Supplementary Information
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  4-1BB Signaling Beyond T CellsCellular & Molecular Immunology (2011) 8, 281–284 ß 2011 CSI and USTC. All rights reserved 1672-7681/11 $32.00 www.nature.com/cmi MINI REVIEW 4-1BB signaling beyond T cells Dass S Vinay1 and Byoung S Kwon1,2 Originally discovered as a T cell-activating molecule, 4-1BB (CD137) is now also recognized as an activator of non-T cells, thus imparting a new dimension to its potential in vivo effects. 4-1BB expression is seen on a variety of non-T cells including activated dendritic cells (DCs), monocytes, neutrophils, B cells and natural killer (NK) cells, and promotes their individual effector functions. The T cell- and non-T cell-activating ability of 4-1BB may be the basis of its powerful anti-cancer, anti-autoimmune and anti-viral effects. Here we discuss the consequence and importance of 4-1BB signaling in non-T cells. We consider its effects on immune regulation, and the distinct and/or overlapping pathways involved in these responses, as well as possible therapeutic applications. Cellular & Molecular Immunology (2011) 8, 281–284; doi:10.1038/cmi.2010.82; published online 10 January 2011 Keywords: APC; cytokines; natural killer cells; T cells; 4-1BB INTRODUCTION focus on the functions of 4-1BB in non-T cells including DCs, mono- 4-1BB (CD137; TNFRSF9), discovered originally on T cells,1 is a 50- cytes, neutrophils, B cells and NK cells, and discuss how its expression to 55-kDa protein concerned with progressive immunity.2,3 4-1BB might be manipulated to treat various immune diseases. expression is in most cases activation induced.
- 
												  Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - MouseWelcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
- 
												  DFFA Monoclonal Antibody (M05), Degradation of the Chromosomal DNA Into Nucleosomal Clone 3A11 UnitsDFFA monoclonal antibody (M05), degradation of the chromosomal DNA into nucleosomal clone 3A11 units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. Catalog Number: H00001676-M05 DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated Regulatory Status: For research use only (RUO) when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active Product Description: Mouse monoclonal antibody component of DFF. DFFB has been found to trigger both raised against a partial recombinant DFFA. DNA fragmentation and chromatin condensation during apoptosis. Two alternatively spliced transcript variants Clone Name: 3A11 encoding distinct isoforms have been found for this gene. [provided by RefSeq] Immunogen: DFFA (NP_004392.1, 231 a.a. ~ 331 a.a) partial recombinant protein with GST tag. MW of the GST tag alone is 26 KDa. Sequence: TSSDVALASHILTALREKQAPELSLSSQDLELVTKEDPK ALAVALNWDIKKTETVQEACERELALRLQQTQSLHSLR SISASKASPPGDLQNPKRARQDPT Host: Mouse Reactivity: Human Applications: ELISA, PLA-Ce, S-ELISA, WB-Re, WB-Tr (See our web site product page for detailed applications information) Protocols: See our web site at http://www.abnova.com/support/protocols.asp or product page for detailed protocols Isotype: IgG2a Kappa Storage Buffer: In 1x PBS, pH 7.4 Storage Instruction: Store at -20°C or lower. Aliquot to avoid repeated freezing and thawing. Entrez GeneID: 1676 Gene Symbol: DFFA Gene Alias: DFF-45, DFF1, ICAD Gene Summary: Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and Page 1/1 Powered by TCPDF (www.tcpdf.org).
- 
												  Tools for Cell Therapy and ImmunoregulationRnDSy-lu-2945 Tools for Cell Therapy and Immunoregulation Target Cell TIM-4 SLAM/CD150 BTNL8 PD-L2/B7-DC B7-H1/PD-L1 (Human) Unknown PD-1 B7-1/CD80 TIM-1 SLAM/CD150 Receptor TIM Family SLAM Family Butyrophilins B7/CD28 Families T Cell Multiple Co-Signaling Molecules Co-stimulatory Co-inhibitory Ig Superfamily Regulate T Cell Activation Target Cell T Cell Target Cell T Cell B7-1/CD80 B7-H1/PD-L1 T cell activation requires two signals: 1) recognition of the antigenic peptide/ B7-1/CD80 B7-2/CD86 CTLA-4 major histocompatibility complex (MHC) by the T cell receptor (TCR) and 2) CD28 antigen-independent co-stimulation induced by interactions between B7-2/CD86 B7-H1/PD-L1 B7-1/CD80 co-signaling molecules expressed on target cells, such as antigen-presenting PD-L2/B7-DC PD-1 ICOS cells (APCs), and their T cell-expressed receptors. Engagement of the TCR in B7-H2/ICOS L 2Ig B7-H3 (Mouse) the absence of this second co-stimulatory signal typically results in T cell B7-H1/PD-L1 B7/CD28 Families 4Ig B7-H3 (Human) anergy or apoptosis. In addition, T cell activation can be negatively regulated Unknown Receptors by co-inhibitory molecules present on APCs. Therefore, integration of the 2Ig B7-H3 Unknown B7-H4 (Mouse) Receptors signals transduced by co-stimulatory and co-inhibitory molecules following TCR B7-H5 4Ig B7-H3 engagement directs the outcome and magnitude of a T cell response Unknown Ligand (Human) B7-H5 including the enhancement or suppression of T cell proliferation, B7-H7 Unknown Receptor differentiation, and/or cytokine secretion.
- 
												  Megakaryopoiesis in Dengue Virus Infected K562 Cell Promotes Viral Replication Which Inhibits 2 Endomitosis and Accumulation of ROS Associated with DifferentiationbioRxiv preprint doi: https://doi.org/10.1101/2020.06.25.172544; this version posted June 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Megakaryopoiesis in Dengue virus infected K562 cell promotes viral replication which inhibits 2 endomitosis and accumulation of ROS associated with differentiation 3 Jaskaran Kaur *1, Yogita Rawat *1, Vikas Sood 2, Deepak Rathore1, Shrikant K. Kumar1, Niraj K. Kumar1 4 and Sankar Bhattacharyya1 5 1 Translational Health Science and Technology Institute, NCR Biotech Science Cluster, PO Box# 4, 6 Faridabad-Gurgaon expressway, Faridabad, Haryana-121001, India 7 2 Department of Biochemistry, School of Chemical and Life Sciences, Jamia Hamdard (Hamdard 8 University) Hamdard Nagar, New Delhi - 110062, India 9 10 *Equal contribution 11 Email for correspondence: [email protected] 12 13 14 Keywords: Dengue virus replication, Megakaryopoiesis, Reactive oxygen species, Endomitosis 15 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.25.172544; this version posted June 26, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 16 Abstract: In the human host blood Monocytes and bone marrow Megakaryocytes are implicated as major 17 sites supporting high replication. The human K562 cell line supports DENV replication and represent 18 Megakaryocyte-Erythrocyte progenitors (MEP), replicating features of in vivo Megakaryopoiesis upon 19 stimulation with Phorbol esters. In this article, we report results that indicate the mutual influence of 20 Megakaryopoiesis and DENV replication on each other, through comparison of PMA-induced 21 differentiation of either mock-infected or DENV-infected K562 cells.
- 
												  The Role of RNA Editing in Cancer Development and Metabolic DisordersWashington University School of Medicine Digital Commons@Becker Open Access Publications 2018 The oler of RNA editing in cancer development and metabolic disorders Che-Pei Kung Washington University School of Medicine in St. Louis Leonard B. Maggi Jr. Washington University School of Medicine in St. Louis Jason D. Weber Washington University School of Medicine in St. Louis Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Kung, Che-Pei; Maggi, Leonard B. Jr.; and Weber, Jason D., ,"The or le of RNA editing in cancer development and metabolic disorders." Frontiers in endocrinology.9,. 762. (2018). https://digitalcommons.wustl.edu/open_access_pubs/7400 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. REVIEW published: 18 December 2018 doi: 10.3389/fendo.2018.00762 The Role of RNA Editing in Cancer Development and Metabolic Disorders Che-Pei Kung 1,2*, Leonard B. Maggi Jr. 1,2 and Jason D. Weber 1,2,3* 1 ICCE Institute, Washington University School of Medicine, Saint Louis, MO, United States, 2 Division of Molecular Oncology, Department of Medicine, Washington University School of Medicine, Saint Louis, MO, United States, 3 Siteman Cancer Center, Department of Cell Biology and Physiology, Washington University School of Medicine, Saint Louis, MO, United States Numerous human diseases arise from alterations of genetic information, most notably DNA mutations. Thought to be merely the intermediate between DNA and protein, changes in RNA sequence were an afterthought until the discovery of RNA editing 30 years ago.
- 
												  Mohammad Karbaschi ThesisSTRUCTURAL, PHYSIOLOGICAL AND MOLECULAR CHARACTERISATION OF THE AUSTRALIAN NATIVE RESURRECTION GRASS TRIPOGON LOLIIFORMIS (F.MUELL.) C.E.HUBB. DURING DEHYDRATION AND REHYDRATION Mohammad Reza Karbaschi Submitted in fulfilment of the requirements for the degree of Doctor of Philosophy Centre for Tropical Crops and Biocommodities Science and Engineering Faculty Queensland University of Technology November 2015 Keywords Arabidopsis thaliana; Agrobacterium-mediated transformation; Anatomy; Anti-apoptotic proteins; BAG4; Escherichia coli; Bulliform cells; C4 photosynthesis; Cell wall folding; Cell membrane integrity; Chaperone-mediated autophagy; Chlorophyll fluorescence; Hsc70/Hsp70; Desiccation tolerance, Dehydration; Drought; Electrolyte leakage; Freehand sectioning; Homoiochlorophyllous; Leaf structure; Leaf folding; Reactive oxygen species (ROS); Resurrection plant; Morphology; Monocotyledon; Nicotiana benthamiana; Photosynthesis; Physiology; Plant tissue; Programed cell death (PCD); Propidium iodide staining; Protein microarray chip; Sclerenchymatous tissue; Stress; Structure; Tripogon loliiformis; Ubiquitin; Vacuole fragmentation; Kranz anatomy; XyMS+; Structural, physiological and molecular characterisation of the Australian native resurrection grass Tripogon loliiformis (F.Muell.) C.E.Hubb. during dehydration and rehydration i Abstract Plants, as sessile organisms must continually adapt to environmental changes. Water deficit is one of the major environmental stresses that affects plants. While most plants can tolerate moderate dehydration
- 
												  Supplementary Table 2 Supplementary Table 1Supplementary table 1 Rai/ Binet IGHV Cytogenetic Relative viability Fludarabine- Sex Outcome CD38 (%) IGHV gene ZAP70 (%) Treatment (s) Stage identity (%) abnormalities* increase refractory 1 M 0/A Progressive 14,90 IGHV3-64*05 99,65 28,20 Del17p 18.0% 62,58322819 FCR n.a. 2 F 0/A Progressive 78,77 IGHV3-48*03 100,00 51,90 Del17p 24.8% 77,88052021 FCR n.a. 3 M 0/A Progressive 29,81 IGHV4-b*01 100,00 9,10 Del17p 12.0% 36,48 Len, Chl n.a. 4 M 1/A Stable 97,04 IGHV3-21*01 97,22 18,11 Normal 85,4191657 n.a. n.a. Chl+O, PCR, 5 F 0/A Progressive 87,00 IGHV4-39*07 100,00 43,20 Del13q 68.3% 35,23314039 n.a. HDMP+R 6 M 0/A Progressive 1,81 IGHV3-43*01 100,00 20,90 Del13q 77.7% 57,52490626 Chl n.a. Chl, FR, R-CHOP, 7 M 0/A Progressive 97,80 IGHV1-3*01 100,00 9,80 Del17p 88.5% 48,57389901 n.a. HDMP+R 8 F 2/B Progressive 69,07 IGHV5-a*03 100,00 16,50 Del17p 77.2% 107,9656878 FCR, BA No R-CHOP, FCR, 9 M 1/A Progressive 2,13 IGHV3-23*01 97,22 29,80 Del11q 16.3% 134,5866919 Yes Flavopiridol, BA 10 M 2/A Progressive 0,36 IGHV3-30*02 92,01 0,38 Del13q 81.9% 78,91844953 Unknown n.a. 11 M 2/B Progressive 15,17 IGHV3-20*01 100,00 13,20 Del11q 95.3% 75,52880995 FCR, R-CHOP, BR No 12 M 0/A Stable 0,14 IGHV3-30*02 90,62 7,40 Del13q 13.0% 13,0939004 n.a.
- 
												  Flow Reagents Single Color Antibodies CD ChartCD CHART CD N° Alternative Name CD N° Alternative Name CD N° Alternative Name Beckman Coulter Clone Beckman Coulter Clone Beckman Coulter Clone T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells T Cells B Cells Granulocytes NK Cells Macrophages/Monocytes Platelets Erythrocytes Stem Cells Dendritic Cells Endothelial Cells Epithelial Cells CD1a T6, R4, HTA1 Act p n n p n n S l CD99 MIC2 gene product, E2 p p p CD223 LAG-3 (Lymphocyte activation gene 3) Act n Act p n CD1b R1 Act p n n p n n S CD99R restricted CD99 p p CD224 GGT (γ-glutamyl transferase) p p p p p p CD1c R7, M241 Act S n n p n n S l CD100 SEMA4D (semaphorin 4D) p Low p p p n n CD225 Leu13, interferon induced transmembrane protein 1 (IFITM1). p p p p p CD1d R3 Act S n n Low n n S Intest CD101 V7, P126 Act n p n p n n p CD226 DNAM-1, PTA-1 Act n Act Act Act n p n CD1e R2 n n n n S CD102 ICAM-2 (intercellular adhesion molecule-2) p p n p Folli p CD227 MUC1, mucin 1, episialin, PUM, PEM, EMA, DF3, H23 Act p CD2 T11; Tp50; sheep red blood cell (SRBC) receptor; LFA-2 p S n p n n l CD103 HML-1 (human mucosal lymphocytes antigen 1), integrin aE chain S n n n n n n n l CD228 Melanotransferrin (MT), p97 p p CD3 T3, CD3 complex p n n n n n n n n n l CD104 integrin b4 chain; TSP-1180 n n n n n n n p p CD229 Ly9, T-lymphocyte surface antigen p p n p n
- 
												  DFFB (NM 004402) Human Tagged ORF Clone Product DataOriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC208266 DFFB (NM_004402) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DFFB (NM_004402) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DFFB Synonyms: CAD; CPAN; DFF-40; DFF2; DFF40 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC208266 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTCCAGAAGCCCAAGAGCGTGAAGCTGCGGGCCCTGCGCAGCCCGAGGAAGTTCGGCGTGGCTGGCC GGAGCTGCCAGGAGGTGCTGCGCAAGGGCTGTCTCCGCTTCCAGCTCCCTGAGCGCGGTTCCCGGCTGTG CCTGTACGAGGATGGCACGGAGCTGACGGAAGATTACTTCCCCAGTGTTCCCGACAACGCCGAGCTGGTG CTGCTCACCTTGGGCCAGGCCTGGCAGGGCTATGTGAGCGACATCAGGCGCTTCCTCAGTGCATTTCACG AGCCACAGGTGGGGCTCATCCAGGCCGCCCAGCAGCTGCTGTGTGATGAGCAGGCCCCACAGAGGCAGAG GCTGCTGGCTGACCTCCTGCACAACGTCAGCCAGAACATCGCGGCCGAGACCCGGGCTGAGGACCCGCCG TGGTTTGAAGGCTTGGAGTCCCGATTTCAGAGCAAGTCTGGCTATCTGAGATACAGCTGTGAGAGCCGGA TCCGGAGTTACCTGAGGGAGGTGAGCTCCTACCCCTCCACAGTGGGTGCGGAGGCTCAGGAGGAATTCCT GCGGGTCCTCGGCTCCATGTGCCAGAGGCTCCGGTCCATGCAGTACAATGGCAGCTACTTCGACAGAGGA GCCAAGGGCGGCAGCCGCCTCTGCACACCGGAAGGCTGGTTCTCCTGCCAGGGTCCCTTTGACATGGACA GCTGCTTATCAAGACACTCCATCAACCCCTACAGTAACAGGGAGAGCAGGATCCTCTTCAGCACCTGGAA CCTGGATCACATAATAGAAAAGAAACGCACCATCATTCCTACACTGGTGGAAGCAATTAAGGAACAAGAT GGAAGAGAAGTGGACTGGGAGTATTTTTATGGCCTGCTTTTTACCTCAGAGAACCTAAAACTAGTGCACA
- 
												  ATP-Binding and Hydrolysis in Inflammasome Activationmolecules Review ATP-Binding and Hydrolysis in Inflammasome Activation Christina F. Sandall, Bjoern K. Ziehr and Justin A. MacDonald * Department of Biochemistry & Molecular Biology, Cumming School of Medicine, University of Calgary, 3280 Hospital Drive NW, Calgary, AB T2N 4Z6, Canada; [email protected] (C.F.S.); [email protected] (B.K.Z.) * Correspondence: [email protected]; Tel.: +1-403-210-8433 Academic Editor: Massimo Bertinaria Received: 15 September 2020; Accepted: 3 October 2020; Published: 7 October 2020 Abstract: The prototypical model for NOD-like receptor (NLR) inflammasome assembly includes nucleotide-dependent activation of the NLR downstream of pathogen- or danger-associated molecular pattern (PAMP or DAMP) recognition, followed by nucleation of hetero-oligomeric platforms that lie upstream of inflammatory responses associated with innate immunity. As members of the STAND ATPases, the NLRs are generally thought to share a similar model of ATP-dependent activation and effect. However, recent observations have challenged this paradigm to reveal novel and complex biochemical processes to discern NLRs from other STAND proteins. In this review, we highlight past findings that identify the regulatory importance of conserved ATP-binding and hydrolysis motifs within the nucleotide-binding NACHT domain of NLRs and explore recent breakthroughs that generate connections between NLR protein structure and function. Indeed, newly deposited NLR structures for NLRC4 and NLRP3 have provided unique perspectives on the ATP-dependency of inflammasome activation. Novel molecular dynamic simulations of NLRP3 examined the active site of ADP- and ATP-bound models. The findings support distinctions in nucleotide-binding domain topology with occupancy of ATP or ADP that are in turn disseminated on to the global protein structure.
- 
												  The UVB-Induced Gene Expression Profile of Human Epidermis in Vivo Is Different from That of Cultured KeratinocytesOncogene (2006) 25, 2601–2614 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE The UVB-induced gene expression profile of human epidermis in vivo is different from that of cultured keratinocytes CD Enk1, J Jacob-Hirsch2, H Gal3, I Verbovetski4, N Amariglio2, D Mevorach4, A Ingber1, D Givol3, G Rechavi2 and M Hochberg1 1Department of Dermatology, The Hadassah-Hebrew University Medical Center, Jerusalem, Israel; 2Department of Pediatric Hemato-Oncology and Functional Genomics, Safra Children’s Hospital, Sheba Medical Center and Sackler School of Medicine, Tel-Aviv University,Tel Aviv, Israel; 3Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot, Israel and 4The Laboratory for Cellular and Molecular Immunology, Department of Medicine, The Hadassah-Hebrew University Medical Center, Jerusalem, Israel In order to obtain a comprehensive picture of the radiation. UVB, with a wavelength range between 290 molecular events regulating cutaneous photodamage of and 320 nm, represents one of the most important intact human epidermis, suction blister roofs obtained environmental hazards affectinghuman skin (Hahn after a single dose of in vivo ultraviolet (UV)B exposure and Weinberg, 2002). To protect itself against the were used for microarray profiling. We found a changed DNA-damaging effects of sunlight, the skin disposes expression of 619 genes. Half of the UVB-regulated genes over highly complicated cellular programs, including had returned to pre-exposure baseline levels at 72 h, cell-cycle arrest, DNA repair and apoptosis (Brash et al., underscoring the transient character of the molecular 1996). Failure in selected elements of these defensive cutaneous UVB response.