DOCSLIB.ORG

INVESTIGATING the ROLE of CRABP1 in ADIPOSE BIOLOGY By

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
INVESTIGATING the ROLE of CRABP1 in ADIPOSE BIOLOGY By i INVESTIGATING THE ROLE OF CRABP1 IN ADIPOSE BIOLOGY by JOSHUA E. MILLER Submitted in partial fulfillment of the requirements For the degree of Master of Science Thesis Adviser: Dr. Noa Noy Department of Pharmacology CASE WESTERN RESERVE UNIVERSITY May, 2017 ii CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis of Joshua E. Miller candidate for the degree of Master of Science*. Committee Chair: Ruth Keri, Ph.D. Committee Member: Hua Lou, Ph.D. Committee Member: Noa Noy, Ph.D. Committee Member: Monica Montano, Ph.D. Committee Member: David Danielpour Date of Defense: January 13th, 2017 *We also certify that written approval has been obtained for any proprietary material contained therein. iii Table of Contents TABLE OF CONTENTS___________________________________________________________iii LIST OF FIGURES____________________________________________________________iv-v ACKNOWLEDGEMENTS_____________________________________________vi-vii ABSTRACT____________________________________________________________1 CHAPTER 1: Background and Statement of Purpose______________________________________________________________2-8 CHAPTER 2: Materials and Methods_____________________________________________________________9-14 CHAPTER 3: Examination of the role of CRABP1 in Adipocytes__________________________________________________________15-30 CHAPTER 4: Conclusions, Discussion and Future Directions___________________________________________________________31-37 Bibliography________________________________________________________38-41 iv LIST OF FIGURES Figure 1.1 Retinoic acid functions through two distinct nuclear hormone receptors_______________________________________________________________3 Figure 3.1. CRABP transcript expression declines upon adipocyte differentiation_________________________________________________________19 Figure 3.2. CRABP1 protein expression is diminished upon adipocyte differentiation_________________________________________________________20 Figure 3.3. CRABP1 transcript expression in WAT greatly exceeds that of D0 3T3- L1 cells__________________________________________________________________21 Figure 3.4. Severe ablation of CRABP1 transcript upon high fat feeding and vitamin A deficient diet__________________________________________________________________22 Figure 3.5. Dietary changes alter the mouse white adipose tissue______________________________________________________________23-24 Figure 3.6. Generation of stable 3T3- L1s__________________________________________________________________25 Figure 3.7. Overexpression of CRABP1 does not significantly alter RAR target genes in WAT_________________________________________________________________26 v Figure 3.8. CRABP1 overexpression does not significantly reduce FABP4 transcript_____________________________________________________________27 Figure 3.9. Retinoic Acid inhibits adipocyte differentiation while CRABP1 overexpression induces less lipid droplet formation_____________________________________________________________28 Figure 3.10. CRABP1 overexpression reduces CEBPα protein expression_____________________________________________________________29 Figure 3.11. CRABP1 overexpression does not affect phosphorylation of HSL at Ser 563___________________________________________________________________30 vi ACKNOWLEDGEMENTS I would like to thank my graduate school mentor, Dr. Noa Noy. Noa contributed greatly to my training as a scientist, both in that she challenged me to convey my ideas concisely and confidently and she trained me to really reflect on the meaning of the data before jumping to conclusions. Her passion and enthusiasm for research drove me to persevere in the face of innumerable failures, and I am a stronger person for it. She provided me with opportunities to interact with leaders in the field and to develop a diverse depth of knowledge. She will be deeply missed. I would like to express my gratitude to the members of the Noy lab, both past and present, who have guided my development as a scientist. I thank you for your patience in teaching me lab techniques, providing me with useful tips and protocols and overseeing the honing of my lab skills. Thank you for your advice when planning experiments and for being generous with lending samples and reagents when I needed them. Finally, thank you for being more than a colleague when I needed a friend. You became like second family to me. To my thesis committee, Drs. Keri, Montano, Lou and Danielpour, I am so grateful for your participation in my development as a scientist. Thank you for your help and guidance throughout my project and your patience when I was following a hypothesis that you may not have believed in. You challenged me to think critically and for that I thank you. I would like to thank my friends and fellow pharmacology graduate students for all of their help and support in the good times and bad. You created a community and I am so grateful that I could be a part of it. To Leslie and Sahil, you have become two of vii my closest friends, and I want you to know that I could not have survived graduate school without you. Finally I would like to thank my family, who have loved and supported me throughout my time in this program. 1 Investigating The Role of CRABP1 In Adipose Biology Abstract by JOSHUA E. MILLER Dysfunctional regulation of adipose tissue is a key risk factor for a number of diseases such as type 2 diabetes(1). Consequently, understanding the role of specific proteins involved in adipose biology is critical to treatment of these serious illnesses. Administration of the vitamin A metabolite, retinoic acid has been shown to improve insulin responses and protect against diet-induced obesity in several mouse studies(2,3). One of its carrier proteins, CRABP2 has been shown to participate in adipose tissue biology by enhancing retinoic acid-induced transcriptional modulation of target genes(4,5). Due to its role in adipose tissue biology, we hypothesized that CRABP1 may also be involved. Our studies show that CRABP1 is down regulated upon induction of adipocyte differentiation. However, high fat diet feeding depletes CRABP1 from mouse white adipose tissue, suggesting that there may be an interesting link between CRABP1 and fat accumulation in the adipose tissue. 2 Chapter 1: Background and Statement of Purpose 1.1 Background Vitamin A Vitamin A (all-trans retinol) is a key nutrient involved in numerous biological processes, ranging from development and vision to maintenance of the immune system(6). Many of its functions are carried out by a key metabolite, known as all- trans retinoic acid (RA), which is synthesized from all-trans retinol by a series of dehydrogenases(7). Retinoic acid is then able to travel to the nucleus, where it binds directly to specific nuclear hormone receptors, including PPARβ/δ and the three isotypes of RAR, known as RARα, RARβ and RARγ(6,8). Binding of RA to these nuclear hormone receptors alters the transcription of specific target genes. Although retinoic acid is largely hydrophobic and is able to traverse the nuclear membrane by itself, its delivery to specific nuclear hormone receptors is facilitated by a group of proteins from the intracellular lipid binding protein family(9). It has been well established that the effect of retinoic acid on a given cell is dependent upon the expression of specific lipid binding proteins and nuclear hormone receptors(10-13). For example, fatty acid binding protein 5 (FABP5) shuttles retinoic acid to peroxisome proliferator activated receptor β/δ, PPARβ/δ, which is a nuclear hormone receptor that regulates genes involved in promoting cell proliferation(8,14- 16). However, when cellular retinoic acid binding protein 2 (CRABP2) is the predominant intracellular lipid binding protein in the cell, it will deliver retinoic acid 3 to the retinoic acid receptor (RAR), which regulates a different set of genes that induce differentiation, growth arrest and cellular apoptosis(17). Figure 1.1 Retinoic acid functions through two distinct nuclear hormone receptors All-trans retinoic acid is capable of binding to either CRABP2 or FABP5 in the cytosol, after which it is shuttled to either RAR or PPARβ/δ respectively. In cells which highly express CRABP2, delivery of retinoic acid to RAR will induce transcription of genes involved in apoptosis and cell cycle arrest. When FABP5 is highly expressed, retinoic acid will be delivered to PPARβ/δ, which will modulate 4 transcription of genes that induce pro-survival pathways. Figure adapted from Vreeland, A. (2015). Cellular Retinoic Acid-Binding Protein 2 Cooperates with HuR to Stabilize RNA and Inhibit Tumor Growth . (Electronic Thesis or Dissertation). Retrieved from https://etd.ohiolink.edu, with contributions from Dr. Liraz Levi and Dr. Noa Noy. CRABPs Among the lipid binding proteins, two homologs, the cellular retinoic acid binding proteins 1 and 2 (CRABPs) share ~75% homology and bind to all-trans retinoic acid with sub-nanomolar affinity(12,18). CRABP2 has been shown to have two distinct functions. In the presence of retinoic acid, CRABP2 enhances delivery of retinoic acid to RAR to modulate transcription of target genes. However, in the absence of retinoic acid, CRABP2 has been shown to directly cooperate with an RNA binding protein known as HuR(19,20). When CRABP2 binds to HuR it enhances the affinity of HuR for target mRNAs that bear an AU-rich region in their 3’UTR(21-24). This interaction with HuR allows CRABP2 to enhance the stability
Load more

Recommended publications
  • Sonic Hedgehog-Gli1 Signaling and Cellular Retinoic Acid Binding Protein 1 Gene Regulation in Motor Neuron Differentiation and Diseases
    International Journal of Molecular Sciences Article Sonic Hedgehog-Gli1 Signaling and Cellular Retinoic Acid Binding Protein 1 Gene Regulation in Motor Neuron Differentiation and Diseases Yu-Lung Lin y, Yi-Wei Lin y, Jennifer Nhieu y, Xiaoyin Zhang and Li-Na Wei * Department of Pharmacology, University of Minnesota, Minneapolis, MN 55455, USA; [email protected] (Y.-L.L.); [email protected] (Y.-W.L.); [email protected] (J.N.); [email protected] (X.Z.) * Correspondence: [email protected]; Tel.: +1-612-6259402 Contributed equally. y Received: 29 April 2020; Accepted: 7 June 2020; Published: 9 June 2020 Abstract: Cellular retinoic acid-binding protein 1 (CRABP1) is highly expressed in motor neurons. Degenerated motor neuron-like MN1 cells are engineered by introducing SODG93A or AR-65Q to model degenerated amyotrophic lateral sclerosis (ALS) or spinal bulbar muscular atrophy neurons. Retinoic acid (RA)/sonic hedgehog (Shh)-induced embryonic stem cells differentiation into motor neurons are employed to study up-regulation of Crabp1 by Shh. In SODG93A or AR-65Q MN1 neurons, CRABP1 level is reduced, revealing a correlation of motor neuron degeneration with Crabp1 down-regulation. Up-regulation of Crabp1 by Shh is mediated by glioma-associated oncogene homolog 1 (Gli1) that binds the Gli target sequence in Crabp10s neuron-specific regulatory region upstream of minimal promoter. Gli1 binding triggers chromatin juxtaposition with minimal promoter, activating transcription. Motor neuron differentiation and Crabp1 up-regulation are both inhibited by blunting Shh with Gli inhibitor GANT61. Expression data mining of ALS and spinal muscular atrophy (SMA) motor neurons shows reduced CRABP1, coincided with reduction in Shh-Gli1 signaling components.
    [Show full text]
  • Cell Line-Dependent Variability of Coordinate Expression of P75ntr and CRABP1 and Modulation of Effects of Fenretinide on Neuroblastoma Cells
    Hindawi Publishing Corporation Oxidative Medicine and Cellular Longevity Volume 2016, Article ID 7568287, 8 pages http://dx.doi.org/10.1155/2016/7568287 Research Article Cell Line-Dependent Variability of Coordinate Expression of p75NTR and CRABP1 and Modulation of Effects of Fenretinide on Neuroblastoma Cells Yaoli Pu Yang, Simeng Wang, Xingguo Li, and Nina F. Schor Department of Pediatrics, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642, USA Correspondence should be addressed to Nina F. Schor; nina [email protected] Received 10 September 2015; Revised 18 October 2015; Accepted 22 October 2015 Academic Editor: Giuseppe Filomeni Copyright © 2016 Yaoli Pu Yang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Neuroblastoma is a childhood neural crest tumor. Fenretinide, a retinoic acid analogue, induces accumulation of mitochondrial reactive oxygen species and consequent apoptosis in neuroblastoma cells. The p75 neurotrophin receptor (p75NTR) enhances the antineuroblastoma cell efficacy of fenretinide in vitro. We examined the role of the retinoid binding protein, CRABP1, in p75NTR- mediated potentiation of the efficacy of fenretinide. Knockdown and overexpression, respectively, of either p75NTR or CRABP1 were effected in neuroblastoma cell lines using standard techniques. Expression was determined by qRT-PCR and confirmed atthe protein level by Western blot. Metabolic viability was determined by Alamar blue assay. While protein content of CRABP1 correlated roughly with that of p75NTR in the three neuroblastoid or epithelioid human neuroblastoma cell lines studied, manipulation of p75NTR expression resulted in cell line-dependent, variable change in CRABP1 expression.
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Role of Cellular Retinoic Acid Binding Protein 2
    Airway biology Dysregulation of elastin expression by fibroblasts in Thorax: first published as 10.1136/thx.2007.093302 on 11 July 2008. Downloaded from pulmonary emphysema: role of cellular retinoic acid binding protein 2 L Plantier,1,2,3 C Rochette-Egly,4 D Goven,1 A Boutten,1,5 M Bonay,1,6 G Lese`che,3,7 M Fournier,2,3 B Crestani,1,2,3 J Boczkowski1,8 1 INSERM U700, Hoˆpital Bichat, ABSTRACT in the lung is a stimulus for the alveologenesis 2 Paris, France; Services de Background: All-trans retinoic acid (ATRA) stimulates phase of lung development3; secondly, all-trans Pneumologie, Hoˆpital Bichat, elastin synthesis by lung fibroblasts and induces alveolar retinoic acid (ATRA) induces the expression of Assistance Publique-Hoˆpitaux de 4 Paris, Paris, France; 3 Universite´ regeneration in animal models of pulmonary emphysema. elastin in lung fibroblasts ; thirdly, vitamin A Paris 7, UFR me´dicale Denis However, ATRA treatment has had disappointing results deficiency leads to an emphysema-like phenotype Diderot, Faculte´Bichat, Paris, in human emphysema. It was hypothesised that a defect in the lung of adult rats5; finally, the systemic 4 France; Institut de Ge´ne´tique in the ATRA signalling pathway contributes to the defect administration of ATRA has been reported to et de Biologie Mole´culaire et Cellulaire, Strasbourg, France; of alveolar repair in the human emphysematous lung. abrogate elastase induced emphysema in adult rats 5 Service de Biochimie A, Hoˆpital Methods: Fibroblasts were cultured from the lung of 10 and mice.67 Retinoic acid exerts its effects by Bichat, Assistance Publique- control subjects and eight patients with emphysema.
    [Show full text]
  • ADAMTS1, CRABP1, and NR3C1 Identified As
    Cellular Oncology 28 (2006) 259–272 259 IOS Press ADAMTS1, CRABP1,andNR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis Guro E. Lind a, Kristine Kleivi b,∗, Gunn I. Meling c, Manuel R. Teixeira d, Espen Thiis-Evensen e, Torleiv O. Rognum f and Ragnhild A. Lothe a,g,∗∗ a Department of Cancer Prevention, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway b Department of Genetics, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway c Surgical Department, Faculty Division Akershus University Hospital, University of Oslo, Oslo, Norway d Department of Genetics, Portuguese Oncology Institute, Porto, Portugal e Medical Department, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway f Institute of Forensic Medicine, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway g Department of Molecular Biosciences, University of Oslo, Oslo, Norway Abstract. Background: Gene silencing through CpG island hypermethylation is a major mechanism in cancer development. In the present study, we aimed to identify and validate novel target genes inactivated through promoter hypermethylation in colorectal tumor development. Methods: With the use of microarrays, the gene expression profiles of colon cancer cell lines before and after treatment with the demethylating agent 5-aza-2 -deoxycytidine were identified and compared. The expression of the responding genes was compared with microarray expression data of primary colorectal carcinomas. Four of these down- regulated genes were subjected to methylation-specific PCR, bisulphite sequencing, and quantitative gene expression analysis using tumors (n = 198), normal tissues (n = 44), and cell lines (n = 30). Results: Twenty-one genes with a CpG island in their promoter responded to treatment in cell lines, and were simultaneously down-regulated in primary colorectal carcinomas.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name cellular retinoic acid binding protein I Gene Symbol Crabp1 Organism Mouse Gene Summary Description Not Available Gene Aliases AI326249, Crabp-1, CrabpI, Rbp-5 RefSeq Accession No. NC_000075.6, NT_039474.8 UniGene ID Mm.34797 Ensembl Gene ID ENSMUSG00000032291 Entrez Gene ID 12903 Assay Information Unique Assay ID qMmuCID0018468 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000034830 Amplicon Context Sequence CTGTGCGCACCACGGAGATCAACTTCAAGGTCGGAGAGGGCTTCGAGGAGGAG ACAGTGGACGGACGCAAATGCAGGAGTTTACCCACGTGGGAGAATGAGAACAA GATTCACTGCACACAGACACTTCTTGAGGGGGATGGCCCTAAAA Amplicon Length (bp) 120 Chromosome Location 9:54765585-54768456 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 96 R2 0.999 cDNA Cq 19.04 cDNA Tm (Celsius) 84.5 gDNA Cq 43.1 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Crabp1, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • CRABP1 Protects the Heart from Isoproterenol-Induced Acute and Chronic Remodeling
    236 3 Journal of S W Park et al. CRABP1 protects the heart 236:3 151–165 Endocrinology RESEARCH CRABP1 protects the heart from isoproterenol-induced acute and chronic remodeling Sung Wook Park1, Shawna D Persaud1, Stanislas Ogokeh1, Tatyana A Meyers2, DeWayne Townsend2 and Li-Na Wei1 1Department of Pharmacology, University of Minnesota Medical School, Minneapolis, Minnesota, USA 2Department of Integrative Biology and Physiology, University of Minnesota Medical School, Minneapolis, Minnesota, USA Correspondence should be addressed to L-N Wei: [email protected] Abstract Excessive and/or persistent activation of calcium-calmodulin protein kinase II (CaMKII) is Key Words detrimental in acute and chronic cardiac injury. However, intrinsic regulators of CaMKII f CaMKII activity are poorly understood. We find that cellular retinoic acid-binding protein 1 f CRABP1 (CRABP1) directly interacts with CaMKII and uncover a functional role for CRABP1 in f heart failure regulating CaMKII activation. We generated Crabp1-null mice (CKO) in C57BL/6J background f cardiac remodeling for pathophysiological studies. CKO mice develop hypertrophy as adults, exhibiting significant left ventricular dilation with reduced ejection fraction at the baseline cardiac function. Interestingly, CKO mice have elevated basal CaMKII phosphorylation at T287, and phosphorylation on its substrate phospholamban (PLN) at T17. Acute isoproterenol (ISO) challenge (80 mg/kg two doses in 1 day) causes more severe apoptosis and necrosis in CKO hearts, and treatment with a CaMKII inhibitor KN-93 protects CKO mice from this injury. Chronic (30 mg/kg/day) ISO challenge also significantly increases hypertrophy and fibrosis in CKO mice as compared to WT. In wild-type mice, CRABP1 expression is increased in early stages of ISO challenge and eventually reduces to the basal level.
    [Show full text]
  • (DARPP-32) and Survival in Breast Cancer: a Retrospective Analysis of Protein and Mrna Expression Shreeya Kotecha1, Marie N
    www.nature.com/scientificreports OPEN Dopamine and cAMP-regulated phosphoprotein 32 kDa (DARPP-32) and survival in breast cancer: a retrospective analysis of protein and mRNA expression Shreeya Kotecha1, Marie N. Lebot1, Bhudsaban Sukkarn1, Graham Ball 2, Paul M. Moseley1, Stephen Y. Chan1, Andrew R. Green1, Emad Rakha1, Ian O. Ellis1, Stewart G. Martin1 & Sarah J. Storr 1* Dopamine and cAMP regulated phosphoprotein 32 kDa (DARPP-32) also known as phosphoprotein phosphatase-1 regulatory subunit 1B and encoded by the PPP1R1B gene is an inhibitor of protein phosphatase-1 and protein kinase A. DARPP-32 is expressed in a wide range of epithelial cells and some solid tumours; however, its role in breast cancer is only partially defned. DARPP-32 expression was determined using immunohistochemistry in two independent cohorts of early stage invasive breast cancer patients (discovery n = 1352; validation n = 1655), and 112 HER2 positive breast cancer patients treated with trastuzumab and adjuvant chemotherapy. PPP1R1B mRNA expression was assessed in the METABRIC cohort (n = 1980), using artifcial neural network analysis to identify associated genes. In the discovery cohort, low nuclear expression of DARPP-32 was signifcantly associated with shorter survival (P = 0.041), which was independent of other prognostic variables (P = 0.019). In the validation cohort, low cytoplasmic and nuclear expression was signifcantly associated with shorter survival (both P = 0.002), with cytoplasmic expression independent of other prognostic variables (P = 0.023). Stronger associations with survival in oestrogen receptor (ER) positive disease were observed. In patients treated with trastuzumab, low nuclear expression was signifcantly associated with adverse progression-free survival (P = 0.031).
    [Show full text]
  • V12a58-Dash Pgmkr
    Molecular Vision 2006; 12:499-505 <http://www.molvis.org/molvis/v12/a58/> ©2006 Molecular Vision Received 30 September 2005 | Accepted 26 April 2006 | Published 12 May 2006 Fine mapping of the keratoconus with cataract locus on chromosome 15q and candidate gene analysis Durga Prasad Dash,1 Giuliana Silvestri,2 Anne E. Hughes1 Departments of 1Medical Genetics and 2Ophthalmology, Queen’s University of Belfast, Belfast, United Kingdom Purpose: To report the fine mapping of the keratoconus with cataract locus on chromosome 15q and the mutational analysis of positional candidate genes. Methods: Genotyping of two novel microsatellite markers and a single nucleotide polymorphism (SNP) in the critical region of linkage for keratoconus with cataract on 15q was performed. Positional candidate genes (MORF4L1, KIAA1055, ETFA, AWP1, REC14, KIAA1199, RCN2, FA H , IDH3A, MTHFS, ADAMTS7, MAN2C1, PTPN9, KIAA1024, ARNT2, BCL2A1, ISL2, C15ORF22 (P24B), DNAJA4, FLJ14594, CIB2 (KIP2), C15ORF5, and PSMA4) prioritized on the basis of ocular expression and probable function were screened by PCR-based DNA sequencing methods. Results: We report the refinement of the linkage region for keratoconus with cataract to an interval of approximately 5.5 Mb flanked by the MAN2C1 gene and the D15S211 marker on chromosome 15q. Mutational analysis of positional candi- date genes detected many sequence variations and single nucleotide polymorphisms. None of the sequence variants were considered pathogenic as they were also found in unaffected family members and normal control DNA samples. Conclusions: Fine mapping of the keratoconus with cataract locus on 15q has reduced the linked region to 5.5 Mb, thereby excluding 28 candidate genes.
    [Show full text]
  • A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression
    Supplementary Materials A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression Table S1. Statistically significant DEGs (Adj. p-value < 0.01) derived from meta-analysis for samples irradiated with high doses of HZE particles, collected 6-24 h post-IR not common with any other meta- analysis group. This meta-analysis group consists of 3 DEG lists obtained from DGEA, using a total of 11 control and 11 irradiated samples [Data Series: E-MTAB-5761 and E-MTAB-5754]. Ensembl ID Gene Symbol Gene Description Up-Regulated Genes ↑ (2425) ENSG00000000938 FGR FGR proto-oncogene, Src family tyrosine kinase ENSG00000001036 FUCA2 alpha-L-fucosidase 2 ENSG00000001084 GCLC glutamate-cysteine ligase catalytic subunit ENSG00000001631 KRIT1 KRIT1 ankyrin repeat containing ENSG00000002079 MYH16 myosin heavy chain 16 pseudogene ENSG00000002587 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 ENSG00000003056 M6PR mannose-6-phosphate receptor, cation dependent ENSG00000004059 ARF5 ADP ribosylation factor 5 ENSG00000004777 ARHGAP33 Rho GTPase activating protein 33 ENSG00000004799 PDK4 pyruvate dehydrogenase kinase 4 ENSG00000004848 ARX aristaless related homeobox ENSG00000005022 SLC25A5 solute carrier family 25 member 5 ENSG00000005108 THSD7A thrombospondin type 1 domain containing 7A ENSG00000005194 CIAPIN1 cytokine induced apoptosis inhibitor 1 ENSG00000005381 MPO myeloperoxidase ENSG00000005486 RHBDD2 rhomboid domain containing 2 ENSG00000005884 ITGA3 integrin subunit alpha 3 ENSG00000006016 CRLF1 cytokine receptor like
    [Show full text]
  • Powerful Gene-Based Testing by Integrating Long-Range Chromatin Interactions and Knockoff Genotypes
    medRxiv preprint doi: https://doi.org/10.1101/2021.07.14.21260405; this version posted July 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . Powerful gene-based testing by integrating long-range chromatin interactions and knockoff genotypes Shiyang Ma1, James L. Dalgleish1, Justin Lee2, Chen Wang1, Linxi Liu3, Richard Gill4;5, Joseph D. Buxbaum6, Wendy Chung7, Hugues Aschard8, Edwin K. Silverman9, Michael H. Cho9, Zihuai He2;10, Iuliana Ionita-Laza1;# 1 Department of Biostatistics, Columbia University, New York, NY, 10032, USA 2 Quantitative Sciences Unit, Department of Medicine, Stanford University, Stanford, CA, 94305, USA 3 Department of Statistics, University of Pittsburgh, Pittsburgh, PA, 15260, USA 4 Department of Human Genetics, Genentech, South San Francisco, CA, 94080, USA 5 Department of Epidemiology, Columbia University, New York, NY, 10032, USA 6 Departments of Psychiatry, Neuroscience, and Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, NY, 10029, USA 7 Department of Pediatrics and Medicine, Herbert Irving Comprehensive Cancer Center, Columbia Uni- versity Irving Medical Center, New York, NY, 10032, USA 8 Department of Computational Biology, Institut Pasteur, Paris, France 9 Channing Division of Network Medicine and Division of Pulmonary and Critical Care Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115, USA 10 Department of Neurology and Neurological Sciences, Stanford University, Stanford, CA 94305, USA # e-mail: [email protected] Abstract Gene-based tests are valuable techniques for identifying genetic factors in complex traits.
    [Show full text]
  • Physiological and Pathological Implications of Retinoid Action in the Endometrium
    236 3 Journal of Y Jiang et al. Retinoids and endometrium 236:3 R169–R188 Endocrinology REVIEW Physiological and pathological implications of retinoid action in the endometrium Yanwen Jiang1, Lu Chen1, Robert N Taylor2, Chunjin Li1,* and Xu Zhou1,* 1College of Animal Sciences, Jilin University, Changchun, Jilin, China 2Departments of Obstetrics and Gynecology and Molecular Medicine and Translational Sciences, Wake Forest School of Medicine, Winston-Salem, North Carolina, USA Correspondence should be addressed to X Zhou or C Li: [email protected] or [email protected] *(C Li and X Zhou contributed equally to this work) Abstract Retinol (vitamin A) and its derivatives, collectively known as retinoids, are required for Key Words maintaining vision, immunity, barrier function, reproduction, embryogenesis and cell f retinoids proliferation and differentiation. Despite the fact that most events in the endometrium f endometrial stroma are predominantly regulated by steroid hormones (estrogens and progesterone), f implantation accumulating evidence shows that retinoid signaling is also involved in the development f endometriosis and maintenance of the endometrium, stromal decidualization and blastocyst implantation. Moreover, aberrant retinoid metabolism seems to be a critical factor in the development of endometriosis, a common gynecological disease, which affects up to 10% of reproductive age women and is characterized by the ectopic localization of endometrial-like tissue in the pelvic cavity. This review summarizes recent advances in research on the mechanisms and molecular actions of retinoids in normal endometrial development and physiological function. The potential roles of abnormal retinoid signaling in endometriosis are also discussed. The objectives are to identify limitations in current knowledge regarding the molecular actions of retinoids in endometrial biology and to stimulate new investigations toward the development potential therapeutics to Journal of Endocrinology ameliorate or prevent endometriosis symptoms.
    [Show full text]