI:IPI00011609.4 Tax_Id=9606 Gene_Symbol=UBE3A IPI00011609 101 kDa 84 Isoform II of Ubiquitin-protein ligase E3A (+3) IPI:IPI00015018.1 Tax_Id=9606 Gene_Symbol=PPA1 Inorganic IPI00015018 33 kDa 100% pyrophosphatase IPI:IPI00017510.3 Tax_Id=9606 Gene_Symbol=MT-CO2 IPI00017510 26 kDa 100% Cytochrome c oxidase subunit 2 IPI:IPI00026260.1 Tax_Id=9606 Gene_Symbol=NME2;NME1 IPI00026260 17 kDa 100% Isoform 1 of Nucleoside diphosphate kinase B (+2) IPI:IPI00031804.1 Tax_Id=9606 Gene_Symbol=VDAC3 IPI00031804 31 kDa 100% Isoform 1 of Voltage-dependent anion-selective channel protein (+1) 3 IPI:IPI00215911.3 Tax_Id=9606 Gene_Symbol=APEX1 DNA- IPI00215911 36 kDa 100% (apurinic or apyrimidinic site) lyase (+1) IPI:IPI00640981.3 Tax_Id=9606 Gene_Symbol=UBR4 Isoform IPI00640981 574 kDa 98% 4 of E3 ubiquitin-protein ligase UBR4 (+3) IPI:IPI00217923.3 Tax_Id=9606 Gene_Symbol=DZIP1L IPI00217923 87 kDa 95% Isoform 1 of Zinc finger protein DZIP1L (+2) IPI:IPI00153023.7 Tax_Id=9606 Gene_Symbol=CCDC51 IPI00153023 46 kDa 86% Isoform 1 of Coiled-coil domain-containing protein 51 (+4) IPI:IPI00329380.3 Tax_Id=9606 Gene_Symbol=NT5DC4 5'- IPI00329380 53 kDa 83% nucleotidase domain containing 4 (+2) IPI:IPI00000757.1 Tax_Id=9606 Gene_Symbol=SNAI1 Zinc IPI00000757 29 kDa 86% finger protein SNAI1 IPI:IPI00001849.5 Tax_Id=9606 Gene_Symbol=KIAA1530 IPI00001849 81 kDa 86% Isoform 1 of Uncharacterized protein KIAA1530 (+1) IPI:IPI00002649.2 Tax_Id=9606 Gene_Symbol=PNN Isoform 2 IPI00002649 67 kDa 86% of Pinin (+1) IPI:IPI00009471.1 Tax_Id=9606 Gene_Symbol=WDR3 WD IPI00009471 106 kDa 86% repeat-containing protein 3 IPI:IPI00014312.1 Tax_Id=9606 Gene_Symbol=CUL3 Isoform IPI00014312 89 kDa 86% 1 of Cullin-3 (+2) IPI:IPI00016067.1 Tax_Id=9606 Gene_Symbol=MMP19 IPI00016067 57 kDa 86% Isoform 1 of Matrix metalloproteinase-19 (+5) IPI:IPI00017640.1 Tax_Id=9606 Gene_Symbol=SLIT3 Isoform IPI00017640 168 kDa 86% 1 of Slit homolog 3 protein (+5) IPI:IPI00022367.3 Tax_Id=9606 Gene_Symbol=ASTN1 Isoform IPI00022367 145 kDa 86%

40

2 of Astrotactin-1 (+3) IPI:IPI00023026.6 Tax_Id=9606 Gene_Symbol=WDR91 IPI00023026 82 kDa 86% Putative uncharacterized protein WDR91 (+3) IPI:IPI00025276.1 Tax_Id=9606 Gene_Symbol=TNXB Isoform IPI00025276 464 kDa 86% XB of Tenascin-X (+10) IPI:IPI00025671.1 Tax_Id=9606 Gene_Symbol=DSCR6 Isoform IPI00025671 20 kDa 86% 1 of Protein ripply3 IPI:IPI00027180.1 Tax_Id=9606 Gene_Symbol=ZMPSTE24 IPI00027180 55 kDa 86% CAAX prenyl protease 1 homolog IPI:IPI00167903.7 Tax_Id=9606 Gene_Symbol=ZNF555 IPI00167903 63 kDa 86% Isoform 2 of Zinc finger protein 555 (+1) IPI:IPI00217178.6 Tax_Id=9606 Gene_Symbol=C22orf30 IPI00217178 237 kDa 86% Isoform 4 of Uncharacterized protein C22orf30 (+2) IPI:IPI00219575.5 Tax_Id=9606 Gene_Symbol=BLMH IPI00219575 53 kDa 86% Bleomycin hydrolase (+1) IPI:IPI00291646.3 Tax_Id=9606 Gene_Symbol=MTHFD1L IPI00291646 106 kDa 86% Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) (+1) 1-like IPI:IPI00302641.1 Tax_Id=9606 Gene_Symbol=FAT2 IPI00302641 479 kDa 86% Protocadherin Fat 2 IPI:IPI00307591.5 Tax_Id=9606 Gene_Symbol=ZNF609 Zinc IPI00307591 151 kDa 86% finger protein 609 IPI:IPI00328550.3 Tax_Id=9606 Gene_Symbol=THBS4 IPI00328550 106 kDa 86% Thrombospondin-4 IPI:IPI00332095.1 Tax_Id=9606 Gene_Symbol=BCAS3 Isoform IPI00332095 101 kDa 86% 2 of Breast carcinoma-amplified sequence 3 (+7) IPI:IPI00334362.7 Tax_Id=9606 Gene_Symbol=LRRC37A2 IPI00334362 188 kDa 86% Leucine-rich repeat-containing protein 37A2 (+7) IPI:IPI00339381.3 Tax_Id=9606 Gene_Symbol=HLTF Isoform IPI00339381 114 kDa 86% 1 of Helicase-like transcription factor (+2) IPI:IPI00383649.1 Tax_Id=9606 Gene_Symbol=CEBPA HP8 IPI00383649 38 kDa 86% peptide IPI:IPI00385649.2 Tax_Id=9606 Gene_Symbol=LRCH3 Isoform IPI00385649 89 kDa 86% 2 of Leucine-rich repeat and calponin homology domain- (+4) containing protein 3 IPI:IPI00444272.2 Tax_Id=9606 Gene_Symbol=LIFR Leukemia IPI00444272 124 kDa 86% inhibitory factor receptor IPI:IPI00477207.3 Tax_Id=9606 Gene_Symbol=MTRF1L IPI00477207 31 kDa 86% Isoform 2 of Peptide chain release factor 1-like, mitochondrial (+1) IPI:IPI00478429.2 Tax_Id=9606 Gene_Symbol=- Putative IPI00478429 84 kDa 86% uncharacterized protein ENSP00000346572 (+2) IPI:IPI00513701.2 Tax_Id=9606 Gene_Symbol=TMEM222 23 IPI00513701 23 kDa 86% kDa protein (+6) IPI:IPI00642581.1 Tax_Id=9606 Gene_Symbol=ROGDI 23 kDa IPI00642581 23 kDa 86%

41

protein (+1) IPI:IPI00742682.2 Tax_Id=9606 Gene_Symbol=TPR IPI00742682 267 kDa 86% Nucleoprotein TPR IPI:IPI00744099.2 Tax_Id=9606 Gene_Symbol=- Conserved IPI00744099 12 kDa 86% hypothetical protein IPI:IPI00848163.1 Tax_Id=9606 Gene_Symbol=- Transposase, IPI00848163 13 kDa 86% L1 family protein IPI:IPI00922656.1 Tax_Id=9606 Gene_Symbol=PIK3C2G IPI00922656 171 kDa 86% PIK3C2G protein IPI:IPI00935888.1 Tax_Id=9606 IPI00935888 53 kDa 86% Gene_Symbol=LOC100289447;LOC100291332 hypothetical protein XP_002344275 IPI:IPI00937599.1 Tax_Id=9606 Gene_Symbol=LOC100287812 IPI00937599 79 kDa 86% hypothetical protein XP_002343253 IPI:IPI00939596.1 Tax_Id=9606 Gene_Symbol=- Putative IPI00939596 18 kDa 86% uncharacterized protein ENSP00000402815 (Fragment) IPI:IPI00395759.2 Tax_Id=9606 Gene_Symbol=- cDNA IPI00395759 25 kDa 86% FLJ45290 fis, clone BRHIP3002691 IPI:IPI00013302.1 Tax_Id=9606 Gene_Symbol=ADAM15 IPI00013302 88 kDa 84% Disintegrin and metalloproteinase domain-containing protein 15 (+7) IPI:IPI00640531.1 Tax_Id=9606 IPI00640531 23 kDa 84% Gene_Symbol=LY6G5B;CSNK2B Isoform 1 of Lymphocyte (+4) antigen 6 complex locus protein G5b IPI:IPI00022333.1 Tax_Id=9606 Gene_Symbol=BAI1 Brain- IPI00022333 174 kDa 83% specific angiogenesis inhibitor 1 IPI:IPI00385631.7 Tax_Id=9606 Gene_Symbol=ZZEF1 Isoform IPI00385631 331 kDa 83% 1 of Zinc finger ZZ-type and EF-hand domain-containing protein (+2) 1 IPI:IPI00065057.4 Tax_Id=9606 Gene_Symbol=CXorf58 IPI00065057 39 kDa 82% Putative uncharacterized protein CXorf58 IPI:IPI00396126.2 Tax_Id=9606 Gene_Symbol=C5orf24 IPI00396126 20 kDa 82% Isoform 1 of UPF0461 protein C5orf24 IPI:IPI00879984.6 Tax_Id=9606 Gene_Symbol=KLKB1 cDNA IPI00879984 58 kDa 82% FLJ51250, highly similar to Plasma kallikrein (+1) IPI:IPI00006024.4 Tax_Id=9606 Gene_Symbol=DOCK4 IPI00006024 222 kDa 82% Isoform 2 of Dedicator of cytokinesis protein 4 (+6) IPI:IPI00007880.1 Tax_Id=9606 Gene_Symbol=MS4A1 B- IPI00007880 33 kDa 81% lymphocyte antigen CD20 IPI:IPI00083235.7 Tax_Id=9606 Gene_Symbol=- 118 kDa IPI00083235 118 kDa 81% protein (+2) IPI:IPI00181821.3 Tax_Id=9606 Gene_Symbol=FAM193A IPI00181821 140 kDa 80% Isoform 1 of Uncharacterized protein C4orf8 (+2) IPI:IPI00142538.4 Tax_Id=9606 Gene_Symbol=SETX Isoform IPI00142538 303 kDa 80% 1 of Probable helicase senataxin (+3)

42

Table 1-4 All Putative CSN-Interacting Proteins Identified by LC-MS

Protein ID Accession Molecular Protein Number Weight Identification Probability IPI:IPI00156282.2 Tax_Id=9606 Gene_Symbol=GPS1 Isoform 1 of COP9 IPI00156282 56 kDa 100% signalosome complex subunit 1 (+2) IPI:IPI00009480.1 Tax_Id=9606 Gene_Symbol=COPS8 COP9 signalosome IPI00009480 23 kDa 100% complex subunit 8 (+1) IPI:IPI00025721.3 Tax_Id=9606 Gene_Symbol=COPS3 COP9 signalosome IPI00025721 48 kDa 100% complex subunit 3 IPI:IPI00018813.5 Tax_Id=9606 Gene_Symbol=COPS2 Isoform 2 of COP9 IPI00018813 52 kDa 100% signalosome complex subunit 2 (+1) IPI:IPI00171844.3 Tax_Id=9606 Gene_Symbol=COPS4 COP9 signalosome IPI00171844 46 kDa 100% complex subunit 4 IPI:IPI00009958.6 Tax_Id=9606 Gene_Symbol=COPS5 COP9 signalosome IPI00009958 38 kDa 100% complex subunit 5 (+1) IPI:IPI00009301.1 Tax_Id=9606 Gene_Symbol=COPS7B Isoform 1 of COP9 IPI00009301 30 kDa 100% signalosome complex subunit 7b (+2) IPI:IPI00163230.5 Tax_Id=9606 Gene_Symbol=COPS6 COP9 signalosome IPI00163230 36 kDa 100% complex subunit 6 (+2) IPI:IPI00301419.2 Tax_Id=9606 Gene_Symbol=COPS7A COP9 signalosome IPI00301419 30 kDa 76% complex subunit 7a (+1) IPI:IPI00021266.1 Tax_Id=9606 Gene_Symbol=RPL23A 60S ribosomal protein IPI00021266 18 kDa 100% L23a (+4) IPI:IPI00015833.1 Tax_Id=9606 Gene_Symbol=CHCHD3 Coiled-coil-helix- IPI00015833 26 kDa 100% coiled-coil-helix domain-containing protein 3, mitochondrial (+4) IPI:IPI00335168.9 Tax_Id=9606 Gene_Symbol=MYL6;MYL6B Isoform Non- IPI00335168 17 kDa 100% muscle of Myosin light polypeptide 6 (+5) IPI:IPI00936755.1 Tax_Id=9606 Gene_Symbol=- 104 kDa protein IPI00936755 104 kDa 76% IPI:IPI00003949.1 Tax_Id=9606 Gene_Symbol=UBE2N Ubiquitin-conjugating IPI00003949 17 kDa 100% enzyme E2 N (+2) IPI:IPI00328415.1 Tax_Id=9606 Gene_Symbol=CYB5R3 cDNA FLJ56301, IPI00328415 38 kDa 100% highly similar to NADH-cytochrome b5 reductase (+3) IPI:IPI00848331.1 Tax_Id=9606 Gene_Symbol=RPL31 ribosomal protein L31 IPI00848331 15 kDa 100% isoform 2 (+6) IPI:IPI00003815.3 Tax_Id=9606 Gene_Symbol=ARHGDIA Rho GDP- IPI00003815 23 kDa 76% dissociation inhibitor 1 (+4) IPI:IPI00007067.5 Tax_Id=9606 Gene_Symbol=GLIPR2 Golgi-associated plant IPI00007067 17 kDa 76% pathogenesis-related protein 1 (+4) IPI:IPI00006579.1 Tax_Id=9606 Gene_Symbol=COX4I1 Cytochrome c oxidase IPI00006579 20 kDa 100% subunit 4 isoform 1, mitochondrial (+1) IPI:IPI00045396.1 Tax_Id=9606 Gene_Symbol=CALU Isoform 2 of Calumenin IPI00045396 37 kDa 100% (+3)

43

IPI:IPI00028414.3 Tax_Id=9606 Gene_Symbol=GMFG Glia maturation factor IPI00028414 17 kDa 76% gamma IPI:IPI00032179.3 Tax_Id=9606 Gene_Symbol=SERPINC1 Antithrombin-III IPI00032179 53 kDa 76% (+1) IPI:IPI00216298.6 Tax_Id=9606 Gene_Symbol=TXN Thioredoxin IPI00216298 12 kDa 76% (+1) IPI:IPI00935969.1 Tax_Id=9606 IPI00935969 9 kDa 80% Gene_Symbol=LOC100290821;LOC100292037;LOC100287334 hypothetical protein XP_002343201 IPI:IPI00009960.6 Tax_Id=9606 Gene_Symbol=IMMT Isoform 1 of IPI00009960 84 kDa 99% Mitochondrial inner membrane protein (+6) IPI:IPI00027252.6 Tax_Id=9606 Gene_Symbol=PHB2 Prohibitin-2 IPI00027252 33 kDa 98% (+1) IPI:IPI00000015.2 Tax_Id=9606 Gene_Symbol=SFRS4 Splicing factor, IPI00000015 57 kDa 76% arginine/serine-rich 4 (+7) IPI:IPI00003348.3 Tax_Id=9606 Gene_Symbol=GNB2 Guanine nucleotide- IPI00003348 37 kDa 76% binding protein G(I)/G(S)/G(T) subunit beta-2 IPI:IPI00007611.1 Tax_Id=9606 Gene_Symbol=ATP5O ATP synthase subunit IPI00007611 23 kDa 76% O, mitochondrial (+1) IPI:IPI00220642.7 Tax_Id=9606 Gene_Symbol=YWHAG 14-3-3 protein IPI00220642 28 kDa 76% gamma IPI:IPI00924839.1 Tax_Id=9606 Gene_Symbol=- Putative uncharacterized IPI00924839 20 kDa 86% protein ENSP00000393291 IPI:IPI00748360.2 Tax_Id=9606 Gene_Symbol=KIAA1797 Uncharacterized IPI00748360 200 kDa 82% protein KIAA1797 IPI:IPI00787023.2 Tax_Id=9606 Gene_Symbol=- Conserved hypothetical IPI00787023 32 kDa 60% protein IPI:IPI00256861.4 Tax_Id=9606 Gene_Symbol=MACF1 Isoform 2 of IPI00256861 620 kDa 76% Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5 (+4) IPI:IPI00025849.1 Tax_Id=9606 Gene_Symbol=ANP32A;LOC723972 Acidic IPI00025849 29 kDa 100% leucine-rich nuclear phosphoprotein 32 family member A (+2) IPI:IPI00299155.5 Tax_Id=9606 Gene_Symbol=PSMA4 Proteasome subunit IPI00299155 29 kDa 100% alpha type-4 (+2) IPI:IPI00478410.2 Tax_Id=9606 Gene_Symbol=ATP5C1 Isoform Liver of ATP IPI00478410 33 kDa 100% synthase subunit gamma, mitochondrial IPI:IPI00550991.3 Tax_Id=9606 Gene_Symbol=SERPINA3 cDNA FLJ35730 IPI00550991 51 kDa 100% fis, clone TESTI2003131, highly similar to ALPHA-1-ANTICHYMOTRYPSIN (+1) IPI:IPI00012493.1 Tax_Id=9606 Gene_Symbol=RPS20 40S ribosomal protein IPI00012493 13 kDa 99% S20 IPI:IPI00012750.3 Tax_Id=9606 Gene_Symbol=RPS25 40S ribosomal protein IPI00012750 14 kDa 99% S25 (+1) IPI:IPI00298662.5 Tax_Id=9606 Gene_Symbol=C19orf25 Isoform 1 of IPI00298662 17 kDa 86% UPF0449 protein C19orf25 (+2) IPI:IPI00011609.4 Tax_Id=9606 Gene_Symbol=UBE3A Isoform II of IPI00011609 101 kDa 84%

44

Ubiquitin-protein ligase E3A (+3) IPI:IPI00007676.3 Tax_Id=9606 Gene_Symbol=HSD17B12 Estradiol 17-beta- IPI00007676 34 kDa 76% dehydrogenase 12 IPI:IPI00024976.5 Tax_Id=9606 Gene_Symbol=TOMM22 Mitochondrial IPI00024976 16 kDa 76% import receptor subunit TOM22 homolog IPI:IPI00026627.4 Tax_Id=9606 Gene_Symbol=RP2 Protein XRP2 IPI00026627 40 kDa 76% IPI:IPI00027285.1 Tax_Id=9606 Gene_Symbol=SNRPB Isoform SM-B' of IPI00027285 25 kDa 76% Small nuclear ribonucleoprotein-associated proteins B and B' (+7) IPI:IPI00028004.2 Tax_Id=9606 Gene_Symbol=PSMB3 Proteasome subunit IPI00028004 23 kDa 76% beta type-3 (+2) IPI:IPI00029628.1 Tax_Id=9606 Gene_Symbol=RCN2 Reticulocalbin-2 IPI00029628 37 kDa 76% (+1) IPI:IPI00216318.5 Tax_Id=9606 Gene_Symbol=YWHAB Isoform Long of 14- IPI00216318 28 kDa 76% 3-3 protein beta/alpha (+1) IPI:IPI00332662.1 Tax_Id=9606 Gene_Symbol=RUNDC2B RUN domain- IPI00332662 30 kDa 76% containing protein 2B (+3) IPI:IPI00940354.1 Tax_Id=9606 Gene_Symbol=- Putative uncharacterized IPI00940354 27 kDa 76% protein ENSP00000389667 (Fragment) (+1) IPI:IPI00247659.4 Tax_Id=9606 Gene_Symbol=ZNF878 Putative IPI00247659 67 kDa 62% uncharacterized protein ENSP00000408518 IPI:IPI00179057.6 Tax_Id=9606 Gene_Symbol=CUL4B Isoform 1 of Cullin-4B IPI00179057 102 kDa 76% (+2) IPI:IPI00003377.1 Tax_Id=9606 Gene_Symbol=SFRS7 Isoform 1 of Splicing IPI00003377 27 kDa 76% factor, arginine/serine-rich 7 (+1) IPI:IPI00015018.1 Tax_Id=9606 Gene_Symbol=PPA1 Inorganic IPI00015018 33 kDa 100% pyrophosphatase IPI:IPI00017510.3 Tax_Id=9606 Gene_Symbol=MT-CO2 Cytochrome c IPI00017510 26 kDa 100% oxidase subunit 2 IPI:IPI00026260.1 Tax_Id=9606 Gene_Symbol=NME2;NME1 Isoform 1 of IPI00026260 17 kDa 100% Nucleoside diphosphate kinase B (+2) IPI:IPI00031804.1 Tax_Id=9606 Gene_Symbol=VDAC3 Isoform 1 of Voltage- IPI00031804 31 kDa 100% dependent anion-selective channel protein 3 (+1) IPI:IPI00215911.3 Tax_Id=9606 Gene_Symbol=APEX1 DNA-(apurinic or IPI00215911 36 kDa 100% apyrimidinic site) lyase (+1) IPI:IPI00640981.3 Tax_Id=9606 Gene_Symbol=UBR4 Isoform 4 of E3 IPI00640981 574 kDa 98% ubiquitin-protein ligase UBR4 (+3) IPI:IPI00217923.3 Tax_Id=9606 Gene_Symbol=DZIP1L Isoform 1 of Zinc IPI00217923 87 kDa 95% finger protein DZIP1L (+2) IPI:IPI00289861.4 Tax_Id=9606 Gene_Symbol=ZCCHC11 Isoform 1 of IPI00289861 185 kDa 65% Terminal uridylyltransferase 4 (+3) IPI:IPI00220308.1 Tax_Id=9606 Gene_Symbol=NF2 Isoform 2 of Merlin IPI00220308 73 kDa 73% (+3) IPI:IPI00153023.7 Tax_Id=9606 Gene_Symbol=CCDC51 Isoform 1 of Coiled- IPI00153023 46 kDa 86% coil domain-containing protein 51 (+4)

45

IPI:IPI00329380.3 Tax_Id=9606 Gene_Symbol=NT5DC4 5'-nucleotidase IPI00329380 53 kDa 83% domain containing 4 (+2) IPI:IPI00008115.3 Tax_Id=9606 Gene_Symbol=MAP3K9 Isoform 1 of IPI00008115 122 kDa 76% Mitogen-activated protein kinase kinase kinase 9 (+1) IPI:IPI00018146.1 Tax_Id=9606 Gene_Symbol=YWHAQ 14-3-3 protein theta IPI00018146 28 kDa 76% IPI:IPI00018593.1 Tax_Id=9606 Gene_Symbol=TRIM23 Isoform Gamma of IPI00018593 61 kDa 76% GTP-binding protein ARD-1 (+3) IPI:IPI00019213.1 Tax_Id=9606 Gene_Symbol=DLG4 Isoform 2 of Disks large IPI00019213 85 kDa 76% homolog 4 (+3) IPI:IPI00023004.7 Tax_Id=9606 Gene_Symbol=EIF1AY Eukaryotic translation IPI00023004 16 kDa 76% initiation factor 1A, Y-chromosomal (+3) IPI:IPI00027462.1 Tax_Id=9606 Gene_Symbol=S100A9 Protein S100-A9 IPI00027462 13 kDa 76% (+1) IPI:IPI00032034.1 Tax_Id=9606 Gene_Symbol=B3GALT5 Beta-1,3- IPI00032034 36 kDa 76% galactosyltransferase 5 IPI:IPI00072377.1 Tax_Id=9606 Gene_Symbol=SET Isoform 1 of Protein SET IPI00072377 33 kDa 76% (+7) IPI:IPI00178352.6 Tax_Id=9606 Gene_Symbol=FLNC Isoform 1 of Filamin-C IPI00178352 291 kDa 76% (+10) IPI:IPI00304596.3 Tax_Id=9606 Gene_Symbol=NONO Non-POU domain- IPI00304596 54 kDa 76% containing octamer-binding protein (+4) IPI:IPI00383732.1 Tax_Id=9606 Gene_Symbol=- VH3 protein (Fragment) IPI00383732 16 kDa 76% (+10) IPI:IPI00410714.5 Tax_Id=9606 Gene_Symbol=HBA2;HBA1 Hemoglobin IPI00410714 15 kDa 76% subunit alpha (+1) IPI:IPI00412607.6 Tax_Id=9606 Gene_Symbol=RPL35 60S ribosomal protein IPI00412607 15 kDa 76% L35 (+2) IPI:IPI00418277.3 Tax_Id=9606 Gene_Symbol=CHSY3 Chondroitin sulfate IPI00418277 100 kDa 76% synthase 3 IPI:IPI00418497.1 Tax_Id=9606 Gene_Symbol=TIMM50 Isoform 2 of IPI00418497 50 kDa 76% Mitochondrial import inner membrane translocase subunit TIM50 (+1) IPI:IPI00479722.2 Tax_Id=9606 Gene_Symbol=PSME1 Proteasome activator IPI00479722 29 kDa 76% complex subunit 1 (+1) IPI:IPI00644782.2 Tax_Id=9606 Gene_Symbol=MTR 5-methyltetrahydrofolate- IPI00644782 92 kDa 76% homocysteine methyltransferase (+2) IPI:IPI00741005.7 Tax_Id=9606 Gene_Symbol=MGA MAX-interacting protein IPI00741005 315 kDa 76% isoform 2 (+1) IPI:IPI00306429.6 Tax_Id=9606 Gene_Symbol=MAP6 Isoform 2 of IPI00306429 47 kDa 74% Microtubule-associated protein 6 (+1) IPI:IPI00069817.2 Tax_Id=9606 Gene_Symbol=BAZ1B Isoform 1 of Tyrosine- IPI00069817 171 kDa 74% protein kinase BAZ1B (+1) IPI:IPI00478003.1 Tax_Id=9606 Gene_Symbol=A2M Alpha-2-macroglobulin IPI00478003 163 kDa 69% IPI:IPI00020436.4 Tax_Id=9606 Gene_Symbol=RAB11B Ras-related protein IPI00020436 24 kDa 67% Rab-11B (+5)

46

IPI:IPI00289301.4 Tax_Id=9606 Gene_Symbol=TSGA10 Testis-specific gene IPI00289301 81 kDa 52% 10 protein (+2) IPI:IPI00025019.3 Tax_Id=9606 Gene_Symbol=PSMB1 Proteasome subunit IPI00025019 26 kDa 51% beta type-1 IPI:IPI00024933.3 Tax_Id=9606 Gene_Symbol=RPL12 Isoform 1 of 60S IPI00024933 18 kDa 40% ribosomal protein L12 (+1) IPI:IPI00300990.5 Tax_Id=9606 Gene_Symbol=C1orf77 Isoform 1 of IPI00300990 26 kDa 37% Uncharacterized protein C1orf77 (+2) IPI:IPI00295313.6 Tax_Id=9606 Gene_Symbol=MRVI1 JAW1-related protein IPI00295313 90 kDa 34% isoform b (+6) IPI:IPI00454910.1 Tax_Id=9606 Gene_Symbol=CDC42BPG Serine/threonine- IPI00454910 173 kDa 29% protein kinase MRCK gamma IPI:IPI00000757.1 Tax_Id=9606 Gene_Symbol=SNAI1 Zinc finger protein IPI00000757 29 kDa 86% SNAI1 IPI:IPI00001849.5 Tax_Id=9606 Gene_Symbol=KIAA1530 Isoform 1 of IPI00001849 81 kDa 86% Uncharacterized protein KIAA1530 (+1) IPI:IPI00002649.2 Tax_Id=9606 Gene_Symbol=PNN Isoform 2 of Pinin IPI00002649 67 kDa 86% (+1) IPI:IPI00009471.1 Tax_Id=9606 Gene_Symbol=WDR3 WD repeat-containing IPI00009471 106 kDa 86% protein 3 IPI:IPI00014312.1 Tax_Id=9606 Gene_Symbol=CUL3 Isoform 1 of Cullin-3 IPI00014312 89 kDa 86% (+2) IPI:IPI00016067.1 Tax_Id=9606 Gene_Symbol=MMP19 Isoform 1 of Matrix IPI00016067 57 kDa 86% metalloproteinase-19 (+5) IPI:IPI00017640.1 Tax_Id=9606 Gene_Symbol=SLIT3 Isoform 1 of Slit IPI00017640 168 kDa 86% homolog 3 protein (+5) IPI:IPI00022367.3 Tax_Id=9606 Gene_Symbol=ASTN1 Isoform 2 of IPI00022367 145 kDa 86% Astrotactin-1 (+3) IPI:IPI00023026.6 Tax_Id=9606 Gene_Symbol=WDR91 Putative IPI00023026 82 kDa 86% uncharacterized protein WDR91 (+3) IPI:IPI00025276.1 Tax_Id=9606 Gene_Symbol=TNXB Isoform XB of IPI00025276 464 kDa 86% Tenascin-X (+10) IPI:IPI00025671.1 Tax_Id=9606 Gene_Symbol=DSCR6 Isoform 1 of Protein IPI00025671 20 kDa 86% ripply3 IPI:IPI00027180.1 Tax_Id=9606 Gene_Symbol=ZMPSTE24 CAAX prenyl IPI00027180 55 kDa 86% protease 1 homolog IPI:IPI00167903.7 Tax_Id=9606 Gene_Symbol=ZNF555 Isoform 2 of Zinc IPI00167903 63 kDa 86% finger protein 555 (+1) IPI:IPI00217178.6 Tax_Id=9606 Gene_Symbol=C22orf30 Isoform 4 of IPI00217178 237 kDa 86% Uncharacterized protein C22orf30 (+2) IPI:IPI00219575.5 Tax_Id=9606 Gene_Symbol=BLMH Bleomycin hydrolase IPI00219575 53 kDa 86% (+1) IPI:IPI00291646.3 Tax_Id=9606 Gene_Symbol=MTHFD1L IPI00291646 106 kDa 86% Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (+1)

47

IPI:IPI00302641.1 Tax_Id=9606 Gene_Symbol=FAT2 Protocadherin Fat 2 IPI00302641 479 kDa 86% IPI:IPI00307591.5 Tax_Id=9606 Gene_Symbol=ZNF609 Zinc finger protein IPI00307591 151 kDa 86% 609 IPI:IPI00328550.3 Tax_Id=9606 Gene_Symbol=THBS4 Thrombospondin-4 IPI00328550 106 kDa 86% IPI:IPI00332095.1 Tax_Id=9606 Gene_Symbol=BCAS3 Isoform 2 of Breast IPI00332095 101 kDa 86% carcinoma-amplified sequence 3 (+7) IPI:IPI00334362.7 Tax_Id=9606 Gene_Symbol=LRRC37A2 Leucine-rich IPI00334362 188 kDa 86% repeat-containing protein 37A2 (+7) IPI:IPI00339381.3 Tax_Id=9606 Gene_Symbol=HLTF Isoform 1 of Helicase- IPI00339381 114 kDa 86% like transcription factor (+2) IPI:IPI00383649.1 Tax_Id=9606 Gene_Symbol=CEBPA HP8 peptide IPI00383649 38 kDa 86% IPI:IPI00385649.2 Tax_Id=9606 Gene_Symbol=LRCH3 Isoform 2 of Leucine- IPI00385649 89 kDa 86% rich repeat and calponin homology domain-containing protein 3 (+4) IPI:IPI00444272.2 Tax_Id=9606 Gene_Symbol=LIFR Leukemia inhibitory IPI00444272 124 kDa 86% factor receptor IPI:IPI00477207.3 Tax_Id=9606 Gene_Symbol=MTRF1L Isoform 2 of Peptide IPI00477207 31 kDa 86% chain release factor 1-like, mitochondrial (+1) IPI:IPI00478429.2 Tax_Id=9606 Gene_Symbol=- Putative uncharacterized IPI00478429 84 kDa 86% protein ENSP00000346572 (+2) IPI:IPI00513701.2 Tax_Id=9606 Gene_Symbol=TMEM222 23 kDa protein IPI00513701 23 kDa 86% (+6) IPI:IPI00642581.1 Tax_Id=9606 Gene_Symbol=ROGDI 23 kDa protein IPI00642581 23 kDa 86% (+1) IPI:IPI00742682.2 Tax_Id=9606 Gene_Symbol=TPR Nucleoprotein TPR IPI00742682 267 kDa 86% IPI:IPI00744099.2 Tax_Id=9606 Gene_Symbol=- Conserved hypothetical IPI00744099 12 kDa 86% protein IPI:IPI00848163.1 Tax_Id=9606 Gene_Symbol=- Transposase, L1 family IPI00848163 13 kDa 86% protein IPI:IPI00922656.1 Tax_Id=9606 Gene_Symbol=PIK3C2G PIK3C2G protein IPI00922656 171 kDa 86% IPI:IPI00935888.1 Tax_Id=9606 IPI00935888 53 kDa 86% Gene_Symbol=LOC100289447;LOC100291332 hypothetical protein XP_002344275 IPI:IPI00937599.1 Tax_Id=9606 Gene_Symbol=LOC100287812 hypothetical IPI00937599 79 kDa 86% protein XP_002343253 IPI:IPI00939596.1 Tax_Id=9606 Gene_Symbol=- Putative uncharacterized IPI00939596 18 kDa 86% protein ENSP00000402815 (Fragment) IPI:IPI00395759.2 Tax_Id=9606 Gene_Symbol=- cDNA FLJ45290 fis, clone IPI00395759 25 kDa 86% BRHIP3002691 IPI:IPI00013302.1 Tax_Id=9606 Gene_Symbol=ADAM15 Disintegrin and IPI00013302 88 kDa 84% metalloproteinase domain-containing protein 15 (+7) IPI:IPI00640531.1 Tax_Id=9606 Gene_Symbol=LY6G5B;CSNK2B Isoform 1 IPI00640531 23 kDa 84% of Lymphocyte antigen 6 complex locus protein G5b (+4) IPI:IPI00022333.1 Tax_Id=9606 Gene_Symbol=BAI1 Brain-specific IPI00022333 174 kDa 83% angiogenesis inhibitor 1

48

IPI:IPI00385631.7 Tax_Id=9606 Gene_Symbol=ZZEF1 Isoform 1 of Zinc IPI00385631 331 kDa 83% finger ZZ-type and EF-hand domain-containing protein 1 (+2) IPI:IPI00065057.4 Tax_Id=9606 Gene_Symbol=CXorf58 Putative IPI00065057 39 kDa 82% uncharacterized protein CXorf58 IPI:IPI00396126.2 Tax_Id=9606 Gene_Symbol=C5orf24 Isoform 1 of UPF0461 IPI00396126 20 kDa 82% protein C5orf24 IPI:IPI00879984.6 Tax_Id=9606 Gene_Symbol=KLKB1 cDNA FLJ51250, IPI00879984 58 kDa 82% highly similar to Plasma kallikrein (+1) IPI:IPI00006024.4 Tax_Id=9606 Gene_Symbol=DOCK4 Isoform 2 of Dedicator IPI00006024 222 kDa 82% of cytokinesis protein 4 (+6) IPI:IPI00007880.1 Tax_Id=9606 Gene_Symbol=MS4A1 B-lymphocyte antigen IPI00007880 33 kDa 81% CD20 IPI:IPI00083235.7 Tax_Id=9606 Gene_Symbol=- 118 kDa protein IPI00083235 118 kDa 81% (+2) IPI:IPI00181821.3 Tax_Id=9606 Gene_Symbol=FAM193A Isoform 1 of IPI00181821 140 kDa 80% Uncharacterized protein C4orf8 (+2) IPI:IPI00142538.4 Tax_Id=9606 Gene_Symbol=SETX Isoform 1 of Probable IPI00142538 303 kDa 80% helicase senataxin (+3) IPI:IPI00719446.2 Tax_Id=9606 Gene_Symbol=C14orf145 Isoform 2 of IPI00719446 128 kDa 78% Uncharacterized protein C14orf145 (+1) IPI:IPI00007110.5 Tax_Id=9606 Gene_Symbol=OSGEPL1 Isoform 3 of IPI00007110 33 kDa 78% Probable O-sialoglycoprotein endopeptidase 2 (+2) IPI:IPI00000005.1 Tax_Id=9606 Gene_Symbol=NRAS GTPase NRas IPI00000005 21 kDa 76% (+6) IPI:IPI00000643.1 Tax_Id=9606 Gene_Symbol=BAG2 BAG family molecular IPI00000643 24 kDa 76% chaperone regulator 2 IPI:IPI00003968.1 Tax_Id=9606 Gene_Symbol=NDUFA9 NADH IPI00003968 43 kDa 76% dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial (+1) IPI:IPI00009906.5 Tax_Id=9606 Gene_Symbol=ARMCX3 Armadillo repeat- IPI00009906 43 kDa 76% containing X-linked protein 3 IPI:IPI00016676.1 Tax_Id=9606 Gene_Symbol=TOMM20 Mitochondrial IPI00016676 16 kDa 76% import receptor subunit TOM20 homolog IPI:IPI00018235.3 Tax_Id=9606 Gene_Symbol=PEF1 Peflin IPI00018235 30 kDa 76% IPI:IPI00018278.3 Tax_Id=9606 Gene_Symbol=H2AFV Histone H2A.V IPI00018278 14 kDa 76% (+2) IPI:IPI00018768.1 Tax_Id=9606 Gene_Symbol=TSN Translin IPI00018768 26 kDa 76% (+1) IPI:IPI00019770.3 Tax_Id=9606 Gene_Symbol=FAU ubiquitin-like protein fubi IPI00019770 14 kDa 76% and ribosomal protein S30 precursor IPI:IPI00021854.1 Tax_Id=9606 Gene_Symbol=APOA2 Apolipoprotein A-II IPI00021854 11 kDa 76% IPI:IPI00022229.1 Tax_Id=9606 Gene_Symbol=APOB Apolipoprotein B-100 IPI00022229 516 kDa 76% (+1) IPI:IPI00024915.2 Tax_Id=9606 Gene_Symbol=PRDX5 Isoform Mitochondrial IPI00024915 22 kDa 76% of Peroxiredoxin-5, mitochondrial (+3)

49

IPI:IPI00025257.1 Tax_Id=9606 Gene_Symbol=SEMA7A Semaphorin-7A IPI00025257 75 kDa 76% (+1) IPI:IPI00029133.4 Tax_Id=9606 Gene_Symbol=ATP5F1 ATP synthase subunit IPI00029133 29 kDa 76% b, mitochondrial IPI:IPI00031169.1 Tax_Id=9606 Gene_Symbol=RAB2A Ras-related protein IPI00031169 24 kDa 76% Rab-2A (+3) IPI:IPI00032496.2 Tax_Id=9606 Gene_Symbol=MCM8 Isoform 1 of DNA IPI00032496 94 kDa 76% replication licensing factor MCM8 (+2) IPI:IPI00033866.1 Tax_Id=9606 Gene_Symbol=BTBD1 BTB/POZ domain- IPI00033866 53 kDa 76% containing protein 1 (+1) IPI:IPI00060893.1 Tax_Id=9606 Gene_Symbol=C10orf104 UPF0448 protein IPI00060893 12 kDa 76% C10orf104 IPI:IPI00074489.1 Tax_Id=9606 Gene_Symbol=NDUFB10 NDUFB10 protein IPI00074489 20 kDa 76% (+1) IPI:IPI00075248.1 Tax_Id=9606 Gene_Symbol=CALM1;CALM2;CALM3 IPI00075248 17 kDa 76% Calmodulin (+4) IPI:IPI00100160.3 Tax_Id=9606 Gene_Symbol=CAND1 Isoform 1 of Cullin- IPI00100160 136 kDa 76% associated NEDD8-dissociated protein 1 (+1) IPI:IPI00103851.1 Tax_Id=9606 Gene_Symbol=LOC100190939 Putative IPI00103851 13 kDa 76% uncharacterized protein pp13759 (+2) IPI:IPI00106928.1 Tax_Id=9606 Gene_Symbol=PTPN2 protein tyrosine IPI00106928 41 kDa 76% phosphatase, non-receptor type 2 (+5) IPI:IPI00166729.4 Tax_Id=9606 Gene_Symbol=AZGP1 alpha-2-glycoprotein 1, IPI00166729 34 kDa 76% zinc (+4) IPI:IPI00166974.4 Tax_Id=9606 Gene_Symbol=AIPL1 aryl hydrocarbon IPI00166974 37 kDa 76% receptor interacting protein-like 1 isoform 2 (+3) IPI:IPI00172460.4 Tax_Id=9606 Gene_Symbol=AK2 Isoform 3 of Adenylate IPI00172460 22 kDa 76% kinase 2, mitochondrial (+3) IPI:IPI00180730.1 Tax_Id=9606 Gene_Symbol=- Similar to Elongation factor IPI00180730 50 kDa 76% 1-alpha 1 IPI:IPI00183302.7 Tax_Id=9606 Gene_Symbol=PHF8 Isoform 3 of PHD finger IPI00183302 107 kDa 76% protein 8 (+5) IPI:IPI00215790.6 Tax_Id=9606 Gene_Symbol=RPL38 60S ribosomal protein IPI00215790 8 kDa 76% L38 (+1) IPI:IPI00216237.5 Tax_Id=9606 Gene_Symbol=RPL36 60S ribosomal protein IPI00216237 12 kDa 76% L36 IPI:IPI00217471.3 Tax_Id=9606 Gene_Symbol=HBE1 Hemoglobin subunit IPI00217471 16 kDa 76% epsilon (+10) IPI:IPI00217612.3 Tax_Id=9606 Gene_Symbol=ARMC3 Isoform 1 of IPI00217612 96 kDa 76% Armadillo repeat-containing protein 3 (+4) IPI:IPI00219622.3 Tax_Id=9606 Gene_Symbol=PSMA2 Proteasome subunit IPI00219622 26 kDa 76% alpha type-2 (+2) IPI:IPI00219806.7 Tax_Id=9606 Gene_Symbol=S100A7 Protein S100-A7 IPI00219806 11 kDa 76% (+1)

50

IPI:IPI00219913.1 Tax_Id=9606 Gene_Symbol=USP14 Ubiquitin carboxyl- IPI00219913 56 kDa 76% terminal hydrolase 14 (+2) IPI:IPI00220362.5 Tax_Id=9606 Gene_Symbol=HSPE1 10 kDa heat shock IPI00220362 11 kDa 76% protein, mitochondrial (+4) IPI:IPI00288964.3 Tax_Id=9606 Gene_Symbol=ANO8 Isoform 1 of IPI00288964 136 kDa 76% Anoctamin-8 (+1) IPI:IPI00289344.4 Tax_Id=9606 Gene_Symbol=NCOR1 Isoform 1 of Nuclear IPI00289344 270 kDa 76% receptor corepressor 1 (+2) IPI:IPI00294398.1 Tax_Id=9606 Gene_Symbol=HADH Isoform 1 of IPI00294398 34 kDa 76% Hydroxyacyl-coenzyme A dehydrogenase, mitochondrial (+2) IPI:IPI00297477.3 Tax_Id=9606 Gene_Symbol=SNRPA1 U2 small nuclear IPI00297477 28 kDa 76% ribonucleoprotein A' (+2) IPI:IPI00305457.5 Tax_Id=9606 Gene_Symbol=SERPINA1 PRO2275 IPI00305457 13 kDa 76% (+1) IPI:IPI00399076.2 Tax_Id=9606 Gene_Symbol=TNFAIP8L3 Tumor necrosis IPI00399076 33 kDa 76% factor, alpha-induced protein 8-like protein 3 (+1) IPI:IPI00399119.1 Tax_Id=9606 Gene_Symbol=FLJ46321 FAM75-like protein IPI00399119 176 kDa 76% FLJ46321 IPI:IPI00418440.1 Tax_Id=9606 Gene_Symbol=TP53I3 Isoform 2 of Quinone IPI00418440 25 kDa 76% oxidoreductase PIG3 (+2) IPI:IPI00549242.2 Tax_Id=9606 Gene_Symbol=VPS8 Isoform 2 of Vacuolar IPI00549242 151 kDa 76% protein sorting-associated protein 8 homolog (+4) IPI:IPI00794880.1 Tax_Id=9606 Gene_Symbol=CHD7 Isoform 1 of IPI00794880 336 kDa 76% Chromodomain-helicase-DNA-binding protein 7 IPI:IPI00877933.1 Tax_Id=9606 Gene_Symbol=- 15 kDa protein IPI00877933 15 kDa 76% IPI:IPI00936925.1 Tax_Id=9606 IPI00936925 16 kDa 76% Gene_Symbol=LOC100286887;LOC100288609 hypothetical protein XP_002342631 IPI:IPI00094972.8 Tax_Id=9606 Gene_Symbol=TTLL8 Putative IPI00094972 93 kDa 76% uncharacterized protein TTLL8 (+1) IPI:IPI00167498.3 Tax_Id=9606 Gene_Symbol=C9orf93 Isoform 2 of IPI00167498 142 kDa 76% Uncharacterized protein C9orf93 (+1) IPI:IPI00024701.3 Tax_Id=9606 Gene_Symbol=COL4A3BP Isoform 1 of IPI00024701 71 kDa 75% Collagen type IV alpha-3-binding protein (+1) IPI:IPI00000996.2 Tax_Id=9606 Gene_Symbol=KIAA1539 Isoform 1 of IPI00000996 57 kDa 74% Uncharacterized protein KIAA1539 (+3) IPI:IPI00170751.8 Tax_Id=9606 Gene_Symbol=TIGD5 tigger transposable IPI00170751 69 kDa 74% element derived 5 IPI:IPI00296533.6 Tax_Id=9606 Gene_Symbol=RNF144B E3 ubiquitin-protein IPI00296533 34 kDa 72% ligase RNF144B (+1) IPI:IPI00010903.2 Tax_Id=9606 Gene_Symbol=DOPEY1 Dopey family IPI00010903 267 kDa 71% member 1 (+1) IPI:IPI00011592.3 Tax_Id=9606 Gene_Symbol=DYNC1LI2 Cytoplasmic IPI00011592 54 kDa 71% dynein 1 light intermediate chain 2 (+2)

51

IPI:IPI00005948.1 Tax_Id=9606 Gene_Symbol=MRI1 Isoform 1 of IPI00005948 39 kDa 71% Methylthioribose-1-phosphate isomerase (+1) IPI:IPI00290368.3 Tax_Id=9606 Gene_Symbol=HDC Histidine decarboxylase IPI00290368 74 kDa 71% IPI:IPI00032849.2 Tax_Id=9606 Gene_Symbol=NOP16 Nucleolar protein 16 IPI00032849 21 kDa 70% (+3) IPI:IPI00455316.3 Tax_Id=9606 Gene_Symbol=FRAS1 Fraser syndrome 1 IPI00455316 444 kDa 70% protein isoform 1 precursor (+1) IPI:IPI00101968.3 Tax_Id=9606 Gene_Symbol=DBNL Isoform 3 of Drebrin- IPI00101968 49 kDa 69% like protein (+10) IPI:IPI00065287.7 Tax_Id=9606 Gene_Symbol=C17orf66 Isoform 1 of IPI00065287 66 kDa 69% Uncharacterized protein C17orf66 (+3) IPI:IPI00029606.1 Tax_Id=9606 Gene_Symbol=ADAM17 Isoform B of IPI00029606 79 kDa 68% Disintegrin and metalloproteinase domain-containing protein 17 (+1) IPI:IPI00021841.1 Tax_Id=9606 Gene_Symbol=APOA1 Apolipoprotein A-I IPI00021841 31 kDa 66% (+1) IPI:IPI00219160.3 Tax_Id=9606 Gene_Symbol=RPL34 60S ribosomal protein IPI00219160 13 kDa 66% L34 IPI:IPI00152496.3 Tax_Id=9606 Gene_Symbol=TRIM40 Isoform 2 of Tripartite IPI00152496 26 kDa 66% motif-containing protein 40 (+3) IPI:IPI00013826.2 Tax_Id=9606 Gene_Symbol=NPR3 Isoform 1 of Atrial IPI00013826 60 kDa 64% natriuretic peptide clearance receptor (+2) IPI:IPI00013455.8 Tax_Id=9606 Gene_Symbol=CLIP1 Isoform 1 of CAP-Gly IPI00013455 162 kDa 64% domain-containing linker protein 1 (+2) IPI:IPI00145593.7 Tax_Id=9606 Gene_Symbol=NOM1 Nucleolar MIF4G IPI00145593 96 kDa 64% domain-containing protein 1 IPI:IPI00022149.1 Tax_Id=9606 Gene_Symbol=PIP5K1A Isoform 2 of IPI00022149 56 kDa 63% Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha (+4) IPI:IPI00004970.4 Tax_Id=9606 Gene_Symbol=UTP20;LOC653877 Small IPI00004970 318 kDa 63% subunit processome component 20 homolog (+1) IPI:IPI00025311.2 Tax_Id=9606 Gene_Symbol=BCAS1 Isoform 1 of Breast IPI00025311 62 kDa 63% carcinoma-amplified sequence 1 (+2) IPI:IPI00006935.3 Tax_Id=9606 Gene_Symbol=EIF5A2 Eukaryotic translation IPI00006935 17 kDa 62% initiation factor 5A-2 (+6) IPI:IPI00298410.2 Tax_Id=9606 Gene_Symbol=PIK3CD Phosphatidylinositol- IPI00298410 119 kDa 61% 4,5-bisphosphate 3-kinase catalytic subunit delta isoform (+1) IPI:IPI00746581.3 Tax_Id=9606 Gene_Symbol=C22orf36 Isoform 2 of IPI00746581 17 kDa 61% Leucine-rich repeat-containing protein C22orf36 IPI:IPI00794944.1 Tax_Id=9606 Gene_Symbol=- Hypothetical short protein IPI00794944 3 kDa 61% IPI:IPI00152946.1 Tax_Id=9606 Gene_Symbol=RACGAP1 Rac GTPase- IPI00152946 71 kDa 60% activating protein 1 (+1) IPI:IPI00013219.1 Tax_Id=9606 Gene_Symbol=ILK Integrin-linked protein IPI00013219 51 kDa 60% kinase (+2) IPI:IPI00012225.3 Tax_Id=9606 Gene_Symbol=TAF1D TATA box-binding IPI00012225 32 kDa 59% protein-associated factor RNA polymerase I subunit D

52

IPI:IPI00021119.1 Tax_Id=9606 Gene_Symbol=CHST1 Carbohydrate IPI00021119 47 kDa 59% sulfotransferase 1 IPI:IPI00020416.8 Tax_Id=9606 Gene_Symbol=TPP2 Tripeptidyl-peptidase 2 IPI00020416 138 kDa 59% (+1) IPI:IPI00556358.1 Tax_Id=9606 Gene_Symbol=CRB1 Crumbs homolog 1 IPI00556358 48 kDa 59% isoform II variant (Fragment) IPI:IPI00719505.2 Tax_Id=9606 Gene_Symbol=RABL2A RAB, member of IPI00719505 18 kDa 59% RAS oncogene family-like 2A (+1) IPI:IPI00938232.1 Tax_Id=9606 Gene_Symbol=LOC100288878 hypothetical IPI00938232 15 kDa 58% protein XP_002342781 IPI:IPI00031015.1 Tax_Id=9606 Gene_Symbol=SLBP Histone RNA hairpin- IPI00031015 31 kDa 58% binding protein (+4) IPI:IPI00927439.1 Tax_Id=9606 Gene_Symbol=- 107 kDa protein IPI00927439 107 kDa 58% IPI:IPI00009895.1 Tax_Id=9606 Gene_Symbol=ZDHHC3 Isoform 1 of IPI00009895 37 kDa 58% Palmitoyltransferase ZDHHC3 (+5) IPI:IPI00297954.1 Tax_Id=9606 Gene_Symbol=FAM87B Protein FAM87B IPI00297954 18 kDa 58% (+1) IPI:IPI00883684.1 Tax_Id=9606 Gene_Symbol=- RNA-directed DNA IPI00883684 5 kDa 57% polymerase (reverse transcriptase), related domain containing protein IPI:IPI00329038.5 Tax_Id=9606 Gene_Symbol=CDK5RAP2 Isoform 1 of IPI00329038 215 kDa 57% CDK5 regulatory subunit-associated protein 2 (+6) IPI:IPI00878221.1 Tax_Id=9606 Gene_Symbol=- 66 kDa protein IPI00878221 66 kDa 56% IPI:IPI00218848.5 Tax_Id=9606 Gene_Symbol=ATP5I ATP synthase, H+ IPI00218848 8 kDa 56% transporting, mitochondrial F0 complex, subunit E IPI:IPI00064158.6 Tax_Id=9606 Gene_Symbol=TTBK1 Isoform 1 of Tau- IPI00064158 143 kDa 55% tubulin kinase 1 IPI:IPI00002614.3 Tax_Id=9606 Gene_Symbol=UVRAG UV radiation IPI00002614 78 kDa 55% resistance-associated gene protein IPI:IPI00001432.1 Tax_Id=9606 Gene_Symbol=PCDHB2 Protocadherin beta-2 IPI00001432 87 kDa 55% IPI:IPI00743271.3 Tax_Id=9606 Gene_Symbol=GIT1 Putative uncharacterized IPI00743271 42 kDa 54% protein DKFZp686G1640 IPI:IPI00005661.1 Tax_Id=9606 Gene_Symbol=MLX Isoform Gamma of Max- IPI00005661 33 kDa 54% like protein X IPI:IPI00029733.1 Tax_Id=9606 Gene_Symbol=AKR1C1 Aldo-keto reductase IPI00029733 37 kDa 54% family 1 member C1 (+6) IPI:IPI00419041.3 Tax_Id=9606 Gene_Symbol=LOC100132731 IPI00419041 66 kDa 53% Uncharacterized protein FLJ43738 IPI:IPI00396468.3 Tax_Id=9606 Gene_Symbol=- 36 kDa protein IPI00396468 36 kDa 53% IPI:IPI00386199.2 Tax_Id=9606 Gene_Symbol=C19orf6 Isoform 1 of IPI00386199 68 kDa 52% Membralin (+1) IPI:IPI00795981.1 Tax_Id=9606 Gene_Symbol=- 14 kDa protein IPI00795981 14 kDa 52% IPI:IPI00879569.3 Tax_Id=9606 Gene_Symbol=LOC729756 similar to IPI00879569 32 kDa 52% hCG2041108 IPI:IPI00008726.4 Tax_Id=9606 Gene_Symbol=IREB2 Iron-responsive IPI00008726 105 kDa 51%

53

element-binding protein 2 (+1) IPI:IPI00024278.2 Tax_Id=9606 Gene_Symbol=ABCC9 Isoform SUR2A of IPI00024278 174 kDa 50% ATP-binding cassette transporter sub-family C member 9 (+2) IPI:IPI00328798.1 Tax_Id=9606 Gene_Symbol=BCL9L Isoform 1 of B-cell IPI00328798 157 kDa 49% CLL/lymphoma 9-like protein (+5) IPI:IPI00552756.4 Tax_Id=9606 Gene_Symbol=MTIF3 Translation initiation IPI00552756 32 kDa 49% factor IF-3, mitochondrial IPI:IPI00293464.5 Tax_Id=9606 Gene_Symbol=DDB1;LOC100290337 DNA IPI00293464 127 kDa 49% damage-binding protein 1 (+2) IPI:IPI00217513.1 Tax_Id=9606 Gene_Symbol=NPAS3 Isoform 1 of Neuronal IPI00217513 101 kDa 49% PAS domain-containing protein 3 (+4) IPI:IPI00002938.1 Tax_Id=9606 Gene_Symbol=ABT1 Activator of basal IPI00002938 31 kDa 48% transcription 1 IPI:IPI00747917.1 Tax_Id=9606 Gene_Symbol=- Similar to Tyrosine-protein IPI00747917 10 kDa 48% phosphatase non-receptor type 1 IPI:IPI00011769.1 Tax_Id=9606 Gene_Symbol=NR5A2 Isoform 2 of Nuclear IPI00011769 61 kDa 48% receptor subfamily 5 group A member 2 (+3) IPI:IPI00909943.1 Tax_Id=9606 Gene_Symbol=- cDNA FLJ52922, highly IPI00909943 18 kDa 48% similar to Serine/threonine-protein kinase WNK4 IPI:IPI00010426.8 Tax_Id=9606 Gene_Symbol=FOXJ3 Isoform 1 of Forkhead IPI00010426 69 kDa 48% box protein J3 (+3) IPI:IPI00290755.6 Tax_Id=9606 Gene_Symbol=FAM81A hypothetical protein IPI00290755 42 kDa 47% LOC145773 IPI:IPI00163185.8 Tax_Id=9606 Gene_Symbol=AGAP3 centaurin, gamma 3 IPI00163185 98 kDa 47% isoform a (+7) IPI:IPI00395903.1 Tax_Id=9606 Gene_Symbol=TMEM106B Transmembrane IPI00395903 31 kDa 47% protein 106B IPI:IPI00006094.4 Tax_Id=9606 Gene_Symbol=RIMS3 Regulating synaptic IPI00006094 33 kDa 46% membrane exocytosis protein 3 IPI:IPI00443987.1 Tax_Id=9606 Gene_Symbol=LOC400743 cDNA FLJ45933 IPI00443987 20 kDa 46% fis, clone PLACE7003639 (+1) IPI:IPI00885174.1 Tax_Id=9606 Gene_Symbol=PLEKHG4B Pleckstrin IPI00885174 139 kDa 45% homology domain-containing family G member 4B IPI:IPI00219703.3 Tax_Id=9606 Gene_Symbol=PVALB Parvalbumin alpha IPI00219703 12 kDa 45% (+3) IPI:IPI00012593.1 Tax_Id=9606 Gene_Symbol=DNMT3B Isoform 1 of DNA IPI00012593 96 kDa 45% (cytosine-5)-methyltransferase 3B (+5) IPI:IPI00015538.1 Tax_Id=9606 Gene_Symbol=PRKD3 Isoform 1 of IPI00015538 100 kDa 43% Serine/threonine-protein kinase D3 (+2) IPI:IPI00099037.9 Tax_Id=9606 Gene_Symbol=ADAD1 Isoform 1 of IPI00099037 64 kDa 43% Adenosine deaminase domain-containing protein 1 (+2) IPI:IPI00165092.3 Tax_Id=9606 Gene_Symbol=YARS2 Tyrosyl-tRNA IPI00165092 53 kDa 43% synthetase, mitochondrial IPI:IPI00289819.4 Tax_Id=9606 Gene_Symbol=IGF2R Cation-independent IPI00289819 274 kDa 42%

54

mannose-6-phosphate receptor (+1) IPI:IPI00893362.1 Tax_Id=9606 Gene_Symbol=RYR3 Putative uncharacterized IPI00893362 552 kDa 42% protein RYR3 IPI:IPI00015920.2 Tax_Id=9606 Gene_Symbol=SLC25A10 Isoform 1 of IPI00015920 31 kDa 42% Mitochondrial dicarboxylate carrier (+2) IPI:IPI00307536.2 Tax_Id=9606 Gene_Symbol=TEX11 Isoform 1 of Testis- IPI00307536 108 kDa 42% expressed sequence 11 protein (+3) IPI:IPI00937425.1 Tax_Id=9606 Gene_Symbol=LOC100288363 hypothetical IPI00937425 19 kDa 42% protein XP_002344266 IPI:IPI00164387.1 Tax_Id=9606 Gene_Symbol=KCNMA1 Isoform 5 of IPI00164387 131 kDa 42% Calcium-activated potassium channel subunit alpha-1 (+10) IPI:IPI00065518.6 Tax_Id=9606 Gene_Symbol=DUOXA1 Dual oxidase IPI00065518 49 kDa 41% maturation factor 1 delta (+1) IPI:IPI00005811.3 Tax_Id=9606 Gene_Symbol=MLH3 Isoform 1 of DNA IPI00005811 164 kDa 40% mismatch repair protein Mlh3 (+1) IPI:IPI00470809.4 Tax_Id=9606 Gene_Symbol=SEL1L3;SERINC2 Isoform 1 IPI00470809 129 kDa 40% of SEL1-like repeat-containing protein KIAA0746 (+2) IPI:IPI00871825.1 Tax_Id=9606 Gene_Symbol=CDH8 Putative uncharacterized IPI00871825 78 kDa 40% protein CDH8 IPI:IPI00879193.3 Tax_Id=9606 Gene_Symbol=TTC28 Tetratricopeptide repeat IPI00879193 271 kDa 39% protein 28 IPI:IPI00883858.2 Tax_Id=9606 Gene_Symbol=C1orf81 Conserved IPI00883858 43 kDa 39% hypothetical protein IPI:IPI00027481.2 Tax_Id=9606 Gene_Symbol=ABCB1 Multidrug resistance IPI00027481 141 kDa 39% protein 1 (+3) IPI:IPI00465048.7 Tax_Id=9606 Gene_Symbol=RUFY2 RUN and FYVE IPI00465048 74 kDa 39% domain-containing 2 isoform a (+1) IPI:IPI00297473.2 Tax_Id=9606 Gene_Symbol=TRAF3 TNF receptor- IPI00297473 64 kDa 38% associated factor 3 (+1) IPI:IPI00552137.3 Tax_Id=9606 Gene_Symbol=REPS1 Putative IPI00552137 81 kDa 38% uncharacterized protein REPS1 (+7) IPI:IPI00395561.1 Tax_Id=9606 Gene_Symbol=PLCB1 Isoform B of 1- IPI00395561 134 kDa 38% phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta-1 (+2) IPI:IPI00741894.2 Tax_Id=9606 Gene_Symbol=LOC730429 similar to IPI00741894 309 kDa 37% ubiquitin protein ligase E3 component n-recognin 5 isoform 1 IPI:IPI00171336.3 Tax_Id=9606 Gene_Symbol=RIOK1 Serine/threonine- IPI00171336 66 kDa 37% protein kinase RIO1 IPI:IPI00328360.5 Tax_Id=9606 Gene_Symbol=ZNF434 cDNA FLJ77128, IPI00328360 79 kDa 36% highly similar to Homo sapiens zinc finger protein 434 (ZNF434) mRNA (+2) IPI:IPI00009542.1 Tax_Id=9606 Gene_Symbol=MAGED2 Isoform 1 of IPI00009542 65 kDa 36% Melanoma-associated antigen D2 (+5) IPI:IPI00015533.4 Tax_Id=9606 Gene_Symbol=ZNF552 Zinc finger protein IPI00015533 46 kDa 36% 552 IPI:IPI00382757.1 Tax_Id=9606 Gene_Symbol=- Putative uncharacterized IPI00382757 13 kDa 36%

55

protein IPI:IPI00783604.2 Tax_Id=9606 Gene_Symbol=EPHA6 EPH receptor A6 IPI00783604 127 kDa 35% isoform a (+1) IPI:IPI00419647.2 Tax_Id=9606 Gene_Symbol=PTCH2 Isoform 1 of Protein IPI00419647 131 kDa 35% patched homolog 2 (+1) IPI:IPI00888980.1 Tax_Id=9606 Gene_Symbol=LOC100130803 similar to IPI00888980 10 kDa 34% hCG2041493 IPI:IPI00251596.2 Tax_Id=9606 Gene_Symbol=COL23A1 Isoform 1 of IPI00251596 52 kDa 34% Collagen alpha-1(XXIII) chain IPI:IPI00065096.4 Tax_Id=9606 Gene_Symbol=ZNF528;ZNF534 Putative IPI00065096 21 kDa 34% uncharacterized protein IPI:IPI00900279.1 Tax_Id=9606 Gene_Symbol=C6orf217 Putative IPI00900279 29 kDa 34% uncharacterized protein C6orf217 IPI:IPI00256684.2 Tax_Id=9606 Gene_Symbol=AP2A1 Isoform B of AP-2 IPI00256684 105 kDa 33% complex subunit alpha-1 (+2) IPI:IPI00023756.2 Tax_Id=9606 Gene_Symbol=JARID2 Protein Jumonji IPI00023756 139 kDa 33% (+2) IPI:IPI00000192.2 Tax_Id=9606 Gene_Symbol=SON Isoform F of Protein SON IPI00000192 264 kDa 33% (+10) IPI:IPI00166555.3 Tax_Id=9606 Gene_Symbol=RBM26 114 kDa protein IPI00166555 114 kDa 32% (+5) IPI:IPI00252153.3 Tax_Id=9606 Gene_Symbol=FRMD5 Isoform 1 of FERM IPI00252153 65 kDa 32% domain-containing protein 5 (+3) IPI:IPI00909087.1 Tax_Id=9606 Gene_Symbol=PCSK9 cDNA FLJ60453, IPI00909087 23 kDa 32% highly similar to Proprotein convertase subtilisin/kexin type 9 IPI:IPI00063106.4 Tax_Id=9606 Gene_Symbol=SENP5 Sentrin-specific IPI00063106 87 kDa 32% protease 5 (+1) IPI:IPI00930334.1 Tax_Id=9606 Gene_Symbol=LOC348751 hypothetical IPI00930334 28 kDa 32% protein IPI:IPI00016636.1 Tax_Id=9606 Gene_Symbol=RPS14 Putative IPI00016636 18 kDa 31% uncharacterized protein RPS14 IPI:IPI00396012.3 Tax_Id=9606 Gene_Symbol=GRM8 Isoform B of IPI00396012 102 kDa 31% Metabotropic glutamate receptor 8 (+1) IPI:IPI00298935.4 Tax_Id=9606 Gene_Symbol=KDM3B Isoform 1 of Lysine- IPI00298935 192 kDa 31% specific demethylase 3B (+1) IPI:IPI00012104.1 Tax_Id=9606 Gene_Symbol=- Putative uncharacterized IPI00012104 37 kDa 30% protein IPI:IPI00024279.4 Tax_Id=9606 Gene_Symbol=HEATR1 HEAT repeat- IPI00024279 242 kDa 30% containing protein 1 (+1) IPI:IPI00761166.2 Tax_Id=9606 Gene_Symbol=DENND2A Putative IPI00761166 89 kDa 30% uncharacterized protein DENND2A (+3) IPI:IPI00025323.7 Tax_Id=9606 Gene_Symbol=MAP9 Isoform 1 of IPI00025323 74 kDa 30% Microtubule-associated protein 9 IPI:IPI00012075.1 Tax_Id=9606 Gene_Symbol=NPPC C-type natriuretic IPI00012075 13 kDa 30%

56

peptide IPI:IPI00294728.1 Tax_Id=9606 Gene_Symbol=DMXL1 DmX-like protein 1 IPI00294728 338 kDa 30% IPI:IPI00302453.4 Tax_Id=9606 Gene_Symbol=DNAH9 Isoform 1 of Dynein IPI00302453 512 kDa 30% heavy chain 9, axonemal (+1) IPI:IPI00018381.1 Tax_Id=9606 Gene_Symbol=TLL1 Isoform 1 of Tolloid-like IPI00018381 115 kDa 30% protein 1 (+1) IPI:IPI00068068.1 Tax_Id=9606 Gene_Symbol=C21orf63 Isoform A of IPI00068068 49 kDa 29% Uncharacterized protein C21orf63 (+4) IPI:IPI00556241.3 Tax_Id=9606 Gene_Symbol=SECISBP2 SECIS-binding IPI00556241 95 kDa 29% protein 2 (+1) IPI:IPI00217934.6 Tax_Id=9606 Gene_Symbol=ZNF521 Zinc finger protein IPI00217934 152 kDa 29% 521 (Fragment) (+2) IPI:IPI00942998.1 Tax_Id=9606 Gene_Symbol=- Putative uncharacterized IPI00942998 30 kDa 29% protein ENSP00000416538 (Fragment) IPI:IPI00304527.4 Tax_Id=9606 Gene_Symbol=FAM83B Protein FAM83B IPI00304527 115 kDa 29% IPI:IPI00383888.3 Tax_Id=9606 Gene_Symbol=DCST2 Isoform 2 of DC- IPI00383888 72 kDa 29% STAMP domain-containing protein 2 (+2) IPI:IPI00375533.5 Tax_Id=9606 Gene_Symbol=UBA3 ubiquitin-activating IPI00375533 50 kDa 29% enzyme 3 isoform 2 (+3) IPI:IPI00217439.6 Tax_Id=9606 Gene_Symbol=CDAN1 Isoform 1 of Codanin- IPI00217439 134 kDa 28% 1 (+2) IPI:IPI00009724.3 Tax_Id=9606 Gene_Symbol=EFCAB6 Isoform 1 of EF-hand IPI00009724 173 kDa 28% calcium-binding domain-containing protein 6 (+2) IPI:IPI00012533.3 Tax_Id=9606 Gene_Symbol=POU2F2 Isoform 1 of POU IPI00012533 51 kDa 28% domain, class 2, transcription factor 2 (+3) IPI:IPI00936816.1 Tax_Id=9606 Gene_Symbol=LOC100289054 hypothetical IPI00936816 22 kDa 27% protein XP_002343716 IPI:IPI00033892.3 Tax_Id=9606 Gene_Symbol=GZF1 GDNF-inducible zinc IPI00033892 80 kDa 27% finger protein 1 IPI:IPI00465074.2 Tax_Id=9606 Gene_Symbol=KLC3 Isoform 3 of Kinesin IPI00465074 57 kDa 27% light chain 3 (+2) IPI:IPI00033217.3 Tax_Id=9606 Gene_Symbol=AASS Alpha-aminoadipic IPI00033217 102 kDa 27% semialdehyde synthase, mitochondrial (+3) IPI:IPI00064607.3 Tax_Id=9606 Gene_Symbol=MEGF10 Isoform 1 of Multiple IPI00064607 122 kDa 27% epidermal growth factor-like domains 10 IPI:IPI00018860.1 Tax_Id=9606 Gene_Symbol=ULBP2 NKG2D ligand 2 IPI00018860 27 kDa 27% (+5) IPI:IPI00888338.2 Tax_Id=9606 Gene_Symbol=LOC100130701 similar to IPI00888338 40 kDa 27% hCG1657343 IPI:IPI00029596.1 Tax_Id=9606 Gene_Symbol=ARL4A ADP-ribosylation IPI00029596 23 kDa 26% factor-like protein 4A (+1) IPI:IPI00793545.1 Tax_Id=9606 Gene_Symbol=hCG_2015435 13 kDa protein IPI00793545 13 kDa 26% IPI:IPI00016910.1 Tax_Id=9606 Gene_Symbol=EIF3C;EIF3CL Eukaryotic IPI00016910 105 kDa 26% translation initiation factor 3 subunit C (+1)

57

IPI:IPI00009057.2 Tax_Id=9606 Gene_Symbol=G3BP2 Isoform A of Ras IPI00009057 54 kDa 26% GTPase-activating protein-binding protein 2 (+1) IPI:IPI00166168.2 Tax_Id=9606 Gene_Symbol=C6orf214 Putative IPI00166168 19 kDa 26% uncharacterized protein C6orf214 IPI:IPI00022058.3 Tax_Id=9606 Gene_Symbol=ASAP2 Isoform 1 of Arf-GAP IPI00022058 112 kDa 25% with SH3 domain, ANK repeat and PH domain-containing protein 2 (+1) IPI:IPI00424869.2 Tax_Id=9606 Gene_Symbol=RAP1GDS1 RAP1, GTP-GDP IPI00424869 57 kDa 25% dissociation stimulator 1 isoform 6 (+5) IPI:IPI00302045.1 Tax_Id=9606 Gene_Symbol=NEUROD2 Neurogenic IPI00302045 41 kDa 25% differentiation factor 2 IPI:IPI00073110.4 Tax_Id=9606 Gene_Symbol=FYB cDNA FLJ56106, highly IPI00073110 92 kDa 25% similar to Homo sapiens FYN binding protein (FYB-120/130) (FYB), transcript variant 1, mRNA IPI:IPI00164066.3 Tax_Id=9606 Gene_Symbol=CCDC136 Isoform 4 of Coiled- IPI00164066 135 kDa 25% coil domain-containing protein 136 (+4) IPI:IPI00027820.2 Tax_Id=9606 Gene_Symbol=ESPN Isoform 1 of Espin IPI00027820 92 kDa 25% IPI:IPI00017964.1 Tax_Id=9606 Gene_Symbol=SNRPD3 Small nuclear IPI00017964 14 kDa 25% ribonucleoprotein Sm D3 (+2) IPI:IPI00452091.1 Tax_Id=9606 Gene_Symbol=DZIP1 Isoform 1 of Zinc finger IPI00452091 99 kDa 24% protein DZIP1 (+1) IPI:IPI00249282.9 Tax_Id=9606 Gene_Symbol=MYB v-myb myeloblastosis IPI00249282 68 kDa 24% viral oncogene homolog isoform 7 IPI:IPI00936219.1 Tax_Id=9606 Gene_Symbol=LOC340970 similar to tripartite IPI00936219 34 kDa 23% motif-containing 53 (+1) IPI:IPI00141118.6 Tax_Id=9606 Gene_Symbol=EPC2 Enhancer of polycomb IPI00141118 91 kDa 23% homolog 2 IPI:IPI00004341.8 Tax_Id=9606 Gene_Symbol=FBXL17 Isoform 1 of F- IPI00004341 76 kDa 23% box/LRR-repeat protein 17 IPI:IPI00023013.4 Tax_Id=9606 Gene_Symbol=UTY Isoform 1 of Histone IPI00023013 150 kDa 23% demethylase UTY (+1) IPI:IPI00746232.2 Tax_Id=9606 Gene_Symbol=CCDC112 Isoform 1 of Coiled- IPI00746232 54 kDa 23% coil domain-containing protein 112 (+1) IPI:IPI00480049.2 Tax_Id=9606 Gene_Symbol=OCRL Isoform B of Inositol IPI00480049 103 kDa 22% polyphosphate 5-phosphatase OCRL-1 (+2) IPI:IPI00470883.2 Tax_Id=9606 Gene_Symbol=STAG2 stromal antigen 2 IPI00470883 146 kDa 21% isoform a (+1) IPI:IPI00929247.1 Tax_Id=9606 Gene_Symbol=RPRD1A Conserved IPI00929247 10 kDa 21% hypothetical protein IPI:IPI00020356.4 Tax_Id=9606 Gene_Symbol=MAP1A 331 kDa protein IPI00020356 331 kDa 20% (+2) IPI:IPI00293125.5 Tax_Id=9606 Gene_Symbol=ACOX2 Peroxisomal acyl- IPI00293125 77 kDa 20% coenzyme A oxidase 2 (+1) IPI:IPI00167811.1 Tax_Id=9606 Gene_Symbol=TC2N Isoform 1 of Tandem C2 IPI00167811 55 kDa 20% domains nuclear protein (+2)

58

IPI:IPI00930202.1 Tax_Id=9606 IPI00930202 12 kDa 20% Gene_Symbol=LOC100289789;LOC100289561;LOC100292484 hypothetical protein XP_002342787 IPI:IPI00941323.1 Tax_Id=9606 Gene_Symbol=- 10 kDa protein IPI00941323 10 kDa 20% IPI:IPI00152007.1 Tax_Id=9606 Gene_Symbol=ARHGEF17 Rho guanine IPI00152007 222 kDa 20% nucleotide exchange factor 17 IPI:IPI00298007.3 Tax_Id=9606 Gene_Symbol=C6orf150 Isoform 1 of IPI00298007 59 kDa 20% Uncharacterized protein C6orf150 (+1) IPI:IPI00006192.2 Tax_Id=9606 Gene_Symbol=MAP3K13 Isoform 1 of IPI00006192 108 kDa 20% Mitogen-activated protein kinase kinase kinase 13 (+5) IPI:IPI00011757.2 Tax_Id=9606 Gene_Symbol=ELL2 RNA polymerase II IPI00011757 72 kDa 20% elongation factor ELL2

CHAPTER II

Development of Random Retroviral Nuclear-Targeted Peptide Libraries as Tools for

Discovery of Novel HIV-1 Inhibitors

59

60

INTRODUCTION

The COP9 Signalosome was identified as a potential target of HIV-1 through the use of cytoplasmic retroviral peptide libraries. Due to the fact that the CSN is primarily a nuclear-localized complex, and integration into the host genome is a hallmark of

Retroviridae such as HIV-1, we hypothesized that a peptide library targeted to the nucleus would have a higher chance of disrupting the HIV-1 infection by interacting with

HIV-1 Integrase or a cellular factor required for successful integration.

HIV-1 Integrase (IN) presents a particularly attractive target for drug development as this enzyme is absolutely critical to the viral lifecycle and, unlike Protease, has no known analogous proteins in the host cell. A large number of Integrase molecules,

(between 40 and 400) are packaged into each HIV-1 virion, which are released into the cytoplasm following viral fusion and uncoating of the Capsid [1]. Following reverse transcription, IN initiates the process of preparing the viral cDNA for insertion into the host genome by clipping a CA dinucleotide from both ends of the cDNA strand (3’ processing), thereby generating reactive 3’ hydroxyl residues necessary for strand transfer [2]. Following the processing event, IN binds both ends of the cDNA and assembles into a pre-integration complex (PIC), consisting of viral proteins Matrix (MA),

Reverse Transcriptase (RT), nucleocapsid (NC), and Vpr, along with cellular proteins including INT1, LEDGF, HSP60, EED, PML, BAF, and HMGA1. The role of the PIC is to facilitate nuclear localization of the viral cDNA and IN by crossing the nuclear envelope, and binding host DNA [2–9].

Once in the nucleus, IN preferentially targets transcribed genes, and initiates the integration of the viral genome by ligating the 3’-OH ends of the cDNA to the 5’-DNA

61 phosphate of the host chromosome, attacking the major groove of the chromosomal

DNA, in a process called strand transfer. Once this reaction is complete, cellular enzymes assist with the ligation of the 5’end of the viral cDNA into the chromosome

[10–12]. The viral genes are now transcribed and translated to initiate the replication of new virions and the later stages of infection.

Currently, there is only one FDA-approved IN inhibitor available to HIV-1 patients, Raltegravir. Raltegravir is a diketo acid compound that, along with other analogous diketo acid compounds, was identified through an in vitro screen for its ability to block the strand transfer reaction [13]. Although a potent HIV-1 inhibitor in vitro, like with other antiretroviral drugs, patients soon developed resistant strains of HIV-1 due to the fact the IN is a highly polymorphous protein, with a much lower degree of amino acid conservation than RT or PR [14]. Although chemical compounds and in vitro biochemical assay are invaluable tools of drug discovery, they are limited by the fact that the reactions they monitor take place out of context of a cellular milieu and therefore are not capable of detecting indirect inhibitors of viral proteins.

The potential of retroviral peptide libraries to create peptidic sequences with functionality in eukaryotic cells has previously been demonstrated in Wolkowicz, et al

(2005), where a random peptide library was fused to the CCR5 chemokine receptor for the expression of peptides on the cell surface [15]. This chapter describes the design and development of a retroviral, nuclear-targeted random peptide library (NLS-RPL) as well as a screening utilizing one such library for the search of novel HIV-1 IN inhibitors in T- cells.

62

MATERIALS AND METHODS

Plasmids:

The retroviral transfer vector pBMN.i.mCherry was constructed by amplifying mCherry from pmCherry-C1 (Clontech) using the forward primer with extending NcoI site ATCGATGGATCCCCACCATGGTGAGCAAGGGCGAGGAG and reverse primer with extending XhoI site ATGGACGAGCTGTACAAGTAACTCGAGGATCGATC, and inserting it into partially digested pBMN-i-eGFP (Gary Nolan, Stanford University) with NcoI/SalI. The GNF construct was created by amplifying GFP from pBMN.i.eGFP with the forward primer TATAAGATCTCCACCATGGATCCGTGAGCA-

AGGGCGAGGA containing a BglII site followed by a Kozak sequence and a BamHI site, and a reverse primer TATACTCGAGTTACT-TGTACAGCTCGTCCAT containing an XhoI site; the amplified sequence was digested with BglII and XhoI, and was inserted into the pBMN.i.mCherry vector digested with BamHI and XhoI. The construct SBP-

GNF was created by amplifying the SBP-tag from SBP-Citrine with the forward primer with extending BglII site TATAAGATCTCGACGAGAAGACCACCGGCTGG and reverse primer with extending BamHI and XhoI sites TATACTCGAGTATATAGGA-

TCCGGGCTCCCTCTGGCCCT, digested with BglII/XhoI and inserted into GNF digested with BamHI/XhoI. The resulting plasmid was subsequently re-digested with

BamHI/XhoI and the GFP sequence from GNF digested with BamHI/XhoI re-ligated into the vector. The BNF scaffold was created by amplifying the Blasticidin resistance gene from pmGIB (Gary Nolan, Stanford University) with the forward primer containing a

BamHI site TATAGGATCCAAAACATTTAACATTTCTCAA and a reverse primer containing an XhoI site TATACTCGAGTTAATTTCGGGTATATTTGAGTGG; the

63 amplified sequence was digested with BamHI/XhoI and ligated into the vector GNF digested with BamHI/XhoI. The vector 3XF(GGS)3Blast was created by amplifying the

3XFLAG Tag (Sigma, kindly provided by Christopher Glembotski, SDSU) with the forward primer TATAAGATCTGACTACAAAGACCACGACGGT containing a BglII site, and a reverse primer containing a BamHI and XhoI sites

TATACTCGAGTATATAGGATCCCTTGTCATCGTCATCCTTGTA. The amplified

3XFLAG tag was digested with BglII and XhoI and ligated into GNF digested with

BamHI/XhoI. The resulting plasmid was re-digested with BamHI/XhoI and ligated with the Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser linker that was amplified with a forward primer containing BglII TATAAGATCTGGTGGTGGTGGTAGTGGTGGT and a reverse primer TATACTCGAGTATAGGATCCGGATCCAGAACCACCACCACC containing BamHI and XhoI. Finally, the resulting plasmid was re-digested with

BamHI/XhoI and the Blasticidin gene was ligated after the linker utilizing the

BamHI/XhoI sites. The 3XFmCherryBlast scaffold was created by inserting the scaffold of 3XF(GGS)3Blast into pBMN.i.Blast vector using the restriction sites AgeI/HindIII.

The mCherry gene was amplified using the BglII containing forward primer

TATAAGATCTGTGAGCAAGGGCGAGGAGGAT and the reverse primer containing the BamHI/XhoI sites TATACTCGAGTATAGGATCCCTTGTACAGCTCGTCCAT, and ligated into the pBMN.i.Blast 3XF(GGS)3 plasmid digested with BamHI/XhoI. The resulting plasmid was then cut with BamHI/XhoI and ligated with the Blasticidin gene from BNF cut with BamHI/XhoI.

64

RPL Insert Polymerization:

An annealing reaction containing 2 µl of the NLS-RPL oligo

AACTAATAGCGGATCCCCCAAGAAGAAGCGCAAGGTGGGCGGTNNKNNKNN

KNNKNNKNNKNNKNNKNNKTGAATAGCTTAACACTCGAGCAGTGCTACA

(100 pMol/ µl) and 2 µl of the reverse primer TGAGCACTCGAGTGATCCACC (100 pMol/ µl) and 36 µl of water was performed on a Peltier Thermo Cycler (DNAEngine,

BioRad) with the conditions of 95°C for 30 sec, 85°C for 10 sec followed by a ramp decreasing the temperature by 0.1°C/sec until 57°C is reached and held for 10 sec , then decreased by 0.1°C/sec until the temperature reaches 30°C. The 40 µl of the annealed template is then assembled in a T4 DNA Polymerase reaction as follows: 40 µl of annealed template, 464 µl of DNAse/RNAse free water (ThermoScientific, Glen Burnie,

MD), 60 µl of Buffer 2 (NEB, Ipswich, MA), 6 µl Bovine Serum Albumin (10 µg/ µl )

(NEB, Ipswich, MA), 6 µl 0.1M Dithiothreol, 14 µl of dNTPs (583 µM )

(ThermoScientific, Glen Burnie, MD), and 10 µl T4 DNA Polymerase (3 units/ µl)

(NEB, Ipswich, MA). The reaction is incubated at 37°C for 50 mins. Following the polymerization, the polymerized double-stranded NLS-RPL DNA is extracted with

Phenol: Chloroform: Isoamyl Alcohol (25: 24: 1) and ethanol precipitated.

Cells:

Human T-cell line SupT1 was obtained from the American Type Culture

Collection (ATCC, Manassas, VA). Cells were maintained in complete RPMI 1640 media supplemented with 10% fetal bovine serum (Gemini Bio-Products, West

Sacramento, CA), glutamine (2 mM), penicillin G (100 units/mL), and streptomycin (100

µg/mL). Phoenix GP cell-line (Nolan Lab, Stanford University, CA) was maintained in

65

Dulbecco’s Modified Eagle’s media supplemented with 10% fetal bovine serum (Gemini

Bio-Products, West Sacramento, CA), glutamine (2 mM), penicillin G (100 units/mL), and streptomycin (100 µg/mL).

Antibodies and reagents:

The antibody to FLAG Tag (F1804-200UG) was obtained from Sigma-Aldritch

(St. Louis, MO). The anti-mouse IgG-HRP (115-035-003) antibody was provided by

Jackson Immunoresearch (West Grove, PA). The anti-mouse AlexaFluor 488 antibody was obtained from Invitrogen (Carlsbad, CA).

Virus production and transductions:

For the production of MLV based library virus, 3 10cm2 plates of Phoenix GP cells at 50% confluence was transfected with 10µg of the library transfer vector and 3µg of a vector expressing the Envelope glycoprotein of the Vesicular Stomatitis Virus (pCI-

VSVg) by mixing the plasmids in 125µl of FCS-free DMEM and 30µg of

Polyethylenimine (linear, MW 24000; Polysciences, Inc, Warrington, PA). Media

(DMEM with 10% FCS, Pen-Strep and L-Glutamine) was replaced 24 hours post- transfection and viral supernatant was collected 48 and 72 hours after transfection and filtered with 0.45 micron PTFE filters (Pall Corporation). The supernatant was used to spin-infect naïve SupT1 cells in a 12-well plate format. Briefly, viral supernatant was mixed with polybrene (5µg/mL final concentration) and added to 2x106 cells per well, and spun at 1500 x g, 32C for 80 min in a hanging bucket rotors centrifuge (Becton

Dickinson). 24 hours post-infection, cells were resuspended in fresh media. The sinHIV-

GFP virus was produced by transfecting 293T cells with a combination of plasmids containing 2 µg of packaging vector pCMV d8.2 containing the gag-pol proteins of HIV-

66

1, 3 µg of the transfer vector pH-CMV GFP containing the LTR’s of HIV-1, 3 µg of

VSVg, and 1.5 µg of pci-Vpr. The viral collection was performed as described for MLV.

Flow Cytometry and Sorting:

Flow Cytometry and sorting were performed on a BD FACSAria with 405nm,

488nm and 633nm lasers. Data was collected on FACSDiva 6.1.1 at the .San Diego State

University FACS core facility.

Pulldowns and Western blotting:

Magnetic bead pull downs and Western blots were performed as described in the

Materials and Methods section of Chapter I.

Immunofluorescent Staining for Confocal Microscopy:

HEK 293T cells were plated at 2.5x105 cells per well on a six-well plate and grown to 50% confluence. The cells were then transfected with 750ng of appropriate plasmid vector as described previously. 24 hours post-transfection, the cells were treated with 0.25% Trypsin (Invitrogen, Carlsbad, CA) and resuspended in media. The transfected cells were then plated on LabTekII 8-well chamber slides (ThermoScientific,

Glen Burnie, MD) at 5x105 cells per chamber and grown for 24 hours. The cells were then fixed with 2% Paraformaldehyde (Alpha Aesar, Ward Hill, MA) for 10 minutes, washed twice with PBS and permeabilized with 100% methanol for 10 minutes at -20°C.

The chambers were washed with PBS, and the cells were blocked with 5% BSA for 30 mins to decrease non-specific binding. The cells were then stained with anti-FLAG antibody (F1804-200UG, Sigma-Aldritch, St. Louis, MO) for 1 hour, washed with PBS, and stained with anti-mouse IgG AlexaFluor488 (A-11001, Invitrogen, Carlsbad, CA).

The cells were then washed, incubated with ToPro3 (T3605, Invitrogen, Carlsbad, CA)

67

DNA binding dye and the slides were mounted with slide covers. The imaging was performed on a Leica TCS SP2 Confocal Inverted Light Microscope.

68

RESULTS

Design of the Retroviral Scaffolds for Peptide Expression

In order to deliver the genetic information to the SupT1 T-cell line for the stable expression of the peptide sequence, several MLV-based retroviral transfer vectors were adapted, all based on pBMN.i.GFP [16]. The DNA plasmid vectors produced contain the

5’ and 3’ long terminal repeats (LTRs) of Moloney Murine Leukemia Virus (MoMLV) required for viral packaging, integration and expression in target cells, a Ψ3 packaging signal, a Kozak sequence followed by the ATG start codon encoding the first Methionine followed by a BamHI and an XhoI site, with a placeholder DNA sequence encoding either the green fluorescent protein (GFP), or a Blasticidin resistance gene (Blastr)

[17,18]. This cassette was followed by an internal ribosome entry site (IRES) and an additional selectable marker.

In total, five scaffolds were produced: GNF, containing a GFP sequence between the BamHI and XhoI sites and the mCherry selectable marker; BNF, containing a Blastr between the cloning sites and the mCherry selectable marker; SBP-GNF, containing a

Streptavidin-binding Peptide tag (SBP) in frame with the Kozak sequence followed by the cloning site containing a GFP placeholder with an mCherry selectable marker;

3XF(GGS)3Blast, containing the sequence for 3XFLAG Tag (Sigma) in frame with the

Kozak sequence followed by three Glycine-Glycine-Glycine-Serine linkers, followed by cloning site containing a Blastr placeholder; and finally 3XFmCherryBlast, containing a

3XFLAG sequence in frame with mCherry and a Blastr placeholder sequence with a

Blasticidin selectable marker (Fig. 2-1,2). The selectable markers allow for easy selection of infected cells, either by cell sorting or Blasticidin selection; and the

69 placeholder sequences serve to increase restriction digest efficiency due to the large size of the insert and facilitate library complexity estimation.

Fig. 2-1. Schematic representation of scaffolds used in library construction

Design and Synthesis of the Random Peptide Insert

In order to create a nuclear-localized peptide, an oligo was designed to contain the

BamHI restriction site forming Gly-Ser, a classical SV40 nuclear localization signal

(NLS) Pro-Lys-Lys-Lys-Arg-Lys-Val, followed by a Gly amino acid and a 9-amino acid random peptide sequence, wherein each of the nine codons had the first two nucleotides

A, T, C, or G, and the last nucleotide either a G or a T [19]. The reason for omitting an A or a C from the third codon was to reduce the chance of an early stop codon (TAA and

TGA are thus eliminated) as well as to reduce the number of possible Proline, Argenine,

70

Serine and Glycine residues. The reason a 9-mer was chosen was to mimic the types of peptides produced in the cell for MHC-I presentation [20]. The 9-mer sequence is followed by a TAG Stop codon, a short nucleotide sequence and an XhoI restriction site

(Table 2-1). A short reverse primer (5’- TGAGCACTCGAGTGATCCACC-3’) was designed in order to anneal to the oligo and allow for polymerization (as described in

Materials and Methods).

Fig. 2-2. Expression of scaffold constructs (A) Fluorescent micrographs of 293T cells transiently transfected with the GNF scaffold and SupT1 cells infected with MLV produced with the GNF as the transfer vector. (B) Coomassie stain of the eluted fraction of a pulldown from 293T cells transfected with SBP-GNF. (C) Western blot performed on cells transfected with the 3XF(GGS)3Blast scaffold. (D) Fluorescent micrograph of 293T cells transfected with the 3XFmCherryBlast scaffold.

71

Table 2-1. Possible amino acid residues created by the NLS-RPL oligo polymerization

T C A G

T TTG Leu (L) TCG Ser (S) TAG Stop (*) TGG Trp (W) G

TTT Phe (F) TCT Ser (S) TAT Tyr (Y) TGT Cys (C) T

TTA Leu (L) TCA Ser (S) TAA Stop (*) TGA Stop (*) A TTC Phe (F) TCC Ser (S) TAC Tyr (Y) TGC Cys (C) C

C CTG Leu (L) CCG Pro (P) CAG Gln (Q) CGG Arg (R) G

CTT Leu (L) CCT Pro (P) CAT His (H) CGT Arg (R) T

CTA Leu (L) CCA Pro (P) CAA Gln (Q) CGA Arg (R) A

CTC Leu (L) CCC Pro (P) CAC His (H) CGC Arg (R) C

A ATG Met (M) ACG Thr (T) AAG Lys (K) AGG Arg (R) G

ATT Ile (I) ACT Thr (T) AAT Asn (N) AGT Ser (S) T

ATA Ile (I) ACA Thr (T) AAA Lys (K) AGA Arg (R) A

ATC Ile (I) ACC Thr (T) AAC Asn (N) AGC Ser (S) C

G GTG Val (V) GCG Ala (A) GAG Glu (E) GGG Gly (G) G

GTT Val (V) GCT Ala (A) GAT Asp (D) GGT Gly (G) T

GTA Val (V) GCA Ala (A) GAA Glu (E) GGA Gly (G) A

GTC Val (V) GCC Ala (A) GAC Asp (D) GGC Gly (G) C

72

Synthesis of the NLS-RPL Libraries

In order to maximize the ligation efficiency and decrease the background, large amount of scaffold plasmid (~20 µg per reaction) was digested with 100 units of BamHI and XhoI (NEB) for an hour, and silica-bead purified from agarose gel. The reaction was then repeated to ensure complete digest. The same reaction was performed with the polymerized RPL insert DNA. Once both the vector and insert DNA was sufficiently digested and purified, a ligation reaction was set up, containing 8 µg of vector DNA, 1 µg of insert DNA and 4000 units of T4 DNA ligase (NEB), incubated overnight at 16°C.

The ligation was then concentrated by ethanol precipitation, and resuspended in 10 µl of water.

Fig. 2-3. Analysis of library complexity and ligation efficiency (A) Restriction digest analysis (BamHI and XhoI) of the bacterial colonies produced by the ligation of the 3XF(GGS)3Blast library. (B, C, D) Peptide sequences produced as a result of the 3XF(GGS)3Blast ligation, GNF ligation and SBP-GNF ligation.

73

Ligation efficiency and library complexity was then tested by transforming electrocompetent E. coli XL-1 Blue cells with a fraction of the ligation. The transformed bacteria were then plated in serial dilutions, and the resulting colonies analyzed for the presence of the RPL insert in the scaffold vector by DNA digest (Fig. 2-3A). The complexity of the library ligation was further analyzed by sequencing the resulting plasmids to ensure that the insert was truly random (Fig. 2-3B-D).

Once the complexity and a high number of transformants were confirmed, the remaining ligation was transformed; large volumes (1L of bacteria per library) of transformed bacteria were grown up, as well as plated in serial dilutions for final complexity determination (Table 2-2). Confocal and fluorescence microscopy was used to confirm the localization of the peptides of the 3XF(GGS)3 NLS RPL and 3XFmCherry

NLS RPL to the nucleus (Fig. 2-4A, B) in 293T cells prior to the transfer of the library to

SupT1 cells.

Establishment of 3XF(GGS)3 NLS RPL-expressing SupT1 Cell Population

In order to establish a population of SupT1 cells expressing the 3XF(GGS)3 NLS

RPL, VSVg pseudo typed MLV virions were first produced as described in Materials and

Methods. The virus was subsequently titrated, and SupT1 cells were infected at an MOI of 1 (roughly 10% infection as determined by mCherry expression). In order to establish a complex library, 2x108 SupT1 cells were infected to produce a population of roughly

7 7 2x10 library-expressing cells (3XF(GGS)3 NLS RPL complexity=2.34 x 10 transformants). The cells were then expanded in culture and sorted based on mCherry expression in order to set up a robust library-expressing population (Fig. 2-5A-D)

74

Fig. 2-4 Sub-cellular localization of the 3XF(GGS)3 NLS RPL and 3XFmCherry NLS RPL (A) Immunofluorecent staining for FLAG expression of 293T cells transfected with either the 3XF(GGS)3Blast scaffold or the 3XF(GGS)3 NLS RPL. (B) Fluorescent micrographs demonstrating the localization of mCherry in 293T cells transfected with either the 3XFmCherryBlast scaffold or the 3FmCherry NLS RPL.

75

Table 2-2 Summary of the constructed NLS-RPL libraries

Library Name Selectable Marker Peptide Tag Complexity (transformants) GNF NLS RPL mCherry None 7 x 105 BNF NLS RPL mCherry None 5 x 106 SBP-GNF mCherry 38 AA SBP 3.5 x 106 NLS RPL 7 3XF(GGS)3 mCherry 3xFLAG 2.34 x 10 NLS RPL 3XFmCherry mCherry/Blast 3xFLAG/mCherry 1.02 x 107 NLS RPL

Screening of the 3XF(GGS)3 NLS RPL-Expressing SupT1 Population for Inhibitors of

HIV-1

The 3XF(GGS)3 NLS RPL was used to screen for inhibitors of HIV-1 due to its greatest complexity, thereby increasing the chance of finding a biologically-relevant peptide, and as the library is targeted to the nucleus, it is expected to specifically interact with proteins involved in integration. In order to screen a population of SupT1 expressing this library, a self-inactivating pseudo-typed HIV-1 carrying a CMV-GFP expression cassette was utilized [21]. This virus is a self-inactivating HIV-1 virion that is only capable of one round of infection, with the infected cells expressing GFP. The virus was collected as with MLV, at 48 and 72 hours post-transfection and titrated to determine the amount necessary for an MOI of 1. The 3XF(GGS)3 NLS RPL SupT1 cells and cells expressing pBMN.i.mCherry were then screened by infection with sinHIV-GFP as described in Fig. 2-6A. 72 hours post-infection, the cells were sorted by Fluorescence

76

Fig. 2-5 Establishment of NLS RPL-expressing SupT1 cells. (A) The retroviral library is transfected along with the VSVg envelope into Phoenix-GP cells, for the production of (B) non-replicative MLV virions carrying the peptide sequences, which are used to infect (C) naïve SupT1 cells. (D) The infected SupT1 cells are sorted on the basis of mCherry expression.

Activated Cell Sorting (FACS) based on the expression of GFP, retaining and expanding

GFP-negative cells in culture (Fig 2-6B). Once expanded, the cells are then re-infected with sinHIV-GFP, and the process repeated until a decrease in the infection rate of library expressing cells is significantly lower than the control cells (Fig. 2-6C). After the

3XF(GGS)3 NLS RPL SupT1 population was screened 12 times, eight clones were isolated from the population, and expanded in culture. Of the eight, clones 2, 6, and 8 exhibited the largest decrease in sinHIV-GFP infection rate, as compared to the mCherry control (Fig. 2-7A). Furthermore, when infected with sinMLV-GFP, the rates of infection were not significantly different from the mCherry control (Fig. 2-7B).

77

Fig. 2-6 Screening of the 3XF(GGS)3 NLS RPL library for inhibitors of HIV-1 Graphical representation of the screening process (A). Infection rates of mCherry and 3XF(GGS)3 NLS RPL SupT1 cells after the second round of screening (B) compared to infection rates after the twelfth round of screening (C).

78

Fig. 2-7 Screening of clonal populations derived from the 3XF(GGS)3 NLS RPL library. Infection of selected clones with sinHIV-GFP (A) compared to infection with sinMLV-GFP (n=3) (B).

Rescue of Peptide Sequences from the 3XF(GGS)3 NLS RPL library Clones 2. 6 and 8

In order to rescue the peptide sequences express in the clones, genomic DNA from the clones was isolated from clones 2, 6 and 8 using a Qiagen® DNeasy Blood &

Tissue kit. The DNA was used as a template for PCR amplification with the forward primer to 3XFLAG containing a BglII restriction enzyme site (TATAAGATCTGACT-

79

ACAAAGACCACGACGGT) and a reverse primer to mCherry

(TATACTCGAGTATAGGATCCCTTGTACAGCTCGTCCAT) (Fig. 2-8A), resulting in a 1528 bp amplicon. The amplified sequence was digested with BamHI and XhoI enzymes and ligated into the original 3XF(GGS)3Blast scaffold (Fig. 2-8A). The resulting constructs were sequenced by primer extension (Eton Bioscience Inc., CA) to recover the peptide sequences (Fig. 2-8B), and protein BLAST (blastp) was used to identify possible protein hits (Table 2-3), with clones 2 and 8 sharing the same sequence

[22].

Fig. 2-8 Recovery and Identification of Sequences from the 3XF(GGS)3 clones Amplification of the clone sequences from genomic PCR of 3XF(GGS)3 clones 2 and 6 (A) Full peptide sequences rescued by genomic PCR from Clones 2, 6, and 8 (B).

80

Table 2-3 Sequences with significant alignments as determined by Protein BLAST®

Peptide Protein Name Protein Sequence Max E value Score Clone2/8 Putative tail fiber protein [Brochothrix RVVAHNSD 25.7 163 phage BL3] TRVVAHNSE

Predicted: similar to TRVVAHN 25.2 218 endonuclease/exonuclease/phosphatase family domain containing 1 [Ciona intestinalis]

Type VI secretion protein, family TKVVAHNSD 25.2 219 [Campylobacter rectus RM3267]

hypothetical protein PSF113_0324c RVVAQNSE 24.8 289 [Pseudomonas fluorescens F113]

Arginase [Rhodobacterales bacterium TRVIAHTSE 24.8 290 HTCC2083]

Clone 6 Holliday junction endonuclease RuvC WRGAAMAR 26.9 0.007 [Acidothermus cellulolyticus 11B]

WRGAAMVRG Hypothetical protein JDM601_2017 WKDRGAAMVR 26.1 0.012 [Mycobacterium sp. JDM601] ABC transporter-like protein WRGAALCMVR 26.1 0.013 [Verminephrobacter aporrectodeae subsp. tuberculatae At4]

DNA helicase/exodeoxyribonuclease V WRGAVCAMVR 26.1 0.013 subunit beta [Geobacter metallireducens

GS-15] Cation efflux protein [Marinobacter WRGRAAMVKG 25.7 0.017 aquaeolei VT8]

81

DISCUSSION

A non-rational approach to drug discovery such as phage display or peptidomimetic/ chemical libraries has proven itself invaluable in the search for potential

HIV-1 inhibitors, as well as aiding in epitope mapping, diagnosis and identification of therapeutic antibodies [23,24]. Phage display libraries, with the ability to display billions of sequences, have led to greater understanding of HIV-1 neutralizing antibodies, generating peptides that elicit an immune response against host proteins such as CCR5 in infected cells, generating competitor CD4 mutants with high affinity for the HIV-1 envelope, and designing peptides that bind specific HIV-1 proteins, among others [25–

28]. The major drawback of these libraries as mean of finding direct or indirect inhibitors of HIV-1 is that they take place in vitro, out of context of eukaryotic cells, or often in cells that are not natural targets of HIV-1. Furthermore, the screens are often performed with isolated HIV-1 proteins; and while they may exhibit inhibitory activity in assays, few are inhibitory in nanomolar or picomolar concentration ranges, and many only be effective in micromolar amounts, and therefore not practical for therapeutic use [24].

Chemical libraries, while extremely important in the search for HIV-1 inhibitors, also face additional problems of limited complexity (350,000 chemicals are currently available through the NIH Molecular Libraries Probe Production Centers Network) and cytotoxicity.

This chapter described an approach that results in the production of a highly complex library of peptides. Importantly, the libraries are targeted to a specific cellular compartment; the nucleus, drastically increasing the chances of interacting with HIV-1

Integrase, or cellular proteins required in any step leading to integration of viral cDNA.

82

These would include the PIC formation, as the peptides enter the nucleus through the same pathways as HIV-1. In addition, the peptides are not designed to specifically interact with HIV-1 IN, and can therefore target known and unknown cellular factors necessary for integration or bind to the HIV-1 cDNA. In the case of HIV-1, this indirect approach to inhibition is more favorable due to the fact that direct evolutionary pressure would not be placed on the virus, driving the emergence of resistant strains. A further benefit to this approach is the fact that peptides that are harmful to the cells would not be picked up by the screen, since those cells would not survive the screening process.

Finally, the fact that retroviral technology is used to deliver the peptides allows the screening to be performed in a cultured T-cell line, which is derived from a T-cell lymphoblastic lymphoma and closely match primary T-cells [29].

Of the two potential HIV-1 inhibitor peptides, Clone 6 (WRGAAMVRG) shares a high degree of homology with the RuvC Holliday junction endonuclease of

Acidothermus cellulolyticus 11B. Interestingly, HIV-1 IN contains a αβ-fold containing a central five-stranded mixed β-sheet surrounded by α-helices on both sides in the same topological order as Escherichia Coli RuvC, E. Coli RNase H and the HIV-1 RNase H domain of Reverse Transcriptase. All four structures exhibit the folding topology of many nucleotide-binding proteins across many organisms [30]. Further studies validating the peptide’s inhibitory effect are currently under way, but may present an interesting candidate for interfering with the strand-transfer process of HIV-1 integration.

There are several drawbacks to utilizing retroviral peptide libraries; foremost amongst them is the inability to control the amount of peptide expressed by the target cells due to semi-random integration of the MLV virions carrying the peptide sequence.

83

Therefore, a potential inhibitor may be missed simply due to low expression levels.

Another drawback may be the stability of the short peptides, which could potentially have a very short half-life and therefore be degraded in the ER before they have a chance to inhibit Integrase. However, the complexity and nuclear localization makes the retroviral peptide library a useful tool in the search for HIV-1. Moreover, the libraries are engineered by fusing the random sequence to a constant region, thus increasing the size of the potentially active peptide. Furthermore, the ability to deliver the peptides to almost any cultured cell makes it an attractive tool in searching for peptide activators or inhibitors of any nuclear cellular process, provided an appropriate cell-based assay is used in conjunction.

84

REFERENCES

[1] Y. Pommier, A.A. Johnson, C. Marchand, Integrase inhibitors to treat HIV/Aids, Nature Reviews Drug Discovery. 4 (2005) 236–248.

[2] F. Turlure, E. Devroe, P.A. Silver, A. Engelman, Human cell proteins and human immunodeficiency virus DNA integration, Front. Biosci. 9 (2004) 3187–3208.

[3] P. Cherepanov, G. Maertens, P. Proost, B. Devreese, J.V. Beeumen, Y. Engelborghs, et al., HIV-1 Integrase Forms Stable Tetramers and Associates with LEDGF/p75 Protein in Human Cells, J. Biol. Chem. 278 (2003) 372–381.

[4] S. Violot, S.S. Hong, D. Rakotobe, C. Petit, B. Gay, K. Moreau, et al., The Human Polycomb Group EED Protein Interacts with the Integrase of Human Immunodeficiency Virus Type 1, J. Virol. 77 (2003) 12507–12522.

[5] V. Parissi, C. Calmels, V.R.D. Soultrait, A. Caumont, M. Fournier, S. Chaignepain, et al., Functional Interactions of Human Immunodeficiency Virus Type 1 Integrase with Human and Yeast HSP60, J. Virol. 75 (2001) 11344–11353.

[6] P. Turelli, V. Doucas, E. Craig, B. Mangeat, N. Klages, R. Evans, et al., Cytoplasmic Recruitment of INI1 and PML on Incoming HIV Preintegration Complexes: Interference with Early Steps of Viral Replication, Molecular Cell. 7 (2001) 1245–1254.

[7] P. Hindmarsh, T. Ridky, R. Reeves, M. Andrake, A.M. Skalka, J. Leis, HMG protein family members stimulate human immunodeficiency virus type 1 and avian sarcoma virus concerted DNA integration in vitro, J. Virol. 73 (1999) 2994–3003.

[8] C.M. Farnet, F.D. Bushman, HIV-1 cDNA Integration: Requirement of HMG I(Y) Protein for Function of Preintegration Complexes In Vitro, Cell. 88 (1997) 483–492.

[9] M.I. Bukrinsky, N. Sharova, T.L. McDonald, T. Pushkarskaya, W.G. Tarpley, M. Stevenson, Association of integrase, matrix, and reverse transcriptase antigens of human immunodeficiency virus type 1 with viral nucleic acids following acute infection, Proceedings of the National Academy of Sciences of the United States of America. 90 (1993) 6125–6129.

[10] K.E. Yoder, F.D. Bushman, Repair of Gaps in Retroviral DNA Integration Intermediates, J. Virol. 74 (2000) 11191–11200.

85

[11] R. Daniel, J.G. Greger, R.A. Katz, K.D. Taganov, X. Wu, J.C. Kappes, et al., Evidence that Stable Retroviral Transduction and Cell Survival following DNA Integration Depend on Components of the Nonhomologous End Joining Repair Pathway, J. Virol. 78 (2004) 8573–8581.

[12] A.R.W. Schröder, P. Shinn, H. Chen, C. Berry, J.R. Ecker, F. Bushman, HIV-1 Integration in the Human Genome Favors Active Genes and Local Hotspots, Cell. 110 (2002) 521–529.

[13] D.J. Hazuda, P. Felock, M. Witmer, A. Wolfe, K. Stillmock, J.A. Grobler, et al., Inhibitors of Strand Transfer That Prevent Integration and Inhibit HIV-1 Replication in Cells, Science. 287 (2000) 646–650.

[14] N. Sichtig, S. Sierra, R. Kaiser, M. Däumer, S. Reuter, E. Schülter, et al., Evolution of raltegravir resistance during therapy, J. Antimicrob. Chemother. 64 (2009) 25– 32.

[15] R. Wolkowicz, G.C. Jager, G.P. Nolan, A random peptide library fused to CCR5 for selection of mimetopes expressed on the mammalian cell surface via retroviral vectors, J. Biol. Chem. 280 (2005) 15195–15201.

[16] R. Wolkowicz, G.P. Nolan, M.A. Curran, Lentiviral vectors for the delivery of DNA into mammalian cells, Methods Mol. Biol. 246 (2004) 391–411.

[17] R. Heim, A.B. Cubitt, R.Y. Tsien, Improved green fluorescence, Nature. 373 (1995) 663–664.

[18] K. Kobayashi, T. Kamakura, T. Tanaka, I. Yamaguchi, T. Endo, Nucleotide sequence of the bsr gene and N-terminal amino acid sequence of blasticidin S deaminase from blasticidin S resistant Escherichia coli TK121, Agric. Biol. Chem. 55 (1991) 3155–3157.

[19] D. Kalderon, B.L. Roberts, W.D. Richardson, A.E. Smith, A short amino acid sequence able to specify nuclear location, Cell. 39 (1984) 499–509.

[20] R.M. Chicz, R.G. Urban, W.S. Lane, J.C. Gorga, L.J. Stern, D.A.A. Vignali, et al., Predominant naturally processed peptides bound to HLA-DR1 are derived from MHC-related molecules and are heterogeneous in size, , Published Online: 27 August 1992; | Doi:10.1038/358764a0. 358 (1992) 764–768.

[21] R. Zufferey, D. Nagy, R.J. Mandel, L. Naldini, D. Trono, Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo, Nat. Biotechnol. 15 (1997) 871–875.

86

[22] S.F. Altschul, T.L. Madden, A.A. Schäffer, J. Zhang, Z. Zhang, W. Miller, et al., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25 (1997) 3389–3402.

[23] L.R. Whitby, D.L. Boger, Comprehensive Peptidomimetic Libraries Targeting Protein–Protein Interactions, Acc. Chem. Res. (2012).

[24] S. Delhalle, J.-C. Schmit, A. Chevigné, Phages and HIV-1: From Display to Interplay, Int J Mol Sci. 13 (2012) 4727–4794.

[25] C.F. Scott Jr, S. Silver, A.T. Profy, S.D. Putney, A. Langlois, K. Weinhold, et al., Human monoclonal antibody that recognizes the V3 region of human immunodeficiency virus gp120 and neutralizes the human T-lymphotropic virus type IIIMN strain, Proc. Natl. Acad. Sci. U.S.A. 87 (1990) 8597–8601.

[26] S. Khurana, M. Kennedy, L.R. King, H. Golding, Identification of a linear peptide recognized by monoclonal antibody 2D7 capable of generating CCR5-specific antibodies with human immunodeficiency virus-neutralizing activity, J. Virol. 79 (2005) 6791–6800.

[27] R. Krykbaev, J. McKeating, I. Jones, Mutant CD4 molecules with improved binding to HIV envelope protein gp120 selected by phage display, Virology. 234 (1997) 196–202.

[28] D. Lener, R. Benarous, R.A. Calogero, Use of a constrain phage displayed-peptide library for the isolation of peptides binding to HIV-1 nucleocapsid protein (NCp7), FEBS Lett. 361 (1995) 85–88.

[29] S.D. Smith, M. Shatsky, P.S. Cohen, R. Wamke, M.P. Link, B.E. Glader, Monoclonal Antibody and Enzymatic Profiles of Human Malignant T-Lymphoid Cells and Derived Cell Lines, Cancer Res. 44 (1984) 5657–5660.

[30] W. Yang, T.A. Steitz, Recombining the structures of HIV integrase, RuvC and RNase H, Structure. 3 (1995) 131–134.

CHAPTER III

Further Applications of Retroviral Peptide Libraries for Targeting HIV-1 Gag-Pol and

Envelope Processing

87

88

INTRODUCTION

The retroviral random peptide library described in the previous chapter was designed in order to target HIV-1Integrase and/or nuclear cellular factors. However, there are other cellular compartments that are no less important for the later stages of the viral lifecycle. Two of these, the cytosol and the Endoplasmic Reticulum (ER) are especially crucial for viral maturation. The processing of the Gag-Pol precursor polyprotein by the viral protease (PR) occurs in the cytosol (and within the pre-mature viral particle), while the cleavage of gp160 Envelope protein occurs in the ER-trans Golgi compartments.

The HIV-1 Protease

HIV-1 PR is an aspartyl protease encoded by the Pol region of HIV-1 genome, and whose function is to cleave the entire HIV-1 precursor polyprotein (including itself in an autocatalytic fashion), with the exception of Envelope into discrete, functional viral proteins [1–3]. The catalytic core of PR consists of the Asp, Thr, Gly triad, with the

Asp25 residue responsible for the catalytic activity [4]. The key role PR plays in the viral lifecycle makes it an especially attractive target for anti-retroviral drugs, and in fact, protease inhibitors (PIs), alongside Nucleoside Reverse Transcriptase Inhibitors (NRTIs) represent the largest number of FDA-approved HIV-1 drugs since the approval of

Saquinavir (first PI) in 1995 [5,6].

The inhibition of PR by PIs results in incomplete polyprotein cleavage and decreased viral production [7]. Unfortunately, as with IN, the high rates of mutation and malleability of the viral proteins results in rapid emergence of resistant strains, and often in strains resistant to multiple PIs [8]. Furthermore, assays for discovery of novel

89 inhibitors are often performed in vitro or in bacterial, or yeast cells, and therefore do not take into consideration the natural milieu of infection as a T-cell would represent [9–12].

Previous work in our lab has produced a T-cell based assay for the monitoring of HIV-1

PR activity (Fig. 3-1A-D, 3-2 A, B) [13]. In order to target HIV-1 PR, a cytosolic retroviral peptide library of 9-, 13-, and 14-amino acid residues was used in conjunction with the assay to search for novel PR inhibitors.

HIV-1 Envelope Processing

While PR is responsible for the processing of the Gag-Pol polyprotein, processing of the gp160 Envelope (Env) is carried out while the protein travels to the cell surface through the classical secretion pathway. In the process, Env is cleaved by the cellular proteases located in the lumen of the ER/Trans-Golgi Network, mainly Furin, and protein convertases PC1 and PC7 [14–16]. In order to produce fully infectious virions, proper post-translational processing of the Env molecule must take place. The processing includes the homologous trimerization of three gp160 monomers, addition of sugar moieties on almost thirty N-linked glycosylation sites, and subsequent cleavage of each gp160 into gp120 and gp41. The host enzymes cleave gp160 at a specific dibasic cleavage site with a recognition sequence of REKRA [17]. The tripartite agglomeration of gp120 and gp41 molecules occurs through non-covalent interactions, forming a mature

Envelope protein on the surface of the virion. The inhibition of the gp160 cleavage event into gp120 and gp41 can therefore effectively ablate the production of infectious viral particles [3]. In order to target this process, we designed a random peptide library localized to the ER either containing the classical ER retention signal KDEL to localize it

90 to the ER lumen, or lacking the signal in order to send the peptide through the TGN via the classical secretion pathway [18].

91

MATERIALS AND METHODS

Flow Cytometry and Sorting:

Flow Cytometry and sorting were performed on a BD FACSAria with 405nm,

488nm and 633nm lasers at the .San Diego State University FACS core facility. Data was collected on FACSDiva 6.1.1.

Virus production and transductions:

For the production of MLV based library virus, 3 10cm2 plates of Phoenix GP cells at 50% confluence was transfected with 10µg of the library transfer vector and 3µg of a vector expressing the Envelope glycoprotein of the Vesicular Stomatitis Virus (pCI-

VSVg) by mixing the plasmids in 125µl of FCS-free DMEM and 30µg of

Polyethylenimine (linear, MW 24000; Polysciences, Inc, Warrington, PA). Media

(DMEM with 10% FCS, Pen-Strep, and L-Glutamine) was replaced 24 hours post- transfection and viral supernatant was collected 48 and 72 hours after transfection and filtered with 0.45 micron PTFE filters (Pall Corporation). The supernatant was used to spin-infect naïve SupT1 cells in a 12-well plate format. Briefly, viral supernatant was mixed with polybrene (5g/mL final concentration) and added to 2x106 cells per well, and spun at 1500 x g, 32C for 80 min in a hanging bucket rotors centrifuge (Becton

Dickinson). 24 hours post-infection, cells were resuspended in fresh media.

Cells:

Human T-cell line SupT1 was obtained from the American Type Culture

Collection (ATCC, Manassas, VA). Cells were maintained in complete RPMI 1640 media supplemented with 10% fetal bovine serum (Gemini Bio-Products, West

Sacramento, CA), glutamine (2 mM), penicillin G (100 units/mL), and streptomycin (100

92

g/mL). Phoenix GP cell-line (Nolan Lab, Stanford University, CA) was maintained in

Dulbecco’s Modified Eagle’s media supplemented with 10% fetal bovine serum (Gemini

Bio-Products, West Sacramento, CA), glutamine (2 mM), penicillin G (100 units/mL), and streptomycin (100 g/mL).

Plasmids

The ER scaffold vector was created by first PCR amplifying the signal sequence of prolactin (kindly provided by Warner Greene, Gladstone Institute, San Francisco, CA) with the forward primer containing a BglII extending sequence TATAAGATCTC-

CACCATGGACAGCAAAGGTTCGTCGCAGAAA and a reverse primer containing

BamHI and XhoI extension sequences GGTCCCACACCAGAGGCTAAATCCT-

AGGGAGCTC into the pBMN.i.mCherry vector cut with BamHI/XhoI. The

BamHI/XhoI site of this new vector was then restriction digested, and ligated with the sequence for the expression of a FLAG-glycine-serine linker, which was amplified with the forward primer containing the extending sequence BamHI

TATAGGATCCGATTACAAAGATGATGATGATAAGGGACCA and the reverse primer containing the XhoI CCATCACCACCACCACCAAGAGA-

GCTCCCGCGCGGTATA. The resulting construct was subsequently digested with

XhoI and AscI, and ligated with the sequence for Glycine-Serine-KDEL-STOP amplified with the forward primer containing the extending sequence for XhoI TATACTCGAGG-

GTGGTGGTGGTTCCAAGGAT and a reverse sequence containing the extending sequences for NotI, NheI and AscI TTCCTACTCGACATCCGCCGGCGAT-

CGCCGCGCGGTATA.

93

RPL Insert Polymerization:

The polymerization of the insert was performed as described in Chapter II.

Immunofluorescent Staining for Confocal Microscopy:

The immunohistochemistry and microscopy were performed as described in

Chapter II. The cells were stained with either anti-FLAG antibody (F1804-200UG,

Sigma-Aldritch, St. Louis, MO) or anti-GRP 78 (sc-1050, Santa Cruz Biotechnology,

Inc., Santa Cruz, CA), and counter-stained with anti-mouse IgG AlexaFluor488 (A-

11001, Invitrogen, Carlsbad, CA) for FLAG and anti-goat IgG Cyanine Cy3 (705-025-

147, Jackson Immunoresearch, West Grove, PA). The cells were incubated with ToPro3

(T3605, Invitrogen, Carlsbad, CA) for nuclear staining.

94

RESULTS

Infection of the PR-Assay Cells with Retroviral Random Peptide Library Localized to the

Cytoplasm

The T-cell based PR-Assay developed in our laboratory is based on the autocatalytic activity of PR and the yeast Gal4-UAS system. Briefly, the assay consists of three constructs, expressed in SupT1: a GFP reporter gene under the control of a Gal4

UAS promoter, Gal4 transcription factor with the DNA-binding domain (DBD) and the trans-activation domain (TAD) separated by HIV-1 PR under the control of a Tet-On promoter (to account for possible PR cytotoxicity), and a reverse Tet transactivator

(rtTA). Upon activation with doxycycline (Dox) to the culture media, the rtTA binds the

Tet-On promoter, driving the expression of the Gal4-PR fusion protein. If no inhibitor is present, PR autocatalytically cleaves itself from the Gal4 fusion, separating the DBD and

TAD domains, both of which are required for induction of GFP expression from the UAS promoter. If, however, a PI is present, PR is unable to cleave itself out of the Gal4 scaffold, and the GFP transcription from the UAS promoter can be initiated (Fig. 3-1A-

D). The entire system was established in SupT1 cells through retroviral transduction following selection of clones with the highest responsiveness and signal-to-noise ratio

(Fig. 3-2A, B)

95

Fig. 3-1 Schematic Overview of the T-cell-based PR Assay. The assay is based on a conditional (Tet-On) expression of the Gal4 transcription factor driving the expression of GFP from the UAS promoter (A, B). The autocatalytic activity of PR, inserted between the DBD and TAD domains inhibits GFP expression (C), unless an inhibitor is added (D).

Fig. 3-2 Expression of GFP in Assay Cells SupT1 cells expressing either Gal4 (A), Gal4 in fusion with a mutant PR (B), or Gal4 in fusion with wild-type PR (C) activated with 1 µg/ml of Dox in the absence or presence of 10 µM Indinavir (IDV).

96

In order to target PR, a retroviral peptide library without a discrete sub-cellular localization signal sequence was utilized in order to try to inhibit PR activity, as measured by the assay. As such, the library is expected to contain putative PIs, since the assay monitors PR activity through the Gal4/PR fusion, cleaved in the cytosol [19]. A library with a complexity of approximately 3.0x106 9, 13, and 14 amino-acid peptides was introduced within a scaffold containing two SKVILFE dimerization domains, in order to stabilize the peptide monomeric tertiary structure (Fig. 3-3A, B) [20]. The assay cells were infected with virions collected from the supernatant of Phoenix-GP cells transfected with the retroviral library, at an MOI of 1, expanded in culture, activated with

1 µg/ml Dox, and sorted based on GFP fluorescence. Around 0.3% of cells exhibited

GFP expression (Fig. 3-4A). The sorted cells were expanded in culture, and clonally selected in 96-well plates. The result of this selection was the isolation of 18 clonal populations that would activate GFP expression only in the presence of Dox (Fig. 3-4B,

3-5).

Fig. 3-3 Random Cytosolic Retroviral Peptide Library The library scaffold in the context of the MoMLV retroviral transfer vector pmGIB MG*XhoI (Nolan Lab, Stanford, CA) (A) and the detailed DNA sequence of the SKVILFE dimerization scaffold (B).

97

Fig. 3-4 Assay Cells Transduced with the RPL Flow cytometry profiles of SupT1 cells expressing the PR assay transduced at an MOI of 1 with the RPL virions and activated with 1 µg/ml Dox (A). Clonal cell populations 5 and 6 expanded from the screen and activated with Dox (Forward Scatter Area on the X-axis, FITC on the Y-axis) (B).

98

Fig. 3-5 Clonal Populations Isolated from The Screen Flow cytometry profiles of the 18 clonal cell lines established from the screen (Forward Scatter Area on the X-axis, FITC on the Y-axis).

99

Rescue of Peptide Sequences from Clonal Cells

The genomic DNA was extracted from 11 of the 18 clones, and used as a template to PCR-amplify the sequence of the peptide using the forward primer recognizing the

SKVILFE domain TATAAGATCTCCACCATGGCACCTGGTGGATCCAAGGTGA-

TTTTGTTTG and a reverse primer recognizing the Blasticidin resistance gene TATAC-

TCGAGTTAATTTCGGGTATATTTGAG (Fig 3-6).

Fig. 3-6 Amplification of the Peptide Sequence from the Genomic DNA of Selected Clones Peptide sequences amplified by PCR from the genomic DNA of Clones 1, 10, 11, and 12 recovered by the screen.

100

Development of an ER-Targeted Random Peptide Library

In order to create a library of peptides localized either to the ER or the trans-

Golgi, we developed a retroviral scaffold which contained an N-terminal 31 amino-acid signal sequence for bovine prolactin, followed by a BamHI restriction site forming a

Glycine-Serine linker to a FLAG tag [21]. The FLAG sequence is followed by a

Glycine-Proline linker with a long Glycine- Serine linker containing an XhoI restriction site followed by a Glycine-Serine linker and either a STOP codon or the sequence encoding the classical KDEL ER-localization signal (Fig. 3-7A, B). The RPL insert utilized in the creation of the library contained a BamHI restriction site followed by nine

NNK nucleotides encoding the peptide, followed by a long Glycine-Serine linker identical to the scaffold, followed by an XhoI restriction site (Fig. 3-7C). After polymerizing and ligating the library as described in Chapter II, a library with the complexity of 13.7x106 peptides was obtained (Fig 3-7D).

101

Fig. 3-7 Random peptide library targeted to the ER (A) Schematic representation of the retroviral scaffold for ER localization. (B) Design of the RPL insert oligo. (C) Confocal microgarphs of 293T cells transfected with the ER scaffold and stained for FLAG-FITC and ER resident protein GRP 78 to confirm ER localization. (D) Restriction digest analysis of ten colonies from the ER RPL ligation for the presence of the peptide insert in the scaffold (replacing a 750 bp GFP placeholder DNA).

102

DISCUSSION

The processing of the HIV-1 Gag-Pol polyprotein in the cytosol by the viral and host proteases represents a crucial step in the viral lifecycle, and any interference with the process will be detrimental to the virus. In order to target this process, a retroviral random peptide library was used in order to block the autocatalytic activity of HIV-1 PR, as measured by the expression of GFP under the control of the UAS promoter. The fact that the clone cell lines isolated from the screen exhibit conditional activation of GFP only in the presence of Dox implies that the peptide expressed may be blocking the ability of PR to cleave itself out of the Gal4 fusion. Once the sequences of the peptides are identified by primer extension, secondary tests will be performed to validate the ability of the peptides to inhibit PR activity, including re-introduction of the peptide into naïve HIV-PR assay cells as well as co-transfections of the peptides into 293T cells together with the full-length HIV-1 polyprotein in order to monitor polypeptide processing by Western blotting with anti-p24 (capsid) antibodies.

A potential drawback of utilizing the random peptide library in conjunction with the assay is the potential of interfering with the Gal4-UAS system or the

Tet-On system rather than PR catalytic activity, either on a protein level by binding those factors, or on a DNA level, due to the fact that the peptides are delivered by MoMLV virions and could potentially interfere with the elements of the system that were established in the assay via retroviral and lentiviral vectors. Indeed, in the original screen, a small subpopulation of assay cells maintained continual GFP fluorescence in the absence of Dox and PIs, implying an activation of the system bypassing the Tet-on Gal4-

UAS GFP system, possibly by integrating downstream of the UAS promoter. However,

103 the clonal populations are only GFP-positive in the presence of Dox, implying that the

Tet-on and the Gal4-UAS elements are intact, and that the peptides may indeed be interfering with the autocatalytic activity of PR. Certainly, more tests, as mentioned above, are still needed to prove their potential inhibitory effects on PR. Although the results obtained from the cytosol-localized library in conjunction with the Gal4/PR assay are preliminary, they indicate the importance of targeted random peptide libraries for the screening of relevant biological processes such as viral infection.

The ER-localized random peptide library described in this chapter represents a novel tool for the search of inhibitors of Env processing by host cell convertases in the

TGN such as Furin, or peptides interfering with the proper folding in the ER. Furin is a member of Ca2+-dependent multidomain protease family characterized by a catalytic serine protease domain of the subtilisin type, which, along with six other members of this family (PC2, PC1/3, PACE4, PC4, PC5/6, and PC7), is responsible for cleaving the gp160 precursor Env into the active gp120/gp41 form, mostly in the TGN [22–25]. The folding of the Env, on the other hand, occurs in the ER, through the formation of disulfide bridges between its cysteine residues [26]. Furthermore, host chaperone proteins GRP 78, calnexin, calreticulin, and PDI help to fold and trimerize the molecule while in the ER [27]. Due to the fact that both of these processes take place in the ER and the TGN, we hypothesize that localizing peptides to those compartments can drastically increase the chances of disrupting either the interaction of the host convertases with the gp160 or with the folding of the molecule in the ER.

Currently, our lab is developing a T-cell-based assay to monitor the activity of the host convertases based on the ability of the enzymes to cleave the gp120/gp41

104 cleavage site (REKRA) in a high-throughput manner. Once the assay is established, the secretion pathway targeted library (lacking the KDEL retention signal) will be used in a screen to identify potential inhibitors of the gp160 cleavage. It is important to mention that while we are interested in finding novel inhibitors of PR we intend to search for competitors of Env processing by Furin and similar enzymes rather than inhibitors, as inhibition of Furin would be detrimental to the cell.

The major advantage of utilizing the peptide library in this fashion is the fact that it allows for the screening of competitors of highly specific Furin/gp160 interactions, and interactions resulting in cell death, often associated with chemical PIs, would not be rescued from the screen as those cells will die. Furthermore, the ER-localized library can be used to screen for inhibitors of viruses that primarily localize their polypeptides in the

ER, such as the members of the Flaviviridae family [28].

105

REFERENCES

[1] R.R. Speck, C. Flexner, C.J. Tian, X.F. Yu, Comparison of human immunodeficiency virus type 1 Pr55(Gag) and Pr160(Gag-pol) processing intermediates that accumulate in primary and transformed cells treated with peptidic and nonpeptidic protease inhibitors, Antimicrob. Agents Chemother. 44 (2000) 1397–1403.

[2] S.C. Pettit, J.N. Lindquist, A.H. Kaplan, R. Swanstrom, Processing sites in the human immunodeficiency virus type 1 (HIV-1) Gag-Pro-Pol precursor are cleaved by the viral protease at different rates, Retrovirology. 2 (2005) 66.

[3] J.M. McCune, L.B. Rabin, M.B. Feinberg, M. Lieberman, J.C. Kosek, G.R. Reyes, et al., Endoproteolytic cleavage of gp160 is required for the activation of human immunodeficiency virus, Cell. 53 (1988) 55–67.

[4] D.D. Loeb, R. Swanstrom, L. Everitt, M. Manchester, S.E. Stamper, C.A. Hutchison 3rd, Complete mutagenesis of the HIV-1 protease, Nature. 340 (1989) 397–400.

[5] J. Erickson, D.J. Neidhart, J. VanDrie, D.J. Kempf, X.C. Wang, D.W. Norbeck, et al., Design, activity, and 2.8 A crystal structure of a C2 symmetric inhibitor complexed to HIV-1 protease, Science. 249 (1990) 527–533.

[6] C.J.L. la Porte, Saquinavir, the pioneer antiretroviral protease inhibitor, Expert Opin Drug Metab Toxicol. 5 (2009) 1313–1322.

[7] S.I. Daniels, D.A. Davis, E.E. Soule, S.J. Stahl, I.R. Tebbs, P. Wingfield, et al., The Initial Step in Human Immunodeficiency Virus Type 1 GagProPol Processing Can Be Regulated by Reversible Oxidation, PLoS ONE. 5 (2010) e13595.

[8] J.H. Condra, W.A. Schleif, O.M. Blahy, L.J. Gabryelski, D.J. Graham, J. Quintero, et al., In vivo emergence of HIV-1 variants resistant to multiple protease inhibitors, , Published Online: 06 April 1995; | Doi:10.1038/374569a0. 374 (1995) 569–571.

[9] M.V. Toth, G.R. Marshall, A simple, continuous fluorometric assay for HIV protease, Int. J. Pept. Protein Res. 36 (1990) 544–550.

[10] E.D. Matayoshi, G.T. Wang, G.A. Krafft, J. Erickson, Novel fluorogenic substrates for assaying retroviral proteases by resonance energy transfer, Science. 247 (1990) 954–958.

106

[11] H.G. Kräusslich, R.H. Ingraham, M.T. Skoog, E. Wimmer, P.V. Pallai, C.A. Carter, Activity of purified biosynthetic proteinase of human immunodeficiency virus on natural substrates and synthetic peptides, Proc. Natl. Acad. Sci. U.S.A. 86 (1989) 807–811.

[12] T.-J. Cheng, A. Brik, C.-H. Wong, C.-C. Kan, Model system for high-throughput screening of novel human immunodeficiency virus protease inhibitors in Escherichia coli, Antimicrob. Agents Chemother. 48 (2004) 2437–2447.

[13] B.J. Hilton, R. Wolkowicz, An Assay to Monitor HIV-1 Protease Activity for the Identification of Novel Inhibitors in T-Cells, PLoS ONE. 5 (2010) e10940.

[14] E. Decroly, S. Wouters, C. Di Bello, C. Lazure, J.-M. Ruysschaert, N.G. Seidah, Identification of the Paired Basic Convertases Implicated in HIV gp160 Processing Based on in Vitro Assays and Expression in CD4+ Cell Lines, J. Biol. Chem. 271 (1996) 30442–30450.

[15] E. Decroly, S. Benjannet, D. Savaria, N.G. Seidah, Comparative functional role of PC7 and furin in the processing of the HIV envelope glycoprotein gp160, FEBS Lett. 405 (1997) 68–72.

[16] M.L. Kantanen, P. Leinikki, E. Kuismanen, Endoproteolytic cleavage of HIV-1 gp160 envelope precursor occurs after exit from the trans-Golgi network (TGN), Archives of Virology. 140 (1995) 1441–1449.

[17] R. Oliva, M. Leone, L. Falcigno, G. D’Auria, M. Dettin, C. Scarinci, et al., Structural investigation of the HIV-1 envelope glycoprotein gp160 cleavage site, Chemistry. 8 (2002) 1467–1473.

[18] S. Munro, H.R. Pelham, A C-terminal signal prevents secretion of luminal ER proteins, Cell. 48 (1987) 899–907.

[19] A.H. Kaplan, R. Swanstrom, Human immunodeficiency virus type 1 Gag proteins are processed in two cellular compartments, Proc. Natl. Acad. Sci. U.S.A. 88 (1991) 4528–4532.

[20] K.M. Marks, M. Rosinov, G.P. Nolan, In Vivo Targeting of Organic Calcium Sensors via Genetically Selected Peptides, Chemistry & Biology. 11 (2004) 347– 356.

[21] X.F. Huang, R.W. Compans, S. Chen, R.A. Lamb, P. Arvan, Polarized Apical Targeting Directed by the Signal/Anchor Region of Simian Virus 5 Hemagglutinin- Neuraminidase, J. Biol. Chem. 272 (1997) 27598–27604.

107

[22] W.J. van de Ven, J. Voorberg, R. Fontijn, H. Pannekoek, A.M. van den Ouweland, H.L. van Duijnhoven, et al., Furin is a subtilisin-like proprotein processing enzyme in higher eukaryotes, Mol. Biol. Rep. 14 (1990) 265–275.

[23] N.C. Rockwell, D.J. Krysan, T. Komiyama, R.S. Fuller, Precursor processing by kex2/furin proteases, Chem. Rev. 102 (2002) 4525–4548.

[24] G. Thomas, Furin At The Cutting Edge: From Protein Traffic To Embryogenesis And Disease, Nat Rev Mol Cell Biol. 3 (2002) 753–766.

[25] S. Hallenberger, V. Bosch, H. Angliker, E. Shaw, H.D. Klenk, W. Garten, Inhibition of furin-mediated cleavage activation of HIV-1 glycoprotein gp160, Nature. 360 (1992) 358–361.

[26] A. Land, D. Zonneveld, I. Braakman, Folding of HIV-1 Envelope glycoprotein involves extensive isomerization of disulfide bonds and conformation-dependent leader peptide cleavage, FASEB J. 17 (2003) 1058–1067.

[27] A. Land, I. Braakman, Folding of the human immunodeficiency virus type 1 envelope glycoprotein in the endoplasmic reticulum, Biochimie. 83 (2001) 783–790.

[28] C.L. Murray, C.T. Jones, C.M. Rice, Architects of Assembly: roles of Flaviviridae nonstructural proteins in virion morphogenesis, Nat Rev Microbiol. 6 (2008) 699– 708.